METHODS OF GENERATING A SYNTHETIC EMBRYO
20250101375 ยท 2025-03-27
Assignee
Inventors
- Yaqub HANNA (Tel Aviv-Yafo, IL)
- Sergey VIUKOV (Rehovot, IL)
- Emilie WILDSCHUTZ (Rehovot, IL)
- Noa Novershtern (Rehovot, IL)
- Carine JOUBRAN (Rehovot, IL)
- Segev NAVEH TASSA (Rehovot, IL)
- Alejandro CASTREJON AGUILERA (Rehovot, IL)
- Bernardo OLDAK (Rehovot, IL)
- Shadi TARAZI (Rehovot, IL)
- Francesco RONCATO (Rehovot, IL)
Cpc classification
C12N5/0606
CHEMISTRY; METALLURGY
C12N2501/119
CHEMISTRY; METALLURGY
C12N2506/45
CHEMISTRY; METALLURGY
C12N2501/999
CHEMISTRY; METALLURGY
C12N2501/16
CHEMISTRY; METALLURGY
C12N5/0696
CHEMISTRY; METALLURGY
C12N2501/115
CHEMISTRY; METALLURGY
C12N2501/155
CHEMISTRY; METALLURGY
International classification
Abstract
Methods of generating a synthetic embryo are provided. Accordingly, there is provided a method of generating a synthetic embryo comprising inducing expression of a factor that induces differentiation to trophectoderm cells in a subpopulation of nave pluripotent stem cells (PSCs) to obtain a trophectoderm primed cells; inducing expression of a factor that induces differentiation to extra embryonic primitive endodermal cells in a second subpopulation of nave PSCs to obtain extra embryonic primitive endodermal primed cells; and mixing said trophectoderm primed cells and said extra embryonic primitive endodermal primed cells with nave PSCs under conditions that allow formation of aggregated cells. Also provided are articles of manufactures, mixtures and aggregates of cells and methods of using same.
Claims
1. A method of generating a synthetic embryo, the method comprising: (a) inducing expression of a factor that induces differentiation to trophectoderm cells in a subpopulation of nave pluripotent stem cells (PSCs) to obtain trophectoderm primed cells; and (b) mixing said trophectoderm primed cells with nave PSCs under conditions that allow formation of aggregated cells, wherein when said factor that induces differentiation to trophectoderm cells is an exogenous factor said inducing said expression comprises inducing transient expression starting within 14 days-0 hours prior to said mixing and ending no later than 120 hours following said mixing; and wherein said factor that induces differentiation to trophectoderm cells is an endogenous factor said inducing said expression comprises culturing said subpopulation of nave PSCs under conditions enabling expression of said factor starting within 14 days-6 hours prior to said mixing, thereby generating the synthetic embryo.
2. The method of claim 1, further comprising inducing expression of a factor that induces differentiation to extra embryonic primitive endodermal cells in a second subpopulation of nave PSCs to obtain extra embryonic primitive endodermal primed cells in said (a); and mixing said extra embryonic primitive endodermal primed cells with said cells in said (b).
3. The method of claim 2, wherein when said factor that induces differentiation to extra embryonic primitive endodermal cells is an exogenous factor said inducing said expression comprises inducing transient expression starting within 14 days-0 hours prior to said mixing and ending no later than 120 hours following said mixing; and wherein said factor that induces differentiation to extra embryonic primitive endodermal cells is an endogenous factor said inducing said expression comprises culturing said subpopulation of nave PSCs under conditions enabling expression of said factor starting within 14 days-6 hours prior to said mixing.
4. The method of claim 2, wherein said mixing said nave PSCs, said trophectoderm primed cells and said extra embryonic primitive endodermal primed cells is effected concomitantly.
5. The method of claim 2, wherein said mixing said nave PSCs and said extra embryonic primitive endodermal primed cells is effected prior to said mixing with said trophectoderm primed cells.
6. The method of claim 1, wherein said trophectoderm cells express a pluripotency marker and a trophectoderm marker at said mixing.
7. The method of claim 2, wherein said extra embryonic endodermal primed cells express a pluripotency marker and an extra embryonic primitive endoderm marker at said mixing.
8. A mixture or aggregate, obtainable by the method of claim 1.
9. A mixture or aggregate comprising: (i) nave pluripotent stem cell (PSCs); (ii) trophectoderm primed cells, wherein said trophectoderm primed cells comprise stem cells expressing an endogenous trophectoderm marker and an endogenous pluripotent marker; and (iii) extra embryonic primitive endodermal primed cells, wherein said extra embryonic primitive endodermal primed cells comprise stem cells expressing an endogenous extra embryonic primitive endoderm marker and an endogenous pluripotency marker, wherein said mixture or aggregate is not structurally organized as a native embryo at any developmental stage; and wherein said mixture or aggregate is capable of forming a synthetic embryo structurally organized as a native embryo of at least a post-implantation egg cylinder or a bilaminar disc developmental stage.
10. A mixture or aggregate, comprising: (i) trophectoderm primed cells, wherein said trophectoderm primed cells comprise stem cells expressing an exogenous factor that induces differentiation to trophectoderm cells, an endogenous trophectoderm marker and an endogenous pluripotent marker; and (ii) nave pluripotent stem cell (PSCs).
11. The mixture or aggregate of claim 10, further comprising: (iii) extra embryonic primitive endodermal primed cells, wherein said extra embryonic primitive endodermal primed cells comprise stem cells expressing an exogenous factor that induces differentiation to extra embryonic primitive endodermal cells, an endogenous extra embryonic primitive endoderm marker and an endogenous pluripotency marker.
12. The method of claim 2, wherein said factor that induces differentiation to extra embryonic primitive endodermal cells comprises Gata4, Gata6 and/or SOX17.
13. The method of claim 3, wherein said inducing expression of a factor that induces differentiation to extra embryonic primitive endodermal cells comprises culturing said second subpopulation of nave PSCs with a factor that induces differentiation to extra embryonic primitive endodermal cells starting within 14 days-6 hours prior to said mixing, wherein said factor that induces differentiation to extra embryonic primitive endodermal cells is selected from the group consisting of a GSK-3 inhibitor, WNT ligand, heparin, FGF2, FGF4, PDGF, leukemia inhibitory factor (LIF) and insulin.
14. The method of claim 1, wherein said factor that induces differentiation to trophectoderm cells is selected from the group consisting of Cdx2, Gata3 and Gata2.
15. The method of claim 1, wherein said inducing expression of a factor that induces differentiation to trophectoderm cells comprises culturing said subpopulation of nave PSCs with a factor that induces differentiation to trophectoderm cells starting within 14 days-6 hours prior to said mixing, wherein said factor that induces differentiation to trophectoderm cells is selected from the group consisting of TGFR inhibitor, FGFR inhibitor, MEK/ERK inhibitor, BMP4, JAK inhibitor, a ROCK pathway inhibitor, FGF4, FGF2, heparin, a SUMOylation inhibitor, a Histone Deacetylase inhibitor, a HIPPO signaling pathway inhibitor and a factor that induces YAP nuclear translocation.
16. The method of claim 1, wherein said inducing said transient expression starts within 120-0 hours prior to said mixing, and/or wherein said inducing said expression of said endogenous factor starts within 10-1 days prior to said mixing.
17. The method of claim 1, wherein a ratio between said nave PSCs and said trophectoderm primed cells is between 1:1 and 1:5.
18. The method of claim 1, further comprising ex-utero culturing said aggregated cells following said (b).
19. The method of claim 18, wherein said culturing is effected in a static culture followed by a dynamic culture.
20. The method of claim 1, wherein said cells are mammalian cells.
Description
BRIEF DESCRIPTION OF THE SEVERAL VIEWS OF THE DRAWINGS
[0110] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.
[0111] Some embodiments of the invention are herein described, by way of example only, with reference to the accompanying drawings. With specific reference now to the drawings in detail, it is stressed that the particulars shown are by way of example and for purposes of illustrative discussion of embodiments of the invention. In this regard, the description taken with the drawings makes apparent to those skilled in the art how embodiments of the invention may be practiced.
[0112] In the drawings:
[0113]
[0114]
[0115]
[0116]
[0117]
[0118]
[0119]
[0120]
[0121]
[0122]
[0123]
[0124]
[0125]
[0126]
[0127]
[0128]
[0129]
[0130]
[0131]
[0132]
[0133]
[0134]
[0135]
[0136]
[0137]
[0138]
[0139]
[0140]
[0141]
[0142]
[0143]
[0144]
[0145]
[0146]
[0147]
[0148]
[0149]
[0150]
[0151]
[0152]
[0153]
[0154]
[0155]
[0156]
[0157]
[0158]
[0159]
[0160]
[0161]
[0162]
[0163]
[0164]
[0165]
[0166]
[0167]
[0168]
[0169]
[0170]
[0171]
[0172]
[0173]
[0174]
[0175]
DESCRIPTION OF SPECIFIC EMBODIMENTS OF THE INVENTION
[0176] The present invention, in some embodiments thereof, relates to methods of generating a synthetic embryo.
[0177] Before explaining at least one embodiment of the invention in detail, it is to be understood that the invention is not necessarily limited in its application to the details set forth in the following description or exemplified by the Examples. The invention is capable of other embodiments or of being practiced or carried out in various ways.
[0178] Advanced artificial embryogenesis utilizing in vitro established embryonic stem cell lines (ESCs) and induced pluripotent stem cell lines (iPSCs) while bypassing the use of oocytes and zygotes or blastocysts has been a desired goal in the fields of developmental biology and reproductive medicine. While different pluripotent states of stem cells can be expanded in vitro and can contribute to embryonic and/or extraembryonic tissues when injected into host embryos, obtaining advanced gastrulating whole embryo-like structures with both embryonic and extra-embryonic compartments without relying on a micro-injected host embryo, has failed to date (see e.g., Zhang et al. (2020) Front. Bioeng. Biotechnol. 8:781; Harrison et al. Science (2017) DOI:10.1126/science.aa1810; Amadei et al. Developmental Cell (2021) 56, 366-382; as also exemplified by Example 1 of the Examples section which follows).
[0179] Whilst reducing specific embodiments of the present invention to practice, the present inventors have now developed a method for generation of synthetic embryos, with both embryonic and extra-embryonic compartments, by starting solely from nave ESCs followed by culturing under a controlled ex-utero embryo culture platform.
[0180] As is illustrated hereinunder and in the examples section, which follows, the present inventors show that co-aggregating three populations of mouse stem cells, namely non-transduced nave PSCs, nave PSCs that transiently overexpress a master regulatory transcription factor for trophectoderm cells (Cdx2) and nave ESCs that transiently overexpress a master regulatory transcription factor for an extra embryonic primitive endodermal cells (Gata4) followed by ex-utero culturing the aggregate in a recently described controlled platform and growth conditions (Aguilera-Castrejon et al., 2021a), resulted in assembly into complete synthetic mouse embryos that accomplish gastrulation, develop brain, neural folds, neural tube, beating heart, somites, and progenitors of other organs (Examples 2-3 and 7-8 of the Examples section which follows). The synthetic embryos developed within extraembryonic membranes as natural embryos. Further, thorough analysis of both embryonic and extra embryonic compartments showed that these synthetic embryos achieved equivalent level of lineage complexity seen in natural in-utero embryos, where all annotated cell types were represented in synthetic embryos at E8.5 equivalent developmental stage. Furthermore, for each tissue a very high level of correlation in gene expression was seen between natural in-utero embryos and the synthetic mouse embryos. In a similar manner, the present inventors show that co-aggregating the same three populations of stem cells but of human origin, followed by ex-utero culturing the aggregate, resulted in assembly into complete synthetic human embryos with both embryonic and extra embryonic compartments (Examples 4-6 of the Examples section which follows). Following, the present inventors show that various culturing conditions can also support differentiation of nave PSCs (of mouse, human or Rhesus Macaque origin) into trophectoderm (TE)-primed or extra embryonic primitive endodermal (PRE)-primed cells; and the co-aggregation of these stem cell populations followed by ex-utero culturing the aggregate resulted in assembly into complete synthetic embryos (Examples 9-12 and 14-16 of the Examples section which follows).
[0181] The establishment of methods and systems for producing such synthetic embryos ex utero may constitute a powerful tool in basic research e.g. as a framework to investigate the emergence of cellular diversity, cell fate decisions and how tissues and organs emerge from a single pluripotent cell; as well as a source of cells, tissues, embryos and organs for transplantation, testing the effect of drugs on embryonic development and possibly the bioengineering of embryos etc.
[0182] Thus, according to an aspect of the present invention, there is provided a method of generating a synthetic embryo, the method comprising: [0183] (a) inducing expression of a factor that induces differentiation to trophectoderm cells in a subpopulation of nave pluripotent stem cells (PSCs) to obtain trophectoderm primed cells; and [0184] (b) mixing said trophectoderm primed cells with nave PSCs under conditions that allow formation of aggregated cells, [0185] wherein when said factor that induces differentiation to trophectoderm cells is an exogenous factor said inducing said expression comprises inducing transient expression starting within 14 days0 hours prior to said mixing and ending no later than 120 hours following said mixing; and [0186] wherein said factor that induces differentiation to trophectoderm cells is an endogenous factor said inducing said expression comprises culturing said subpopulation of nave PSCs under conditions enabling expression of said factor starting within 14 days-6 hours prior to said mixing, [0187] thereby generating the synthetic embryo.
[0188] According to an additional or an alternative aspect of the present invention, there is provided a method of generating a synthetic embryo, the method comprising: [0189] (a) inducing transient expression of an exogenous factor that induces differentiation to trophectoderm cells in a subpopulation of nave pluripotent stem cells (PSCs) to obtain a trophectoderm primed cells; and [0190] (b) mixing said trophectoderm primed cells with nave PSCs under conditions that allow formation of aggregated cells, [0191] wherein said inducing said transient expression starts within 14 days-0 hours prior to said mixing and ends no later than 120 hours following said mixing, thereby generating the synthetic embryo.
[0192] According to specific embodiments, the method further comprising inducing expression of a factor that induces differentiation to extra embryonic primitive endodermal cells in a second subpopulation of nave PSCs to obtain extra embryonic primitive endodermal primed cells in said (a); and mixing said extra embryonic primitive endodermal primed cells with said cells in said (b).
[0193] According to specific embodiments, the method further comprising inducing transient expression of an exogenous factor that induces differentiation to extra embryonic primitive endodermal cells in a second subpopulation of nave PSCs to obtain an extra embryonic primitive endodermal primed cells in said (a); and mixing said extra embryonic primitive endodermal primed cells with said cells in said (b).
[0194] According to an additional or an alternative aspect of the present invention there is provided a mixture or aggregate of cells obtainable by the methods disclosed herein, as further described infra.
[0195] According to an additional or an alternative aspect of the present invention there is provided a synthetic embryo obtainable by the methods disclosed herein.
[0196] As used herein, the term synthetic embryo refers to at least a collection of distinct cells generated ex-vivo using pluripotent stem cells without any donated germ cells, zygotes or blastocysts. When cultured, the synthetic embryo undergoes self-organization and differentiation that give rise to multiple tissue types which are organized as a native embryo or exhibit embryonic-like properties.
[0197] According to specific embodiments, the synthetic embryo structure mimics the developmental stages of a native or naturally occurring embryo, at least in the early stages of embryonic development post the blastocyst developmental stage.
[0198] According to specific embodiments, the synthetic embryo is not a blastocyst (e.g. a structure having characteristic of E3.5/4-5 of an in-utero natural mouse embryo or PFD6/PFD7 of an in-utero natural human embryo).
[0199] According to specific embodiments, the synthetic embryo mimics at least the Carnegie 5, Carnegie 6, Carnegie 8 or later developmental stages (relates to humans), embryo with primary and secondary yolk sac, bilaminar disc stage surrounded by trophoblast surround and formation of amnion, yolk and chorionic cavity including the formation of extra-embryonic mesoderm cells.
[0200] According to specific embodiments, the mouse synthetic embryo mimics at least the formation of egg-cylinder stage, completion of gastrulation (E7.5) and beginning of organogenesis (E8.0 in mouse embryos or later).
[0201] According to specific embodiments, the synthetic embryo is generated solely ex-utero.
[0202] As used herein the phrase pluripotent stem cell (PSC) refers to an undifferentiated cell (e.g., a mammalian cell, a primate cell) capable of differentiating into all three embryonic germ cell layers, i.e., to the mesoderm, ectoderm and endoderm embryonic germ layers; or remaining in an undifferentiated state.
[0203] Methods of determining ability of stem cells to differentiate into the endodermal, mesodermal and ectodermal embryonic germ layers are known in the art and disclosed e.g. in International Patent Application Publication No. WO2014/174470, the contents of which is fully incorporated herein by reference in its entirety, and include for example generation of embryoid bodies (in vitro) or teratomas (in vivo).
[0204] According to some embodiments of the invention, the pluripotent stem cell is selected from the group consisting of embryonic stem cell (ESC), induced pluripotent stem cells (iPSCs), and embryonic germ cell (EGC).
[0205] According to specific embodiments, the cell is a mammalian cell e.g., rodent (e.g. mouse, rat), human (Homo sapiens), monkey (e.g. chimpanzee, Gorillas, Rhesus and/or Baboon), livestock animal (e.g. cattle, sheep, pigs, goats, horses, donkeys, mules).
[0206] According to specific embodiments, the cell is a mouse cell.
[0207] According to specific embodiments, the cell is a human cell.
[0208] According to other specific embodiments, the cell is of a non-human primate (e.g. Macaques).
[0209] The phrase embryonic stem cells refers to embryonic cells which are capable of differentiating into cells of all three embryonic germ layers (i.e., endoderm, ectoderm and mesoderm), or remaining in an undifferentiated state. The phrase embryonic stem cells may comprise cells which are obtained from the embryonic tissue formed after gestation (e.g., blastocyst) before implantation of the embryo (i.e., a pre-implantation blastocyst), extended blastocyst cells (EBCs) which are obtained from a post-implantation/pre-gastrulation stage blastocyst (see WO2006/040763) and embryonic germ (EG) cells which are obtained from the genital tissue of a fetus any time during gestation, preferably before 10 weeks of gestation.
[0210] The embryonic stem cells of some embodiments of the invention can be obtained using well-known cell-culture methods. For example, human embryonic stem cells can be isolated from human blastocysts. Human blastocysts are typically obtained from human in vivo preimplantation embryos or from in vitro fertilized (IVF) embryos. Alternatively, a single cell human embryo can be expanded to the blastocyst stage. For the isolation of human ES cells the zona pellucida is removed from the blastocyst and the inner cell mass (ICM) is isolated by immunosurgery, in which the trophectoderm cells are lysed and removed from the intact ICM by gentle pipetting.
[0211] The ICM is then plated in a tissue culture flask containing the appropriate medium which enables its outgrowth. Following 9 to 15 days, the ICM derived outgrowth is dissociated into clumps either by a mechanical dissociation or by an enzymatic degradation and the cells are then re-plated on a fresh tissue culture medium. Colonies demonstrating undifferentiated morphology are individually selected by micropipette, mechanically dissociated into clumps, and re-plated. Resulting ES cells are then routinely split every 4-7 days. For further details on methods of preparation human ES cells see Thomson et al., [U.S. Pat. No. 5,843,780; Science 282:1145, 1998; Curr. Top. Dev. Biol. 38:133, 1998; Proc. Natl. Acad. Sci. USA 92:7844, 1995]; Bongso et al., [Hum Reprod 4:706, 1989]; and Gardner et al., [Fertil. Steril. 69:84, 1998].
[0212] Another method for preparing ES cells is described in Chung et al., Cell Stem Cell, Volume 2, Issue 2, 113-117, 7 Feb. 2008. This method comprises removing a single cell from an embryo during an in vitro fertilization process. The embryo is not destroyed in this process.
[0213] It will be appreciated that commercially available stem cells can also be used according to some embodiments of the invention. Human ES cells can be purchased from the NIH human embryonic stem cells registry [Hypertext Transfer Protocol://grants(dot)nih(dot)gov/stem_cells/registry/current(dot)htm]. Non-limiting examples of commercially available embryonic stem cell lines are BG01, BG02, BG03, BG04, CY12, CY30, CY92, CY10, TE03, TE32, CHB-4, CHB-5, CHB-6, CHB-8, CHB-9, CHB-10, CHB-11, CHB-12, HUES 1, HUES 2, HUES 3, HUES 4, HUES 5, HUES 6, HUES 7, HUES 8, HUES 9, HUES 10, HUES 11, HUES 12, HUES 13, HUES 14, HUES 15, HUES 16, HUES 17, HUES 18, HUES 19, HUES 20, HUES 21, HUES 22, HUES 23, HUES 24, HUES 25, HUES 26, HUES 27, HUES 28, CyT49, RUES3, WA01, UCSF4, NYUES1, NYUES2, NYUES3, NYUES4, NYUES5, NYUES6, NYUES7, UCLA 1, UCLA 2, UCLA 3, WA077 (H7), WA09 (H9), WA13 (H13), WA14 (H14), HUES 62, HUES 63, HUES 64, CT1, CT2, CT3, CT4, MA135, Eneavour-2, WIBR1, WIBR2, WIBR3, WIBR4, WIBR5, WIBR6, HUES 45, Shef 3, Shef 6, BJNhem19, BJNhem20, SA001, SA001.
[0214] In addition, ES cells can be obtained from other species as well, including mouse (Mills and Bradley, 2001), golden hamster [Doetschman et al., 1988, Dev Biol. 127:224-7], rat [Iannaccone et al., 1994, Dev Biol. 163:288-92] rabbit [Giles et al. 1993, Mol Reprod Dev. 36:130-8; Graves & Moreadith, 1993, Mol Reprod Dev. 1993, 36:424-33], several domestic animal species [Notarianni et al., 1991, J Reprod Fertil Suppl. 43:255-60; Wheeler 1994, Reprod Fertil Dev. 6:563-8; Mitalipova et al., 2001, Cloning. 3:59-67] and non-human primate species (Rhesus monkey and marmoset) [Thomson et al., 1995, Proc Natl Acad Sci USA. 92:7844-8; Thomson et al., 1996, Biol Reprod. 55:254-9].
[0215] Non-limiting examples of commercially available mouse embryonic stem cell lines are v6.5, KH2, BVSC ES line, NGFP1 iPSC line, NGFP2 iPSC lines.
[0216] Extended blastocyst cells (EBCs) can be obtained from a blastocyst of at least nine days post fertilization at a stage prior to gastrulation. Prior to culturing the blastocyst, the zona pellucida is digested [for example by Tyrode's acidic solution (Sigma Aldrich, St Louis, MO, USA)] so as to expose the inner cell mass. The blastocysts are then cultured as whole embryos for at least nine and no more than fourteen days post fertilization (i.e., prior to the gastrulation event) in vitro using standard embryonic stem cell culturing methods.
[0217] EG cells are prepared from the primordial germ cells obtained from fetuses of about 8-11 weeks of gestation (in the case of a human fetus) using laboratory techniques known to anyone skilled in the arts. The genital ridges are dissociated and cut into small chunks which are thereafter disaggregated into cells by mechanical dissociation. The EG cells are then grown in tissue culture flasks with the appropriate medium. The cells are cultured with daily replacement of medium until a cell morphology consistent with EG cells is observed, typically after 7-30 days or 1-4 passages. For additional details on methods of preparation human EG cells see Shamblott et al., [Proc. Natl. Acad. Sci. USA 95:13726, 1998] and U.S. Pat. No. 6,090,622.
[0218] Induced pluripotent stem cells (iPS: embryonic-like stem cells), are cells obtained by de-differentiation of adult somatic cells which are endowed with pluripotency (i.e., being capable of differentiating into the three embryonic germ cell layers, i.e., endoderm, ectoderm and mesoderm). According to some embodiments of the invention, such cells are obtained from a differentiated tissue (e.g., a somatic tissue such as skin) and undergo de-differentiation by genetic manipulation which re-program the cell to acquire embryonic stem cells characteristics. According to some embodiments of the invention, the induced pluripotent stem cells are formed by inducing the expression of Oct-4, Sox2, Kf14 and c-Myc in a somatic stem cell.
[0219] Induced pluripotent stem cells (iPS) (embryonic-like stem cells) can be generated from somatic cells by genetic manipulation of somatic cells, e.g., by retroviral transduction of somatic cells such as fibroblasts, hepatocytes, gastric epithelial cells with transcription factors such as Oct-3/4, Sox2, c-Myc, and KLF4 [Yamanaka S, Cell Stem Cell. 2007, 1 (1): 39-49; Aoi T, et al., Generation of Pluripotent Stem Cells from Adult Mouse Liver and Stomach Cells. Science. 2008 February 14. (Epub ahead of print); I H Park, Zhao R, West J A, et al. Reprogramming of human somatic cells to pluripotency with defined factors. Nature 2008:451:141-146; K Takahashi, Tanabe K. Ohnuki M, et al. Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell 2007; 131:861-872]. Other combinations of pluripotency factor overexpression generated iPSCs are included as well (Buganim et al. Cell (2012) 150 (6): 1209-1222 www(dot)doi(dot)org/10.1016/j.cell.2012.08.023) Other embryonic-like stem cells can be generated by nuclear transfer to oocytes, fusion with embryonic stem cells or nuclear transfer into zygotes if the recipient cells are arrested in mitosis.
[0220] The methods of some embodiments of the invention utilize PSCs in their nave state.
[0221] The phrase nave pluripotent stem cells (PSCs) refers to PSCs that express pluripotent markers (such as Oct4, Nanog and Klf4), lack of extraembryonic endoderm, trophectoderm and somatic early lineage specific markers. The cells retain a non-restricted developmental potential as they can robustly differentiate into all cell types in vitro and, upon injection into the blastocyst, they efficiently contribute to the three germ layers and to the germ-line of chimeric animals.
Human and Non-Human Primate Nave PSCs Also a Pre X-Inactivation State.
[0222] Chromosome X inactivation is an early developmental process in mammalian females that transcriptionally silences one of the pair of X chromosomes, thus providing dosage equivalence between males and females. The process is regulated by several factors, including a region of chromosome X called the X inactivation center (XIC). The XIC comprises several non-coding and protein-coding genes, and XIST gene was the first non-coding gene identified within the XIC.
[0223] When XIST bodies are present, then XIST is exclusively expressed from the XIC of the inactive X chromosome, and is essential for the spread of X-inactivation.
[0224] The pre-X-inactivation state according to some embodiments of the invention is characterized by presence of two unmethylated alleles of the promoter of the X-inactive specific transcript (XIST) gene in the female cell, and presence an unmethylated allele of the promoter of the XIST gene in a male cell.
[0225] This is contrary to human and non-human primate primed PSC or conventional PSC which are characterized by one methylated allele of XIST and one unmethylated allele of XIST in the female cell, and by one methylated allele in the male cell.
[0226] The XIST gene is located on human Xq13.2 chromosome and has the sequence depicted in clone NC_000023.10 (73040486.73072588, complement, based on GenBank version GRCh37. p10). The XIST gene has a non-coding RNA which is provided in GenBank Accession NO. NR_001564.2.
[0227] Methods of determining the methylation status of the XIST gene are known in the art and disclosed e.g. in Lengner Cell 141, 872-883 (2010); Hanna et al., Cell 143, 508-525; (2010); TAKASHI SADO et al., DEVELOPMENTAL DYNAMICS 205:421-434 (1996); and International Patent Application Publication No. WO2016/016894 and WO2014/174470, each of which is fully incorporated herein by reference in its entirety, and include e.g. bisulfite sequencing and Southern blot analysis.
[0228] According to some embodiments of the invention, presence of two unmethylated alleles of XIST gene in a female cell refers to having below about 20% of CpG methylated reads sequenced in the XIST promoter, e.g., below about 19%, below about 18%, below about 17%, below about 16%, below about 15%, below about 14%, below about 13%, below about 12%, below about 11%, below about 10%, below about 9%, below about 8%, below about 7%, below about 6%, below about 5%, below about 4%, below about 3%, below about 2%, below about 1%, e.g., 0% (e.g., complete absence) of CpG methylated reads sequenced in the XIST promoter.
[0229] According to some embodiments of the invention, presence of one unmethylated allele of XIST gene in a male cell refers to having below about 20% of CpG methylated reads sequenced in the XIST promoter, e.g., below about 19%, below about 18%, below about 17%, below about 16%, below about 15%, below about 14%, below about 13%, below about 12%, below about 11%, below about 10%, below about 9%, below about 8%, below about 7%, below about 6%, below about 5%, below about 4%, below about 3%, below about 2%, below about 1%, e.g., 0% of CpG methylated reads sequenced in the XIST promoter.
[0230] A non-limited example of the XIST promoter which includes CpG islands which can be either methylated or unmethylated is provided in the XIST promoter amplicon set forth by SEQ ID NO: 65.
[0231] According to some embodiments of the invention, the naive PSC exhibits a pre-X inactivation status similar to the pre-X inactivation status of a human Inner cell mass (ICM).
[0232] According to some embodiments of the invention, the naive PSC is characterized by a reduced methylation of CpG islands as compared to a level of methylation of the CpG islands in a primed PSC.
[0233] According to some embodiments of the invention, naive PSCs are characterized by significantly low levels of total methylated cytosine out of the total guanine nucleotides in each cell (e.g., 1-2%) as determined by Liquid Chromatography-Mass Spectrometry (LC-MS) quantitative analysis.
[0234] According to some embodiments of the invention, the naive PSC is characterized by 0-3% of total methylated cytosine out of the total Guanine nucleotides in the naive PSC cell. For comparison, the primed PSC or a somatic cell has between 3.5%-5% of total methylated cytosine out of the total Guanine nucleotides in the primed PSC cell.
[0235] According to some embodiments of the invention, the human naive PSC expresses XIST.
