RECOMBINANT MICROORGANISM, METHOD FOR CONSTRUCTING SAME AND USE THEREOF

20250101473 ยท 2025-03-27

    Inventors

    Cpc classification

    International classification

    Abstract

    The present invention relates to the technical field of microbial engineering. Specifically disclosed are a recombinant microorganism, a method for constructing same and use thereof. According to the present invention, by means of constructing a phosphate acetyltransferase-inactivated strain and applying the strain to the production of threonine, the threonine-producing ability of the strain is remarkably improved, and the strain has a remarkably increased production of threonine as compared to an unmodified strain. Combined with attenuated expression or inactivation of acetate kinase, HTH-type transcriptional regulator and the like, as well as improved activity of pyruvate carboxylase and enzymes involved in a threonine synthesis-related pathway, the production of threonine is further improved. The described modifications can be used in the fermentative production of threonine and have relatively good application value.

    Claims

    1. A modified microorganism from the genus Corynebacterium, wherein the modified microorganism has its phosphate acetyltransferase activity reduced or lost as compared to the unmodified microorganism, and has an improved threonine-producing ability as compared to the unmodified microorganism.

    2. The modified microorganism of claim 1, wherein the activity of phosphate acetyltransferase in the modified microorganism is reduced or lost by reducing the expression of a gene encoding phosphate acetyltransferase or by knocking out an endogenous gene encoding phosphate acetyltransferase.

    3. The modified microorganism of claim 2, wherein the reducing the expression of a gene encoding phosphate acetyltransferase or the knocking out an endogenous gene encoding phosphate acetyltransferase is performed by mutagenesis, site-directed mutation, or homologous recombination.

    4. The modified microorganism of claim 1, wherein the modified microorganism has improved pyruvate carboxylase activity and/or feedback-resistant pyruvate carboxylase as compared to the unmodified microorganism.

    5. The modified microorganism of claim 1, wherein the activity of either one or both of (1) acetate kinase and (2) HTH-type transcriptional regulator RamB in the modified microorganism is reduced or lost as compared to the unmodified microorganism.

    6. The modified microorganism of claim 1, wherein the modified microorganism has improved activity of an enzyme involved in the threonine synthesis pathway and/or deregulated enzyme involved in the threonine synthesis pathway as compared to the unmodified microorganism; wherein the enzyme involved in the threonine synthesis pathway is at least one selected from aspartate kinase, homoserine dehydrogenase, and threonine synthase.

    7. The modified microorganism of claim 6, which is any of the following (1) to (4): (1) a microorganism with reduced or lost activity of phosphate acetyltransferase; and improved activity and/or deregulated aspartate kinase, homoserine dehydrogenase, threonine synthase, and/or pyruvate carboxylase; (2) a microorganism with reduced or lost activity of phosphate acetyltransferase and/or acetate kinase; and improved activity and/or deregulated aspartate kinase, homoserine dehydrogenase, threonine synthase, and/or pyruvate carboxylase; (3) a microorganism with reduced or lost activity of phosphate acetyltransferase and/or HTH-type transcriptional regulator RamB; and improved activity and/or deregulated aspartate kinase, homoserine dehydrogenase, threonine synthase, and/or pyruvate carboxylase; (4) a microorganism with reduced or lost activity of at least one of phosphate acetyltransferase, acetate kinase, and HTH-type transcriptional regulator RamB; and improved activity and/or deregulated aspartate kinase, homoserine dehydrogenase, threonine synthase, and/or pyruvate carboxylase; optionally, the improved activity of the enzyme is achieved by any one of or any combination of the following 1) to 6): 1) introducing a plasmid carrying the gene encoding the enzyme; 2) increasing the copy number of the gene encoding the enzyme in the chromosome; 3) altering the promoter sequence of the gene encoding the enzyme in the chromosome; 4) operably linking a strong promoter to the gene encoding the enzyme; 5) altering the amino acid sequence of the enzyme; and 6) altering the nucleotide sequence encoding the enzyme.