[0236] Methods of detecting XIST expression are known in the art and include for example reverse transcriptasepolymerase chain reaction (RT-PCR) analysis using XIST specific PCR primers, e.g., the forward primer: 5-AGGGAGCAGTTTGCCCTACT (SEQ ID NO: 66), and the reverse primer: 5-CACATGCAGCGTGGTATCTT (SEQ ID NO: 67).
[0237] According to some embodiments of the invention, the naive PSC is devoid of XIST bodies.
[0238] As used herein the phrase XIST bodies refers to a XIST-coated inactive X chromosome.
[0239] Methods of detecting XIST bodies are known in the art and include for example RNA fluorescent in situ hybridization. RNA fluorescence in situ hybridization (FISH) is carried out as previously described [Hanna J., et al., Cell 143, 508-525]. Briefly, human pluripotent stem cells are harvested, MEF-depleted, and cytospun onto glass slides before fixation. cDNA probes are generated to XIST exon 1 (GenBank Accession No. U80460: 61251-69449, SEQ ID NO: 26) and exon 6 (GenBank Accession No. U80460: 75081-78658, SEQ ID NO: 27) and labeled by nick translation (Roche) with Cy3-dUTP (Amersham), and Cot-1 DNA is labeled with fluorescein-12-dUTP using the Prime-It Fluor Labeling Kit (Stratagene).
[0240] According to some embodiments of the invention, the naive PSC is devoid of an H3K27me3/polycomb focus.
[0241] As used herein the phrase H3K27me3/polycomb focus refers to nuclear focus obtained following immuno-staining that corresponds to condensed inactive X chromosome.
[0242] Methods of detecting H3K27me3/polycomb focus are known in the art and include for example, the use of immuno-fluorescence analysis using anti H3K27me3 antibodies (e.g., Rabbit anti H3K27me3, Millipore, CA, USA Catalogue number 07-449), as shown for example in
[0243] According to some embodiments of the invention, the naive PSC has a low XIST expression level while being in the naive state, without inactivation of any of the X chromosomes and without presence of XIST bodies.
[0244] It should be noted that the naive PSCs of some embodiments of the invention (which are in a pre-X inactivation and a naive state) can upon differentiation inactivate one of the X chromosome alleles and methylate one of the XIST genes.
[0245] According to specific embodiments, expression level of the transcription factor E3 (TFE3) in the naive PSC is characterized by a nucleus to cytoplasm expression ratio which is equal to or higher than 1, as determined by e.g. an immunostaining assay.
[0246] According to specific embodiments, the nave cells express c-Kit on their cell surface, as determined by e.g. flow cytometry or immunostaining assay.
[0247] Contrary to the known primed PSC, the naive PSC of some embodiments of the invention is resistant to induction of differentiation by FGFR/MEK/ERK inhibitor, JNK inhibitor, and/or P38 inhibitor. Thus, according to some embodiments of the invention, when the isolated naive PSC is incubated in the presence of an agent selected from the group consisting of FGFR/MEK/ERK inhibitor, JNK inhibitor, and P38 inhibitor, the naive PSC remains in the pluripotent state.
[0248] According to some embodiments of the invention, the naive PSC has an inhibited p38 pathway as compared to a primed PSC. For example, p38 activity is inhibited in the naive PSC.
[0249] According to some embodiments of the invention, the level of p38 RNA and/or phosphorylated p38 protein in the naive PSC is less than about 30%, e.g., less than about 20%, e.g., less than about 5%, e.g., less than about 0.5%, e.g., less than about 0.1% as compared to the level of p38 RNA and/or phosphorylated p38 protein, respectively, in a non-naive PSC incubated and/or cultured under the same conditions, yet without being subject to p38 inhibition.
[0250] According to some embodiments of the invention, the naive PSC has an inhibited JNK pathway as compared to a primed PSC. For example, JNK activity is inhibited in the naive PSC.
[0251] According to some embodiments of the invention, the level of JNK RNA and/or phosphorylated JNK protein in the naive PSC is less than about 30%, e.g., less than about 20%, e.g., less than about 5%, e.g., less than about 0.5%, e.g., less than about 0.1% as compared to the level of JNK RNA and/or phosphorylated JNK protein, respectively, in a non-naive PSC incubated and/or cultured under the same conditions, yet without being subject to JNK inhibition.
[0252] According to some embodiments of the invention, the naive PSC has an inhibited ROCK pathway as compared to a primed PSC. For example, ROCK activity is inhibited in the naive PSC.
[0253] According to some embodiments of the invention, the level of ROCK RNA and/or phosphorylated ROCK protein in the naive PSC is less than about 30%, e.g., less than about 20%, e.g., less than about 5%, e.g., less than about 0.5%, e.g., less than about 0.1% as compared to the level of ROCK RNA and/or phosphorylated ROCK protein, respectively, in a non-naive PSC incubated and/or cultured under the same conditions, yet without being subject to ROCK inhibition.
[0254] According to some embodiments of the invention, the naive PSC which is maintained in the undifferentiated, pluripotent and naive state (as defined above), expresses significantly lower levels SOX1 as compared to the level of expression present in primed PSC (e.g., primed ESC) under identical SOX1 assay conditions, and wherein the primed PSC exhibits one methylated and one unmethylated allele of XIST (in a female cell) or one methylated allele of XIST (in a male cell); expresses XIST; exhibits XIST bodies; and exhibits a H3K27me3/polycomb focus.
[0255] According to some embodiments of the invention, the naive PSC expresses a lower level of MHC class I as compared to a primed PSC under identical detection assay conditions, and wherein the primed PSC exhibits one methylated and one unmethylated allele of XIST (in a female cell) or one methylated allele of XIST (in a male cell); expresses XIST; exhibits XIST bodies; and exhibits a H3K27me3/polycomb focus.
[0256] The level of MHC class I can be determined by various methods known in the art such as FACS analysis using specific antibodies to detect the surface expression of the MHC class I molecules, and using fluorescently labeled anti HLA-A,B,C antibody (BD Biosciences).
[0257] According to some embodiments of the invention, the naive PSC is characterized by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90% more RNA polymerase II pausing on chromosomes as compared to a primed PSC under identical assay conditions, and wherein the primed PSC exhibits one methylated and one unmethylated allele of XIST (in a female cell) or one methylated allele of XIST (in a male cell); expresses XIST; exhibits XIST bodies; and exhibits a H3K27me3/polycomb focus.
[0258] According to specific embodiments, the nave PSCs express a pluripotency marker, i.e., positive for one or more pluripotency markers.
[0259] According to specific embodiments, the expression is of an endogenous protein.
[0260] Positive is also abbreviated by (+). Positive for a marker means that at least about 70%, 80%, 85%, 90%, 95%, or 100% of the cells in the population present detectable levels of the marker assayed by a method known to those of skill in the art. Developmental markers can be detected using immunological techniques well known in the art [described e.g. in Thomson J A et al., (1998). Science 282:1145-7]. Examples include, but are not limited to, immunostaining, microscopy, flow cytometry, western blot, and enzymatic immunoassays. Other non-limiting methods include PCR analysis, RNA fluorescence in situ hybridization (FISH), northern blot, single cell RNA sequencing.
[0261] Pluripotency markers are well known in the art and include, but not limited to Oct4, NANOG, KLF4, KLF17, SUSD2, TFCP2L1.
[0262] The nave PSC of some embodiments of the invention is characterized by a positive expression of the C-KIT protein (also known as CD117) on the cell surface.
[0263] According to specific embodiments, the nave PSCs can be obtained in culture in the naive state without the need of exogenous expression of Oct4, Sox2, Klf4 and/or c-Myc factors.
[0264] According to specific embodiments, the nave PSCs are negative for a differentiation marker.
[0265] Negative is also abbreviated by (). Negative for a marker means that no more than about 30%, no more than about 25%, no more than about 20%, no more than about 15%, no more than about 10%, no more than about 5%, no more than about 4%, no more than about 3%, no more than about 2%, no more than about 1%, of the cells in the population present detectable levels of the marker assayed by a method known to those of skill in the art such as FACS, immunofluorescence, immunohistochemistry, Western blot analysis, RT-PCR. Non-limiting examples of differentiation markers include Gata3, Gata2, tbr2, tfap2c, Cdx2, Elf5, Hand1, EOMES, ETS2, Foxa2, Gata4, Gata6, PDGFRA, Sox17.
[0266] Determination of PSC differentiation can also be effected via measurements of alkaline phosphatase activity. Undifferentiated human ES cells have alkaline phosphatase activity which can be detected by fixing the cells with 4% paraformaldehyde and developing with the Vector Red substrate kit according to manufacturer's instructions (Vector Laboratories, Burlingame, California, USA).
[0267] According to specific embodiments, the nave PSCs can be obtained in culture in the naive state under feeder layer free conditions [e.g., on a Matrigel, Laminin, and/or fibronectin-coated surface and not on feeder cell e.g., fibroblast feeder cells, e.g., mouse embryonic fibroblasts (MEFs)].
[0268] According to specific embodiments, the nave PSCs can be obtained in culture in the nave pluripotent state in the absence of exogenous L-glutamine in the culture medium.
[0269] According to specific embodiments, the nave PSCs can be obtained in culture in the nave pluripotent state in the absence of expression of DNA methyltransferase 1 (DNMT1).
[0270] Methods of obtaining nave PSCs and maintaining them in a nave and pluripotent state are known in the art and are further disclosed in the Examples section which follows which serve as an integral part of the specification and in e.g. Choi, J., Huebner, A., Clement, K. et al. Nature 548, 219-223 (2017), www(dot)doi(dot)org/10.1038/nature23274; Yang et al. Cell (2017) 169 (2): 243-257, www(dot)cell(dot)com/fulltext/S0092-8674% 2817%2930183-6; Bayerl et al. 2021, Cell Stem Cell 28, 1549-1565 and International Patent Application Publication No. WO2016/016894 and WO2014/174470, the contents or which are fully incorporated herein by reference.
[0271] Multiple nave PSCs cell lines are also known, for example, V6.5 mouse ESC line, BVSc ES line, NGFP1 iPSC line, WIBR3 line, WIS1 ES line and WIS ES line, and are commercially available from public cell line repositories.
[0272] As used herein, the term trophectoderm (TE) primed cell refers to a stem cell originating from a nave PSC that comprises an exogenous nucleic acid sequence encoding a factor that induces differentiation to a trophectoderm cell and/or a cell originating from a nave PSC that is committed to the trophectoderm lineage (e.g. trophectoderm cell). It will be appreciated that prior to induction of expression of the factor (i.e. the protein product expressed from the exogenous nucleic acid sequence or the endogenous factor) the cell is in a nave and undifferentiated state (i.e. naive PSC) and following induction of expression of the factor the cell acquires characteristics of a trophectoderm cell.
[0273] According to specific embodiments, the trophectoderm primed cell comprises an exogenous polynucleotide suitable for transient expression of the factor that induces differentiation to trophectoderm cells, as further described hereinbelow.
[0274] According to specific embodiments, the trophectoderm primed cell comprises the protein product expressed from the exogenous nucleic acid sequence encoding the factor.
[0275] According to other specific embodiments, the trophectoderm primed cell does not comprise the protein product expressed from the exogenous nucleic acid sequence encoding the factor.
[0276] As used herein, trophectoderm cell refers to a cell having a restricted potential to generate all placental lineages but not other cell lineages.
[0277] According to some embodiment, the trophectoderm cells gives rise to the ecto-placental cone, and/or extra-embryonic ectoderm (ExE), and/or the umbilical cord and/or the chorion.
[0278] Non-limiting examples of trophectoderm cell markers include Gata3, Gata2, tbr2, tfap2c, Cdx2, Elf5, Hand1, EOMES, KLF5 and ETS2.
[0279] According to specific embodiments, the trophectoderm cell expresses Cdx2, i.e. positive for Cdx2.
[0280] According to specific embodiments, the trophectoderm primed cell expresses a trophectoderm marker. According to specific embodiments, the trophectoderm primed cell expresses at least one trophectoderm marker selected from the group consisting of Gata3, Gata2, Cdx2 and Elf5.
[0281] According to specific embodiments, the trophectoderm primed cell expresses pluripotency marker. Such markers are known in the art and are further described hereinabove and below. According to specific embodiments, the trophectoderm primed cell expresses (positive for) at least one pluripotency marker selected from the group consisting of Oct4, Tfap2c. Susd2, Sox2, SSEA1, SSEA3, SSEA4, TRA1-60. According to specific embodiments, the trophectoderm primed cell expresses Oct4. According to specific embodiments, the trophectoderm primed cell is negative for a pluripotency marker selected from the group consisting of Klf17, Klf4 and Nanog.
[0282] According to specific embodiments, the trophectoderm primed cell expresses a trophectoderm marker and a pluripotency marker.
[0283] According to specific embodiments, the marker is endogenous to the cell.
[0284] Thus, according to specific embodiments, the trophectoderm primed cell expresses an exogenous factor that induces differentiation to trophectoderm cells, an endogenous trophectoderm marker and an endogenous pluripotency marker.
[0285] According to specific embodiments, the trophectoderm primed cell expresses a trophectoderm marker upon mixing (i.e., at time 0 hours), in the mixture or in the aggregate.
[0286] According to specific embodiments, the trophectoderm primed cell expresses a pluripotency marker upon mixing (i.e., at time 0 hours), in the mixture or in the aggregate.
[0287] According to specific embodiments, the trophectoderm primed cell does not express Oct4 and Nanog upon mixing (i.e., at time 0 hours), in the mixture or in the aggregate.
[0288] According to specific embodiments, the trophectoderm primed cell (e.g., upon mixing, in the mixture, in the aggregate) is not in a differentiation stage of a trophoblast stem cell (TSC). In other words, it does not have a phenotypic signature of a TSC (derived from the trophectoderm or an induced TSC or obtained by de-differentiation or re-programming of a cell).
[0289] According to specific embodiments, the TSC (e.g., human TSC) has a CDX2.sup. TFAP2C.sup.+GATA3.sup.+SIGLE6.sup.+ phenotype.
[0290] In comparison, the human trophectoderm primed cell or some embodiments of the invention has a CDX2+TFAP2c.sup.+GATA3.sup.+SIGLEC6.sup. phenotype.
[0291] According to specific embodiments, the TSC (e.g., mouse TSC) has a CDX2.sup.+TFAP2C.sup.+MHC class 1.sup.+OCT4.sup. phenotype.
[0292] In comparison, the mouse trophectoderm primed cell or some embodiments of the invention has a CDX2.sup.+TFAP2C.sup.+MHC class 1.sup.Oct4.sup.+(low) phenotype.
[0293] The factor which expression induces differentiation of the nave PSCs of some embodiments of the invention may be endogenous and/or exogenous to the cell.
[0294] According to specific embodiments, the method comprises inducing expression of an exogenous factor that induces differentiation to (towards) trophectoderm cells.
[0295] As used herein, the term exogenous refers to a heterologous polynucleotide or polypeptide which is not naturally expressed within the cell or which overexpression in the cell is desired. It should be noted that the exogenous polynucleotide and/or polypeptide may comprise a nucleic acid sequence and/or an amino acid sequence, respectively, which is identical or partially homologous to an endogenous nucleic acid sequence and/or an endogenous amino acid sequence of the cell.
[0296] According to additional or alternative embodiments, the method comprises inducing expression of an endogenous factor that induces differentiation to (toward) trophectoderm cells. Hence, according to specific embodiments, the cell is cultured under conditions enabling expression of an endogenous factor that induces differentiation to the trophectoderm primed cell. Such conditions include for example an appropriate temperature (e.g., 37 C.), atmosphere (e.g., % O.sub.2, % CO.sub.2), pressure, pH, light, medium, supplements (e.g. a differentiation factor as disclosed herein) and the like. Further description on culturing conditions are provided hereinbelow. Hence, according to specific embodiments, the nave PSC cell or the trophectoderm primed cell is contacted with the factor. Under this culturing scenario the cells may further comprise or be devoid of an exogenous polynucleotide suitable for expression of a factor that induces differentiation to trophectoderm cells. According to a specific embodiment, the cell does not comprise an exogenous polynucleotide suitable for expression of a factor that induces differentiation to trophectoderm cells. In this case inducing expression of the endogenous factor, the culturing or the contacting is typically effected prior to mixing the subpopulations of cells (e.g. starting within 14 days-0 hours prior to the mixing, within 13 days-0 hours prior to the mixing, within 12 days-0 hours prior to the mixing, within 11 days-0 hours prior to the mixing, within 10 days-0 hours prior to the mixing, within 9 days-0 hours prior to the mixing, within 8 days-0 hours prior to the mixing, within 7 days-0 hours prior to the mixing, within 6 days-0 hours prior to the mixing within 5 days-0 hours prior to the mixing, within 120 hours-0 hours prior to the mixing, within 100 hours-0 hours prior to the mixing, within 80 hours-0 hours prior to the mixing, within 60 hours-0 hours prior to the mixing, within 48 hours-0 hours prior to the mixing, within 36 hours-0 hours prior to the mixing, within 24 hours-0 hours prior to the mixing, within 12 hours-0 hours prior to the mixing, within 14-1 days prior to the mixing, within 13-1 days prior to the mixing, within 12-1 days prior to the mixing, within 11-1 days prior to the mixing, within 10-1 days prior to the mixing, within 9-1 days prior to the mixing, within 8-1 days prior to the mixing, within 7-1 days prior to the mixing, within 6-1 days prior to the mixing within 5-1 days prior to the mixing, within 120-20 hours prior to the mixing, within 100-20 hours prior to the mixing, within 80-20 hours prior to the mixing, within 60-20 hours prior to the mixing, within 48-20 hours prior to the mixing, within 14 days-12 hours prior to the mixing, within 13 days-12 hours prior to the mixing, within 12 days-12 hours prior to the mixing, within 11 days-12 hours prior to the mixing, within 10 days-12 hours prior to the mixing, within 9 days-12 hours prior to the mixing, within 8 days-12 hours prior to the mixing, within 7 days-12 hours prior to the mixing, within 6 days-12 hours prior to the mixing within 5 days-12 hours prior to the mixing, within 120-12 hours prior to the mixing, within 100-12 hours prior to the mixing, within 80-12 hours prior to the mixing, within 60-12 hours prior to the mixing, within 48-12 hours prior to the mixing, within 14 days-6 hours prior to the mixing, within 13 days-6 hours prior to the mixing, within 12 days-6 hours prior to the mixing, within 11 days-6 hours prior to the mixing, within 10 days-6 hours prior to the mixing, within 9 days-6 hours prior to the mixing, within 8 days-6 hours prior to the mixing, within 7 days-6 hours prior to the mixing, within 6 days-6 hours prior to the mixing within 5 days-6 hours prior to the mixing, within 120 hours-6 hours prior to the mixing, within 100 hours-6 hours prior to the mixing, within 80 hours-6 hours prior to the mixing, within 60 hours-6 hours prior to the mixing, within 48 hours-6 hours prior to the mixing, within 36 hours-6 hours prior to the mixing, within 24 hours-6 hours prior to the mixing, or within 12 hours-6 hours prior to the mixing, each possibility represents a separate embodiment of the invention).
[0297] According to specific embodiments, the culturing or the contacting starts at least 6 hours, at least 10 hours, at least 12 hours, at least 16 hours, at least 24 hours, at least 36 hours, at least 48 hours, at least 72 hours, or at least 96 hours prior to the mixing.
[0298] According to specific embodiments, the culturing or the contacting starts no more than 3 days, no more than 4 days, no more than 5 days, no more than 6 days, no more that 7 days, no more than 8 days, no more than 9 days, no more than 10 days, not more that 14 days, no more than 16 days, or no more than 20 days prior to the mixing.
[0299] According to specific embodiments, the culturing or the contacting starts within about 6-3 days prior to the mixing.
[0300] According to specific embodiments, the culturing or the contacting starts about 3 days prior to the mixing.
[0301] Factors that induce differentiation towards trophectoderm cells are well known in the art, and include factor expressed in the cells and factor that are contacted with the cells. Non-limiting examples of such factors include Cdx2, Gata3, Gata2, TGFR inhibitor, FGFR inhibitor, MEK/ERK inhibitor, BMP4, JAK inhibitor, FGF4, FGF2, heparin, a SUMOylation inhibitor, a Histone Deacetylase inhibitor, a HIPPO signaling pathway inhibitor and a factor that induces YAP nuclear translocation.
[0302] According to specific embodiments, the factor that induces differentiation to trophectoderm cells is Cdx2.
[0303] As used herein, the term Cdx2, refers to the polynucleotide and expression product e.g., polypeptide of the CDX2 gene (corresponding to human gene ID NO: 1045) or homolog or ortholog of same. According to specific embodiments the Cdx2 refers to the human Cdx2, such as provided in the following GeneBank Numbers NP_001256, NP_001341629, NM_001265, NM_001354700 (SEQ ID NO: 68-70). According to specific embodiments the Cdx2 refers to the mouse Cdx2, such as provided in the following GeneBank Numbers NP_031699 and NM_007673 and (SEQ ID NO: 72-73). A homolog (as further defined hereinbelow) refers to a functional expression product of Cdx2 capable of inducing the differentiation of nave PSCs to trophectoderm cells.
[0304] Thus, as mentioned any of the polynucleotides and expression products described herein (e.g., Cdx2, Gata4 etc.), also refer to homologues which exhibit the desired activity as defined herein. Such homologues can be, for example, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identical to the polypeptide or polynucleotide sequences provided herein.
[0305] The homolog may also refer to an ortholog, a deletion, insertion, or substitution variant, including an amino acid substitution, as long as it retains the activity.
[0306] Sequence identity or homology can be determined using any protein or nucleic acid sequence alignment algorithm such as Blast, ClustalW, and MUSCLE.
[0307] According to specific embodiments, the factor that induces differentiation to trophectoderm cells is Gata3.
[0308] As used herein, the term Gata3, also known as GATA Binding Protein 3 and HDRS, refers to the polynucleotide and expression product e.g., polypeptide of the GATA3 gene (corresponding to human gene ID NO: 2625) or homolog or ortholog of same. According to specific embodiments the Gata3 refers to the human Gata3, such as provided in the following GeneBank Numbers NP_001002295 and NM_001002295 (SEQ ID NO: 74). According to specific embodiments the Gata3 refers to the mouse Gata3, such as provided in the following GeneBank Numbers NP_032117, NP_001342039, NP_001342040, NP_001342041, NM_008091. NM_001355110, NM_001355111 and NM_001355112 (SEQ ID NO: 76-83). A homolog (as further defined hereinabove) refers to a functional expression product of Gata3 capable of inducing the differentiation of nave PSCs to trophectoderm cells.
[0309] According to specific embodiments, the factor that induces differentiation to trophectoderm cells is Gata2.
[0310] As used herein, the term Gata2, also known as GATA Binding Protein 2, refers to the polynucleotide and expression product e.g., polypeptide of the GATA2 gene (corresponding to human gene ID NO: 2624) or homolog or ortholog of same. According to specific embodiments the Gata2 refers to the human Gata2, such as provided in the following GeneBank Numbers NP_001139133, NP_001139134, NP_116027, NM_032638, NM_001145661 and NM_001145662 (SEQ ID NO: 84-89). According to specific embodiments the Gata2 refers to the mouse Gata2, such as provided in the following GeneBank Numbers NP_032116, NP_001342182, NM_008090 and NM_001355253 (SEQ ID NO: 90-93). A homolog (as further defined hereinabove) refer to a functional expression product of Gata2 capable of inducing the differentiation of nave PSCs to trophectoderm cells.
[0311] According to specific embodiments, the factor that induces differentiation to trophectoderm cells is a TGFR inhibitor.
[0312] As used herein the term transforming growth factor receptor (TGFR) (also known as TGFR) refers to TGF- type I receptor ALK5, type I activin/nodal receptor ALK4 and type I nodal receptor ALK7.
[0313] As used herein the term TGFR inhibitor (or TGFRi) refers to a molecule capable of inhibiting TGFR expression and/or activity level as determined by phosphorylated ALK4, 5 and 7. Non-limiting examples of TGFR inhibitors include SB431542 and A 83-01 small molecule compound.
[0314] According to specific embodiments, the factor that induces differentiation to trophectoderm cells is a FGFR inhibitor.
[0315] As used herein the term fibroblast growth factor receptor (FGFR) refers to FGFR1, FGFR2 and FGFR3.
[0316] As used herein the term FGFR inhibitor (or FGFRi) refers to a molecule capable of inhibiting FGFR expression and/or activity level as determined by levels of phosphorylated FGFR1, 2, and 3. Non-limiting examples of FGFR inhibitors include PD173074, SU5401 and PD0325901.
[0317] According to specific embodiments, the factor that induces differentiation to trophectoderm cells is ROCK inhibitor.
[0318] As used herein the term ROCK, also known as Rho-associated protein kinase and includes ROCK1 and ROCK2 having a serine/threonine kinase activity.
[0319] As used herein the term ROCK inhibitor refers to any molecule capable of inhibiting the activity of ROCK as determined by inhibition of ROCK phosphorylation levels (e.g. detected by western blot analysis).
[0320] Non-limiting examples of ROCK inhibitors include Y27632 (TOCRIS, Catalogue number 1254), Blebbistatin (TOCRIS Catalogue number 1760) and Thiazovivin (Axon MedchemAxon 1535). Blebbistatin is a selective inhibitor of myosin II ATpase, a downstream effector of ROCK pathway, and thus effectively leads to ROCK pathway inhibition (Chen G1, Hou Z et al. Actin-myosin contractility is responsible for the reduced viability of dissociated human embryonic stem cells. Cell Stem Cell. 2010; 7 (2): 240-8, which is fully incorporated herein by reference in its entirety).
[0321] According to specific embodiments, the factor that induces differentiation to trophectoderm cells is a MEK/ERK inhibitor (as further defined infra).
[0322] According to specific embodiments, the factor that induces differentiation to trophectoderm cells is BMP4.
[0323] As used herein, the term BMP4, also known as Bone morphogenic protein 4, refers to the polynucleotide and expression product e.g., polypeptide of the BMP4 gene (corresponding to human gene ID NO: 652) or a homolog or ortholog of same. According to specific embodiments the BMP4 refers to the human BMP4, such as provided in the following UniProt Number P12644 (SEQ ID NO: 195). According to specific embodiments the BMP4 refers to the mouse BMP4, such as provided in the following UniProt Number P21275 (SEQ ID NO: 196). A homolog (as further defined hereinabove) refers to a functional expression product of BMP4 capable of inducing the differentiation of nave PSCs to trophectoderm cells.
[0324] According to specific embodiments, the factor that induces differentiation to trophectoderm cells is a JAK inhibitor.
[0325] As used herein the term JAK refers to a Janus kinase and includes JAK1, JAK2, JAK3 and TYK2.
[0326] As used herein the term JAK inhibitor (or JAKi) refers to a molecule capable of inhibiting JAK expression and/or activity level as determined by levels of phosphorylated STAT (signal transducer and activator of transcription). Non-limiting examples of JAK inhibitors include Calbiochem 420099, Tofacitinib, Baricitinib, Ruxolitinib, Fedratinib, Upadacitinib, Cedulatinib, Gandotinib, Lesraurtinib, Momelotinib, Pacritinib, Curuebitacin I, CHZ868.
[0327] According to specific embodiments, the factor that induces differentiation to trophectoderm cells is FGF4.
[0328] As used herein, the term FGF4, also known as Fibroblast growth factor 4, refers to the polynucleotide and expression product e.g., polypeptide of the FGF4 gene (corresponding to human gene ID NO: 2249) or homolog or ortholog of same. According to specific embodiments the FGF4 refers to the human FGF4, such as provided in the following GeneBank Numbers NP_001998 and NM_002007 (SEQ ID NO: 94-95). According to specific embodiments the FGF4 refers to the mouse FGF4, such as provided in the following GeneBank Numbers NP_034332 and NM_010202 (SEQ ID NO: 96-97). A homolog (as further defined hereinabove) refers to a functional expression product of FGF4 capable of inducing the differentiation of nave PSCs to trophectoderm cells and/or extra embryonic primitive endodermal cells.
[0329] According to specific embodiments, the factor that induces differentiation to trophectoderm cells is FGF2.
[0330] As used herein, the term FGF2, also known as basic fibroblast growth factor (bFGF) and FGF-, refers to the polynucleotide and expression product e.g., polypeptide of the FGF2 gene (corresponding to human gene ID NO: 2247) or homolog or ortholog of same. According to specific embodiments the FGF2 refers to the human FGF2, such as provided in the following GeneBank Numbers NP_001997, NP_001348594, NM_002006 and NM_001361665 (SEQ ID NO: 98-101). According to specific embodiments the FGF2 refers to the mouse FGF2, such as provided in the following GeneBank Numbers NP_032032 and NM_008006 (SEQ ID NO: 102-103). A homolog (as further defined hereinabove) refers to a functional expression product of FGF2 capable of inducing the differentiation of nave PSCs to trophectoderm cells and/or extra embryonic primitive endodermal cells.
[0331] According to specific embodiments, the factor that induces differentiation to trophectoderm cells is a SUMOylation inhibitor, such as but not limited to DC 2-D08 (2,3,4-trihydroxy flavone).
[0332] According to specific embodiments, the factor that induces differentiation to trophectoderm cells is a Histone Deacetylase inhibitor (HDACi), such as but not limited to VPA (valproic acid), Trichostatin A, sodium butyrate or UF010 small molecule inhibitor.
[0333] According to specific embodiments, the factor that induces differentiation to trophectoderm cells is a HIPPO signaling pathway inhibitor or a factor that induces YAP nuclear translocation.