    8. The modified microorganism of claim 1, which is Corynebacterium glutamicum.

    9. A method for constructing a threonine-producing strain, comprising: A) attenuating a gene encoding phosphate acetyltransferase in Corynebacterium species, which has an amino acid-producing ability, to obtain an attenuated strain, wherein the attenuating includes knocking out or reducing the expression of the gene encoding phosphate acetyltransferase; and/or B) enhancing the activity of pyruvate carboxylase and/or obtaining feedback-resistant pyruvate carboxylase; and/or C) reducing or losing the activity of either one or both of (1) acetate kinase and (2) HTH transcriptional regulator; and/or D) enhancing the activity of an enzyme involved in the threonine synthesis pathway and/or deregulating the enzyme involved in the threonine synthesis pathway, wherein the enzyme involved in the threonine synthesis pathway is at least one selected from aspartate kinase, homoserine dehydrogenase, and threonine synthase; wherein the activity of the enzyme is improved by any one of or any combination of the following 1) to 6): 1) introducing a plasmid carrying the gene encoding the enzyme; 2) increasing the copy number of the gene encoding the enzyme in the chromosome; 3) altering the promoter sequence of the gene encoding the enzyme in the chromosome; 4) operably linking a strong promoter to the gene encoding the enzyme; 5) altering the amino acid sequence of the enzyme; and 6) altering the nucleotide sequence encoding the enzyme; and/or, the reducing or losing the activity is achieved by reducing the expression of the gene encoding the (1) acetate kinase and/or (2) HTH transcriptional regulator or knocking out the gene encoding the (1) acetate kinase and/or (2) HTH transcriptional regulator.

    10. The method of claim 9, wherein the Corynebacterium species is Corynebacterium glutamicum.

    11. A method for producing threonine, comprising the following steps: a) culturing the engineered microorganism of claim 1, to obtain a culture of the modified microorganism or the threonine-producing strain; b) collecting threonine from the culture obtained in step a).

    Description

    DETAILED DESCRIPTION OF EMBODIMENTS

    [0064] The following examples are intended to illustrate the present invention but are not intended to limit the scope of the present invention.

    [0065] Information on a protein and a gene encoding the protein according to the following examples is as follows: [0066] phosphate acetyltransferase, coding gene pta, NCBI number: cg3048, Cg12753, NCg12657. [0067] aspartate kinase, coding gene lysC, NCBI number: cg0306, Cg10251, NCg10247. [0068] homoserine dehydrogenase, coding gene hom, NCBI number: cg1337, Cgl1183, NCgl1136. [0069] threonine synthase, coding gene thrC, NCBI number: cg2437, Cg12220, NCg12139. [0070] pyruvate carboxylase, coding gene pyc, NCBI number: cg0791, Cg10689, NCg10659. [0071] acetate kinase, coding gene ackA, NCBI number: cg3047, Cg12752, NCg12656. [0072] HTH-type transcriptional regulator RamB, coding gene ramB, NCBI number: cg0444, Cg10369, NCg10358.

    Example 1 Construction of Plasmids for Genome Modification of Strains

    1. Construction of the Plasmid pK18mobsacB-P.sub.sod-lysC.sup.gla-T311I for Enhancing Expression of Aspartate Kinase

    [0073] The upstream homologous arm up was obtained by PCR amplification with P21/P22 primer pair using ATCC13032 genome as template, the promoter fragment Psod was obtained by PCR amplification with P23/P24 primer pair, lysC.sup.gla-T311I was obtained by PCR amplification with P25/P26 primer pair, and the downstream homologous arm dn was obtained by PCR amplification with P27/P28 primer pair. The up-Psod fragment was obtained by fusion PCR with P21/P24 primer pair using up and Psod as templates. The full-length fragment up-Psod-lysC.sup.gla-T311I-dn was obtained by fusion PCR with P21/P28 primer pair using up-Psod, lysC.sup.gla-T311I and dn as templates. pK18mobsacB was digested with BamHI/HindIII. Enzyme-digested up-Psod-lysC.sup.gla-T311I-dn and pK18mobsacB were assembled using a seamless cloning kit and transformed into Trans1 T1 competent cells to obtain the recombinant plasmid pK18mobsacB-P.sub.sod-lysC.sup.gla-T311I.