[0334] The HIPPO signaling pathway, also known as the Salvador/Warts/Hippo (SWH) pathway, comprise a complex cascade of serine/threonine-protein kinases that eventually regulates phosphorylation of Yap/Taz. Specifically, when the Hippo pathway is off, the phosphorylated YAP/TAZ is retained in the cytoplasm and may also undergo proteolytic degradation. When the Hippo pathway is on, the unphosphorylated YAP/TAZ moves into the nucleus and binds to transcription factors called TEA DNA-binding proteins (TEAD1-4). Non-limiting examples of components of the HIPPO signaling pathway include Hpo, Serine threonine kinase 3 (STK3) and STK4 (also known as MST1 and MST2), salvador homolog 1 (SAV1), large tumor suppressor 1/2 (LATS1/2). MAP4K, TAOK, MOB kinase activator 1A/B (MOB1A/B), yes-associated protein (YAP1), transcriptional co-activator with PDZ-binding motif (TAZ or WWTR1) and Neurofibromin 2 (NF2).
[0335] The HIPPO signaling pathway inhibitor disclosed herein binds a component of the HIPPO signaling pathway and inhibits expression and/or activity of same. Such inhibitors are known in the art and include, but not limited to LPA and XMU-MP-1.
[0336] As used herein, the term extra embryonic primitive endodermal (PRE) primed cell refers to a stem cell originating from a nave PSC that comprises an exogenous nucleic acid sequence encoding a factor that induces differentiation to an extra embryonic primitive endodermal cell and/or a cell originating from a nave PSC that is committed to the extra embryonic primitive endoderm lineage (e.g. extra embryonic primitive endodermal cell).
[0337] It will be appreciated that prior to induction of expression of the exogenous factor (i.e. the protein product expressed from the exogenous nucleic acid sequence or the endogenous factor) the cell is in a nave and undifferentiated state (i.e. naive PSC) and following induction of expression of the exogenous factor the cell acquires characteristics of an extra embryonic primitive endodermal cell.
[0338] According to specific embodiments, the extra embryonic primitive endodermal primed cell comprises an exogenous polynucleotide suitable for transient expression of the factor that induces differentiation to extra embryonic primitive endodermal cells, as further described hereinbelow.
[0339] According to specific embodiments, the extra embryonic primitive endodermal primed cell comprises the protein product expressed from the exogenous nucleic acid sequence encoding the factor.
[0340] According to other specific embodiments, the extra embryonic primitive endodermal primed cell does not comprise the protein product expressed from the exogenous nucleic acid sequence encoding the factor.
[0341] As used herein, extra embryonic primitive endodermal cell refers to a cell having a restricted potential to generate all primitive endoderm lineages but not other cell lineages.
[0342] Non-limiting examples of extra embryonic primitive endodermal cell markers include Foxa2, Gata4, Gata6, PDGFRA and Sox17.
[0343] According to specific embodiments, the extra embryonic primitive endodermal cell expresses Gata4, i.e. positive for Gata4.
[0344] According to specific embodiments, the extra embryonic primitive endodermal primed cell expresses an extra embryonic primitive endoderm marker. According to specific embodiments, the extra embryonic primitive endodermal primed cell expresses at least one extra embryonic primitive endoderm marker selected from the group consisting of PDGFRA, GATA4, SOX17, NID2 and GATA6.
[0345] According to specific embodiments, the extra embryonic primitive endodermal primed cell expresses a pluripotency marker. Such markers are known in the art and are further described hereinabove and below. According to specific embodiments, the extra embryonic primitive endodermal primed cell expresses (positive for) at least one pluripotency marker selected from the group consisting of OCT4, SSEA1 and SSEA4. According to specific embodiments, the extra embryonic primitive endodermal primed cell is negative for a pluripotency marker selected from the group consisting of NANOG, KLF17, NANOG-NB and, TFCP2L1.
[0346] According to specific embodiments, the extra embryonic primitive endodermal primed cell expresses an extra embryonic primitive endoderm marker and a pluripotency marker.
[0347] According to specific embodiments, the marker is endogenous to the cell.
[0348] Thus, according to specific embodiments, the extra embryonic primitive endodermal primed cell expresses an exogenous factor that induces differentiation to extra embryonic primitive endodermal cells, an endogenous extra embryonic primitive endoderm marker and an endogenous pluripotency marker.
[0349] According to specific embodiments, the extra embryonic primitive endodermal primed cell expresses an extra embryonic primitive endoderm marker upon mixing (i.e. at time 0 hours), in the mixture or in the aggregate.
[0350] According to specific embodiments, the extra embryonic primitive endodermal primed cell expresses a pluripotency marker upon mixing (i.e. at time 0 hours), in the mixture or in the aggregate.
[0351] According to specific embodiments, the extra embryonic primitive endodermal primed cell expresses Oct4 upon mixing (i.e. at time 0 hours), in the mixture or in the aggregate
[0352] According to other specific embodiments, the extra embryonic primitive endodermal primed cell does not express Oct4 upon mixing (i.e. at time 0 hours), in the mixture or in the aggregate.
[0353] According to specific embodiments, the extra embryonic primitive endodermal primed cell (e.g. upon mixing, in the mixture, in the aggregate) is not in a differentiation stage of a XEN cell. In other words, it does not have a phenotypic signature of a XEN (which can be obtained from blastocysts, early post-implantation embryo or an induced XEN obtained by de-differentiation or re-programming of a cell).
[0354] According to specific embodiments, the XEN has an OCT4.sup. GATA6.sup.+GATA4.sup.+SOX17.sup.+PDGFRa.sup.+ phenotype.
[0355] In comparison the extra embryonic primitive endodermal primed cell of some embodiments of the invention has an OCT4.sup.+GATA6.sup.+GATA4.sup.+SOX17.sup.+PDGFRa.sup.+ phenotype.
[0356] As mentioned, the factor which expression induces differentiation of the nave PSCs of some embodiments of the invention may be endogenous and/or exogenous to the cell.
[0357] According to specific embodiments, the method comprises inducing expression of an exogenous factor that induces differentiation to (towards) extra embryonic primitive endodermal cells.
[0358] According to additional or alternative embodiments, the method comprises inducing expression of an endogenous factor that induces differentiation to (towards) extra embryonic primitive endodermal cells. Hence, according to specific embodiments, the cell is cultured under conditions enabling expression of an endogenous factor that induces differentiation to the extra embryonic primitive endodermal primed cell. Such conditions include for example an appropriate temperature (e.g., 37 C.), atmosphere (e.g., % O.sub.2, % CO.sub.2), pressure, pH, light, medium, supplements (e.g. a differentiation factor as disclosed herein) and the like. Further description on culturing conditions are provided hereinbelow. Hence, according to specific embodiments, the nave PSC cell or the extra embryonic primitive endodermal primed cell is contacted with the factor. Under this culturing scenario the cells may further comprise or be devoid of an exogenous polynucleotide suitable for expression of a factor that induces differentiation to extra embryonic primitive endodermal cells. According to a specific embodiment, the cell does not comprise an exogenous polynucleotide suitable for expression of a factor that induces differentiation to extra embryonic primitive endodermal. In this case inducing expression of the endogenous factor, the culturing or the contacting is typically effected prior to mixing the subpopulations of cells (e.g. starting within 14 days-0 hours prior to the mixing, within 13 days-0 hours prior to the mixing, within 12 days-0 hours prior to the mixing, within 11 days-0 hours prior to the mixing, within 10 days-0 hours prior to the mixing, within 9 days-0 hours prior to the mixing, within 8 days-0 hours prior to the mixing, within 7 days-0 hours prior to the mixing, within 6 days-0 hours prior to the mixing within 5 days-0 hours prior to the mixing, within 120 hours-0 hours prior to the mixing, within 100 hours-0 hours prior to the mixing, within 80 hours-0 hours prior to the mixing, within 60 hours-0 hours prior to the mixing, within 48 hours-0 hours prior to the mixing, within 36 hours-0 hours prior to the mixing, within 24 hours-0 hours prior to the mixing, within 12 hours-0 hours prior to the mixing, within 14-1 days prior to the mixing, within 13-1 days prior to the mixing, within 12-1 days prior to the mixing, within 11-1 days prior to the mixing, within 10-1 days prior to the mixing, within 9-1 days prior to the mixing, within 8-1 days prior to the mixing, within 7-1 days prior to the mixing, within 6-1 days prior to the mixing within 5-1 days prior to the mixing, within 120-20 hours prior to the mixing, within 100-20 hours prior to the mixing, within 80-20 hours prior to the mixing, within 60-20 hours prior to the mixing, within 48-20 hours prior to the mixing, within 14 days-12 hours prior to the mixing, within 13 days-12 hours prior to the mixing, within 12 days-12 hours prior to the mixing, within 11 days-12 hours prior to the mixing, within 10 days-12 hours prior to the mixing, within 9 days-12 hours prior to the mixing, within 8 days-12 hours prior to the mixing, within 7 days-12 hours prior to the mixing, within 6 days-12 hours prior to the mixing within 5 days-12 hours prior to the mixing, within 120-12 hours prior to the mixing, within 100-12 hours prior to the mixing, within 80-12 hours prior to the mixing, within 60-12 hours prior to the mixing, or within 48-12 hours prior to the mixing, within 14 days-6 hours prior to the mixing, within 13 days-6 hours prior to the mixing, within 12 days-6 hours prior to the mixing, within 11 days-6 hours prior to the mixing, within 10 days-6 hours prior to the mixing, within 9 days-6 hours prior to the mixing, within 8 days-6 hours prior to the mixing, within 7 days-6 hours prior to the mixing, within 6 days-6 hours prior to the mixing within 5 days-6 hours prior to the mixing, within 120 hours-6 hours prior to the mixing, within 100 hours-6 hours prior to the mixing, within 80 hours-6 hours prior to the mixing, within 60 hours-6 hours prior to the mixing, within 48 hours-6 hours prior to the mixing, within 36 hours-6 hours prior to the mixing, within 24 hours-6 hours prior to the mixing, or within 12 hours-6 hours prior to the mixing, each possibility represents a separate embodiment of the invention).
[0359] According to specific embodiments, the culturing or the contacting starts at least 6 hours, at least 10 hours, at least 12 hours, at least 16 hours, at least 24 hours, at least 36 hours, at least 48 hours, at least 72 hours, or at least 96 hours prior to the mixing.
[0360] According to specific embodiments, the culturing or the contacting starts no more than 3 days, no more than 4 days, no more than 5 days, no more than 6 days, no more that 7 days, no more than 8 days, no more than 9 days, no more than 10 days, not more that 14 days, no more than 16 days, or no more than 20 days prior to the mixing.
[0361] According to specific embodiments, the culturing or the contacting starts within about 6-3 days prior to the mixing.
[0362] According to specific embodiments, the culturing or the contacting starts about 3 days prior to the mixing.
[0363] Factors that induce differentiation to extra embryonic primitive endodermal cells are well known in the art, and include factor expressed in the cells and factor that are contacted with the cells. Non-limiting examples of such factors include Gata4, Gata6, a GSK-3 inhibitor, WNT ligand, heparin, FGF2, FGF4, PDGFRA, leukemia inhibitory factor (LIF) and insulin.
[0364] According to specific embodiments, the factor that induces differentiation to extra embryonic primitive endodermal cells is Gata4.
[0365] As used herein, the term Gata4, also known as GATA Binding Protein 4 and Transcription factor Gata4, refers to the polynucleotide and expression product e.g., polypeptide of the GATA4 gene (corresponding to human gene ID NO: 2626) or homolog or ortholog of same. According to specific embodiments the Gata4 refers to the human Gata4, such as provided in the following GeneBank Numbers NP_001295022, NP_001295023, NP_002043, NP_001361202, NP_001361203, NM_001308093, NM_001308094, NM_002052, NM_001374273 and NM_001374274 (SEQ ID NO: 104-113). According to specific embodiments the Gata4 refers to the mouse Gata4, such as provided in the following GeneBank Numbers NP_001297539, NP_032118, NM_008092 and NM_001310610 (SEQ ID NO: 114-117). A homolog (as further defined hereinabove) refers to a functional expression product of Gata4 capable of inducing the differentiation of nave PSCs to extra embryonic primitive endodermal cells.
[0366] According to specific embodiments, the factor that induces differentiation to extra embryonic primitive endodermal cells is Gata6.
[0367] As used herein, the term Gata6, also known as GATA Binding Protein 6 and Transcription factor Gata6, refers to the polynucleotide and expression product e.g., polypeptide of the GATA6 gene (corresponding to human gene ID NO: 2627) or homolog or ortholog of same. According to specific embodiments the Gata6 refers to the human Gata6, such as provided in the following GeneBank Numbers NP_005248 and NP_005257 (SEQ ID NO: 118-119). According to specific embodiments the Gata6 refers to the mouse Gata6, such as provided in the following GeneBank Numbers NP_034388 and NM_010258 (SEQ ID NO: 120-121). A homolog (as further defined hereinabove) refers to a functional expression product of Gata6 capable of inducing the differentiation of nave PSCs to extra embryonic primitive endodermal cells.
[0368] According to specific embodiments, the factor that induces differentiation to extra embryonic primitive endodermal cells is SOX17.
[0369] As used herein, the term SOX17, also known as SRY-box 17, refers to the polynucleotide and expression product e.g., polypeptide of the SOX17 gene (corresponding to human gene ID NO: 64321) or homolog or ortholog of same. According to specific embodiments the SOX17 refers to the human SOX17, such as provided in the following GeneBank Numbers NP_071899 and NM_022454 (SEQ ID NO: 197-198). According to specific embodiments the SOX17 refers to the mouse SOX17, such as provided in the following UniProt No. Q61473 (SEQ ID NO: 199). A homolog (as further defined hereinabove) refers to a functional expression product of SOX17 capable of inducing the differentiation of nave PSCs to extra embryonic primitive endodermal cells.
[0370] According to specific embodiments, the factor that induces differentiation to extra embryonic primitive endodermal cells is a GSK-3 inhibitor.
[0371] As used herein the term GSK-3 refers to the glycogen synthase kinase 3 beta protein set forth by GenBank Accession Nos. NP_002084 (SEQ ID NO: 122) and/or NP_001139628 (SEQ ID NO: 123) having the WNT signaling regulatory activity via its kinase activity.
[0372] As used herein the term GSK-3 inhibitor refers to any molecule capable of inhibiting the activity of GSK-3 as determined by specifically inhibiting levels of phosphorylated GSK3b (out of total GSK3b present in a cell).
[0373] Non-limiting examples of GSK-3 inhibitors include CHIR99021 (AXON MEDCHEM-AXON 1386), BIO (AXONMEDCHEMAxon 1693), and Kenpaullone (TOCRIS-cat no. 1398).
[0374] According to specific embodiments, the factor that induces differentiation to extra embryonic primitive endodermal cells is a WNT ligand.
[0375] Wnt ligands are a large family of secreted glycoproteins that are cysteine-rich and highly hydrophobic. Non-limiting examples of Wnt ligands that can be used with specific embodiments of the invention include Wnt-1, Wnt-2, Wnt-2b, Wnt-3a, Wnt-4, Wnt-5a, Wnt-5b, Wnt-6, Wnt-7a. Wnt-7b, Wnt8a, Wnt-8b, Wnt-9a, Wnt-9b, Wnt-10a, Wnt-10b, Wnt-11 and Wnt16b.
[0376] According to specific embodiments, the factor that induces differentiation to extra embryonic primitive endodermal cells is FGF2.
[0377] According to specific embodiments, the factor that induces differentiation to extra embryonic primitive endodermal cells is FGF4.
[0378] According to specific embodiments, the factor that induces differentiation to extra embryonic primitive endodermal cells is PDGF.
[0379] As used herein, the term PDGF, refers to a platelet-derived growth factor, and includes the various subtypes of PDGF including PDGF-B (e.g. GenBank Accession Nos. X02811 and CAA26579), PDGF-A (e.g. GenBank Accession nos. X06374 and CAA29677), PDGF-C(e.g. GenBank Accession Nos. NM 016205 and NP 057289), PDGF-D, variants 1 and 2 (e.g. GenBank Accession Nos. NM 025208, NP 079484, NM 033135, NP 149126), and dimerized forms thereof, including PDGF-AA, PDGF-AB, PDGF-BB, PDGF-CC, and PDGF-DD. Typically, platelet-derived growth factors includes homo- or heterodimers of A-chain and B-chain that exert their action via binding to and dimerization of two related receptor tyrosine kinase platelet-derived growth factor cell surface receptors PDGFR- (also known as PDGFRA, e.g. GenBank Accession Nos. NM 006206 and NP 006197) and PDGFR- (e.g. GenBank Accession Nos. NM 002609 and NP 002600). See also PCT Application Publication No. WO2010/127029 and US Application Publication No. US20150182623, which are incorporated herein in its entirety, for PDGF sequences. According to specific embodiments, the PDGF is capable of inducing the differentiation of nave PSCs to extra embryonic primitive endodermal cells.
[0380] According to specific embodiments, the factor that induces differentiation to extra embryonic primitive endodermal cells is LIF (as further defined infra).
[0381] According to specific embodiments, the factor that induces differentiation to extra embryonic primitive endodermal cells is insulin.
As the present inventors developed culture conditions which enabled the generation of extra embryonic primitive endodermal primed cells from nave PSCs which can be used for example for generating synthetic embryos (Examples 10 and 14 of the Examples section which follows), embodiments of the invention also contemplate methods of obtaining these cells.
[0382] Thus, according to an aspect of the present invention, there is provided a method of obtaining extra embryonic primitive endodermal primed cells, the method comprising culturing nave PSCs in a base medium devoid of Activin A under conditions that allow differentiation of said nave PSCs to GATA4.sup.+GATA6.sup.+OCT4.sup.+Nanog.sup. extra embryonic primitive endodermal primed cells, thereby obtaining the extra embryonic primitive endodermal primed cells.
[0383] According to specific embodiments, the GATA4.sup.+GATA6.sup.+OCT4.sup.+Nanog.sup. cells are also positive for PDGFRA and NID2.
[0384] According to specific embodiments of this aspect of the present invention, the method further comprising inducing expression (e.g. transient expression) of an exogenous factor that induces differentiation to extra embryonic primitive endodermal cells.
[0385] According to other specific embodiments of this aspect of the present invention, the method does not comprise inducing expression (e.g. transient expression) of an exogenous factor that induces differentiation to extra embryonic primitive endodermal cells.
[0386] According to specific embodiments, the culturing is effected for at least 6 hours, at least 12 hours, at least 16 hours, at least 1 day (or at least 24 hours), at least 2 days or at least 3 days.
[0387] According to specific embodiments, the culturing is effected for up to 14 days, up to 13 days, up to 12 days, up to 11 days, up to 10 days, up to 9 days, up to 8 days, up to 7 days or up to 6 days.
[0388] According to specific embodiments, the culturing is effected for 1-10 days.
[0389] According to specific embodiments, the culturing is effected for about 3-6 days.
[0390] According to specific embodiments, the culturing is effected from about 3 days.
[0391] According to specific embodiments, the obtained cells are a stable line maintaining the extra embryonic primitive endodermal primed cells phenotype (e.g. GATA4.sup.+GATA6.sup.+OCT4.sup.+Nanog.sup. phenotype) over multiple generations/passages. Thus, according to specific embodiments, the cells can be expanded in culture for at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 20, or at least 30 passages while maintaining the extra embryonic primitive endodermal primed cells phenotype (e.g. GATA4.sup.+GATA6.sup.+OCT4.sup.+Nanog.sup. phenotype).
[0392] The exogenous factors of some embodiments of the invention are transiently expressed in the cells.
[0393] Methods of expressing an exogenous nucleic acid sequence and/or amino acid sequence are known in the art and include those described for example in the materials and methods of the Examples section which follows and in Mansour et al. 2012; Warren et al. 2010 and Hongyan Zhou al. Cell Stem Cell (2009) 4 (6): 581; Rabinovich and Weissman (2013) Methods Mol Biol. 969:3-28; International Application Publication No. WO 2013049389 and U.S. Pat. No. 8,557,972, which are fully incorporated herein by reference in their entirety.
[0394] Further, methods of transient expression are well known in the art and include, but not limited to, expression under the control of an inducible promoter, by introduction of mRNA into the cells (in this way the mRNA will be translated in the cells and degraded after a relatively short time) or by transfecting with the protein, as further described infra.
[0395] Distinguishing a cell expressing an exogenous polynucleotide and/or polypeptide from a cell not expressing the exogenous polynucleotide and/or polypeptide can be effected by e.g. determining the level and/or distribution of the RNA and/or protein molecules in the cell, the location of DNA integration in the genome of the cell and/or the number of gene copy number. Methods of determining the presence of an exogenous polynucleotide and/or polypeptide in a cell are well known in the art and include e.g. PCR, DNA and RNA sequencing, Southern blot, Western blot, immunoprecipitation, immunocytochemistry, flow cytometry and imaging.
[0396] According to specific embodiments, the expression is affected by introducing to the cells a polynucleotide encoding the factor.
[0397] According to specific embodiments, expressing is not in the natural location (i.e., gene locus) and/or expression level (e.g., copy number and/or cellular localization) of the native gene of the factor.
[0398] Alternatively or additionally, exogenous expression of a factor may be facilitated by activation of the endogenous locus of these genes such that the factor is overexpressed in the cell. Methods of activating and overexpressing an endogenous gene are well known in the art [see for example Menke D. Genesis (2013) 51:618; Capecchi, Science (1989) 244:1288-1292; Santiago et al. Proc Natl Acad Sci USA (2008) 105:5809-5814; International Patent Application Nos. WO 2014085593, WO 2009071334 and WO 2011146121; U.S. Pat. Nos. 8,771,945, 8,586,526, 6,774,279 and UP Patent Application Publication Nos. 20030232410, 20050026157, US20060014264; the contents of which are incorporated by reference in their entireties] and include, but not limited to and include targeted homologous recombination (e.g. Hit and run, double-replacement), site specific recombinases (e.g. the Cre recombinase and the Flp recombinase), PB transposases (e.g. Sleeping Beauty, piggyBac, Tol2 or Frog Prince), genome editing by engineered nucleases (e.g. meganucleases, Zinc finger nucleases (ZFNs), transcription-activator like effector nucleases (TALENs) and CRISPR/Cas system) and genome editing using recombinant adeno-associated virus (rAAV) platform, and small molecules. Agents for introducing nucleic acid alterations to a gene of interest can be designed publically available sources or obtained commercially from Transposagen, Addgene and Sangamo Biosciences.
[0399] As used herein the term polynucleotide refers to a single or double stranded nucleic acid sequence in the form of an RNA sequence (e.g. mRNA), a complementary polynucleotide sequence (cDNA), a genomic polynucleotide sequence (e.g. sequence isolated from a chromosome), a composite polynucleotide sequences (e.g., a combination of the above) or mimetic or analog thereof. This term includes polynucleotides and/or oligonucleotides derived from naturally occurring nucleic acids molecules (e.g., RNA or DNA), synthetic polynucleotide and/or oligonucleotide molecules composed of naturally occurring bases, sugars, and covalent internucleoside linkages (e.g., backbone), as well as synthetic polynucleotides and/or oligonucleotides having non-naturally occurring portions, which function similarly to the respective naturally occurring portions.
[0400] According to specific embodiments, the polynucleotide is a modified polynucleotide e.g. modified RNA.
[0401] Such a modified polynucleotide may comprise a modification in either backbone, internucleoside linkages or bases. The modified polynucleotide may comprise naturally modified nucleotides or synthetic nucleoside analogous. Modified polynucleotides may be preferred over native forms according to specific embodiments, because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for nucleic acid target, increased stability in the presence of nucleases and decreased immunogenicity.
[0402] Such modifications include, but are not limited to 5-methoxyuridine, Pseudouridine, 5-methyl cytidine, N6-methyladenosine, 2-O-methyl, 2-O-methyl 3phosphorothioate, 2-O-methyl 3thiophosphonoacetate, Locked nucleic acid (LNA).
[0403] Methods of stabilizing mRNA are known in the art and include modulation of the length of the polyadenine tail found at the 3 end of the mRNA transcript. Alternatively or additionally, the RNA cap found at the molecule's 5 end can be modified. The naturally occurring cap structure typical in mammalian cells has a tendency to be improperly incorporated into RNAs synthesized in vitro, rendering them less effective. Synthetic anti-reverse cap analogs (e.g. those commercially available at Thermo Fisher Scientific) can prevent this misincorporation, which results in more stable RNA with improved translational efficiency. In order to reduce immunogenicity, substitution of particular nucleotides can be exchanged with chemically modified alternatives such as 5-methylcytosine or pseudouridine. Such substitutions can mute the immune response whilst also bolstering the stability of the mRNA and efficiency of translation. Other exemplary chemically modified nucleotides are described herein above.
[0404] Alternatively, or additionally, the mRNA may be encapsulated in lipid-based particles to enhance fusion with the lipid cell membrane.
[0405] Polynucleotides designed according to the teachings of some embodiments of the invention can be generated according to any polynucleotide synthesis method known in the art such as enzymatic synthesis or solid phase synthesis. Equipment and reagents for executing solid-phase synthesis are commercially available from, for example, Applied Biosystems. Any other means for such synthesis may also be employed; the actual synthesis of the polynucleotides is well within the capabilities of one skilled in the art and can be accomplished via established methodologies as detailed in, for example, Molecular Cloning: A laboratory Manual Sambrook et al., (1989); Current Protocols in Molecular Biology Volumes I-III Ausubel, R. M., ed. (1994); Ausubel et al., Current Protocols in Molecular Biology, John Wiley and Sons, Baltimore, Maryland (1989); Perbal, A Practical Guide to Molecular Cloning, John Wiley & Sons, New York (1988) and Oligonucleotide Synthesis Gait, M. J., ed. (1984) utilizing solid phase chemistry, e.g. cyanoethyl phosphoramidite followed by deprotection, desalting and purification by for example, an automated trityl-on method or HPLC.
[0406] The term polypeptide or protein as used herein encompasses native peptides (either degradation products, synthetically synthesized peptides or recombinant peptides) and peptidomimetics (typically, synthetically synthesized peptides), as well as peptoids and semipeptoids which are peptide analogs, which may have, for example, modifications rendering the peptides more stable while in a body or more capable of penetrating into cells. Such modifications include, but are not limited to N terminus modification, C terminus modification, peptide bond modification, backbone modifications, and residue modification. Methods for preparing peptidomimetic compounds are well known in the art and are specified, for example, in Quantitative Drug Design, C. A. Ramsden Gd., Chapter 17.2, F. Choplin Pergamon Press (1992), which is incorporated by reference as if fully set forth herein.
[0407] Peptide bonds (CONH) within the peptide may be substituted, for example, by N-methylated amide bonds (N(CH3)-CO), ester bonds (C(O)O), ketomethylene bonds (COCH2-), sulfinylmethylene bonds (S(O)CH2-), -aza bonds (NH-NNAve-CO), wherein R is any alkyl (e.g., methyl), amine bonds (CH2-NH), sulfide bonds (CH2-S), ethylene bonds (CH2-CH2-), hydroxyethylene bonds (CH(OH)CH2-), thioamide bonds (CSNH), olefinic double bonds (CHCH), fluorinated olefinic double bonds (CFCH), retro amide bonds (NHCO), peptide derivatives Nave (R)CH2-CO), wherein R is the normal side chain, naturally present on the carbon atom.
[0408] These modifications can occur at any of the bonds along the polypeptide chain and even at several (2-3) bonds at the same time.
[0409] Natural aromatic amino acids, Trp, Tyr and Phe, may be substituted by non-natural aromatic amino acids such as 1,2,3,4-tetrahydroisoquinoline-3-carboxylic acid (Tic), naphthylalanine, ring-methylated derivatives of Phe, halogenated derivatives of Phe or O-methyl-Tyr.
[0410] The polypeptides of some embodiments of the invention may also include one or more modified amino acids or one or more non-amino acid monomers (e.g. fatty acids, complex carbohydrates etc.).
[0411] The term amino acid or amino acids is understood to include the 20 naturally occurring amino acids; those amino acids often modified post-translationally in vivo, including, for example, hydroxyproline, phosphoserine and phosphothreonine; and other unusual amino acids including, but not limited to, 2-aminoadipic acid, hydroxylysine, isodesmosine, nor-valine, nor-leucine and ornithine. Furthermore, the term amino acid includes both D- and L-amino acids.
[0412] The polypeptides of some embodiments of the invention may be synthesized by any techniques known to those skilled in the art of peptide synthesis, for example but not limited to recombinant DNA techniques or solid phase peptide synthesis.
[0413] Following is a non-limiting description of expression vectors and modes of administering thereof into cells which can be used to express a polypeptide-of-interest (e.g., any of the factors described hereinabove and below, e.g. Cdx2, Gata4) in a cell.
[0414] According to specific embodiments, expressing comprises introducing into the cell a polynucleotide encoding the polypeptide-of-interest (e.g. the factor).
[0415] According to specific embodiments, the polynucleotide is a DNA.
[0416] According to specific embodiments, the polynucleotide is a RNA. Typically, mRNA introduced into cells exists only in the cytoplasm, does not cause genome perturbations and is essentially transient. Unless expression of the mRNA changes the cell epigenetically, transient transfection is limited by the time of mRNA and cognate protein persistence in the cell, and does not continue after degradation of cognate proteins.
[0417] To express an exogenous protein in mammalian cells, a polynucleotide sequence encoding the polypeptide-of-interest is preferably ligated into a nucleic acid construct suitable for mammalian cell expression.
[0418] It will be appreciated that over-expression of genes can be effected using knock-in and/or knock-out constructs [see for example, Fukushige, S. and Ikeda, J. E.: Trapping of mammalian promoters by Cre-lox site-specific recombination. DNA Res 3 (1996) 73-50; Bedell, M. A., Jerkins, N. A. and Copeland, N. G.: Mouse models of human disease. Part I: Techniques and resources for genetic analysis in mice. Genes and Development 11 (1997) 1-11; Bermingham, J. J., Scherer, S. S., O'Connell, S., Arroyo, E., Kalla, K. A., Powell, F. L. and Rosenfeld, M. G.: Tst-1/Oct-6/SCIP regulates a unique step in peripheral myelination and is required for normal respiration. Genes Dev 10 (1996) 1751-62].