    2. Construction of Plasmid pK18mobsacB-P.sub.cspB-Hom.sup.G378E for Improved Expression of Homoserine Dehydrogenase

    [0074] The plasmid construction method was referred to above 1, and the primers used were P29, P30, P31, P32, P33, P34, P35, and P36.

    3. Construction of the Plasmid pk18mobsacB-Psod-thrC.sup.gla for Enhancing Expression of Threonine Synthase

    [0075] The plasmid construction method was referred to above 1, and the primers used were P37, P38, P39, P40, P41, and P42.

    4. Construction of the Plasmid pK18mobsacB-Psod-Pyc.sup.P458S for Enhancing Expression of Pyruvate Carboxylase

    [0076] The plasmid construction method was referred to above 1, and the primers used were P13, P14, P15, P16, P17, P18, P19, and P20.

    5. Construction of Plasmid pK18mobsacB-Pta for Inactivating Phosphate Acetyltransferase

    [0077] The upstream homologous arm up was obtained by PCR amplification with P67/P68 primer pair using ATCC13032 genome as template; the downstream homologous arm dn was obtained by PCR amplification with P69/P70 primer pair; and the fragment up-dn was obtained by fusion PCR with P67/P70 primer pair using up and dn as templates. pK18mobsacB was digested with BamHI/HindIII. Enzyme-digested up-dn and pK18mobsacB were assembled using a seamless cloning kit and transformed into Trans1 T1 competent cells to obtain the recombinant plasmid pk18mobsacB-pta.

    6. Construction of Plasmid pk18mobsacB-ackA for Inactivating Acetate Kinase

    [0078] The plasmid construction method was referred to above 5, and the primers used were P165, P166, P167, and P168.

    7. Construction of Plasmid pk18mobsacB-Pta-ackA for Co-Inactivating Phosphate Acetyltransferase and Acetate Kinase

    [0079] The plasmid construction method was referred to above 5, and the primers used were pta-ackAup1, pta-ackAup2q, pta-ackAdn1q, and P168.

    8. Construction of Plasmid pk18mobsacB-ramB.sup.alg for Attenuating HTH-Type Transcriptional Regulator RamB

    [0080] The plasmid construction method was referred to above 5, and the primers used were P115, P116, P117, and P118.

    9. Construction of Plasmid pk18mobsacB-ramB for Inactivating HTH Transcriptional Regulator

    [0081] The plasmid construction method was referred to above 5, and the primers used were P119, P120, P121, and P122.

    [0082] The primers used in the above plasmid construction process are shown in Table 1.

    TABLE-US-00001 TABLE1 Primersequences Name Sequence P13 AATTCGAGCTCGGTACCCGGGGATCCTGACAGTTGCTGATCTGGCT P14 CCCGGAATAATTGGCAGCTATAGAGTAATTATTCCTTTCA P15 TGAAAGGAATAATTACTCTATAGCTGCCAATTATTCCGGG P16 GAAGATGTGTGAGTCGACACGGGTAAAAAATCCTTTCGTA P17 TACGAAAGGATTTTTTACCCGTGTCGACTCACACATCTTC P18 GGTGGAGCCTGAAGGAGGTGCGAGTGATCGGCAATGAATCCGG P19 CCGGATTCATTGCCGATCACTCGCACCTCCTTCAGGCTCCACC P20 GTAAAACGACGGCCAGTGCCAAGCTTCGCGGCAGACGGAGTCTGGG P21 AATTCGAGCTCGGTACCCGGGGATCCAGCGACAGGACAAGCACTGG P22 CCCGGAATAATTGGCAGCTATGTGCACCTTTCGATCTACG P23 CGTAGATCGAAAGGTGCACATAGCTGCCAATTATTCCGGG P24 TTTCTGTACGACCAGGGCCATGGGTAAAAAATCCTTTCGTA P25 TACGAAAGGATTTTTTACCCATGGCCCTGGTCGTACAGAAA P26 TCGGAACGAGGGCAGGTGAAGGTGATGTCGGTGGTGCCGTCT P27 AGACGGCACCACCGACATCACCTTCACCTGCCCTCGTTCCGA P28 GTAAAACGACGGCCAGTGCCAAGCTTAGCCTGGTAAGAGGAAACGT P29 AATTCGAGCTCGGTACCCGGGGATCCCTGCGGGCAGATCCTTTTGA P30 ATTTCTTTATAAACGCAGGTCATATCTACCAAAACTACGC P31 GCGTAGTTTTGGTAGATATGACCTGCGTTTATAAAGAAAT P32 GTATATCTCCTTCTGCAGGAATAGGTATCGAAAGACGAAA P33 TTTCGTCTTTCGATACCTATTCCTGCAGAAGGAGATATAC P34 TAGCCAATTCAGCCAAAACCCCCACGCGATCTTCCACATCC P35 GGATGTGGAAGATCGCGTGGGGGTTTTGGCTGAATTGGCTA P36 GTAAAACGACGGCCAGTGCCAAGCTTGCTGGCTCTTGCCGTCGATA P37 ATTCGAGCTCGGTACCCGGGGATCCGCCGTTGATCATTGTTCTTCA P38 CCCGGAATAATTGGCAGCTAGGATATAACCCTATCCCAAG P39 CTTGGGATAGGGTTATATCCTAGCTGCCAATTATTCCGGG P40 ACGCGTCGAAATGTAGTCCATGGGTAAAAAATCCTTTCGTA P41 TACGAAAGGATTTTTTACCCATGGACTACATTTCGACGCGT P42 GTAAAACGACGGCCAGTGCCAAGCTTGAATACGCGGATTCCCTCGC P67 AGCTCGGTACCCGGGGATCCTGTCCAACTGCGGTGATT P68 GGTAGACAAGCAAGGCAACAGGCAAATGTGTTTATCTTCC P69 GGAAGATAAACACATTTGCCTGTTGCCTTGCTTGTCTACC P70 CAATACGGAGCGGTTACAAAGCTTGGCACTGGCCGTCG P115 CATGATTACGAATTCGAGCTCGGTACCCGGGGATCCCGTGCGTGGATTGTCAG CA P116 GATCACGCTATAGTTGCGCCGTGGGAAAGACATATGTGGG P117 CCCACATATGTCTTTCCCACGGCGCAACTATAGCGTGATC P118 TCACGACGTTGTAAAACGACGGCCAGTGCCAAGCTTCACGGTCGGGATTTCTA ACAG P119 CATGATTACGAATTCGAGCTCGGTACCCGGGGATCCAGTAGACACCTCGAACG CTAC P120 GATCACGCTATAGTTGCGCCGAAAAGGAGCTTGCTTTACGAC P121 GTCGTAAAGCAAGCTCCTTTTCGGCGCAACTATAGCGTGATC P122 TCACGACGTTGTAAAACGACGGCCAGTGCCAAGCTTCACGGTCGGGATTTCTA ACAG P165 CGAGCTCGGTACCCGGGGATCCACCCGGGTGTGGCGCGCAAGAAGATGCCAG P166 TAAATGTTGTACGCGGACCAGAACAAGATTCCGCCGTGGACCACGC P167 GGCGGAATCTTGTTCTGGTCCGCGTACAACATTTACATACACC P168 GTAAAACGACGGCCAGTGCCAAGCTTAGCAAGGTGTTAGAGCAAATTTTCG pta- GAATTCGAGCTCGGTACCCGGGGATCCAACTTGTAACCGCTCCGTAT ackAup1 pta- GGTGTATGTAAATGTTGTACGCGGACCAGTGCTTGCCTTGCTTGTCTA ackAup2q pta- TAGACAAGCAAGGCAAGCACTGGTCCGCGTACAACATTTACATACACC ackAdn1q