[0419] Such a nucleic acid construct or system includes at least one cis-acting regulatory element for directing expression of the nucleic acid sequence. Cis-acting regulatory sequences include those that direct constitutive expression of a nucleotide sequence as well as those that direct inducible expression of the nucleotide sequence only under certain conditions.
[0420] According to specific embodiments, an inducible promoter sequence for directing transcription of the polynucleotide sequence in the cell in an inducible manner is included in the nucleic acid construct. Inducible mammalian promoters are known to those of skill in the art (see, e.g. Bitter et al. (1987) Methods in Enzymology 153:516-544). Inducible promoters can be activated by external signals or agents (i.e. inducer). The inducer may directly activate a promoter or inactivate a repressor of that promoter. For example, inducible systems endogenous to mammalian cells include promoters induced by heavy-metals (Brinster et al. Nature (1982) 296:39-42; Mayo et al. Cell (1982) 29:99-108; and Searle et al. Molecular and Cellular Biology (1985) 5:1480-1489), steroid hormones (Hynes et al. Proc. Natl. Acad. Sci. USA (1981) 78:2038-2042; Lee et al. Nature (1981) 294:228-232; and Klock et al. Nature (1987) 329:734-736), heat shock (Nouer, Heat Shock Response. Boca Raton, FL, Ed. CRC, 1991) (reviewed in Mullick, A. and B. Massie Encyclopedia of Cell Technology pp. 1 140-1 164, 2000)) are well characterized. PCT publication WO2002/088346 discloses a cumate-inducible promoter. Additional inducible promoters are known in the art, and include, but are not limited to inflammation and hypoxia induced promoters. Prokaryotic and insect inducible promoter systems have been adapted for regulated expression in mammalian cells. See, for example, Gossen et al. (1993) TIBS 18:471-475 and No et al. (1996) Proc. Natl. Acad. Sci. USA 93:3346-3351). The insect ecdysone-inducible promoter is tightly regulated with no detectable background expression in the absence of inducer. Ecdysone is suitable for use in vivo because it is a naturally occurring lipophilic steroid that can penetrate tissues, is inert in mammals and exhibits rapid clearance kinetics (No et al). Gupta et al. (PNAS (2004) 101:1927-1932) discloses retroviral delivery of an ecdysone-inducible gene expression system under the control of a modified RNA polymerase Ill-specific U6 promoter.
[0421] The prokaryotic repressors from the lac and tet operons have been incorporated in eukaryotic inducible expression systems. Repression of expression is mediated by the repressor bound to operator sites placed downstream of the minimal promoter in the absence of inducer and repression is relieved on the addition of the inducer (Brown et al. (1987) Cell 49:603-612; Hu and Davidson (1987) Cell 48:555-566; Blau and Rossi, Proc. Natl. Acad. Sci. USA (1999) 96:797-799; and Gossen et al. (1995) Science 268:1766-1769).
[0422] According to specific embodiments, the inducible promoter is a Tet-on promoter induced by Tetracycline or Doxycycline.
[0423] Methods for construction of nucleic acid constructs or systems containing an inducible promoter operatively linked to a coding sequence of any polypeptide are known to those of skill in the art, as are methods for introducing such constructs of systems and vectors containing such expression cassette into cells.
[0424] In the case of mRNA, since gene expression from an RNA source does not require transcription, there is no need in a promoter sequence or the additional sequences involved in transcription described hereinbelow.
[0425] The nucleic acid construct or system (also referred to herein as an expression vector) of some embodiments of the invention includes additional sequences which render this vector suitable for replication and integration in prokaryotes, eukaryotes, or preferably both (e.g., shuttle vectors). In addition, a typical cloning vector may also contain a transcription and/or translation initiation sequence, transcription and/or translation terminator and a polyadenylation signal. By way of example, such constructs will typically include a 5 LTR, a tRNA binding site, a packaging signal, an origin of second-strand DNA synthesis, and a 3 LTR or a portion thereof.
[0426] Eukaryotic promoters typically contain two types of recognition sequences, the TATA box and upstream promoter elements. The TATA box, located 25-30 base pairs upstream of the transcription initiation site, is thought to be involved in directing RNA polymerase to begin RNA synthesis. The other upstream promoter elements determine the rate at which transcription is initiated.
[0427] Enhancer elements can stimulate transcription up to 1,000 fold from linked homologous or heterologous promoters. Enhancers are active when placed downstream or upstream from the transcription initiation site. Many enhancer elements derived from viruses have a broad host range and are active in a variety of tissues. For example, the SV40 early gene enhancer is suitable for many cell types. Other enhancer/promoter combinations that are suitable for some embodiments of the invention include those derived from polyoma virus, human or murine cytomegalovirus (CMV), the long term repeat from various retroviruses such as murine leukemia virus, murine or Rous sarcoma virus and HIV. See, Enhancers and Eukaryotic Expression, Cold Spring Harbor Press, Cold Spring Harbor, N.Y. 1983, which is incorporated herein by reference.
[0428] In the construction of the expression vector, the promoter is preferably positioned approximately the same distance from the heterologous transcription start site as it is from the transcription start site in its natural setting. As is known in the art, however, some variation in this distance can be accommodated without loss of promoter function.
[0429] Polyadenylation sequences can also be added to the expression vector in order to increase the efficiency of mRNA translation. Two distinct sequence elements are required for accurate and efficient polyadenylation: GU or U rich sequences located downstream from the polyadenylation site and a highly conserved sequence of six nucleotides, AAUAAA, located 11-30 nucleotides upstream. Termination and polyadenylation signals that are suitable for some embodiments of the invention include those derived from SV40.
[0430] In addition to the elements already described, the expression vector of some embodiments of the invention may typically contain other specialized elements intended to increase the level of expression of cloned nucleic acids or to facilitate the identification of cells that carry the recombinant DNA. For example, a number of animal viruses contain DNA sequences that promote the extra chromosomal replication of the viral genome in permissive cell types. Plasmids bearing these viral replicons are replicated episomally as long as the appropriate factors are provided by genes either carried on the plasmid or with the genome of the host cell.
[0431] The vector may or may not include a eukaryotic replicon. If a eukaryotic replicon is present, then the vector is amplifiable in eukaryotic cells using the appropriate selectable marker. If the vector does not comprise a eukaryotic replicon, no episomal amplification is possible. Instead, the recombinant DNA integrates into the genome of the engineered cell, where the promoter directs expression of the desired nucleic acid.
[0432] The expression vector of some embodiments of the invention can further include additional polynucleotide sequences that allow, for example, the translation of several proteins from a single mRNA such as an internal ribosome entry site (IRES) and sequences for genomic integration of the promoter-chimeric polypeptide.
[0433] It will be appreciated that the individual elements comprised in the expression vector can be arranged in a variety of configurations. For example, enhancer elements, promoters and the like, and even the polynucleotide sequence(s) encoding the protein-of-interest can be arranged in a head-to-tail configuration, may be present as an inverted complement, or in a complementary configuration, as an anti-parallel strand. While such variety of configuration is more likely to occur with non-coding elements of the expression vector, alternative configurations of the coding sequence within the expression vector are also envisioned.
[0434] According to specific embodiments, the expression construct include labels for imaging in cells, such as fluorescent labels.
[0435] Examples for mammalian expression vectors include, but are not limited to, pcDNA3, pcDNA3.1 (+/), pGL3, pZeoSV2(+/), pSecTag2, pDisplay, pEF/myc/cyto, pCMV/myc/cyto, pCR3.1, pSinRep5, DH26S, DHBB, pNMT1, pNMT41, pNMT81, which are available from Invitrogen, pCI which is available from Promega, pMbac, pPbac, pBK-RSV and pBK-CMV which are available from Strategene, pTRES which is available from Clontech, and their derivatives.
[0436] Expression vectors containing regulatory elements from eukaryotic viruses such as retroviruses can be also used. SV40 vectors include pSVT7 and pMT2. Vectors derived from bovine papilloma virus include pBV-1MTHA, and vectors derived from Epstein Bar virus include pHEBO, and p2O5. Other exemplary vectors include pMSG, pAV009/A.sup.+, pMTO10/A.sup.+, pMAMneo-5, baculovirus pDSVE, and any other vector allowing expression of proteins under the direction of the SV-40 early promoter, SV-40 later promoter, metallothionein promoter, murine mammary tumor virus promoter, Rous sarcoma virus promoter, polyhedrin promoter, or other promoters shown effective for expression in eukaryotic cells.
[0437] As described above, viruses are very specialized infectious agents that have evolved, in many cases, to elude host defense mechanisms. Typically, viruses infect and propagate in specific cell types. The targeting specificity of viral vectors utilizes its natural specificity to specifically target predetermined cell types and thereby introduce a recombinant gene into the infected cell. Thus, the type of vector used by some embodiments of the invention will depend on the cell type transformed. The ability to select suitable vectors according to the cell type transformed is well within the capabilities of the ordinary skilled artisan and as such no general description of selection consideration is provided herein.
[0438] Various methods can be used to introduce the polynucleotide or polypeptide of some embodiments of the invention into cells. Such methods are generally described in Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Springs Harbor Laboratory, New York (1989, 1992), in Ausubel et al., Current Protocols in Molecular Biology, John Wiley and Sons, Baltimore, Md. (1989), Chang et al., Somatic Gene Therapy, CRC Press, Ann Arbor, Mich. (1995), Vega et al., Gene Targeting, CRC Press, Ann Arbor Mich. (1995), Vectors: A Survey of Molecular Cloning Vectors and Their Uses, Butterworths, Boston Mass. (1988) and Gilboa et at. [Biotechniques 4 (6): 504-512, 1986] and include, for example, stable or transient transfection, lipofection, electroporation, nucleofection, microinjection, and infection with recombinant viral vectors. In addition, see U.S. Pat. Nos. 5,464,764 and 5,487,992 for positive-negative selection methods. Currently preferred in vivo nucleic acid transfer techniques include transfection with viral or non-viral constructs, such as adenovirus, lentivirus, Herpes simplex I virus, or adeno-associated virus (AAV) and lipid-based systems.
[0439] According to specific embodiments, introducing is by transient transfection.
[0440] Naked DNA or RNA, cell penetrating peptide or Viral and non-viral vectors (e.g. but not limited to liposomes, nanoparticles, mammalian vectors and the like) may be utilized as delivery vehicles in delivery of the polynucleotide or polypeptide as is known in the art. According to specific embodiments of the invention, the delivery system used is biocompatible and nontoxic.
[0441] Following are exemplary embodiments suitable for enhancing penetration of the exogenous polynucleotide or polypeptide to cells.
[0442] According to one exemplary embodiment, naked DNA or RNA [e.g., naked plasmid DNA (pDNA)] is non-viral vector, which can be produced in bacteria and manipulated using standard recombinant DNA techniques. It does not induce antibody response against itself (i.e., no anti-DNA or RNA antibodies generated) and enables long-term gene expression even without chromosome integration. Naked DNA or RNA can be introduced by numerous means, for example but not limited to, intravascular and electroporation techniques [Wolff J A, Budker V, 2005, Adv. Genet. 54:3-20], or by jet injection [Walther W, et al., 2004, Mol. Biotechnol. 28: 121-8].
[0443] According to another exemplary embodiment, mammalian vectors are used, as further described hereinabove.
[0444] According to specific embodiments, the polynucleotide is comprised in a viral vector. Introduction of nucleic acids by viral infection offers several advantages over other methods such as lipofection and electroporation, since higher transfection efficiency can be obtained due to the infectious nature of viruses. The viral vector may be a virus with DNA based genome of a virus with RNA based genome (i.e. positive single stranded and negative single stranded RNA viruses). Examples of viral vectors include, but are not limited to, Lentivirus, Adenovirus and Retrovirus.
[0445] A viral construct such as a retroviral construct includes at least one transcriptional promoter/enhancer or locus-defining element(s), or other elements that control gene expression by other means such as alternate splicing, nuclear RNA export, or post-translational modification of messenger. Such vector constructs also include a packaging signal, long terminal repeats (LTRs) or portions thereof, and positive and negative strand primer binding sites appropriate to the virus used, unless it is already present in the viral construct. Protocols for producing recombinant retroviruses and for infecting cells in-vitro or in-vivo with such viruses can be found in, for example, Ausubel et al., [eds, Current Protocols in Molecular Biology, Greene Publishing Associates, (1989)]. Other suitable expression vectors may be an adenovirus, a lentivirus, a Herpes simplex I virus or adeno-associated virus (AAV).
[0446] Regulatory elements that limit expression to particular cell types can also be included. Such features include, for example, promoter and regulatory elements that are specific for the desired cell type.
[0447] According to specific embodiments, expressing comprises introducing into the cell the polypeptide-of-interest (e.g. the factor).
[0448] According to specific embodiments, the polypeptide is provided in a formulation suitable for cell penetration that enhances intracellular delivery of the polypeptide as further described hereinbelow.
[0449] Cell-Penetrating Peptides (CPPs) are short peptides (40 amino acids), with the ability to gain access to the interior of almost any cell. They are highly cationic and usually rich in arginine and lysine amino acids. They have the exceptional property of carrying into the cells a wide variety of covalently and noncovalently conjugated cargoes such as proteins, oligonucleotides, and even 200 nm liposomes. Therefore, according to additional exemplary embodiment CPPs can be used to transport the polynucleotide or polypeptide to the interior of cells.
[0450] TAT (transcription activator from HIV-1), pAntp (also named penetratin, Drosophila antennapedia homeodomain transcription factor) and VP22 (from Herpes Simplex virus) are examples of CPPs that can enter cells in a non-toxic and efficient manner and may be suitable for use with some embodiments of the invention. Protocols for producing CPPs-cargos conjugates and for infecting cells with such conjugates can be found, for example L Theodore et al. [The Journal of Neuroscience, (1995) 15 (11): 7158-7167], Fawell S, et al. [Proc Natl Acad Sci USA, (1994) 91:664-668], and Jing Bian et al. [Circulation Research. (2007) 100:1626-1633].
[0451] The expression level and/or activity level of the exogenous polynucleotide and/or polypeptide expressed in the cells of some embodiments of the invention can be determined using methods known in the arts, e.g. but not limited to Northern blot analysis, PCR analysis, Western blot analysis, Immunohistochemistry, and Fluorescence activated cell sorting (FACS).
[0452] As mentioned, according to specific embodiments, expression of the exogenous factor is transient.
[0453] According to specific embodiments, inducing the transient expression starts within 14 days-0 hours prior to the mixing.
[0454] According to specific embodiments, inducing the transient expression starts within 13 days-0 hours prior to the mixing, within 12 days-0 hours prior to the mixing, within 11 days-0 hours prior to the mixing, within 10 days-0 hours prior to the mixing, within 9 days-0 hours prior to the mixing, within 8 days-0 hours prior to the mixing, within 7 days-0 hours prior to the mixing, within 6 days-0 hours prior to the mixing within 5 days-0 hours prior to the mixing, within 120 hours-0 hours prior to the mixing, within 100 hours-0 hours prior to the mixing, within 80 hours-0 hours prior to the mixing, within 60 hours-0 hours prior to the mixing, within 48 hours-0 hours prior to the mixing, within 36 hours-0 hours prior to the mixing, within 24 hours-0 hours prior to the mixing or within 12 hours-0 hours prior to the mixing, each possibility represents a separate embodiment of the invention.
[0455] According to a specific embodiment, inducing the transient expression starts within 120-0 hours prior to the mixing.
[0456] According to a specific embodiment, inducing the transient expression starts within 48-0 hours prior to the mixing.
[0457] According to a specific embodiment, inducing the transient expression starts within 42-0 hours prior to the mixing.
[0458] According to specific embodiments, inducing the transient expression starts no later than 48, 24 or 12 hours prior to the mixing.
[0459] According to specific embodiments, inducing the transient expression starts within 14-1 days prior to the mixing, within 13-1 days prior to the mixing, within 12-1 days prior to the mixing, within 11-1 days prior to the mixing, within 10-1 days prior to the mixing, within 9-1 days prior to the mixing, within 8-1 days prior to the mixing, within 7-1 days prior to the mixing, within 6-1 days prior to the mixing within 5-1 days prior to the mixing, within 120-20 hours prior to the mixing, within 100-20 hours prior to the mixing, within 80-20 hours prior to the mixing, within 60-house prior to the mixing, or within 48-20 hours prior to the mixing, each possibility represents a separate embodiment of the invention.
[0460] According to specific embodiments, inducing the transient expression starts within 14 days-12 hours prior to the mixing, within 13 days-12 hours prior to the mixing, within 12 days-12 hours prior to the mixing, within 11 days-12 hours prior to the mixing, within 10 days-12 hours prior to the mixing, within 9 days-12 hours prior to the mixing, within 8 days-12 hours prior to the mixing, within 7 days-12 hours prior to the mixing, within 6 days-12 hours prior to the mixing within 5 days-12 hours prior to the mixing, within 120-12 hours prior to the mixing, within 100-12 hours prior to the mixing, within 80-12 hours prior to the mixing, within 60-12 hours prior to the mixing, or within 48-12 hours prior to the mixing, each possibility represents a separate embodiment of the invention.
[0461] According to a specific embodiment, inducing the transient expression starts within 48-12 hours prior to the mixing.
[0462] According to specific embodiments, inducing the transient expression ends no later than 120 hours following the mixing.
[0463] According to specific embodiments, inducing the transient expression ends no later than 110 hours, 100 hours, 90 hours, 80 hours, 70 hours, 60 hours, 50 hours, 48 hours, 36 hours, 24 hours, 20 hours or 12 hours following the mixing, each possibility represents a separate embodiment of the invention.
[0464] According to specific embodiments, inducing the transient expression ends no later than 48 hours following the mixing.
[0465] According to specific embodiments, inducing the transient expression is effected for no more than 19 days.
[0466] According to specific embodiments, inducing the transient expression is effected for no more than 18 days, 17 days, 16 days, 15 days, 14 days, 13 days, 12 days, 11 days, 10 days, 9 days, 8 days, 7 days, 6 days, 5 days.
[0467] According to a specific embodiment, inducing the transient expression is effected for no more than 16 days.
[0468] According to a specific embodiment, inducing the transient expression is effected for no more than 96 hours.
[0469] According to a specific embodiment, inducing the transient expression starts 24 hours prior to the mixing and is effected for 96 hours (i.e. ends 48 hours following the mixing).
[0470] It will be appreciated that the culturing conditions suitable for the maintenance of the nave PSCs and trophectoderm- and extra embryonic primitive endodermal-primed cells prior to the mixing include various tissue culture medium composition, feeder cells, oxygen concentration, culture vessel and the like and it is within the capability of one skilled in the art to determine which conditions should be applied. Non-limiting examples of such are described in the Examples section that follows, which serves as an integral part of the specification and Choi, J., Huebner, A., Clement, K. et al. Nature 548, 219-223 (2017); Yang et al. Cell (2017) 169 (2): 243-257, www(dot)cell(dot)com/fulltext/S0092-8674% 2817%2930183-6; www(dot)doi(dot)org/10.1038/nature23274; www(dot)doi(dot)org/10.1242/dev.180620; DOI: 10.1126/science.aay3325; DOI: 10.1016/j.stem.2017.11.004; Shingo Io et al. (2021) Cell Stem Cell, 28 (6): 1023-1039 and Mitsuyoshi Amita et al. (2013) PNAS E1212-1221; and International Patent Application Publication No. WO2016/016894 and WO2014/174470, the contents of which are fully incorporated herein by reference.
[0471] According to specific embodiments, the medium comprises a STAT3 activator.
[0472] As used herein the term STAT3 refers to the signal transducer and activator of transcription 3 gene product (acute-phase response factor) (Gene ID 6774). In response to cytokines and growth factors, STAT family members are phosphorylated by the receptor associated kinases, and then form homo- or heterodimers that translocate to the cell nucleus where they act as transcription activators. Known STAT3 activators include, but are not limited to, interferon (IFN), epidermal growth factor (EGF), interleukin 5 (IL5), interleukin 6 (IL6), hepatocyte growth factor (HGF), leukemia inhibitory factor (LIF) and bone morphogenetic protein 2 (BMP2).
[0473] According to some embodiments of the invention, the STAT3 activator, which is used in the medium of some embodiments of the invention, is selected from the group consisting of LIF, IL6 and EGF.
[0474] According to some embodiments of the invention, the STAT3 activator, which is used in the medium of some embodiments of the invention, is selected from the group consisting of LIF and IL6.
[0475] According to some embodiments of the invention, the STAT3 activator, which is used in the medium of some embodiments of the invention is LIF.
[0476] As used herein the term leukemia inhibitor factor (LIF) refers to the polynucleotide and expression product e.g. polypeptide of the LIF gene (e.g. human Gene ID NO: 3976). A non-limiting example of a human LIF polypeptide is provided in the following GenBank Accession No. NP_001244064 (SEQ ID NO: 124). Preferably, the LIF used by the method according to some embodiments of the invention is capable of supporting, along with other factors, the undifferentiated growth of nave PSCs, while maintaining their pluripotent capacity. LIF can be obtained from various manufacturers such as Millipore, Peprotech, and R&D systems.
[0477] According to specific embodiments, the medium comprises a GSK-3 inhibitor.
[0478] According to specific embodiments, the medium comprises an ERK1/2 inhibitor.
[0479] As used herein the term ERK1 refers to the mitogen-activated protein kinase 3 (MAPK3) isoform 1 e.g. as set forth by GeneBank Accession No. NP_002737 (SEQ ID NO: 125), the MAPK3 isoform 2 e.g., as set forth by GenBank Accession No. NP_001035145 (SEQ ID NO: 126), the MAPK3 isoform 3 e.g. as set forth by GenBank Accession No. NP_001103361 (SEQ ID NO: 127) and/or ERK1 set forth in GenBank Accession No. M84490 (SEQ ID NO: 128) having the MAPK signaling activity.
[0480] As used herein the term ERK2 refers to the mitogen-activated protein kinase 1 (MAPK1) e.g. as set forth by GenBank Accession No. NP_002736 (SEQ ID NO: 129) and/or GenBank Accession No. NP_620407 (SEQ ID NO: 130) having the MAPK signaling activity.
[0481] As used herein the term ERK1/2 inhibitor refers to any molecule capable of inhibiting the activity of ERK1/2 as determined by Western blot protein detection of phosphorylated ERK1/2 proteins.
[0482] Non-limiting examples of ERK1/2 inhibitors (also known as MEK1/2 inhibitors) include PD0325901 (AXONMEDCHEMAXON 1408), PD98059 (AXONMEDCHEMAxon 1223), and PD184352 (AXONMEDCHEMAXON 1368).
[0483] According to specific embodiments, the medium comprises at least one of a GSK-3 inhibitor, WNT ligand, heparin, FGF2, FGF4, PDGF, leukemia inhibitory factor (LIF) and insulin.
[0484] According to specific embodiments, the medium comprises at least one of a GSK-3 inhibitor, leukemia inhibitory factor (LIF) and insulin.
[0485] According to specific embodiments, the medium comprises with at least one of GSK-3 inhibitor, heparin, FGF4, PDGF and BSA.
[0486] According to specific embodiments, the medium is devoid of Activin A [also known as Inhibin beta A, a polynucleotide and expression product e.g., polypeptide of the INHBA gene (corresponding to human gene ID: 3624) or homolog or ortholog of same].
[0487] According to specific embodiments, the medium is devoid of REPROCELL.
[0488] According to specific embodiments, the medium comprises at least one of a TGFR inhibitor, FGFR inhibitor, MEK/ERK inhibitor, BMP4, JAK inhibitor, FGF4, FGF2, heparin, a SUMOylation inhibitor, a Histone Deacetylase inhibitor, a HIPPO signaling pathway inhibitor and a factor that induces YAP nuclear translocation.
[0489] According to specific embodiments, for the TSCs primed cell pre-induction the following components may be useful supplements together or each: TGFRi A-83, LIF, HIPPO inhibitor LPA, ROCK inhibitor Y27632, MEK/ERK inhibitor PD0325901, EGF, JAKi.
[0490] Additional description of media and supplements that can be used with specific embodiments of the invention is provided infra.
[0491] According to specific embodiments, the subpopulation of cells are mixed together under conditions that allow formation of aggregated cells.
[0492] These conditions may comprise culturing time, culture vessel, medium composition, oxygen concentration, cells amount and ratio etc. Determining such conditions is well within the capabilities of the skilled artisan. Non-limiting examples of aggregation protocols that can be used with specific embodiments of the invention are described in the Examples section that follows, which serves as an integral part of the specification.
[0493] According to specific embodiments, mixing the nave PSCs, the trophectoderm primed cells and the extra embryonic primitive endodermal primed cells is effected concomitantly.
[0494] According to other specific embodiments, mixing the nave PSCs, the trophectoderm primed cells and the extra embryonic primitive endodermal primed cells is effected sequentially.
[0495] Thus, for example, according to specific embodiments, mixing the nave PSCs and the extra embryonic primitive endodermal primed cells is effected prior to mixing with the trophectoderm primed cells. According to specific embodiments, mixing the nave PSCs and the trophectoderm primed cells is effected prior to mixing with the extra embryonic primitive endodermal primed cells.
[0496] According to specific embodiments, mixing the trophectoderm primed cells with the extra embryonic primitive endodermal primed cells is effected prior to mixing with the nave PSCs.
[0497] According to specific embodiments, this difference in mixing times can be up to 48 hours, up to 40 hours, up to 35 hours, up to 30 hours, up to 24 hours, up to 16 hours or up to 12 hours, each possibility represented a separate embodiment of the invention.
[0498] According to specific embodiments, the ratio between the nave PSCs and the trophectoderm primed cells is between 1:1 and 1:5.
[0499] According to specific embodiments, the ratio between the nave PSCs and the trophectoderm primed cells is between 1:3-1:4.
[0500] According to a specific embodiment, the ratio between the nave PSCs and the trophectoderm primed cells is about 1:3.3.
[0501] According to specific embodiments, the ratio between the nave PSCs and the primitive endodermal primed cells is between 1:1 and 2:1.
[0502] According to specific embodiments, the ratio between the nave PSCs and the primitive endodermal primed cells is about 1:1.
[0503] According to specific embodiments, the aggregation is effects in an aggregation plate. Such plates are known to the skilled in the art and can be commercially obtained from e.g. STEMCELL Technologies.
[0504] Non-limiting examples of protocols for culturing of nave PSCs, induction of trophectoderm primed cells and primitive endodermal primed cells and aggregation of the three cell types are provided in the Examples section which follows.
[0505] Thus, for example, nave KH2 ESCs comprising a nucleic acid sequence encoding Gata4 under the control of a TetOn promoter may be cultured in 2iLif media and treated with DOX (e.g. 2 g/mlSigma D9891) in 2i/Lif for 24 hours before starting the experiment. Induction of Gata4 can be similarly effected in N2B27 media, MEF media, TSC media or Aggregation media. Nave KH2 ESCs comprising a nucleic acid sequence encoding Cdx2 under the control of a TetOn promoter may be cultured in 2i/Lif are treated with DOX (2 g/mlSigma D9891) for different time points (-1 day to 14 days e.g. 24 hours) in TSC media (25 ng/ml FGF4 (Peprotech), 1 g/ml Heparin (Sigma)) supplemented with or without lysophosphatidic acid (LPA) 0.5-1 M, which is a Hippo pathway inhibitor. TGFR and/or ERK inhibitors may be optionally added as well in this pre-induction step. The non-inducible ESC fraction does not undergo special pre-treatment and is maintained in 2i/Lif conditions or serum LIF conditions. Other nave conditions that can be used instead of 2i/LIF conditions include a2i conditions: which use N2B27 supplemented base media with GSK3 inhibitor CHIR99021 (3 M final concentration), Lif (20 ng/ml final concentration) and SRCI CGP77675 (1 microM final concentration). Following, aggregation is effected in AggreWell 24-well plate 400 (STEMCELL Technologies 34415), or AggreWell 24-well plate 800 (STEMCELL Technologies 34815). Non adherent 96 well shaped wells (NUNC or THERMO) can also be used instead. AggreWell plate preparation may be effected according to manufacturer instructions; for example: 500 l of anti-adherence rinsing solution (STEMCELL Technologies 07010) is added to each well. Plate is centrifuged at 2,000 g for 5 minutes and incubated 30 minutes at room temperature. After incubation, the rinsing solution is removed and the plate is washed twice with PBS. Following, 500 l of aggregation media (AM) supplemented with DOX (2 g/ml final concentrationSigma D9891) and ROCKi Y27632 (5 nM-10 M final concentrationAxon Medchem 1683) is added to each well. At the day of aggregation (day 0), the three cell populations may be trypsinized with 0.05% trypsin-EDTA solution (Biological IndustriesSartorius 03-053-1B) for 4-6 minutes at 37 C. Trypsin enzymatic reaction is stopped by adding Aggregation Media (AM). TrypleE or Accutase can be alternatively be used instead of trypsin. Cells are centrifuged at 1200 rpm for 3 minutes and re-suspended in AM with DOX (2 g/mlSigma D9891) and ROCKi Y27632 (5 nM-10 microM final concentrationAxon Medchem 1683). Cells may be plated on gelatinized tissue culture plates for mouse embryonic fibroblast depletion for 20 minutes at 37 C. Following, supernatant is collected, centrifuged and cells are re-suspended. The three cell fractions are counted and re-suspended in AM with DOX (2 g/mlSigma D9891) and ROCKi Y27632 (5 nMAxon Medchem 1683). An exemplary ratio of (1 Naive ESCs:1 iGata4 ESC:3.33 iCdx2 ESC) is maintained in aggregation experiments with the following exact number of cells depending on the aggregation plate used e.g.: A) AggreWell 800: Number of microwells per well in 24 well plate=300; Number of added cells per each well of a 24 well plate=iCdx2: 5000 cells+iGata4: 1500 cells+Naive ESC 1500 cells; Number of Cells per single microwell=27 cells. B) AggreWell 400: Number of microwells per well in 24 well plate=1200; Number of added cells per each well of a 24 well plate=iCdx2: 20000 cells+iGata4: 6000 cells+Naive ESC 6000 cells; Number of Cells per single microwell=27 cells.