    Example 2 Construction of a Genome-Modified Strain

    1. Construction of a Strain with Improved Expression of Aspartate Kinase

    [0083] ATCC13032 competent cells were prepared according to the classic method of Corynebacterium glutamicum (C. glutamicum Handbook, Chapter 23). The competent cells were transformed with the recombinant plasmid pK18mobsacB-P.sub.sod-lysC.sup.gla-T311I by electroporation, and transformants were screened on a selection medium containing 15 mg/L kanamycin, and the gene of interest was inserted into the chromosome due to homology. The screened transformants were cultured overnight in a normal liquid brain-heart infusion medium at 30 C. under shaken at 220 rpm on a rotary shaker. During this culture process, the transformants underwent a second recombination, removing the vector sequence from the genome through gene exchange. The culture was diluted in a serial gradient (10.sup.2 to 10.sup.4), and the dilutions were spread on a normal solid brain-heart infusion medium containing 10% sucrose and subjected to static culture at 33 C. for 48 h. Strains grown on sucrose medium did not carry the inserted vector sequences in their genome. The sequence of interest was amplified by PCR and analyzed by nucleotide sequencing, and the obtained mutant strain of interest was named SMCT121. Compared to ATCC13032 strain, in this strain, the start codon of lysC gene was mutated from GTG to ATG, threonine encoded at amino acid position 311 was mutated to isoleucine, and the promoter of lysC gene was replaced with Psod promoter.

    2. Construction of a Strain with Improved Expression of Homoserine Dehydrogenase

    [0084] The strain construction method was referred to the above 1. SMCT121 is used as the original strain, and the plasmid pK18mobsacB-P.sub.cspB-hom.sup.G378E was introduced into the strain to perform modification for enhancing the expression of homoserine dehydrogenase. The obtained modified strain was named SMCT122. Compared to the original strain SMCT121, the hom gene of this strain was mutated, resulting in the G378E mutation in its encoded protein, and the promoter of the hom gene was replaced with PcspB promoter.

    3. Construction of a Strain with Threonine Synthase Overexpression

    [0085] The strain construction method was referred to the above 1. SMCT122 is used as the original strain, and the plasmid pk18mobsacB-Psod-thrC.sup.gla was introduced into the strain to perform modification for enhancing the expression of threonine synthase. The obtained modified strain was named SMCT123. Compared to the original strain SMCT122, the start codon of the thrC gene of the strain was mutated from GTG to ATG, and the promoter of the thrC gene was replaced with Psod promoter.

    4. Construction of a Strain with Improved Expression of Pyruvate Carboxylase

    [0086] The strain construction method was referred to the above 1. SMCT123 is used as the original strain, and the plasmid pK18mobsacB-Psod-pyc.sup.P458S was introduced into the strain to perform modification for enhancing the expression of pyruvate carboxylase. The obtained modified strain was named SMCT124. Compared to the original strain SMCT123, the pyc gene of this strain was mutated, resulting in the P458S mutation in its encoded protein, and the promoter of the pyc gene was replaced with Psod promoter.

    5. Construction of a Strain with Inactivated Acetate Kinase

    [0087] The strain construction method was referred to the above 1. SMCT124 is used as the original strain, and the plasmid pk18mobsacB-ackA was introduced into the strain to perform modification for inactivating acetate kinase. The obtained modified strain was named SMCT125. Compared to the original strain SMCT124, the ackA of this strain was knocked out.

    6. Construction of a Strain with Attenuated HTH-Type Transcriptional Regulator

    [0088] The strain construction method was referred to the above 1. SMCT124 is used as the original strain, and the plasmid pk18mobsacB-ramB.sup.alg was introduced into the strain to perform modification for attenuating ramB. The obtained modified strain was named SMCT126. Compared to the original strain SMCT124, the start codon of the ramB gene of this strain was mutated to GTG.

    7. Construction of a Strain with Inactivated HTH-Type Transcriptional Regulator

    [0089] The strain construction method was referred to the above 1. SMCT124 and SMCT125 were used as original strains, and pk18mobsacB-ramB was introduced into the above original strains to perform modification for inactivating ramB, respectively. The obtained modified strains were named SMCT127 and SMCT128. Compared to their corresponding original strains, ramB was knocked out in these two strains.