[0506] As another example, nave PSCs are used to generate the following three population of cells: [0507] 1) Nave WT PSC cells cultured in HENSM medium. [0508] 2) For the primitive endoderm compartmentNave WT cells plated on mouse embryonic fibroblast conditions on HENSM supplemented with ROCKi followed by replacement with a RCL medium on the next day for 72 hours. [0509] 3) For the Trophectoderm lineageNave WT cells plated on feeder free conditions on HENSM supplemented with ROCKi followed by medium replacement on the next day with a (B)AP medium for 24 hours, and then with an with AP(J) for another 48 hours.
[0510] All three cell types are supplemented with a ROCKi before harvesting for co-aggregation on the next day. At the day of aggregation (day 0), Aggrewell plates 400, 24 wells (Stemcell technologies) are prepared and prefilled with 500 L of N2B27 media and kept at 37 C. for medium equilibration. The three cell populations are disaggregated with TrypLE (Thermo Fisher 12604054) for 3 minutes for the WT and Primitive endoderm cells and 5 minutes for the Trophectoderm cells at 37 C., next the enzyme is removed and cells are incubated for two minutes at room temperature, afterwards cells are collected with PBS. Cells are centrifuged at 1300 rpm for 3 minutes and resuspended in N2B27 ROCKi. Following, primitive endoderm cells are plated on gelatinized tissue culture plates for mouse embryonic fibroblast depletion for 30 minutes at 37 C. Supernatant is collected, and all three elements are centrifuged separately and cells resuspended on N2B27 medium. The three cell fractions are counted and resuspended in N2B27 supplemented with ROCKi. A ratio of 1:1:3 (WT:PRE:TE) is maintained in the co-aggregation.
[0511] The present invention also contemplates composition and articles of manufactures comprising the cells and aggregates disclosed herein.
[0512] Thus, according to an aspect of the present invention there is provided an article of manufacture comprising: [0513] (i) trophectoderm primed cells, wherein said trophectoderm primed cells comprise nave pluripotent stem cell (PSCs) comprising an exogenous polynucleotide suitable for transient expression of a factor that induces differentiation to trophectoderm cells; and [0514] (ii) nave PSCs.
[0515] According to specific embodiments, the article of manufacture further comprising: [0516] (iii) extra embryonic primitive endodermal primed cells, wherein said extra embryonic primitive endodermal primed cells comprise nave pluripotent stem cells (PSCs) comprising an exogenous polynucleotide suitable for transient expression of factor that induces differentiation to extra embryonic primitive endodermal cells.
[0517] According to an additional or an alternative aspect of the present invention there is provided an article of manufacture comprising: [0518] (i) trophectoderm primed cells, wherein said trophectoderm primed cells comprise nave pluripotent stem cells (PSCs) comprising an exogenous polynucleotide suitable for transient expression of a factor that induces differentiation to trophectoderm cells; and [0519] (ii) extra embryonic primitive endodermal primed cells, wherein said extra embryonic primitive endodermal primed cells comprise nave pluripotent stem cells (PSCs) comprising an exogenous polynucleotide suitable for transient expression of factor that induces differentiation to extra embryonic primitive endodermal cells.
[0520] According to specific embodiments, the different subpopulations of cells are in a single container.
[0521] According to other specific embodiments, the different subpopulations of cells are in separate containers.
[0522] According to an additional or an alternative aspect of the present invention there is provided a method of ex-utero culturing a synthetic embryo, the method comprising mixing the cells of the article of manufacture disclosed herein under conditions the allow formation of aggregated cells, wherein the method comprises inducing transient expression of said factor starting within 14 days-0 hours prior to said mixing and ending no later than 120 hours following said mixing, thereby generating the synthetic embryo.
[0523] According to an additional or an alternative aspect of the present invention there is provided a mixture or aggregate, generated according to or obtainable by the methods disclosed herein.
[0524] According to specific embodiments, the mixture or aggregate is not structurally organized as a native or naturally occurring embryo at any developmental stage. According to specific embodiments, the different cells in the mixture or aggregate are randomly scattered within the mixture of aggregate in an un-organized manner. According to specific embodiments, the mixture or aggregate does not form a blastocyst at any stage. According to specific embodiments, the mixture or aggregate does not comprise a cavity.
[0525] According to specific embodiments, the mixture or aggregate comprises at least 12, at least 16, at least 32, at least 40, at least 50 cells, or at least 64 cells.
[0526] According to specific embodiments, the mixture or aggregate comprises more than 64 cells.
[0527] According to specific embodiments, the mixture or aggregate comprises up to 500 cells, up to 450 cells, up to 400 cells, up to 350 cells, up to 300 cells, up to 250 cells, up to 200 cells, up to 150 cells, or up to 100 cells.
[0528] It will be appreciated that during culturing the mixture or aggregate of unorganized cells there is a process of re-organization of the cells to form a synthetic embryo having a structure or organization of a native one.
[0529] According to specific embodiments, the mixture or aggregate is capable of forming a synthetic embryo structurally organized as a native embryo of at least a post-implantation egg cylinder or a bilaminar disc developmental stage.
[0530] Thus, according to an additional or an alternative aspect of the present invention, there is provided a mixture or aggregate comprising: [0531] (i) nave pluripotent stem cell (PSCs); [0532] (ii) trophectoderm primed cells, wherein said trophectoderm primed cells comprise stem cells expressing an endogenous trophectoderm marker and an endogenous pluripotent marker; and [0533] (iii) extra embryonic primitive endodermal primed cells, wherein said extra embryonic primitive endodermal primed cells comprise stem cells expressing an endogenous extra embryonic primitive endoderm marker and an endogenous pluripotency marker, [0534] wherein said mixture or aggregate is not structurally organized as a native embryo at any developmental stage; and [0535] wherein said mixture or aggregate is capable of forming a synthetic embryo structurally organized as a native embryo of at least a post-implantation egg cylinder of bilaminar disc developmental stage.
[0536] According to an additional or an alternative aspect of the present invention there is provided a mixture or aggregate comprising: [0537] (i) trophectoderm primed cells, wherein said trophectoderm primed cells comprise stem cells expressing an exogenous factor that induces differentiation to trophectoderm cells, an endogenous trophectoderm marker and an endogenous pluripotent marker; and [0538] (ii) nave pluripotent stem cell (PSCs).
[0539] According to specific embodiments, the mixture or aggregate further comprising: [0540] (iii) extra embryonic primitive endodermal primed cells, wherein said extra embryonic primitive endodermal primed cells comprise stem cells expressing an exogenous factor that induces differentiation to extra embryonic primitive endodermal cells, an endogenous extra embryonic primitive endoderm marker and an endogenous pluripotency marker.
[0541] It will be appreciated that the mixture or aggregate of some embodiments of the invention comprises distinct populations of stem cells all starting from nave pluripotent stem cells (PSCs).
[0542] According to some embodiments of the invention, the method further comprises allowing the synthetic embryo to grow ex vivo (ex utero) or in vivo (in utero).
[0543] Thus, according to an aspect of the present invention, there is provided a method of ex-utero culturing a synthetic embryo, the method comprising ex-utero culturing the mixture or aggregate disclosed herein.
[0544] As described in the Examples section which follows the present inventors were able to generate post gastrulation synthetic embryos by utilizing a controlled ex utero embryo culture platform and growth conditions that previously enabled capturing mouse natural embryos gastrulation and organogenesis ex utero (Aguilera-Castrejon et al., 2021a), indicating these platform and growth conditions can be used to culture ex-utero synthetic embryos generated by both the methods disclosed herein as well as by any other method.
[0545] Thus, according to an aspect of the present invention, there is provided a method of ex-utero culturing a synthetic embryo, the method comprising ex-utero culturing a synthetic embryo at an aggregate stage in a static culture followed by a dynamic culture, wherein said static culture is effected until said embryo reaches at least an early post-implantation egg-cylinder or bilaminar disc developmental stage; and said dynamic culture starts the latest when said embryo reaches an early somite stage.
[0546] According to specific embodiments, the method further comprises determining development of the embryo prior to, during and/or following the culturing. Methods of assessing development are well known in the art and are further described in details herein.
[0547] As used herein, the term culturing a synthetic embryo refers to at least a synthetic embryo and culture medium in an in-vitro or ex-vivo (ex-utero) environment. The culture is maintained under conditions (or set of conditions) capable of inducing development and growth of the synthetic embryos. Such conditions include for example an appropriate temperature (e.g., 37 C.), atmosphere (e.g., % O.sub.2, % CO.sub.2), pressure, pH, light, medium, supplements and the like.
[0548] The culture may be in a glass, plastic or metal vessel that can provide an aseptic environment for culturing. According to specific embodiments, the culture vessel includes dishes, plates, flasks, bottles, vials, bags, bioreactors or any device that can be used to grow cells.
[0549] According to specific embodiments, the culture is maintained under sterile conditions.
[0550] According to specific embodiments, the culture is maintained at 37-38 C.
[0551] According to specific embodiments, the culture is maintained at 38 C.
[0552] According to specific embodiments, the culture is maintained at 37 C.
[0553] As changes in temperature may affect embryo developments, according to specific embodiments, care should be taken not to keep the embryo in a temperature higher than 38 C. and lower than 35 C. for a long periods of time. Thus, for example, opening the culture incubator or keeping the embryo at room temperature for a long periods of time should be avoided.
[0554] According to specific embodiments, the culture is a static culture.
[0555] According to other specific embodiments, the culture is a dynamic culture.
[0556] According to specific embodiments, the culture is a static culture followed by a dynamic culture.
[0557] As used herein, the term static culture refers to a cell culture that is carried out without agitation of the culture.
[0558] According to specific embodiments, the static culture is effected for 3-4 days.
[0559] According to specific embodiments, the static culture is effected for about 3 days.
[0560] Embryonic stage and development may be assessed compared to an in-vivo embryo counterpart at the same developmental stage by multiple ways well known in the art, including, but not limited to, morphology, length, weight, expression of developmental marker genes using specific antibodies or primers, transcriptional profiling and the like, as further described in the Examples section which follows which serve as an integral part of the specification.
[0561] As used herein, the term embryonic day (E), post fertilization day (PFD) or gestation day (GD) refers to an embryo having developmental characteristic of an in vivo (in-uterine tube or in utero, depending on the day) embryo counterpart at the specified day following fertilization or mating, wherein E0/PFD0/GD0 is considered as the fertilized egg.
[0562] According to specific embodiments, the static culture is effected for 2-5 days.
[0563] According to specific embodiments, the static culture is effected for about 4 days.
[0564] According to specific embodiments, the static culture is effected for 10-20 days.
[0565] According to specific embodiments, the static culture is effected for about 12 days.
[0566] According to specific embodiments, the static culture ends the latest when the synthetic embryo reaches the egg cylinder stage (e.g. for mouse) or the bilaminar disc stage (e.g. for human).
[0567] As used herein, the term egg cylinder stage refers to a synthetic embryo post (and not including) the blastocyst stage and prior to the post-gastrulation stage and is characterized by expansion of yolk-sac surrounding the embryo and completion of gastrulation and emergence of somites.
[0568] According to specific embodiments, the egg cylinder stage refers a synthetic embryo having characteristic of E5-7 of an in-utero natural mouse embryo.
[0569] As used herein, the term bilaminar disc stage refers to a synthetic embryo post (and not including) the blastocyst stage and prior to the day 15 stage (Carnegie stage 6) and is characterized by two, dorsally convex cellular discs, one disc formed by a thick layer of pseudostratified columnar cells called epiblast, and the other by a thin layer of cuboidal cells called hypoblast. The disc-shaped epiblast is slightly convex dorsally, separated from the amnion by the amniotic cavity at the middle of the embryonic disc.
[0570] According to specific embodiments, the bilaminar disc stage refers a synthetic embryo having characteristic of PFD8-14 of an in-utero natural human embryo.
[0571] According to specific embodiments, to prevent sticking of the embryonic epiblast and yolk sac to the culture vessel during the static culture, the culture is examined to ensure that only the ectoplacental cone remains attached to the surface of the plate. According to specific embodiments, the embryos are carefully pushed away from the plate surface by using e.g. forceps, when needed.
[0572] As used herein, the term dynamic culture refers to a cell culture that is carried out with agitation (e.g. rolling, shaking, inverting) of the culture. To reiterate, in a dynamic culture the whole culture, including the embryo, is agitated. Non-limiting examples of dynamic cultures include a roller culture (a culture on a rolling device), a shaker culture (a culture on a shaker, e.g. orbital shaker).
[0573] According to specific embodiments, the dynamic culture is a roller culture.
[0574] According to specific embodiments, the rolling culture is rolled in 30 rpm.
[0575] Rotator culture units may be obtained commercially from e.g. B.T.C. EngineeringCullum Starr Precision Engineering LtdUK, but can be further modified and adapted.
[0576] According to other specific embodiments, the dynamic culture is a shaker culture.
[0577] According to specific embodiments, the shaker rotates at 30-80 rpm, 40-70 rpm, 50-70 rpm or 55-65 rpm.
[0578] According to a specific embodiment, the shaker rotates at about 60 rpm.
[0579] According to specific embodiments, the dynamic culture comprises a shaker culture, a roller culture or a sequential combination thereof.
[0580] According to specific embodiments, the dynamic culture starts when the embryo reaches a pre-gastrulation stage.
[0581] As used herein the term pre-gastrulation refers to a synthetic embryo following the egg cylinder stage or the bilaminar disc stage and prior to the early gastrulation stage and is characterized by presence of OCT4 and OTX2+epiblast, pro-amniotic cavity formation and extra ectoderm embryo formation (ExE).
[0582] According to specific embodiments, the pre-gastrulation stage refers to a synthetic embryo having characteristics of E5-6 of an in-utero natural mouse embryo or PFD8-14 of an in-utero natural a human embryo.
[0583] According to specific embodiments, the dynamic culture starts with a shaker culture (for e.g. 1-4 days) followed by a roller culture.
[0584] According to specific embodiments, the roller culture starts when the embryo reaches at least the early gastrulation stage.
[0585] As used herein the term early gastrulation refers to a synthetic embryo following the pre-gastrulation stage and prior to the late gastrulation stage and is characterized e.g. in mice by egg cylinder shape with the primitive streak at the posterior side; in human by bilaminar disc cylinder shape with the primitive streak at the posterior side.
[0586] According to specific embodiments, the early gastrulation stage refers a synthetic embryo having characteristic of E6-7 of an in-utero natural mouse embryo or PFD12-18 of an in-utero natural a human embryo.
[0587] According to specific embodiments, the roller culture starts the latest when the embryo reaches an early somite stage.
[0588] According to specific embodiments, the dynamic culture starts the latest when the embryo reaches an early somite stage.
[0589] As used herein, the term early somite refers to a synthetic embryo following the late gastrulation stage and prior to the neural tube closure stage and is characterized by the appearance of the somites and formation of the first organs.
[0590] According to specific embodiments, the early somite stage refers a synthetic embryo having characteristic of E8-9 of an in-utero natural mouse embryo or PFD18-24 of an in-utero natural a human embryo.
[0591] As used herein the phrase base medium refers to a liquid substance used to support the growth/survival of stem cells and/or synthetic embryos and optionally induce their development.
[0592] The medium (cell or embryo culture medium, aggregation medium etc.) used according to some embodiments of the invention can be a water-based medium which includes a combination of substances such as salts, nutrients, minerals, vitamins, amino acids, nucleic acids, and/or proteins such as cytokines, growth factors and hormones, all of which are needed for cell growth and embryo development.
[0593] Preferably, all ingredients included in the culture medium of the present invention are substantially pure, i.e., a tissue culture grade.
[0594] For example, the culture medium may comprise a base medium such as a synthetic tissue culture medium, e.g. DMEM, DMEM/F12 or advanced DMEM/F12 (can be commercially obtained from e.g. GIBCOR or Biological Industries), Neurobasal (Invitrogen 21103-049 or ThermoFisher 21103049); KO-DMEM (can be commercially obtained from e.g. GIBCO), CMRL (can be commercially obtained from e.g. GIBCO), TCM199 (can be commercially obtained from e.g. Sigma), StemPro (can be commercially obtained from e.g. Thermo Fisher Scientific), RPMI (can be commercially obtained from e.g. Biological Industries) or a combination thereof supplemented with the necessary additives as is further described herein.
[0595] Non-limiting examples of media than can be used with specific embodiments and specific stages of the disclosed methods are described in details in the Examples section which follows and in e.g. International Patent Application Publication No. WO2016/016894 and WO2014/174470, the contents or which are fully incorporated herein by reference.
[0596] Further, as the present inventors have identified novel culture media comprising specific factors which can be used to allow generation of trophectoderm- and extra embryonic primitive endodermal primed cells-primed cells and the development of a synthetic embryo (see the Examples section which follows), the present invention also envisages aspects related to media as described in the Examples section which follows, wherein components of the media are provided in concentrations of +20%.
[0597] According to specific embodiments, the base medium is devoid of phenol red.
[0598] According to a specific embodiment, the base medium comprises DMEM having the same components as the DMEM of GIBCO Cat. No. 11880.
[0599] According to a specific embodiment, the base medium comprises DMEM/F12 having the same components as the DMEM/F12 of GIBCO Cat. No. 12634-010.
[0600] According to a specific embodiment, the base medium comprises CMRL having the same components as the CMRL of GIBCOR Cat. No. 11530037.
[0601] According to a specific embodiment, the base medium comprises TCM199 having the same components as the TCM199 of Sigma Cat. No. M4530.
[0602] According to specific embodiments, the medium comprises serum or serum replacement.
[0603] According to specific embodiments, the medium comprises 10-80% 15-80%, 20-80%, 15-75%, or 20-75% [volume/volume (v/v)] serum or serum replacement.
[0604] According to specific embodiments, the medium comprises 15-60%, 15-40% or 15-30% (v/v) serum or serum replacement.
[0605] According to a specific embodiment, the medium comprises 20-40% or 20-30% (v/v) serum or serum replacement.
[0606] According to other specific embodiments, the medium comprises at least 20% (v/v) serum or serum replacement.
[0607] According to a specific embodiment, the medium comprises about 20% (v/v) serum or serum replacement.
[0608] According to a specific embodiment, the medium comprises about 30% (v/v) serum or serum replacement.
[0609] According to other specific embodiments, the medium comprises at least 30% (v/v) serum or serum replacement.
[0610] According to other specific embodiments, the medium comprises at least 35% (v/v), at least 40% (v/v), at least 45% (v/v), at least 50% (v/v), at least 55% (v/v), at least 60% (v/v), at least 65% (v/v), at least 70% (v/v) serum or serum replacement.
[0611] According to other specific embodiments, the medium comprises 40-80%, 50-80%, 60-80%, 70-80% (v/v) serum or serum replacement.
[0612] According to other specific embodiments, the medium comprises 70-80% (v/v) serum or serum replacement.
[0613] According to a specific embodiment, the medium comprises about 75% (v/v) serum or serum replacement.
[0614] According to a specific embodiment, the medium comprises increasing concentrations of serum or serum replacement throughout the culturing of the embryo.
[0615] According to a specific embodiment, the medium comprises at least 15% serum or serum replacement from the beginning until the embryo reaches an early post-implantation egg-cylinder or bilaminar disc stage and at least 30% serum or serum replacement thereafter.
[0616] The serum may be obtained from a rodent (e.g. rat, mouse) or a mammal (e.g. bovine, human).
[0617] According to specific embodiments, care should be taken that the serum (e.g. human serum) is devoid of any traces of hemolysis.
[0618] According to specific embodiments, the serum is obtained from an adult animal.
[0619] According to other specific embodiments, the serum is obtained from a fetal animal.
[0620] According to specific embodiments, the serum comprises a cord blood serum. Methods of obtaining cord blood serum (e.g. human cord blood serum) are well known in the art and are further described in the Examples section which follows.
[0621] According to specific embodiments, the serum comprises bovine serum (e.g. FCS).
[0622] According to specific embodiments, the serum comprises rat serum.
[0623] According to specific embodiments, the serum comprises human serum.
[0624] According to specific embodiments, the serum comprises human serum for at least part of the culturing.
[0625] According to specific embodiments, the human serum comprises umbilical cord serum (HCS).
[0626] According to other specific embodiments, the human serum comprises adult blood serum (HBS).
[0627] According to specific embodiments, the serum comprises rat serum and human serum.
[0628] According to specific embodiments, the ratio between the rat serum and the human serum in the medium is between 1:1-5:1 (v/v).
[0629] According to specific embodiments, the ratio between the rat serum and the human serum in the medium is between 1:1-3:1 (v/v).
[0630] According to specific embodiments, the ratio between the rat serum and the human serum in the medium is about 2:1 (v/v).
[0631] According to specific embodiments, the ratio between the rat serum and the human serum in the medium is 2:1 (v/v).
[0632] In some embodiments, optionally, the medium comprises knockout serum replacement (KSR) instead of an animal serum.
[0633] In some embodiments, optionally, the medium comprises knockout serum replacement (KSR) in addition to the animal serum e.g. the rat serum and the human serum.
[0634] In some embodiments, optionally, the KSR partially replaces one of either the human serum, the rat serum or partially replaces a quantity of both.
[0635] According to specific embodiments, the ratio between the serum and the base medium in the culture medium is between 1:0.5-10:1, 1:1-10:1 or 1:1-8:1 (v/v).
[0636] According to specific embodiments, the ratio between the serum and the base medium in the culture medium is between 1:1-5:1 (v/v).
[0637] According to specific embodiments, the ratio between the serum and the base medium in the culture medium is about 3:1 (v/v).
[0638] According to specific embodiments, the ratio between the serum and the base medium in the culture medium is 3:1 (v/v).
[0639] According to specific embodiments, the culture medium comprises 20-30% base medium, 40-60% rat serum and 20-30% human serum (v/v).
[0640] According to a specific embodiment, the culture medium comprises 25% base medium, 50% rat serum and 25% human serum (v/v).
[0641] According to specific embodiments, the serum is heat inactivated (e.g. in 55 C. 30-45 minutes).
[0642] According to specific embodiments, the serum is added to the medium just prior to use.
[0643] According to some embodiments of the invention, the medium can further include additional supplements including, but not limited to antibiotics (e.g., PEN-STREP), L-glutamine (e.g., GlutaMAX), sodium pyruvate, non-essential amino acids (NEAA), Insulin-Transferrin-Selenium-Ethanolamine (ITS-X), -Estradiol, progesterone, N-acetyl L-Cysteine, 3,3,5-Triiodo-L-thyronine sodium salt (T3), sodium lactate, glucose, serum replacement and/or HEPES.
[0644] According to some embodiments of the invention, the medium comprises N2 and B27.
[0645] According to specific embodiments, the medium comprises glucose.
[0646] According to specific embodiments, the medium comprises at least 1 mg/ml, at least 2 mg/ml, at least 3 mg/ml or at least 4 mg/ml glucose.
[0647] According to specific embodiments, the medium comprises at least 4 mg/ml, at least 5 mg/ml, at least 6 mg/ml, at least 7 mg/ml or at least 8 mg/ml glucose.
[0648] According to specific embodiments, the medium comprises 2-12 mg/ml glucose, 3-12 mg/ml glucose, 4-12 mg/ml glucose or 4-8 mg/ml glucose.
[0649] According to specific embodiments, the glucose is provided in the medium in a constant or increasing concentrations throughout the culturing.
[0650] Thus, according to specific embodiments, throughout the culturing there is no decrease in the glucose concentration provided in the medium throughout the culturing (e.g. while passing from one set of conditions to a following set of conditions).
[0651] According to specific embodiments, the culture medium is devoid of MATRIGEL.
[0652] According to specific embodiments, the conditions comprise replacement of at least half of the medium every 1-2 days of the culturing (e.g. in the static culture).
[0653] According to specific embodiments, the conditions comprise replacement of all the medium every 1-2 days of the culturing (e.g. in the dynamic culture).
[0654] According to specific embodiments, the culture is maintained under a hyperbaric pressure.
[0655] According to specific embodiments, the dynamic culture is maintained under a hyperbaric pressure.
[0656] According to specific embodiments, the roller culture is maintained under a hyperbaric pressure.
[0657] As used herein, the term hyperbaric pressure refers to a pressure greater than atmospheric pressure, wherein atmospheric pressure is generally regarded as 14.7 pounds per square inch (psi). Hence, wherein a specific hyperbaric pressure is indicated herein, it refers to the indicated pressure above the atmospheric pressure and not the value indicated per-se. For example, a hyperbaric pressure of 5 psi refers to a pressure of 19.7 psi, a hyperbaric pressure of 6.5 psi refers to a pressure of 21.2 psi and a hyperbaric pressure of 10.2 refers to a pressure of 24.7 psi.
[0658] According to specific embodiments, the hyperbaric pressure is more than 2.5 psi, more than 4 psi, more than 5 psi, more than 6 psi.
[0659] According to specific embodiments, the hyperbaric pressure is more than 5 psi.
[0660] According to specific embodiments, the hyperbaric pressure is less than 10.2 psi, less than 9 psi, less than 8 psi, less than 7 psi.
[0661] According to specific embodiments, the hyperbaric pressure is less than 10.2 psi.
[0662] According to specific embodiments, the hyperbaric pressure is more than 5 psi and less than 10.2 psi.
[0663] According to specific embodiments, the hyperbaric pressure is 6-7 psi.
[0664] According to specific embodiments, the hyperbaric pressure is 6.5 psi.
[0665] According to specific embodiments, the hyperbaric pressure is 0.1-0.5 psi.
[0666] According to other specific embodiments, the culture is maintained under atmospheric pressure.
[0667] According to specific embodiments, the static culture is maintained under atmospheric pressure.
[0668] According to specific embodiments, the culture is maintained in an atmosphere comprising a controlled level of O2, N.sub.2 and/or CO.sub.2.
[0669] According to specific embodiments, the culturing is effected in an atmosphere comprising 5% CO.sub.2.
[0670] According to specific embodiments, the culturing is effected in an atmosphere comprising 5-40% oxygen.
[0671] According to specific embodiments, the culturing is effected in an atmosphere comprising 5-30%, 5-25% or 5-21% oxygen.
[0672] According to specific embodiments, the culturing is effected in an atmosphere comprising 10-40%, 10-30% or 15-30% oxygen.
[0673] According to specific embodiments, the culturing is effected in an atmosphere comprising 15-30% oxygen.
[0674] According to specific embodiments, the culturing is effected in an atmosphere comprising 18-23% oxygen.
[0675] According to specific embodiments, the culturing is effected in an atmosphere comprising constant or increasing oxygen concentrations throughout the culturing.
[0676] Thus, according to specific embodiments, throughout the culturing there is no decrease in the oxygen concentration throughout the culturing (e.g. while passing from one set of conditions to a following set of conditions).
[0677] According to specific embodiments, in order to control the pressure and oxygen level in the culture the following fetal incubation system comprising a gas and pressure controller and a static and/or rotating incubator is used.
Exemplary Fetal Incubation System
[0678] Referring now to
[0679]
[0680]
Exemplary Gas and Pressure Controller
[0681] Referring now to
[0682]
Exemplary Gas Mixing Box
[0683] Referring now to
[0684]
Exemplary Incubator
[0685] In some embodiments, the incubator is a static incubator. In some embodiments, the incubator is a rotating incubator. In some embodiments, the incubator is a static incubator comprising a rotating module inside of it. In some embodiments, the static incubator comprises one or more temperature modulators configured to preserve the temperature inside the static incubator, including the rotating module allocated inside of it. In some embodiments, the temperatures inside the incubator are modulated to be from 4 C. to about 60 C. In some embodiments, the incubator is, for example, a precision incubator system (BTC01 model with gas bubbler kitby B.T.C. EngineeringCullum Starr Precision Engineering LtdUK).
[0686] Referring now to
[0687]
Exemplary Automated Fetal Incubation System
[0688] In some embodiments, the fetal incubation system as disclosed above, is connected to a master controller configured to perform automated actions according to predetermined protocols provided by a user. For example, a user programs the master controller to perform changes in the incubation chambers over a certain period of time. In some embodiments, the system will comprise electric valves overall the system, which will be activated/deactivated according to the programed protocols. In some embodiments, a potential advantage of utilizing automated systems is that it reduces the chances of human errors during the developments of the embryos. In some embodiments, optionally, the master controller provides periodic updates to a user to a PC or a mobile electronic device.
Exemplary General Information Related to the System
[0689] In general, a number of culture techniques have been proposed over the years since the 1930s by culturing the embryos in conventional static conditions, in rotating bottles on a drum (referred to as roller culture systems) or on circulator platforms. These platforms remain highly inefficient for embryos survival and are limited to short periods of time, as the embryos begin to display developmental anomalies as early as 24 hours after culture initiation. Thus, stable and efficient protocols for extended culturing of pre-gastrulating mouse embryos all the way until advanced organogenesis stages were developed and are disclosed herein. In some embodiments, some of cell culture supplements or biomechanical principles newly established in stem cell research, were tested to assess if they could be helpful for keeping embryos alive (e.g. hyperbaric chambers, synthetic sera). In some embodiments, the roller culture system on a drum is used and it is integrated with a customized and in house developed electronic gas regulation module 502 that allowed precise control not only of N.sub.2, O.sub.2 and CO.sub.2 levels with high sensitivity, but also allowed controlling the atmospheric pressure. In some embodiments, sequential increases in the oxygen levels every 24 hours, starting from 5% O2 at E7.5, 13% at E8.5, 18% at E9.5, and ending with 21% O.sub.2 at E10.5 were applied and were found to be most optimal for the robust outcome reported herein. Additionally, when necessary, an increase in oxygen levels reached 95%. In addition, in some embodiments, maintaining a hyperbaric pressure of about 6.5 psi was found also critical for normal and efficient development of the embryos.
[0690] In some embodiments, the samples are kept in a static incubator. In some embodiments, the samples are kept in a dynamic incubator, for example a rotating incubator. In some embodiments, the samples are kept first in a static incubator and then moved to a dynamic incubator, or vice versa. In some embodiments, the samples are kept in a static incubator comprising, for example a rotating incubator inside of it. In some embodiments, when kept in a dynamic incubator the samples are kept in rotating bottles on a drum (referred to as roller culture systems) or on circulator platforms.
[0691] In some embodiments, the embryos are kept on the rotating bottles culture unit inside a precision incubator system (For example the BTC01 model with gas bubbler kitby B.T.C. EngineeringCullum Starr Precision Engineering LtdUK) during all the time of culture. In some embodiments, a rotator culture method which provides continuous flow of oxygenating gas to cultures in rotating bottles was used and disclosed herein elsewhere (for example BTC Rotating Bottle Culture Unit BTC02 model by B.T.C. EngineeringCullum Starr Precision Engineering LtdUK). In some embodiments, the culture bottles (Glass Bottles (Small) BTC 03 and Glass Bottles (Large) BTC 04) are plugged into the hollow rotating drum. In some embodiments, gas flows along the axis and is distributed to the culture bottles by a baffle plate within the drum. In some embodiments, the system maintains a stable pH, when compared to other systems with sealed culture bottles. In some embodiments, the rotator is supplied complete with gas filter, bubbler and leads by the manufacturer. In some embodiments, the BTC Precision Incubator uses a thyristor-controlled heater and high flow-rate fan to give a highly stable and uniform temperature throughout the easily accessible working volume. In some embodiments, the incubator has a working volume 370350200 mm high which is accessed through a hinged top. In some embodiments, the heater element is rated at 750 Watts. In some embodiments, Bung (Hole) BTC 06 is used to seal the bottles and Bung (Solid) BTC 07 is used to seal the drum (B.T.C. EngineeringCullum Starr Precision Engineering LtdUK).
[0692] In some embodiments, in order to achieve constant O.sub.2 and CO.sub.2 levels in the culture medium throughout the incubation period, the incubator module is linked to the gas and pressure control unit 502 (model #-HannaLab1; assembled and sold by Arad Technologies LTD, Ashdod, Israel). In some embodiments, carbon dioxide and oxygen concentration are regulated by specific controllers located on the gas and pressure control unit 502. In some embodiments, a pressure controller allows control of the gas pressure between 5 to 10 psi (positive pressure over ambient external atmospheric pressure). In some embodiments, nitrogen, O.sub.2 and/or CO.sub.2 are then injected into the gas mixer box at pressure of 6.5 psi which was found as the optimal level. In some embodiments, the mixing of the gases in the gas box is homogeneous and mixed by a centrifugal mixer blower. In some embodiments, the gases are injected into the incubator by a pump that builds pressure and sufficiency according to the count of air bubbles created in a water bottle, which is under the control of a one-way flow meter. In some embodiments, the bubble rate (which indicates the speed of gas flowing into the bottles) is be adjusted as needed by the user. In some embodiments, gas flows through the inlet into the water bottle, and the speed of gas flowing into the bottle is controlled with a valve. In some embodiments, humidified gas circulates to a glass test tube and then to the inside of the bottles in the rotating drum. In some embodiments, gas flow speed is monitored by the rate of bubbles created inside an outlet water-filled test tube. In some embodiments, the bottles with the samples are placed on the rotating bottle culture system, rotating at 30 revolutions per minute at 37 C., and continuously gassed with an atmosphere of, for example 5% O.sub.2, 5% CO.sub.2 at 6.5 pounds per square inch (psi), or for example 5% O.sub.2, 5% CO.sub.2 at 0.1 pounds per square inch (psi), or for example with a gas mixture of 13% O.sub.2, 5% CO.sub.2, or for example in a gas atmosphere of 18% O.sub.2 and 5% CO.sub.2, or for example with a gas supply of 21% O.sub.2 and 5% CO.sub.2. In some embodiments, for media exchange, culture media is pre-heated for at least an hour by placing it inside a glass bottle on the rotating culture with an adequate gas atmosphere depending on the stage of the cultured embryos.
Exemplary Methods Related to the Fetal Incubation System
[0693] Referring now to
[0694] According to specific embodiments, the methods further comprise isolating a cell, tissue or organ from the embryo following the culturing.
[0695] Non-limiting examples of such cells include stem cells [for example, but not limited to, embryonic stem cells, mesenchymal stem cells, neural stem cells, hematopoietic stem cells], blood cells, liver cells, insulin secreting pancreatic beta cells, muscle cells, lung epithelial cells, endothelial cells, glial cells.
[0696] These cells, tissue or organs may be used for example as a cell-based therapy, tissue replacement, organ or tissue implantation or for research purposes.
[0697] According to other specific embodiments, the methods further comprise transferring the synthetic embryo in-utero.
[0698] The established methods of generating synthetic embryos and methods and systems for culturing them ex utero as described herein may be further combined with e.g. genetic modification, chemical screens, tissue manipulation and microscopy methods and may constitute a powerful tool in basic research e.g. as a framework to investigate the emergence of cellular diversity, cell fate decisions and how tissues and organs emerge from a single totipotent cell; as well as a source of cells, tissue and organs for transplantation, generation of chimeric embryos, testing the effect of drugs on embryonic development (e.g. teratogenic effect) etc. Such methods are known in the art.
[0699] Thus, according to specific embodiments, the method comprises manipulating the synthetic embryo or the subpopulations of cells described herein.
[0700] According to specific embodiments, manipulating comprises introducing into the cells or the embryo a gene of interest.
[0701] According to specific embodiments, manipulating comprises introducing into the cells or embryo a polynucleotide of interest.
[0702] According to specific embodiments, manipulating comprises introducing into the cells or embryo a genome editing or RNA silencing agent.
[0703] According to specific embodiments, the manipulating comprises producing an embryo incompatible with life. Thus, for example, the manipulation may comprise knocking a selected gene to selectively perturb a certain organ, thus making the embryo with limited developmental potential and not being able to sustain viability, e.g. headless (e.g. deletion of Mesp1 or NKX2-5) or heartless (e.g. deletion of Lim1), as further described in the Examples section which follows.
[0704] Thus, according to specific embodiments, the manipulating comprises introducing into the embryo a polynucleotide rendering an embryo incompatible with life.
[0705] Methods of designing, expressing and introducing a polynucleotide of interest such that it will be expressed in a cell of interest are well known in the art and further described herein above and below.
[0706] According to specific embodiments manipulating comprises microinjecting cells into the embryo to thereby obtain a chimeric embryo.
[0707] As used herein, the phrase chimeric embryo refers to an animal comprising cells of at least two genetically distinct individuals.
[0708] It is noted that the chimeric embryo can be composed of cells of two different individuals belonging to two different species, or to the same species.
[0709] According to some embodiments of the invention, the cells are allogeneic to the embryo.
[0710] According to some embodiments of the invention, the cells are xenogeneic to the embryo.
[0711] As used herein, the term xenogeneic refers to at least two individuals of different species.
[0712] According to specific embodiments, the cells are stem cells [for example, but not limited to, embryonic stem cells, mesenchymal stem cells, neural stem cells, hematopoietic stem cells, induced pluripotent stem cells (iPS)].
[0713] According to some embodiments of the invention, introducing the cells is performed ex vivo via direct injection or aggregation with the developing embryo.
[0714] According to specific embodiments, the manipulating comprises introducing into the cells or the embryo a drug of interest.
[0715] According to specific embodiments, the methods further comprise determining an effect of the manipulating on development of the embryo.
[0716] According to specific embodiments, any of the genes, polynucleotides, proteins, polypeptides and/or proteinaceous moieties described herein may have a sequence of a human gene, polynucleotide, protein, polypeptide and/or proteinaceous moiety or a functional fragment or homolog thereof which exhibit the desired activity as described herein.
[0717] According to specific embodiments, the gene, polynucleotide, protein, polypeptide and/or proteinaceous moiety is of a human origin.
[0718] According to other specific embodiments, the gene, polynucleotide, protein, polypeptide and/or proteinaceous moiety is a homolog of a human gene, polynucleotide, protein, polypeptide and/or proteinaceous moiety. Such homologues can be, for example, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identical or homologous to the human sequence.
[0719] As used herein the term about refers to +10%.
[0720] The terms comprises, comprising, includes, including, having and their conjugates mean including but not limited to.
[0721] The term consisting of means including and limited to.
[0722] The term consisting essentially of means that the composition, method or structure may include additional ingredients, steps and/or parts, but only if the additional ingredients, steps and/or parts do not materially alter the basic and novel characteristics of the claimed composition, method or structure.
[0723] As used herein, the singular form a, an and the include plural references unless the context clearly dictates otherwise. For example, the term a compound or at least one compound may include a plurality of compounds, including mixtures thereof.
[0724] Throughout this application, various embodiments of this invention may be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 3, 4, 5, and 6. This applies regardless of the breadth of the range.
[0725] Whenever a numerical range is indicated herein, it is meant to include any cited numeral (fractional or integral) within the indicated range. The phrases ranging/ranges between a first indicate number and a second indicate number and ranging/ranges from a first indicate number to a second indicate number are used herein interchangeably and are meant to include the first and second indicated numbers and all the fractional and integral numerals therebetween.
[0726] As used herein the term method refers to manners, means, techniques and procedures for accomplishing a given task including, but not limited to, those manners, means, techniques and procedures either known to, or readily developed from known manners, means, techniques and procedures by practitioners of the chemical, pharmacological, biological, biochemical and medical arts.
[0727] When reference is made to particular sequence listings, such reference is to be understood to also encompass sequences that substantially correspond to its complementary sequence as including minor sequence variations, resulting from, e.g., sequencing errors, cloning errors, or other alterations resulting in base substitution, base deletion or base addition, provided that the frequency of such variations is less than 1 in 50 nucleotides, alternatively, less than 1 in 100 nucleotides, alternatively, less than 1 in 200 nucleotides, alternatively, less than 1 in 500 nucleotides, alternatively, less than 1 in 1000 nucleotides, alternatively, less than 1 in 5,000 nucleotides, alternatively, less than 1 in 10,000 nucleotides.
[0728] It is appreciated that certain features of the invention, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable subcombination or as suitable in any other described embodiment of the invention. Certain features described in the context of various embodiments are not to be considered essential features of those embodiments, unless the embodiment is inoperative without those elements.
[0729] Various embodiments and aspects of the present invention as delineated hereinabove and as claimed in the claims section below find experimental support in the following examples.
EXAMPLES
[0730] Reference is now made to the following examples, which together with the above descriptions illustrate some embodiments of the invention in a non limiting fashion. Generally, the nomenclature used herein and the laboratory procedures utilized in the present invention include molecular, biochemical, microbiological and recombinant DNA techniques.
Example 1
Aggregation of Mouse Nave PSCs, TSCs and XENs does not Generate an Organized Embryo
Materials and Methods
[0731] Embryo derived Mouse TSC line #1 (mTSC #1)was established according to previously described classical protocols (doi: 10.1126/science.282.5396.2072). Briefly, TSCs were derived from E3.5 blastocysts flushed from the uterus of 5-weeks-old female CD1 mouse. The blastocysts were cultured on mitotically inactivated mouse MEF cells (feeder cells) with TSC culture medium: advanced RPMI 1640 (11875-093 Thermo Fisher Scientific or RPMI (Invitrogen) supplemented with 15-20 (v/v) FBS (Gibco, ES cell qualified; or Biological Industries), 1 GlutaMAX (35050061, Thermo Fisher Scientific; or Invitrogen), 0.1 mM -mercaptoethanol (21985-023, Thermo Fisher Scientific; or Sigma), 1 mM sodium pyruvate (11360070, Thermo Fisher Scientific), 1% (v/v) penicillin-streptomycin (15140122, Thermo Fisher Scientific; or Biological Industries), 25 ng/ml recombinant human FGF4 (235-F4-025, R&D; or Peprotech), 1 g/ml heparin (07980, Stem Cell; or Sigma) and 1 nonessential amino acids (Biological Industries). 25 ng/ml of FGF2 (Peprotech) was optionally added. DMEM can also be used instead of RPMI as typically practiced before in the field for making stable TSC lines. Until the outgrowth formed on day 4, the cells were subsequently disaggregated by incubated in 0.1% trypsin-EDTA for 5 minutes in the incubator. Mouse 70% embryonic fibroblast-conditioned medium containing FGF4 and heparin was added to stop the reaction and cells were returned to the incubator. Medium was replaced every other day until TS cell colonies were be observed (not before day 14-passage 3), and following the medium was changed to a TSC culture medium to maintain the cells. Immunostaining for TSC markers Cdx2, Gata3, TBR2, and TFAP2C and lack of Oct4 and Nanog pluripotency markers, confirmed TSC identity of this representative TSC line (
[0732] Mouse ES derived Mouse TSC line #2 (mTSC #2)was derived as previously established (PMID: 10742100) by inhibition of Oct4 together with transferring the cells in TSC media detailed above in mTSC #1. Briefly, the ZHBTC4 mouse ES line was used in which DOX induces inhibition of Oct4 shut down (Tet-off), and was passaged in TSC media together with DOX (PMID: 10742100). Immunostaining showed that while the parental ESC line is positive for the Oct4 pluripotency marker and negative for Cdx2 and Gata3 TSC markers (
[0733] Mouse ES derived Mouse TSC line #3 (mTSC #3)was derived as previously established (www(dot)doi(dot)org/10 (dot)1016/j(dot)cell(dot)2005(dot)08(dot)040) by transient overexpression of Cdx2 in mouse ESCs expanded in semi-primed FBS/LIF conditions with transferring the cells in TSC media detailed above in mTSC #1. Specifically, a previously described ICR mouse ES line (PMID: 19427283) was used in which Cdx2 was transiently transfected, and was passaged in TSC media. Following, TSC colonies were picked, passaged and validated. Immunostaining for TSC markers Cdx2 and Gata3 confirmed TSC identity of this representative TSC line (
[0734] Mouse XEN line #7 (XEN-ICR clone #7)was established according to previously described classical protocols (doi: 10.1071/rd06125). Briefly, XEN cells were derived from E3.5 blastocysts flushed from the uterus of 5-weeks-old female ICR mouse using modified XEN conditions. Mouse blastocysts were cultured on feeder cells until they formed an outgrowth on day 4 that was subsequently disaggregated by incubation in 0.1% trypsin-EDTA for 5 minutes in the incubator. Fresh mouse ES (FBS-LIF based) was added to stop the trypsin reaction, and was replaced the medium every other day until XEN cell colonies could be observed. Following, XEN cell colonies were picked and maintained as lines with a standard XEN medium: advanced RPMI 1640 (11875-093, Thermo Fisher Scientific) or RPMI1640 (Gibco 11875085) supplemented with 15% (v/v) FBS (Gibco or Biological Industries) and 0.1 mM -mercaptoethanol (21985-023, Thermo Fisher Scientific or Sigma), 1 Glutamax (Invitrogen), 1% penicillin-streptomycin (15140122, Thermo Fisher Scientific; or Biological Industries), 1 nonessential amino acids (Biological Industries) and 1 mM Sodium-pyruvate (BI 03-042-1B). It required at least 15 days and 3 passages to be able to establish individual early passage mouse XEN lines, as previously described (doi: 10.1071/rd06125). Immunostaining of early passage mouse XEN line clone 7 at passage 5, validated loss of the pluripotency markers Oct4 and Nanog as expected, and expression of the XEN markers Foxa2 and Gata4 (
[0735] Mouse XEN line XEN-Prep1was established as described for XEN line #7 (side by side). Real-time PCR analysis demonstrated upregulation of expression of the XEN markers Gata6, PDGFRA, Sox17 and Gata4 (
[0736] Mouse nave pluripotent stem cells (nave PSCs) line-Pluripotent V6.5 GFP labeled mouse ES line (PMID: 19427283) was maintained and expanded in serum-free chemically defined N2B27-based media: 240 ml Neurobasal (ThermoFisher 21103049) and 240 ml of DMEM-F12 with HEPES (SIGMA D6421), 5 ml N2 supplement (Invitrogen; 17502048), 5-10 ml B27 supplement (Invitrogen; 17504044), 2 mM glutamine or 1 mM GLutamax (Invitrogen), 1% nonessential amino acids (Invitrogen), 0.1 mM -mercaptoethanol (Sigma), 1% penicillin-streptomycin (Invitrogen). Optionally, the medium also included 5 mg/ml BSA (Sigma). Nave 2i/LIF conditions for murine PSCs included 20 ng/ml recombinant human LIF (in-house made). Where indicated 2i was added: small-molecule inhibitors CHIR99021 (CH, 3 MAxon Medchem) and PD0325901 (PD, 1 MAxon Medchem 1408).
[0737] KH2-Gata4 Dox inducible cells (KH2-GATA4)-KH2-WT cell line is a v6.5 mouse ES line in which the Rosa26 locus was targeted to express M2Rtta, and the Cola1 Locus was modified to be receptive to a plasmid with TetOn promoter (PMID: 16400644) and an insert (in this case Gata4 gccctttttgggtttttgttttttttttttttttgatttttggtgacagttccgcacacccgcattctagttcttgtctgcctcgtgctcagagcttgg ggcgatgtaccaaagcctggccatggccgccaaccacggccccccgcccggcgcctacgaagcaggtggccctggcgccttcatgcac agcgcgggcgccgcgtcctcgcccgtctacgtgcccactccgcgggtgccgtcctctgtgctgggcctgtcctacctgcagggcggtggc agtgccgctgcagctggaaccacctcgggtggcagctccggggccggcccgtcgggtocagggcctgggacccagcagggtagccct ggctggagccaagctggagccgagggagccgcctacaccccgccgcccgtgtccccgcgcttctctttcccggggactactgggtccct ggcggccgctgccgccgctgccgcagcccgggaagctgcagcctacggcagtggcggcggggcggcgggcgctggtctggctggcc gagagcagtacgggcgtccgggcttcgccggctcctactccagcccctacccagcctacatggccgacgtgggagcatcctgggccgca gccgctgccgcctctgccggccccttcgacagcccagtcctgcacagcctgcctggacgggccaaccctggaagacaccccaatctcgt agatatgtttgatgacttctcagaaggcagagagtgtgtcaattgtggggccatgtccaccccactctggaggcgagatgggacgggacac tacctgtgcaatgcctgtggcctctatcacaagatgaacggcatcaaccggcccctcattaagcctcagegccgcctgtccgcttcccgccg ggtaggcctctcctgtgccaactgccagactaccaccaccacgctgtggcgtcgtaatgccgagggtgagcctgtatgtaatgcctgcggc ctctacatgaagctccatggggttcccaggcctcttgcaatgcggaaggaggggattcaaaccagaaaacggaagcccaagaacctgaat aaatctaagacgccagcaggtcctgctggtgagaccctccctccctccagtggtgcctccagcggtaactccagcaatgccactagcagca gcagcagcagtgaagagatgcgccccatcaagacagagcccgggctgtcatctcactatgggcacagcagctccatgtcccagacattca gtactgtgtccggccacgggccctccatccatccagtgctgtctgctctgaagctgtccccacaaggctatgcatctcctgtcactcagacat cgcaggccagctccaagcaggactcttggaacagcctggtcctggctgacagtcatggggacataatcaccgcgtaatcagegcccccc cttccctcttcaaattcctgctcggacttgggacgtgggggccagcaaagtaaaaggctgggaagggc; SEQ ID NO: 1) which can be flipped in the collagen locus. Targeted colonies were subjected to hygromycin selection of 10 days, and individual ES colonies were selected for further analysis to generate KH2-Gata4 that overexpress Gata4 upon DOX addition (
[0738] Aggregation media (AM)240 ml Neurobasal (ThermoFisher 21103049) and 240 ml of DMEM-F12 (Thermo 21331-020 or SIGMA D6421), 5 ml N2 supplement (Invitrogen; 17502048), 10 ml B27 supplement (Invitrogen; 17504044), 2 mM glutamine or 1 GLutamax (Invitrogen), 1 nonessential amino acids (NEAA) (Invitrogen), 0.1 mM -mercaptoethanol (GIBCO 31350-010), 1 penicillin-streptomycin (Invitrogen), 0.45% BSA (Sigma A7979), 1% Sodium-pyruvate (BI 03-042-1B). When indicated, serum was added to aggregation media at the indicated percentage and origin.
[0739] IVC1 mediaAdvanced DMEM/F12 (Gibco 12634010) supplemented with Glutamax 1, Pen/Strep 1, ITS-X 1 (Gibco 51500056), beta-Estradiol 8 nM, Progesterone 20 ng/ml, N-acetyl-L-cysteine 25 M and FBS or HAS as indicated.
[0740] EUCM media (also referred to as EUCM1)25% DMEM (GIBCO 11880) or Advanced DMEM/F12 (Thermo 12634010), 25% HAS (Human Adult Serum or Human umbilical cord serum), 50% Rat Serum (RAS), Glutamax 1 (GIBCO 35050038), HEPES 11 mM (GIBCO 15630056), Pen/Strep 1. When indicated, the media was further supplemented with D-Glucose 4-12 mg/ml, sodium pyruvate 1 mM and/or non-essential amino acids (NEAA 1). DMEM aliquots were stored at 4 C. and used within 2 months. Rat serum was stored at 80 C. and heat inactivated at 56 C. for half an hour and filtered through a 0.22 m PVDF filter (Millipore: SLGV033RS) prior to use. HAS should be freshly thawed and used immediately before experimentation. Rat serum and HAS can be thawed/frozen once.
[0741] Aggregation plate preparationTo prepare the 24 well AggreWell 400 plate (STEMCELL Technologies 34415) or AggreWell 800 plate (STEMCELL Technologies), 500 ml of anti-adherence rinsing solution (STEMCELL Technologies 07010) was added to each well. The plate was then centrifuged at 2,000g for 5 minutes and was incubated for 30 minutes at room temperature. Anti-adherence Rinsing solution (Stem Cell Technologies#07010) was then aspirated from the well and 1 ml of PBS/ was added to wash each well, and this PBS wash was repeated twice. The 500 ml of aggregation medium (AM) was added to each well after aspirating the PBS.
[0742] Co-aggregation and culture (
[0746] Cells were trypsinised with 0.05% trypsin-EDTA for 3-5 minutes followed by feeder depletion on gelatinized plates for 20 minutes at 37 C. (when MEFs were used). Following, cells were resuspended in aggregation media (AM) supplemented with Doxycycline (2 g/ml final concentration). Following cell count, a total number of 18000 TSCs, 6000 XEN and 6000 v6.5-GFP WT cells were added per well in an AggreWell 400 Microwell 24 well plate. In 800 Microwell plates a total number of 4500 TSCs, 1500 XEN and 1500 V6.5 GFP cells were added per well in an AggreWell 24 well. The cell mixture was added as 1 ml per well (final volume of each well of 24 well is 1.5 ml), 25 cells/well. [0747] Day 0The plate was centrifuged at 100g for 3 minutes and this was marked as day 0, and then placed into static incubator at 37 C., 5% Co2 and 20% O2. [0748] On Day 1, 1 ml of media was gently aspirated from each well and replaced with pre-warmed 1 ml of fresh AM+20% PBS+DOX as indicated in
[0755] Co-aggregation and culture (
[0759] Cells were trypsinised with 0.05% trypsin-EDTA for 3-5 minutes followed by feeder depletion on gelatinized plates for 20 minutes at 37 C. (when MEFs were used). Following, cells were re-suspended in aggregation media (AM) supplemented with Doxycycline (2 g/ml final concentration). Following cell count, a total number of 18000 TSCs, 6000 KH2-GATA4 and 6000 V6.5-GFP nave ES cells were added per well in AggreWell 400 Microwell 24 well plate. In 800 Microwell plates a total number of 4500 TSCs, 1500 KH2-GATA4 and 1500 V6.5 GFP WT cells were added per well in AggreWell 24 well. The cell mixture was added as 1 ml per well (final volume of each well of 24 well is 1.5 ml), 25 cells/well. [0760] Day 0The plate was centrifuged at 100g for 3 minutes and this was marked as day 0, and then placed into static incubator at 37 C., 5% Co2 and 20% O2. [0761] On Day 1, 1 ml of media was gently aspirated from each well and replaced with pre-warmed 1 ml of fresh AM+20% FBS+DOX, as indicated in
[0768] Whole-mount immunostaining of embryosEmbryos grown ex utero were dissected (with or without removing the yolk sac and amnion for E8.5 embryos), washed once with 1PBS, then transferred to ibidi glass bottom 8-well slides (iBidi) and fixed with 4% PFA EM grade (Electron microscopy sciences, 15710) in PBS at 4 C. over-night. Embryos were then washed in PBS for 5 minutes 3 times, permeabilized in PBS with 0.5% Triton X-100/0.1 M glycine for 30 minutes, blocked with 10% normal donkey serum/0.1% Triton X-100 in PBS for 1 hour at room temperature (RT), and incubated over-night at 4 C. with primary antibodies, diluted in blocking solution. After, embryos were rinsed 3 times for 5 minutes each in PBS/0.2% TritonX-100, incubated for 2 hours at room temperature with secondary antibodies diluted 1:200 in blocking solution (all secondary antibodies were from Jackson ImmunoResearch), counterstained with DAPI (1 g/ml in PBS) for 10 minutes, and washed with PBS for 5 minutes 3 times. If necessary, yolk sacs separated from the embryos were fixed and stained using this whole-mount immunostaining protocol. The following primary antibodies were used: Rabbit monoclonal anti-Brachyury (Cell Signaling, 81694) 1:100; Rabbit polyclonal anti-Cdx2 (Cell Signaling, 3977) 1:100; Mouse monoclonal anti-Cdx2 (Biogenex, AU392A-UC) 1:100; Goat polyclonal anti-Gata4 (Santa Cruz, SC-1237) 1:100; Rabbit polyclonal anti-Gata4 (Abcam, Ab84593) 1:100; Rabbit polyclonal anti-Foxa2 (Abcam, Ab40874) 1:100; Mouse monoclonal anti-Myosin Heavy Chain II (MF-20) (R&D, MAB4470) 1:100; Goat polyclonal anti-Otx2 (R&D, AF1979) 1:200; Rabbit polyclonal anti-Pax6 (Covance, PBR-278P) 1:100; Goat polyclonal anti-Sox2 (R&D, AF2018) 1:200; Rabbit polyclonal anti-Sox9 (Millipore, AB5535) 1:100; Goat polyclonal anti-Sox17 (R&D, AF1924) 1:100; Mouse monoclonal anti-Tuj1 (C-10) (Covance, MMS-435P) 1:200; Chicken polyclonal anti-GFP (Abcam, Ab13970) 1:250; Mouse monoclonal anti-Oct4 (Santa Cruz, SC-5279) 1:100; Goat polyclonal anti-Lefty 1 (R&D, AF746) 1:100, Goat polyclonal anti-mCherry/Tomato (SiCGEN, AB0040-200) 1:200.
[0769] Clearing of embryos from E9.5 to E11.5 was performed as follows: embryos were washed once with 1PBS and fixed overnight at 4 C. with 4% PFA EM grade diluted in PBS. Samples were washed in PBS for 5 minutes three times, followed by sample pre-treatment without methanol, i.e.: Washed in PBS/0.2% TritonX-100 for 1 hour twice, then incubated in PBS/0.2% TritonX-100/20% DMSO at 37 C. overnight, then in PBS/0.1% Tween-20/0.1% TritonX-100/0.1% Deoxycholate/0.1% NP40/20% DMSO at 37 C. overnight, then washed in PBS/0.2% TritonX-100 for 1 hour twice. For immunostaining, embryos were permeabilized in PBS/0.2% TritonX-100/20% DMSO/0.3 M glycine at 37 C. overnight, and then blocked in PBS/0.2% TritonX-100/10% DMSO/6% Donkey Serum at 37 C. overnight. After blocking, embryos were incubated with primary antibodies diluted in PBS/0.2% Tween-20 with 10 g/ml heparin (PTwH)/5% DMSO/3% Donkey Serum at 37 C. [E9.5/E10.5=24 hours; E11.5=48 hours (72 hours for Sox17 and Foxa2 antibodies)]. Afterwards, samples were washed in PTwH for 24 hours (15 minutes, 30 minutes, 1 hour, 2 hours, and overnight washes), and incubated with adequate secondary antibodies (1:200) diluted in PTwH/3% Donkey Serum at 37 C. for 48 hours.