    8. Construction of a Strain with Inactivated Phosphate Acetyltransferase

    [0090] The strain construction method was referred to the above 1. SMCT124, SMCT125, SMCT126, SMCT127 and SMCT128 were used as original strains, and the pk18mobsacB-pta or pk18mobsacB-pta-ackA plasmid was used to perform modification for inactivating phosphate acetyltransferase. The obtained modified strains were named SMCT129, SMCT130, SMCT131, SMCT132 and SMCT133. Compared to their corresponding original strains, the pta gene of these strains was knocked out.

    [0091] The genotype information of the strains obtained above is shown in Table 2.

    TABLE-US-00002 TABLE 2 Genotype information of strains Strain Name Genotype SMCT121 ATCC13032, P.sub.sod-lysC.sup.g1a-T311I SMCT122 ATCC13032, P.sub.sod-lysC.sup.g1a-T311I, P.sub.cspB-hom.sup.G378E SMCT123 ATCC13032, P.sub.sod-lysC.sup.g1a-T311I, P.sub.cspB-hom.sup.G378E, P.sub.sod-thrC.sup.g1a SMCT124 ATCC13032, P.sub.sod-lysC.sup.g1a-T311I, P.sub.cspB-hom.sup.G378E, P.sub.sod-thrC.sup.g1a, P.sub.sod-pyc.sup.P458S SMCT125 ATCC13032, P.sub.sod-lysC.sup.g1a-T311I, P.sub.cspB-hom.sup.G378E, P.sub.sod-thrC.sup.g1a, P.sub.sod-pyc.sup.P458S, ackA SMCT126 ATCC13032, P.sub.sod-lysC.sup.g1a-T311I, P.sub.cspB-hom.sup.G378E, P.sub.sod-thrC.sup.g1a, P.sub.sod-pyc.sup.P458S, ramB.sup.a1g SMCT127 ATCC13032, P.sub.sod-lysC.sup.g1a-T311I, P.sub.cspB-hom.sup.G378E, P.sub.sod-thrC.sup.g1a, P.sub.sod-pyc.sup.P458S, ramB SMCT128 ATCC13032, P.sub.sod-lysC.sup.g1a-T311I, P.sub.cspB-hom.sup.G378E, P.sub.sod-thrC.sup.g1a, P.sub.sod-pyc.sup.P458S, ackA, ramB SMCT129 ATCC13032, P.sub.sod-lysC.sup.g1a-T311I, P.sub.cspB-hom.sup.G378E, P.sub.sod-thrC.sup.g1a, P.sub.sod-pyc.sup.P458S, pta SMCT130 ATCC13032, P.sub.sod-lysC.sup.g1a-T311I, P.sub.cspB-hom.sup.G378E, P.sub.sod-thrC.sup.g1a, P.sub.sod-pyc.sup.P458S, ackA, pta SMCT131 ATCC13032, P.sub.sod-lysC.sup.g1a-T311I, P.sub.cspB-hom.sup.G378E, P.sub.sod-thrC.sup.g1a, P.sub.sod-pyc.sup.P458S, ramB.sup.a1g, pta SMCT132 ATCC13032, P.sub.sod-lysC.sup.g1a-T311I, P.sub.cspB-hom.sup.G378E, P.sub.sod-thrC.sup.g1a, P.sub.sod-pyc.sup.P458S, ramB, pta SMCT133 ATCC13032, P.sub.sod-lysC.sup.g1a-T311I, P.sub.cspB-hom.sup.G378E, P.sub.sod-thrC.sup.g1a, P.sub.sod-pyc.sup.P458S, ackA, ramB, pta

    Example 3 Shake Flask Fermentation Verification of Strains

    [0092] Each strain constructed in Example 2 was validated by shake flask fermentation as follows:

    1. Medium

    [0093] Seed activation medium: BHI 3.7%, agar 2%, pH 7.