[0770] For human cell specific NUMA staining (when used), donkey anti-rabbit Biotin and Streptavidin-Cy3 (each incubated overnight) were used for signal enhancement. After, embryos were incubated for 30 minutes with DAPI (1 g/ml) diluted in PTwH, washed in PTwH for one day (5 minutes, 15 minutes, 30 minutes, 1 hour, 2 hours, and overnight washes) and dehydrated in methanol/H.sub.2O series (20%, 40%, 60%, 80%, 100%) 1 hour each at room temperature, and then incubated overnight in 100% methanol. Embryos were incubated in 66.6% DCM/33.3% methanol at room temperature on shaker for 3 hours, followed by 100% DCM (Sigma; 270997) for 5 minutes, and finally cleared and stored in Benzyl Ether (Sigma: 108014). The following primary antibodies were used: Rabbit monoclonal anti-Brachyury (Cell Signaling, 81694) 1:100; Rabbit polyclonal anti-Cdx2 (Cell Signaling, 3977) 1:100; Mouse monoclonal anti-Cdx2 (Biogenex, AU392A-UC) 1:100; Goat polyclonal anti-Gata4 (Santa Cruz, SC-1237) 1:100; Rabbit polyclonal anti-Gata4 (Abcam, Ab84593) 1:100; Rabbit polyclonal anti-Foxa2 (Abcam, Ab40874) 1:50; Mouse monoclonal anti-Myosin Heavy Chain II (MF-20) (R&D, MAB4470) 1:100; Goat polyclonal anti-Otx2 (R&D, AF1979) 1:200; Rabbit polyclonal anti-Pax6 (Covance, PBR-278P) 1:100; Goat polyclonal anti-Sox2 (R&D, AF2018) 1:200; Rabbit polyclonal anti-Sox9 (Millipore, AB5535) 1:100; Goat polyclonal anti-Sox17 (R&D, AF1924) 1:50; Mouse monoclonal anti-Tuj1 (C-10) (Covance, MMS-435P) 1:200; Chicken polyclonal anti-GFP (Abcam, Ab13970) 1:250, Goat polyclonal anti-mCherry/Tomato (SiCGEN, AB0040-200) 1:200; Rabbit polyclonal anti-human TEMEM119 (Invitrogen, PA562505) 1:100; Rabbit anti-hNUMA (Abcam, ab84680) 1:100.
[0771] Confocal MicroscopyImages were acquired with a Zeiss LSM 700 inverted confocal microscope (Carl Zeiss) equipped with 405 nm, 488 nm, 555 nm and 635 nm solid state lasers, using a Plan-Apochromat 20 air objective (numerical aperture 0.8) for E5.5/E6.5 embryos, and an EC Plan Neofluar 10 air objective (numerical aperture 0.3) for E7.5 to E11.5 embryos. Images were acquired at 10241024 resolution. All images were acquired within the following range of parameters: Laser power: 405 nm: 10-20%; 488 nm: 5-20%; 555 nm 10-40%; 635 nm: 30-80%. Gain ranged from 350 to 600. Pixel size was 1.25 m with a z-step of 15 m when using the 10 objective, or 0.5 m with z-step of 5 m when using the 20 objective. For confocal imaging, iDISCO cleared embryos were mounted in 35 mm glass bottom dishes (In Vitro Scientific, D35201.5N), employing ethyl cinnamate (Sigma, 112372) as imaging solution. For chimeric embryos, all parameters during image acquisition were compared to stained non-injected control embryos, imaged with equal parameters as the injected embryos. Images and maximum intensity projections were processed using Zen 2 blue edition software 2011 (Carl Zeiss) and Adobe Photoshop CS4.
[0772] Immunostaining of ES, TSC and XEN cell lines-Cells were grown on glass cover slips (13 mm 1.5H; Marienfeld, 0117530) fixed with 4% paraformaldehyde/phosphate buffer for 10 minutes at room temperature, washed three times with PBS, and permeabilized in PBS/0.1% Triton for 10 minutes. Cells were blocked with blocking solution (2% normal goat serum, 0.1% BSA in PBS/0.05% Tween) for 1 hour at RT and incubated with primary antibody diluted in blocking solution overnight at 4 C. (Antibodies in this study have all been validated in the literature and by ourselves). Cells were then washed three times with PBS/0.05% Tween, incubated with secondary antibodies for 1 hour at room temperature, washed in PBS/0.05% Tween, counterstained with DAPI (1 g/ml), washed again three times with PBS/Tween 0.05% and mounted with Shandon Immu-Mount (Thermo Scientific, 9990412), and imaged. All comparative experiments were done simultaneously. All secondary antibodies were used from Jackson ImmunoResearch.
[0773] Real-Time PCR analysisFor RT-PCR total RNA was isolated using Trizol (Ambion Life Technologies), and 1 g of total RNA was reverse transcribed using High-Capacity Reverse Transcription Kit (Applied Biosystems). Quantitative PCR analysis was performed with the SYBR Green PCR Master Mix (Applied Biosystems) using 10 ng of cDNA per reaction in a Viia7 platform (Applied Biosystems). Fold change was normalized to Gapdh and/or Actin expression as indicated per figure. The following primers were used:
TABLE-US-00001 MouseGapdh-Forward: (SEQIDNO:2) AGTCAAGGCCGAGAATGGGAAG; MouseGapdh-Reverse: (SEQIDNO:3) AAGCAGTTGGTGGTGCAGGATG MouseOct4-Forward: (SEQIDNO:4) AGAGGATCACCTTGGGGTACA; MouseOct4-Reverse: (SEQIDNO:5) CGAAGCGACAGATGGTGGTC; MouseNanog-Forward: (SEQIDNO:6) CTCAAGTCCTGAGGCTGACA; MouseNanog-Reverse: (SEQIDNO:7) TGAAACCTGTCCTTGAGTGC; MouseSox2-Forward: (SEQIDNO:8) TAGAGCTAGACTCCGGGCGATGA; MouseSox2-Reverse: (SEQIDNO:9) TTGCCTTAAACAAGACCACGAAA; MouseKlf4-Forward: (SEQIDNO:10) GCACACCTGCGAACTCACAC; MouseKlf4-Reverse: (SEQIDNO:11) CCGTCCCAGTCACAGTGGTAA; MouseCdx2-Forward: (SEQIDNO:12) GCGAAACCTGTGCGAGTGGATG; MouseCdx2-Reverse: (SEQIDNO:13) CGGTATTTGTCTTTTGTCCTGGTTTTCA; MouseGata4-Forward: (SEQIDNO:14) CACAAGATGAACGGCATCAACC; MouseGata4-Reverse: (SEQIDNO:15) CAGCGTGGTGGTAGTCTG; MouseGata6-Forward: (SEQIDNO:16) CTTGCGGGCTCTATATGAAACTCCAT; MouseGata6-Reverse: ((SEQIDNO:17) TAGAAGAAGAGGAAGTAGGAGTCATAGGGACA; MouseBrachyury(T)-Forward: (SEQIDNO:18) CTGTGACTGCCTACCAGAATGAGGAG; MouseBrachyury(T)-Reverse: (SEQIDNO:19) GGTCGTTTCTTTCTTTGGCATCAAG; MouseOtx2-Forward: (SEQIDNO:20) CTTCGGGTATGGACTTGCTG MouseOtx2-Reverse: (SEQIDNO:21) CCTCATGAAGATGTCTGGGTAC; MouseFgf5-Forward: (SEQIDNO:22) CAAAGTCAATGGCTCCCACGAAG; MouseFgf5-Reverse: (SEQIDNO:23) CTACAATCCCCTGAGACACAGCAAATA; Total(endogenous+exogenous) mouseGata4Forward: (SEQIDNO:24) CCAGTGCTGTCTGCTCTGAA; Total(endogenous+exogenous) mouseGata4Reverse: (SEQIDNO:25) GCTGTTCCAAGAGTCCTGCT; Total(endogenous+exogenous) mouseCdx2Forward: (SEQIDNO:26) GCGAAACCTGTGCGAGTGGATG; Total(endogenous+exogenous) mouseCdx2Reverse: (SEQIDNO:27) CGGTATTTGTCTTTTGTCCTGGT; ExogenousmouseGata4Forward: (SEQIDNO:28) AAATTCCTGCTCGGACTTGGGAC; ExogenousmouseGata4Reverse: (SEQIDNO:29) GTGGTTTGTCCAAACTCATCAATGTATCTT; ExogenousmouseCdx2Forward: (SEQIDNO:30) GAGGGGTTTTAAACTCCACTGTCACC; ExogenousmouseCdx2Reverse: (SEQIDNO:31) GTGGTTTGTCCAAACTCATCAATGTATCTT; EndogenousmouseGata4Forward: (SEQIDNO:32) CACTGGAAAAGCCTGCGTTCTTACA; EndogenousmouseGata4Reverse: (SEQIDNO:33) AGAATAAGGAAGGAAGAAGTCTCTTGCCTC; EndogenousmouseCdx2Forward: (SEQIDNO:34) AATTATGGACCTCAGGGGAAGACATG; EndogenousmouseCdx2Reverse: (SEQIDNO:35) GCTGGCAGGAAGAGTCGGAATG.
Results
[0774] Co-aggregation of three starting cell types, namely a nave mouse PSCs (V6.5-GFP), mouse XEN cells [mouse XEN line #7 cells or KH2-Gata4 Dox inducible cells) and mouse TSCs (mouse TSC line #1 cells) followed by ex-utero culturing (
Example 2
[0775] Aggregation of Three Mouse Nave PSCs Subpopulations Generates an Organized Embryo
Materials and Methods
[0776] Mouse nave pluripotent stem cells (nave PSCs) lineAs described in Example 1 hereinabove.
[0777] KH2-Gata4 Dox inducible nave pluripotent stem cells (KH2-GATA4)As described in Example 1 hereinabove.
[0778] KH2-Cdx2 Dox inducible nave pluripotent stem cells (KH2-Cdx2)As noted hereinabove, KH2-WT cell line is a v6.5 mouse ES line in which the Rosa26 locus was targeted to express M2Rtta, and the Cola1 Locus was modified to be receptive to a plasmid with TetOn promoter (PMID: 16400644) and an insert (in this case Cdx2: atgtacgtgagctaccttctggacaaggacgtgagcatgtatcctagctccgtgcgccactccggcggcctgaacctggctccgcagaactt tgtcagtcctccgcagtacccggactacggtggttaccacgtggcggccgcggcggctgctacggcgaacttggacagcgctcagtcccc agggccatcctggcccaccgcgtacggcgcccctctccgcgaggactggaatggctacgcacccgggggcgctgcggcagccaacgc ggtagcccacggtctcaatggtggctccccggccgccgctatgggctacagcagccccgccgaataccacgcgcaccatcacccgcatc atcacccgcaccatccggccgcctcgccgtcctgcgcctccggcttgctgcagacgctcaaccteggccccccggggcccgcagccacc gccgccgccgaacagctgtcccccagcggccagcggcgaaacctgtgcgagtggatgcggaagcccgcgcagcagtccctaggaag ccaagtgaaaaccaggacaaaagacaaataccgggtggtgtacacagaccatcagcggctggagctggagaaggagtttcactttagtcg atacatcaccatcaggaggaaaagtgagctggctgccacacttgggctctccgagaggcaggttaaaatttggtttcagaaccgcagagcc aaggagaggaaaatcaagaagaagcagcagcagcaacagcagcagcagcaacaacagcctccacagccgccgccacaaccttccca gcctcagccgggtgccctgcggagcgtgcccgagcccttgagtcctgtgacctccttgcaaggctcagtgcctggttctgtccctggggttc tggggccagctggaggggttttaaactccactgtcacccagtga: SEQ ID NO: 36) which can be flipped in the collagen locus. Targeted colonies were subjected to hygromycin selection of 10 days, and individual ES colonies were selected for further analysis to generate KH2-Cdx2 that overexpress Cdx2 upon DOX addition (
[0779] Expansion and maintenance of nave mouse PSCsThree different mouse ES lines were separately expanded and maintained in mouse nave N2B27 2iLIF conditions: KH2 ESC, KH2-Gata4 Dox inducible cells (KH2-GATA4) and KH2-Cdx2 Dox inducible cells (KH2-CDX2). Cells were expanded on gelatin or MEF coated plates in N2B27 2i/LIF medium for at least 3 passages (10-12 days) in order to become nave (PMID 33915080; PMID 26860365; PMID: 26291026; PMID: 26076835; PMID 24172903; PMID 25569111) and competent to successfully execute the protocol delineated herein. Both 5% O2 and 20% O2 conditions were suitable (37 C. and 5% Co2).
[0780] N2B27 2i/LIF medium240 ml Neurobasal (ThermoFisher 21103049) and 240 ml of DMEM-F12 (Thermo 21331-020 or SIGMA D6421), 5 ml N2 supplement (Invitrogen; 17502048), 10 ml B27 supplement (Invitrogen; 17504044), 2 mM glutamine or 1 mM GLutamax (Invitrogen), 1% nonessential amino acids (Invitrogen), 0.1 mM -mercaptoethanol (Sigma), 1% penicillin-streptomycin (Invitrogen), 3 M CHIR99021 (GSK3i-CH, Axon Medchem), 1 M PD0325901 (MEK/ERKi, PD, Axon Medchem 1408) and recombinant LIF 20 ng/ml.
[0781] Aggregation media (AM)As described in Example 1 hereinabove.
[0782] EUCM media (also referred to as EUCM1)As described in Example 1 hereinabove.
[0783] EUCM2 mediaCMRL (Gibco 11530037) or a 1:1 mix of CMRL and Advanced DMEM/F12 (Thermo 12634010), Glutamax 1, Sodium pyruvate 1 mM, Pen/Strep 1+NEAA 1, D-Glucose 4 mg/mL, ITS-X 1 (Gibco 51500056), beta-Estradiol 8 nM, Progesterone 20 ng/ml, 20% FBS.
[0784] EUCM3 mediaCMRL (Gibco 11530037) or a 1:1 mix of CMRL and Advanced DMEM/F12 (Thermo 12634010), Glutamax 1, Sodium pyruvate 1 mM, Pen/Strep 1+NEAA 1, D-Glucose 4 mg/mL, ITS-X 1 (Gibco 51500056), beta-Estradiol 8 nM, Progesterone 20 ng/ml, 30% FBS.
[0785] EUCM4 mediaCMRL (Gibco 11530037) or a 1:1 mix of CMRL and Advanced DMEM/F12 (Thermo 12634010), Glutamax 1, Sodium pyruvate 1 mM, Pen/Strep 1+NEAA 1, D-Glucose 4 mg/mL, ITS-X 1 (Gibco 51500056), beta-Estradiol 8 nM, Progesterone 20 ng/ml, 30% HAS.
[0786] EUCM4* media4:1 mix of CMRL (Gibco 11530037) and Advanced DMEM/F12 (Thermo 12634010), Glutamax 1, Sodium pyruvate 0.5 mM, Pen/Strep 1+NEAA 0.5, +extra D-Glucose 3 mg/mL, ITS-X 1 (Gibco 51500056), beta-Estradiol 8 nM, Progesterone 20 ng/ml, 20% RAS, 10% HAS+HEPES 2 mM (GIBCO 15630056). When indicated, EUCM5 also contained 10% KSR.
[0787] EUCM5 media4:1 mix of CMRL (Gibco 11530037) and Advanced DMEM/F12 (Thermo 12634010), Glutamax 1, Sodium pyruvate 0.5 mM, Pen/Strep 1+NEAA 0.5, +extra D-Glucose 3 mg/mL, ITS-X 1 (Gibco 51500056), beta-Estradiol 8 nM, Progesterone 20 ng/ml, 30% RAS, 15% HAS, HEPES 2 mM (GIBCO 15630056). When indicated, EUCM5 also contained 5% KSR.
[0788] Optional short pre-aggregation Pre-TreatmentThis optional step was applied where indicated for some of the donor nave cells types already expanded in nave N2B272i/LIF conditions for at least three passages, and were pre-treated for up to 48 hours prior to co-aggregation (defined as time 0) as indicated in the scheme. In this specific regimen (see e.g.
[0789] Aggregation plate preparationAs described in Example 1 hereinabove.
[0790] Co-aggregation and culture (
Cells were trypsinised with 0.05% trypsin-EDTA for 3-5 minutes followed by feeder depletion on gelatinized plates for 20 minutes at 37 C. (when MEFs were used). Cells were resuspended in aggregation media (AM) supplemented with Doxycycline (2 g/ml final concentration). Following cell count, a total number of 18000 KH2-CDX2, 6000 KH2-GATA4 and 6000 KH2-WT (empty) cells were added per well in AggreWell 400 Microwell 24 well plates. In 800 Microwell plates, a total number of 4500 KH2-CDX2, 1500 KH2-GATA4 and 1500 KH2-WT (empty) cells were added per well in AggreWell 24 well. The cell mixture was added as 1 ml per well (final volume of each well of 24 well is 1.5 ml), 25 cells/well. [0794] Day 0The plate was centrifuged at 100g for 3 minutes and this was marked as day 0, and then placed into static incubator at 37 C., 5% Co2 and 20% O2. [0795] On Day 1, 1 ml of media was gently aspirated from each well and replaced with pre-warmed 1 ml of fresh AM+20% FBS+DOX, as indicated in
[0802] Co-aggregation and culture (
Cells were trypsinised with 0.05% trypsin-EDTA for 3-5 minutes followed by feeder depletion on gelatinized plates for 20 minutes at 37 C. (when MEFs were used). Following, cells were resuspended in aggregation media (AM) supplemented with Doxycycline (2 g/ml final concentration). Following cell count, a total number of 18000 KH2-CDX2, 6000 KH2-GATA4 and 6000 KH2-WT (empty) cells were added per well in in 400 Microwell AggreWell 24 well plate. In 800 Microwell plates a total number of 4500 KH2-CDX2, 1500 KH2-GATA4 and 1500 KH2-WT (empty) cells were added per well in AggreWell 24 well. The cell mixture was added as 1 ml per well (final volume of each well of 24 well is 1.5 ml), 25 cells/well. [0806] Day 0The plate was centrifuged at 100g for 3 minutes and this was marked as day 0, and then placed into a static incubator at 37 C., 5% Co2 and 20% O2. [0807] On Day 1, 1 ml of media was gently aspirated from each well and replaced with pre-warmed 1 ml of fresh AM 20% FBS+DOX, as indicated in
[0814] Co-aggregation and culture (
Cells were trypsinised with 0.05% trypsin-EDTA for 3-5 minutes followed by feeder depletion on gelatinized plates for 20 minutes at 37 C. (when MEFs were used). Following, cells were resuspended in aggregation media (AM) supplemented with Doxycycline (2 g/ml final concentration). Following cell count, a total number of 18000 KH2-CDX2, 6000 KH2-GATA4 and 6000 KH2-WT (empty) cells were added per well in 400 Microwell AggreWell 24 well plates. In 800 Microwell plates a total number of 4500 KH2-CDX2, 1500 KH2-GATA4 and 1500 KH2-WT (empty) cells were added per well in AggreWell 24 well. The cell mixture was added as 1 ml per well (final volume of each well of 24 well is 1.5 ml), 25 cells/well. [0818] Day 0The plate was centrifuged at 100g for 3 minutes and this was marked as day 0, and then placed into static incubator at 37% C. 5% Co2 and 20% O2. [0819] On Day 1, 1 ml of media was gently aspirated from each well and replaced with pre-warmed 1 ml of fresh AM+20% FBS+DOX, as indicated in
[0826] Co-aggregation and culture (
Cells were trypsinised with 0.05% trypsin-EDTA for 3-5 min followed by feeder depletion on gelatinized plates for 20 min at 37 C (when MEFs were used). Cells were resuspended in aggregation media (AM) supplemented with Doxycycline (2 g/ml final concentration). Following cell count, a total number of 18000 KH2-CDX2, 6000 KH2-GATA4 and 6000 KH2-WT (empty) cells were added per well in in 400 Microwell AggreWell 24 well plates. In 800 Microwell plates, a total number of 4500 KH2-CDX2, 1500 KH2-GATA4 and 1500 KH2-WT (empty) cells were added per well in AggreWell 24 well. The cell mixture was added as 1 ml per well (final volume of each well of 24 well is 1.5 ml), 25 cells/well. [0830] Day 0The plate was centrifuged at 100g for 3 minutes and this was marked as day 0, and then placed into static incubator at 37 C., 5% Co2 and 20% O2. [0831] On Day 1, 1 ml of media was gently aspirated from each well and replaced with pre-warmed 1 ml of fresh AM+20% FBS+DOX, as indicated in
[0838] Co-aggregation and culture (
[0842] Cells were trypsinised with 0.0 5% trypsin-EDTA for 3-5 minutes followed by feeder depletion on gelatinized plates for 20 minutes at 37 C. (when MEFs were used). Following, cells were resuspended in aggregation media (AM) supplemented with Doxycycline (2 g/ml final concentration). Following cell count, a total number of 18000 KH2-CDX2, 6000 KH2-GATA4 and 6000 KH2-WT (empty) cells were added per well in 400 Microwell AggreWell 24 well plates. In 800 Microwell plates a total number of 4500 KH2-CDX2, 1500 KH2-GATA4 and 1500 KH2-WT (empty) cells were added per well in AggreWell 24 well. The cell mixture was added as 1 ml per well (final volume of each well of 24 well is 1.5 ml), 25 cells/well. [0843] Day 0The plate was centrifuged at 100g for 3 minutes and this was marked as day 0, and then placed into static incubator at 37 C., 5% Co2 and 20% O2. [0844] On Day 1, 1 ml of media was gently aspirated from each well and replaced with pre-warmed 1 ml of fresh AM+20% FBS+DOX, as indicated in
[0851] Co-aggregation and culture (
[0855] Cells were trypsinised with 0.05% trypsin-EDTA for 3-5 minutes followed by feeder depletion on gelatinized plates for 20 minutes at 37 C. (when MEFs were used). Cells were resuspended in aggregation media (AM) supplemented with Doxycycline (2 g/ml final concentration). Following cell count, a total number of 18000 KH2-CDX2, 6000 KH2-GATA4 and 6000 KH2-WT (empty) cells were added per well in 400 Microwell AggreWell 24 well plates. In 800 Microwell plates, a total number of 4500 KH2-CDX2, 1500 KH2-GATA4 and 1500 KH2-WT (empty) cells were added per well in AggreWell 24 well. The cell mixture was added as 1 ml per well (final volume of each well of 24 well is 1.5 ml), 25 cells/well. [0856] Day 0The plate was centrifuged at 100g for 3 minutes and this was marked as day 0, and then placed into static incubator at 37 C., 5% Co2 and 20% O2. [0857] On Day 1, 1 ml of media was gently aspirated from each well and replaced with pre-warmed 1 ml of fresh AM+20% FBS+DOX, as indicated in
[0864] Co-aggregation and culture (
The protocols were as described hereinabove for e.g.
[0868] Immunostaining and MicroscopyAs described in Example 1 herein above.
Real-Time PCR analysisAs described in Example 1 herein above.
Results
[0869] The present inventors have devised a novel and inventive method to generate advanced synthetic embryos made solely from nave ESCs or iPSCs, by transiently inducing overexpression of a factor that induces differentiation to extra embryonic primitive endodermal (Pre) cells such as Gata4 and/or Gata6 in a subpopulation of the nave PSCs, transiently inducing overexpression of a factor that induces differentiation to trophectoderm cells such as Cdx2 and/or Gata3 and/or Gata2 and/or nuclear YAP in another subpopulation of the nave PSCs and mixing and aggregating the two subpopulations with the same nave PSCs that were not subjected to transient overexpression. Following, the generated aggregates may be grown ex utero to complete gastrulation and organogenesis or injected to the uterus to continue growth in-utero.
[0870] To this end, instead of using stable TSC lines made from the transgenic ESC lines described in Example 1 hereinabove and stabilized after several passages (at least 3 passages, 15 days), which might alter their characteristics, nave mESCs that transiently overexpress Cdx2 upon addition of DOX in the early stages of embryo aggregation protocol were generated, in order to induce their rapid transition into early trophectoderm (TE). In addition, instead of using the blastocysts derived XEN cells described in Example 1 hereinabove, nave mESCs that transiently overexpress Gata4 upon addition of DOX in the early stages of embryo aggregation protocol were generated, in order to induce their rapid transition into the extraembryonic primitive endoderm lineage.
[0871] Indeed, co-aggregation of these three stem cell populations, all originating from nave ESCs/iPSCs as a starting material, followed by ex-utero culturing enabled generation of organized embryos, as exemplified in
[0872] Real-time PCR analysis indicated that KH2-Gata4 cells significantly upregulate the endogenous extraembryonic ectoderm markers Gata4, Gata6 and PDGFRA following DOX induction in 2i/LIF (
Example 3
Aggregation of Three Mouse Nave PSCs Subpopulations Generates an Organized Embryo
Materials and Methods
[0873] Animals-Natural in utero developed embryos were obtained from female mice 5-8 weeks old ICR or BDF1 mated with BDF1 male studs (Harlan). Insemination was verified the next morning by the presence of a copulatory plug, and this day was defined as embryonic day 0.5 (E0.5). All animal experiments were performed according to the Animal Protection Guidelines of Weizmann Institute of Science and approved by relevant Weizmann Institute IACUC (#01390120-1, 01330120-2, 33520117-2). Mice were housed in a standard 12-hours light/12-hours dark cycle conditions in a specialized and certified animal facility.
[0874] Stem cell linesThe following mouse ES lines were used: WT V6.5 ESCs (C57B6/129sJae), BVSC ESC (Mixed BDF1 X B6 background) and KH2-WT ESC line carrying both M2RtTa allele in the Rosa26 locus and a modified Col1 locus with an FRT site to efficiently insert Tet-ON regulated alleles as previously described (Hochedlinger et al., 2005). The previously described BVSC ESC lines (Hayashi et al., 2011) carries Blimp1-mVenus and Stella-Cfp (BVSC) reporter alleles which can be useful for tracking PGC formation.
[0875] Stem cells in vitro culture conditionsGolden stocks of mouse ESCs were cultured on feeder layer of irradiated mouse embryonic fibroblast (MEFs) and maintained (and gene targeted when relevant) in conventional mouse ES medium (Serum/LIF) composed of 1DMEM (GIBCO 41965) supplemented with 20% FBS (heat inactivated and filtered), 1 mM GlutaMAX (GIBCO, 35050061), 1% penicillin streptomycin (Biological IndustriesSartorius 03-031-1B), 1% Sodium Pyruvate (Biological IndustriesSartorius 03-042-1B), 1% nonessential amino acids (Biological IndustriesSartorius 01-340-1B), 0.1 mM -mercaptoethanol (Thermo 31350010), 10 ng/ml recombinant human LIF (in-house prepared).
[0876] To convert the cells into ground state nave ESCs in 2i/LIF conditions, ESCs were maintained and expanded in serum-free chemically defined N2B27-based media: 240 ml Neurobasal (Thermo 21103049) and 240 ml of DMEM-F12 with HEPES (SIGMA D6421), 5 ml N2 supplement (Invitrogen: 17502048), 5 ml B27 supplement (Invitrogen; 17504044 or in house prepared), 1 mM GlutaMAX (GIBCO, 35050061), 1% nonessential amino acids (Biological IndustriesSartorius 01-340-1B), 0.1 mM -mercaptoethanol (Thermo 31350010), 1% penicillin-streptomycin (Biological IndustriesSartorius 03-031-1B). Nave 2i/LIF conditions for murine PSCs included 20 ng/ml recombinant human LIF (in-house made) and small-molecule inhibitors CHIR99021 (CHIR, 3 MAxon Medchem 1386) and PD0325901 (PD, 1 MAxon Medchem 1408) (referred to as 2i). Murine nave ESCs were expanded on feeder layer (MEFs) or on 0.2% gelatin-coated plates. At least three passages in 2i/LIF conditions were applied before initiation of experimentation. Mouse nave ESC lines were used up to 15 passages in 2i/LIF conditions. For maintenance ESCs were passaged with 0.25% trypsinization every 3-5 days.
[0877] KH2-Gata4 Dox inducible nave pluripotent stem cells (KH2-GATA4)As described in Example 1 hereinabove.
[0878] KH2-Cdx2 Dox inducible nave pluripotent stem cells (KH2-Cdx2)As described in Example 2 hereinabove.
[0879] Generation of ELF5 EYFP-NLS reporter on KH2-Cdx2 ESCsiCdx2 (KH2-CDX2) validated clone 3 was used for CRISPR targeting EYFP in 3 end of mouse ELF5 gene. Cells we co-transfected with previously generated nuclear EYFP plasmid (Addgene #128833) and guide RNA plasmid (#128836). Following neomycin and ganciclovir antibiotic selection for 10 days, total clonal population was transfected with Cre and subcloned. Single cell clones were validated for correct insertion: at 3 end using forward ATGGTCCTGCTGGAGTTCGTGAC (SEQ ID NO: 37) and reverse TGGTCCATCTGCTTGTAGGCAAGA (SEQ ID NO: 38) primer pair, and at 5 end using forward TTCACCTTTGAAGCTAATCGTTTGAGG (SEQ ID NO: 39) and reverse AACTTGTGGCCGTTTACGTCGC (SEQ ID NO: 40) primer pair. Correctly targeted clones were further validated for off-target insertions by Southern blot analysis.
[0880] Generation of fluorescent labeled ESCsKH2 WT ESCs, KH2-Gata4 clone 7 (iGata4) and KH2-Cdx2 clone 3 (iCdx2) were transduced with FUGW lentivirus particles constitutively expressing either fluorescent BFP, GFP or mCherry proteins, respectively. For the generation of lentivirus, HEK293T cells were plated in 10 ml DMEM, containing 10% FBS and Pen/Strep in 10 cm dishes, in aliquots of 5.5 million cells per well. On the next day, cells were transfected with the third generation Addgene lentivirus vectors [0.8 g of pRSV-Rev (Addgene 12253), 0.8 g of pMDLg/pRRE (Addgene 12251), 1.6 g of pMD2.G (Addgene12259)], using jetPEI transfection reagent, along with 16 g of the target plasmid of each transduced fluorescent proteins BFP, GFP and mCherry. The supernatant containing the virus was collected 48 hours and 72 hours following transfection, filtered using 0.45 m filter and freezed in 80 C. in 1 ml aliquots. ESCs were plated in FBS/Lif condition on gelatin coated 6-well plates at low density and transduced with lentivirus in the presence of protamine sulfate (8 g/ml). 48 hours later the infected ESCs were expanded for 1-3 passages and sorted for positive population and further expanded for experimentation.