    [0094] Seed medium: Peptone 5/L, yeast extract 5 g/L, sodium chloride 10 g/L, ammonium sulfate 16 g/L, urea 8 g/L, potassium dihydrogen phosphate 10.4 g/L, dipotassium hydrogen phosphate 21.4 g/L, biotin 5 mg/L, magnesium sulfate 3 g/L. Glucose 50 g/L, pH 7.2.

    [0095] Fermentation medium: corn steep liquor 50 mL/L, glucose 30 g/L, ammonium sulfate 4 g/L, MOPS 30 g/L, potassium dihydrogen phosphate 10 g/L, urea 20 g/L, biotin 10 mg/L, magnesium sulfate 6 g/L, ferrous sulfate 1 g/L, VB1.Math.HCl 40 mg/L, calcium pantothenate 50 mg/L, nicotinamide 40 mg/L, manganese sulfate 1 g/L, zinc sulfate 20 mg/L, copper sulfate 20 mg/L, pH 7.2.

    2. Production of L-Threonine by Shake Flask Fermentation with Engineered Strain

    [0096] (1) Seed culture: 1 loop of seed of strains SMCT121, SMCT122, SMCT123, SMCT124, SMCT125, SMCT126, SMCT127, SMCT128, SMCT129, SMCT130, SMCT131, SMCT132 and SMCT133 on the slant culture medium was picked and inoculated into a 500 mL Erlenmeyer flask containing 20 mL of seed culture medium, and cultured at 30 C. and 220 r/min for 16 h to obtain a seed broth.

    [0097] (2) Fermentation culture: 2 mL of seed liquid was inoculated into a 500 mL Erlenmeyer flask containing 20 mL of fermentation medium and cultured at 33 C. and 220 r/min under shaking for 24 h to obtain a fermentation broth.

    [0098] (3) 1 mL of fermentation broth was taken and centrifuged (12000 rpm, 2 min), and the supernatant was collected. L-threonine in the fermentation broth of modified strain and control strain were detected by HPLC.

    [0099] The fermentation results of the strains with preliminary threonine synthesis ability are shown in Table 3.

    TABLE-US-00003 TABLE 3 Fermentation test results (1) Strain number OD.sub.562 L-threonine (g/L) SMCT121 23 1.2 SMCT122 23 2.4 SMCT123 23 3.0

    [0100] As can be seen from Table 3, after the aspartate kinase was modified in the wild strain ATCC13032, the threonine of the engineered strain was initially accumulated. With the improved expression of enzymes (homoserine dehydrogenase and threonine synthase) in the threonine synthesis pathway, the threonine production was further improved, and 3.0 g/L of threonine could be accumulated.

    [0101] The threonine accumulation in the further engineered strains including modified phosphate acetyltransferase coding gene is shown in Table 4.

    TABLE-US-00004 TABLE 4 Fermentation results (2) Strain L-threonine number OD.sub.562 (g/L) SMCT124 23 3.6 SMCT125 23 4.2 SMCT126 23 4.0 SMCT127 23 4.2 SMCT128 23 5.0 SMCT129 23 4.3 SMCT130 23 5.3 SMCT131 23 5.0 SMCT132 23 5.3 SMCT133 23 6.5

    [0102] As can be seen from Table 4, the threonine production of the strains after inactivating the pta gene to optimize the carbon metabolic flow and reduce carbon loss is improved to varying degrees, among which the threonine production of SMCT133 is increased by 30% compared to the control strain SMCT128, indicating that more carbon flow to threonine synthesis after the overflow metabolic flux is reduced in the terminal pathway of the engineered strain with improved threonine synthesis pathway Moreover, different combinations of inactivation of the pta and modifications of the pyc (encoding pyruvate carboxylase), ackA (encoding acetate kinase), ramB (encoding HTH transcriptional regulator), lysC (encoding aspartate kinase), hom (encoding homoserine dehydrogenase), thrC (encoding threonine synthase) and the like can all further improve the threonine yield.

    [0103] Although the present invention has been described in detail above with general descriptions and specific embodiments, it is obvious to those skilled in the art that some modifications or improvements may be made based on the present invention. Therefore, these modifications or improvements made without departing from the spirit of the present invention belong to the scope of protection claimed by the present invention.