[0881] Isolation of human umbilical cord blood serum-Collection of human cord blood serum was done as described previously (Aguilera-Castrejon et al., 2021b) following the guidelines approved by Rambam Medical Center Helsinki committee (#RMB-0452-15). Healthy women over the age of 18 and under 40 who gave their consent and were scheduled for caesarian section delivery were eligible for cord blood collection. Blood was manually drawn by the obstetrician surgeon, using a large bore 14-gauge needle and a 50 ml syringe, directly from the umbilical cord. In brief, blood was collected and quickly distributed to mL pro-coagulant sterile test tubes (Greiner Bio-One, Z Serum Sep Clot Activator, #456005) and cooled to 4 C. for 15 minutes, followed by centrifugation at 2500G for 10 minutes at 4 C. Tubes showing signs of hemolysis were discarded. Serum was filtered through a 0.22 M filter (Nalgene, Ref #565-0020), heat-inactivated at 55 C. in a water bath for 45 minutes and immediately aliquoted and stored at 80 C. for up to six months.
[0882] Co-aggregation and culture-AggreWell 24-well plate 400 (STEMCELL Technologies 34415), or AggreWell 24-well plate 800 (STEMCELL Technologies 34815) were used with equivalent outcome. AggreWell plate preparation was done according to manufacturer instructions. Briefly, 500 l of anti-adherence rinsing solution (STEMCELL Technologies 07010) was added to each well. Plate was centrifuged at 2,000g for 5 minutes and incubated 30 minutes at room temperature. After incubation, rinsing solution was removed and the plate was washed twice with PBS. 500 l of aggregation media AM supplemented with DOX (2 g/ml final concentrationSigma D9891) and ROCKi Y27632 (5 nM final concentrationAxon Medchem 1683) was added to each well. The aggregation media contained: 1DMEM (GIBCO-41965) supplemented with 20% FBS (GIBCO), 1 mM GlutaMAX (GIBCO, 35050061), 1% penicillin streptomycin (Biological IndustriesSartorius 03-031-1B), 1% Sodium Pyruvate (Biological IndustriesSartorius 03-042-1B), 1% nonessential amino acids (Biological IndustriesSartorius 01-340-1B) and 0.1 mM -mercaptoethanol (Thermo 31350010).
[0883] To generate the synthetic embryos, referred to herein as sEmbryo iCdx2, three starting PSC cell types were co-aggregated: [0884] 1) nave WT ESCs (either KH2-WT, BVSC or V6.5 ESC) in 2i/LIF; [0885] 2) nave iGata4 ESCs in 2i/LIF pre-treated with DOX (2 g/mlSigma D9891) in 2iLIF media for 24 hours prior to the co-aggregation; and [0886] 3) nave iCdx2 ESCs in 2i/LIF pretreated with DOX (2 g/mlSigma D9891) for different time points (1 day to 14 days prior to the co-aggregation) in TSC media (25 ng/ml FGF4 (Peprotech), 1 /ml Heparin (Sigma)) supplemented with lysophosphatidic acid (LPA, a Hippo pathway inhibitor) 0.5-1 M.
Co-aggregation was defined as time point 0 of the protocol
[0887] At the day of aggregation (day 0), the three donor cell populations were trypsinized with 0.05% trypsin-EDTA solution (Biological IndustriesSartorius 03-053-1B) for 4 minutes at 37 C. Trypsin enzymatic reaction was stopped by adding aggregation media. Cells were centrifuged at 1200 rpm for 3 minutes and resuspended in aggregation medium with DOX (2 g/mlSigma D9891) and ROCKi Y27632 (5 nM final concentrationAxon Medchem 1683). Following, cells were plated on gelatinized tissue culture plates for mouse embryonic fibroblast depletion for 20 minutes at 37 C. Supernatant was collected, centrifuged and cells were resuspended. The three cell fractions were counted and resuspended in aggregation media with DOX (2 g/mlSigma D9891) and ROCKi Y27632 (5 nMAxon Medchem 1683). A ratio of (1 WT-ESCs:1 iGata4 ESC:3.33 iCdx2 ESC) was maintained in aggregation experiments, as follows:
TABLE-US-00002 Number of Number of added # of Cells microwells per well cells per each well per single in 24 well plate of a 24 well plate microwell AggreWell 300 1-iCDX2: 5000 cells ~27 cells 800 2-iGATA4: 1500 cells 3-WT ESC 1500 cells Aggre Well 1200 1-iCDX2: 20000 cells ~27 cells 400 2-iGATA4: 6000 cells 3-WT ESC 6000 cells
[0888] 1 ml of cell-mix suspension was gently added drop wise to each well of the AggreWell plate followed by centrifugation at 700 rpm for 3 minutes and incubation at 37 C. (total end volume is 1.5 ml).
[0889] On the next day (day 1), 1 ml of media (out of total 1.5 ml) was gently removed from each well and replaced with 1 ml of preheated aggregation media with DOX (2 g/mlSigma D9891).
[0890] On day 2, 1 ml of media was removed from each well and replaced with 1 ml of preheated aggregation media.
[0891] On day 3, 1 ml of media was removed from each well and replaced with 1 ml of preheated EUCM2 media. In this example, EUCM2 media refers to: Advanced DMEM/F12 (GIBCO 21331-020), 5 ml CMRL media (1% final concentration) as a supplement (5 mlGIBCO 11530037), extra added 1 mg/ml D (+)-Glucose Monohydrate (J.T. Baker0113) (add 500 mg per 500 ml media), 100 nM T3 (3,3,5-Triiodo-L-thyronine sodium salt) (Sigma-Aldrich, T6397), 1 mM Sodium pyruvate (Sigma-Aldrich, S8636), 1 mM GlutaMAX (GIBCO, 35050061), 1% penicillin streptomycin (Biological IndustriesSartorius 03-031-1B), 1 of ITS-X supplement (Thermo Fisher Scientific 51500-056), 8 nM B-estradiol (Sigma-Aldrich, E8875), 200 ng/ml progesterone (Sigma-Aldrich, P0130), 25 M N-acetyl-L-cysteine (Sigma-Aldrich, A7250)+20% FBS.
[0892] On day 4, the synthetic embryos were gently transferred to 6-well cell suspension culture plates (Greiner, 657185) with 5 ml of preheated EUCM3 media per well and placed on shaker rotation 60 rpm/min (Thermo 88881102+88881123). In this example, EUCM3 media refers to: Advanced DMEM/F12 (GIBCO 21331-020), 5 ml CMRL media (1% final concentration) as a supplement (5mlGIBCO 11530037), extra added 1 mg/ml D (+)-Glucose Monohydrate (J.T. Baker0113) (add 500 mg per 500 ml media), 100 nM T3 (3,3,5-Triiodo-L-thyronine sodium salt) (Sigma-Aldrich, T6397), 1 mM Sodium pyruvate (Sigma-Aldrich, S8636), 1 mM GlutaMAX (GIBCO, 35050061), 1% penicillin streptomycin (Biological IndustriesSartorius 03-031-1B), 1 of ITS-X supplement (Thermo Fisher Scientific 51500-056), 8 nM B-estradiol (Sigma-Aldrich, E8875), 200 ng/ml progesterone (Sigma-Aldrich, P0130), 25 M N-acetyl-L-cysteine (Sigma-Aldrich, A7250)+30% FBS.
[0893] On day 5, egg cylinder shape sEmbryos were picked and transferred to glass culture bottles (50-30 embryos per bottle) containing 2 mL of EUCM media (the contents of which are described in Example 1 hereinabove). Following, the bottles were placed on the rolling culture system previously described electronically controlled roller culture platform (Aguilera-Castrejon et al., 2021a), rotating at 30 revolutions per minute at 37 C., and continuously gassed with an atmosphere of 21% O.sub.2, 5% CO.sub.2 at 7-8 pounds per square inch (psi). A black non-transparent cloth was used to cover the incubator from light during unit operation.
[0894] From day 6 to day 8, 1 ml of EUCM was replaced with preheated 1 ml of EUCM and kept on rolling culture system. Culture media was pre-heated for at least an hour by placing it inside a glass bottle on the rotating culture.
[0895] Whole-mount immunostainingsynthetic embryos grown ex utero and equivalent in utero controls were fixed with 4% PFA EM grade (Electron microscopy sciences, 15710) in PBS at 4 C. over-night. Natural embryos were dissected removing the Reichert's membrane for E6.5-E7.5 embryos, or the yolk sac and amnion for E8.5 embryos and washed once with 1PBS before fixation. Synthetic embryos were then washed in PBS for 5 minutes 3 times, permeabilized in PBS with 0.5% Triton X-100/0.1 M glycine for 30 minutes, blocked with 10% normal donkey serum/0.1% Triton X-100 in PBS for 1 hour at room temperature (RT), and incubated over-night at 4 C. with primary antibodies, diluted in blocking solution. Following, embryos were rinsed 3 times for 5 minutes each in PBS/0.2% TritonX-100, incubated for 2 hours at room temperature with secondary antibodies diluted 1:200 in blocking solution (all secondary antibodies were from Jackson ImmunoResearch), counterstained with DAPI (1 g/ml in PBS) for 10 minutes, and washed with PBS for 5 minutes 3 times. Yolk sacs isolated from natural and synthetic embryos were fixed and stained following this protocol. The primary antibodies used were the following: Rabbit polyclonal anti-Gata4 (Abcam, Ab84593) 1:200; Rabbit polyclonal anti-Foxa2 (Abcam, Ab40874) 1:100; Goat polyclonal anti-Sox2 (R&D, AF2018) 1:200; monoclonal anti-Myosin Heavy Chain II (MF-20) (R&D, MAB4470) 1:200; Goat polyclonal anti-Sox17 (R&D, AF1924) 1:100; Rabbit monoclonal anti-Brachyury (Cell Signaling, 81694) 1:100; Rabbit polyclonal anti-Cdx2 (ab76541) 1:100; Mouse monoclonal anti-Oct4 (Santa Cruz, SC-5279) 1:100; Goat polyclonal anti-Otx2 (R&D, AF1979) 1:200; Goat polyclonal anti-TFAP2C/AP2y (R&D, AF5059) 1:100; Goat polyclonal anti-Gata6 (R&D, AF1700) 1:100; Rabbit polyclonal anti-Eomes/Tbr2 (Abcam, Ab23345) 1:50; Rat Monoclonal anti-Cerberus 1 (R&D, MAB1986) 1:100; Rabbit polyclonal anti-Sox9 (Millipore, Ab5535) 1:100; Mouse monoclonal anti-Gata3 (Invitrogen, MA1-028) 1:100, Rabbit polyclonal anti-Nanog (Bethyl, A300-397A) 1:100; Goat polyclonal anti-Elf5 (Santa Cruz, sc9645) 1:100; Goat polyclonal anti-DKK1 (R&D, AF1096) 1:100 or Goat polyclonal anti-Brachyury (R&D, AF2085) 1:100.
[0896] ImmunohistochemistryFor OCT-staining, on day 8 of the protocol, the synthetic embryos were fixed overnight in 4% PFA at 4 C., washed three times in PBS for 10 minutes each and submerged first in 15% Sucrose/PBS and then 30% sucrose overnight at 4 C. The day after, samples were subjected to increasing gradient of OCT concentration in Sucrose/PBS followed by embedding in OCT on dry ice and stored at 80 C. until further processing. Cryoblocks were cut with LEICA CM1950 and washed once with 1PBS and incubated with 0.3% H.sub.2O.sub.2 for 20 minutes. Following permeabilization with 0.1% Triton X-100 in PBS for 10 minutes, slides were washed three times with 1PBS for 2 minutes each and blocked in 10% normal donkey serum in PBS in humidified chamber for 20 minutes at room temperature. Slides were then incubated with a primary antibody diluted in antibody solution (1% BSA in 0.1% Triton X-100) at 4 C. overnight. Sections were then washed three times (5 minutes each) in 0.1% Triton X-100 in PBS, incubated with the appropriate secondary antibodies diluted in antibody solution at room temperature for 1 hour in the dark, counterstained with DAPI for 20 minutes and mounted with Shandon Immuno-Mount (Thermo Scientific, 9990412). The primary antibodies used were the following: Rabbit polyclonal anti-Gata4 (Abcam, Ab84593) 1:100; Rabbit polyclonal anti-Foxa2 (Abcam, Ab40874) 1:100; Goat polyclonal anti-Sox2 (R&D, AF2018) 1:100; Goat polyclonal anti-GATA6 (R&D, AF1700) 1:100; monoclonal anti-Myosin Heavy Chain II (MF-20) (R&D, MAB4470) 1:100 or Rabbit polyclonal NKX2.5 (Abcam, Ab97355) 1:100.
[0897] Confocal microscopyWhole-mount immunofluorescence and immunohistochemistry images were acquired with a Zeiss LSM 700 inverted confocal microscope (Carl Zeiss) equipped with 405 nm, 488 nm, 555 nm and 635 nm solid state lasers, using a Plan-Apochromat 20 air objective (numerical aperture 0.8) for E5.5/E6.5 embryos, and an EC Plan Neofluar 10 air objective (numerical aperture 0.3) for synthetic embryos. Images were acquired at 10241024 resolution. All images were acquired within the following range of parameters: Laser power: 405 nm: 10-20%; 488 nm: 5-20%: 555 nm 10-40%; 635 nm: 30-80%. Gain ranged from 350 to 600. Pixel size was 1.25 m with a z-step of 15 m when using the 10 objective, or 0.5 m with z-step of 5 m when using the 20 objective. For confocal imaging synthetic embryos were mounted in 35 mm glass bottom dishes (In Vitro Scientific, D35201.5N). Images and maximum intensity projections were processed using Zen 2 blue edition software 2011 (Carl Zeiss) and Adobe Photoshop CS4.
[0898] Assessment of length-Morphometric measurements were performed using bright field images of synthetic embryos at the indicated time points. Length of the proximal-distal axis was measured for synthetic embryos at both day 4 and day 5. Antero-posterior axis was measured for synthetic embryos from day 8. Measurements were performed using the CellSens Entry software (Olympus). Length of in utero control natural embryos was used for comparison at matched embryonic stages as indicated.
[0899] Yolk sac erythroid progenitor staining-Synthetic embryos at day 8 of the protocol and natural E8.5 derived yolk sacs were dissected. Single cells flow cytometry staining was effected using MacsQuant VYB instrument (Miltenyi, Bergisch Gladbach, Germany). Data was analyzed with FlowJo. Staining was performed for 30 minutes at 4 C. in flow cytometry buffer (PBS, 10% fetal bovine serum and 0.02% azide). For erythroid progenitor staining, a biotinylated lineage cocktail of CD4, CD8, B22, CD11b, GR-1 and Ter119 (Miltenyi), together with anti-cKit APC (2B8), CD41 VG (MRW), CD45 PE (30-F11) (all from Biolegend) and CD34 PB (RAM34, eBioscience) was used, as previously described (Iturri et al., 2021). Streptavidin-PE-Cy7 (Biolegend) was used as a secondary conjugated antibody.
[0900] Erythroid colony forming assay-Harvested cells from day 8 or E8.5 yolk sacs were prepared as single cell suspension in Iscove's modified Dulbecco's medium supplemented with 2% FBS (GIBCO) and 1% penicillin streptomycin (Invitrogen). Isolated cells were plated in triplicate at a density of (110.sup.6) cells per 1.1 ml of MethoCult medium (Stem Cell Technologies, SF M3436) in 35-mm dish and maintained at 37 C. with 5% CO.sub.2 for 12 days before being scored for primitive erythroid colonies. Colonies were visualized and validated with a bright field microscope A1 microscope (Zeiss).
[0901] RNA extraction & RT-PCR analysisTotal RNA was isolated using RNeasy mini kit (Qiagen) following manufacturer instructions. 1 g of total RNA was reverse transcribed using a High-Capacity Reverse Transcription Kit (Applied Biosystems). RT-PCR was performed in triplicate using SYBR Green PCR Master Mix (QIAGEN) and run on Viia7 platform (Applied Biosystems). Values were normalization to ACTIN and/or GAPDH across all experiments, data is presented as fold difference compared reference sample set as 1. The following primers were used:
TABLE-US-00003 mGata3-Forward: (SEQIDNO:41) CTCGGCCATTCGTACATGGAA; mGata3-Reverse: (SEQIDNO:42) GGATACCTCTGCACCGTAGC; mGata2Forward: (SEQIDNO:43) CACCCCGCCGTATTGAATG; mGata2Reverse: (SEQIDNO:44) CCTGCGAGTCGAGATGGTTG; mElf5Forward: (SEQIDNO:45) ATGTTGGACTCCGTAACCCAT; mElf5-Reverse: (SEQIDNO:46) GCAGGGTAGTAGTCTTCATTGCT; mHand1F: (SEQIDNO:47) GGCAGCTACGCACATCATCA; mHand1Reverse: (SEQIDNO:48) CCTGGCATCGGGACCATAG; TotalmCdx2Forward: (SEQIDNO:12) GCGAAACCTGTGCGAGTGGATG; TotalmCdx2Reverse: (SEQIDNO:13) CGGTATTTGTCTTTTGTCCTGGT; mFgfr2Forward: (SEQIDNO:49) GCCTCTCGAACAGTATTCTCCT; mFgfr2Reverse: (SEQIDNO:50) ACAGGGTTCATAAGGCATGGG; EndogenousmGata4Forward: (SEQIDNO:32) CACTGGAAAAGCCTGCGTTCTTACA; EndogenousmGata4Reverse: (SEQIDNO:33) AGAATAAGGAAGGAAGAAGTCTCTTGCCTC; EndogenousmCdx2Forward: (SEQIDNO:34) AATTATGGACCTCAGGGGAAGACATG; EndogenousmCdx2Reverse: (SEQIDNO:35) GCTGGCAGGAAGAGTCGGAATG; mDppa1-Forward: (SEQIDNO:51) ATGATGTCCCTTCAAGTCCTCA; mDppa1-Reverse: (SEQIDNO:52) TGTGTTGGGATCACTTCAGTGT; TotalmGata4-Forward: (SEQIDNO:14) CACAAGATGAACGGCATCAACC; TotalmGata4-Reverse: (SEQIDNO:15) CAGCGTGGTGGTAGTCTG; mGata6-Forward (SEQIDNO:53) TCAGGGGTAGGGGCATCAG; mGata6-Reverse: (SEQIDNO:54) GTAGAGGCCGTCTTGACCTG; mGapdh-Forward: (SEQIDNO:2) AGTCAAGGCCGAGAATGGGAAG; mGapdh-Reverse: (SEQIDNO:3) AAGCAGTTGGTGGTGCAGGATG; mSox17-Forward: (SEQIDNO:55) AGCAGAACCCAGATCTGCAC; mSox17-Reverse: (SEQIDNO:56) CGCCTTCCAAGACTTGCCTA; mActin-Forward: (SEQIDNO:57) GATATCGCTGCGCTGGTCG; mActin-Reverse: (SEQIDNO:58) CCACGATGGAGGGGAATACAG; mHnf4a-Forward: (SEQIDNO:59) TGTTGCTAACACGATGCCCT; mHnf4a-Forward: (SEQIDNO:60) GGCCACTCACACATCTGTCC; Foxa2-Forward: (SEQIDNO:61) GCACTCGGCTTCCAGTATGC; Foxa2-Reverse: (SEQIDNO:62) CGTAGTAGCTGCTCCAGTCG; mPdgfra-Forward: (SEQIDNO:63) AGTGGCTACATCATCCCCCT; mPdgfra-Reverse: (SEQIDNO:64) CCGAAGTCTGTGAGCTGTGT.
[0902] Bulk RNA-seq (Bulk MARS-seq)RNA-seq libraries were prepared at the crown genomics institute of the Nancy and Stephen Grand Israel National Center for Personalized Medicine, Weizmann Institute of Science. A bulk adaptation of the MARS-Seq protocol (Keren-Shaul et al.) was used to generate RNA-Seq libraries for expression profiling different samples (3 biological replicates from each). Briefly, 60 ng of input RNA from each sample was barcoded during reverse transcription and pooled. Following Agencourct Ampure XP beads cleanup (Beckman Coulter), the pooled samples underwent second strand synthesis and were linearly amplified by T7 in vitro transcription. The resulting RNA was fragmented and converted into a sequencing-ready library by tagging the samples with Illumina sequences during ligation, RT, and PCR. Libraries were quantified by Qubit and TapeStation as previously described (Keren-Shaul et al.) Sequencing was done on a NovaSeq600 using an SP 100 cycles kit (Illumina).
[0903] Bulk RNA-seq analysisSamples were analyzed using UTAP software. Reads were trimmed using CutAdapt (Martin 2011) (parameters: -a ADAPTER1-a A {10}-a T{10}-A A{10}-A T{10}-times 2-u 3-u-3-q 20-m 25). Reads were mapped to genome mm10 using STAR v2.4.2a (parameters: -alignEndsType EndToEnd, -outFilterMismatchNoverLmax 0.05, -twopassMode BasicalignSoftClipAtReferenceEnds No).
[0904] Sample counting was done using STAR, quantifying mm10 RefSeq annotated genes. Further analysis was done for genes having a minimum of five reads in at least one sample. Normalization of the counts and differential expression analysis was performed using DESeq2 (Love et al. 2014) with the parameters betaPrior=true, cooksCutoff=false, and independentFiltering=false. Raw P-values were adjusted for multiple testing using the procedure of Benjamini and Hochberg. Hierarchical clustering was generated in UTAP software. Expression heatmap was generated using R pheatmap package.
[0905] 10 single cell RNA-seq-E8.5 natural embryos and day 8 synthetic embryos were selected for single cell RNA-sequencing. Several samples were sequenced, one samples represents sEmbryo iCdx2 short term DOX induced (from Day1 until Day+2) and two samples represent sEmbryo iCdx2 10 day dox induced (from Day8 until Day+2). Moreover, to obtain sampling of single embryo based single cell RNA-seq (rather than relying only on pooled samples 2 embryos), a single sEmbryo from short term induced iCdx2 was processed and sequenced. All synethetic embryos samples were processed including extraembryonic compartments without any dissection. synthetic embryos were dissociated using Trypsin-EDTA solution A 0.25% (Biological Industries: 030501B). Trypsin was neutralized with media including 10% FBS and cells were washed and resuspended in 1PBS with 400 g/ml BSA. Cell suspension was filtered with a 100 m cell strainer to remove cell clumps. A percentage of cell viability higher than 90% was determined by trypan blue staining. Cells were diluted at a final concentration of 1000 cells/L. scRNA-seq libraries were generated using the 10 Genomics Chromium v3 system (5000 cell target cell recovery) and sequenced on on Illumina NovaSeq 6000 platform according to the manufacturer's instructions.
[0906] 10 Single cell RNA-seq analysis10 Genomics data analysis was performed using Cell Ranger 7.0 software (10 Genomics) for pre-processing of raw sequencing data, and Seurat 3.6.3 for downstream analysis. The mm10-3.0.0 gene set downloaded from 10 was used for gene reference requirements. To filter out low-expressing single cells, possible doublets produced during the 10 sample processing, or single cells with extensive mitochondrial expression, we filtered out cells with under 200 expressing genes, over 4.000 expressing genes and over 15% mitochondrial gene expression. Filtering reduced the cell count from overall 61,816 to 46,428 cells across all samples. Seurat integrated analysis and anchoring of all individual samples was performed and then normalized by log-normalization using a scale-factor of 10,000. The top 2,000 variable genes were identified by the variance stabilizing transformation method, and subsequently scaled and centered. Principal components analysis was performed for dimensional examination using the elbow method. The first 15 dimensions showed the majority of data variability. Therefore, UMAP dimensional reduction was performed on the first 15 dimensions in all samples. Clusters were detected using Seurat FindClusters function, with resolution parameter=0.6.
[0907] For cluster annotation, the area under the curve (AUC) methodology was used to identify the enrichment of each annotated gene-set to each individual single cell. The annotations were based on published gene annotations (Ibarra-Soria et al., 2018), and performed using the R package AUCELL 1.8.035, using parameters: aucMaxRank=100 (5% of the total gene count) under the AUCell_calcAUC function. Each cell was then annotated to a single tissue based on its highest AUC score prediction. Each tissue was then cross-tabulated with each cluster to assess cluster-tissue overlap, and additionally normalized by z-score and ranged to 0-1 for plotting purposes. Next, to evaluate the probability of a certain cluster being enriched in a certain tissue, the annotated AUC predictions of each cell to a tissue was used to compare the observed cluster annotation of each cell, thus producing a P value based on Mann-Whitney U statistics. This was calculated using the R package verification v1.42 roc. area function (CRAN.R-project (dot) org). Integration of both the predicted annotation overlap and its statistical enrichment to each cluster resulted in a predicted tissue per cluster. T-test was used to assess significant changes in the proportional size of each cluster between natural and synthetic embryos. Expression pattern of selected genes was shown as two parameters: normalized mean expression, and enrichment of cells that express this gene (expression>0), among the specified cluster (either in natural or in synthetic originated cells).
[0908] Statistical analysisAll statistical analysis were performed using the GraphPad Prism 8 software (La Joya, California). Data on graphs indicates means plus s.e.m. of a minimum of three independent experiments, unless otherwise stated. Kolmogorov-Smirnov test was performed to check normal distribution of data before each statistical test. Significant difference between two samples was evaluated by unpaired two-sided Student's t-test if data was normally distributed or Mann-Whitney test for non-normally distributed data. p<0.05 was considered as statistically significant.
Results
[0909] As demonstrated in Example 2 hereinabove, co-aggregation of three stem cell populations, all originating from nave ESCs/iPSCs as a starting material, followed by ex-utero culturing enabled generation of organized embryos.
[0910] Following, multiple rounds of testing and optimizations were conducted to determine the DOX pretreatment regimen compatible with a relatively more productive outcome, and to define optimal cell numbers and aggregation plates. The inventors also tested whether DOX continuation after co-aggregation of the three subpopulations (set as timepoint 0) could improve the experimental outcome.
[0911] The following conditions were selected and applied throughout Example 3 (
[0921] This 8 day protocol supported the self-organization and growth of nave ESC derived aggregates into organogenesis stage synthetic embryos (also referred to herein as sEmbryo iCdx2) that grow within extraembryonic membranes (
[0922] Notably, synthetic embryos generated from the same iCdx2 and iGata4 ESCs but grown from day 4-7 in previous published IVC medium-static conditions based protocols (Bedzhov and Zernicka-Goetz, 2014; Harrison et al., 2017; Sozen et al., 2018), did not develop further than previously achieved (Amadei et al., 2021) and yielded empty yolk sacs that lack embryo proper structures (
[0923] Analysis of defined morphological traits during synthetic embryo growth were systematically compared to those classically well established in natural embryos at different time points in mouse embryogenesis (Dai et al., 2016; van Maele-Fabry et al., 1992; Mittenzweig et al., 2021; Ohinata et al., 2005; Parameswaran and Tam, 1995; Rossant and Tam, 2017; Schwarz and Hadjantonakis, 2020; Tam and Snow, 1980). The synthetic embryos originating from nave ESCs starting populations faithfully resembled all stages of natural post-implantation development, going through luminogenesis, symmetry breaking and gastrulation, until early organ formation (
[0924] Using whole-mount immunofluorescence in natural embryos dissected at E5.5-E6.5, and in egg-cylinder synthetic embryos at day 3, 4 and 5, proper expression of canonical markers for the three cell lineages expected to be present in the mouse embryo at the egg cylinder-stage were corroborated: a cup-shaped epiblast positive for OCT4 and OTX2 (
[0925] To analyze the emergence of primordial germ cells (PGCs) in the synthetic embryos the Blimp1-mVenus Stella-CFP reporter found in the BVSC ESC line (Hayashi et al., 2011) was used in the aggregation protocol alongside induction of Cdx2 and Gata4 cells. Activation of the Blimp1-mVenus fluorescent reporter was detected at day 5 by live imaging, specifically at the site of putative the primitive streak, in the boundaries of the Epi/ExE (
[0926] Following gastrulation, the developing embryo establishes its general body plan and displays multiple ectodermal, endodermal, and mesodermal-derived tissues. In addition to the morphological similarities observed between day 8 synthetic embryos and E8.5 natural in-utero embryos, proper differentiation and tissue morphogenesis were corroborated by assessing the expression of several lineage-specific markers by whole-mount immunofluorescence. The neural folds (NF) and neural tube (NT) derived from the epiblast ectoderm, presented strong Sox2 expression, properly allocated along the antero-posterior axis of the embryo (
[0927] To further analyze the extent of tissue patterning, transversal plane cross-sectioning of the embryonic neural tube and heart was performed. SOX1 and FOXA2 staining indicated proper establishment of the dorso-ventral axis in the spinal cord, evidenced by the double positive cells specifically located at the ventral part, resembling the floor plate in natural embryos (
[0928] Development of the post-implantation mammalian embryo is highly dependent on the extraembryonic tissues, which are the main drivers for induction of symmetry breaking (AVE) at E5.5, and gastrulation together with formation of the primitive streak (ExE) at E6.5. As gastrulation proceeds, the mouse embryo becomes encapsulated by the rapidly enlarging extraembryonic tissues (e.g., yolk sac and amnion) (Pereira et al., 2011) (
[0929] One of the important developmental events involving the extra-embryonic yolk sac, is the emergence of blood islands in the yolk sac (Yamane, 2018), which marks the first hematopoietic event during mammalian development (Nowotschin et al.; Pijuan-Sala et al., 2019). Blood islands were widely visible and abundant in developing yolk sacs (data not shown), and immunostaining of whole yolk-sacs for RUNX1 which marks these primitive hematopoietic progenitors, termed erythromyeloid progenitors (EMPs) (Iturri et al., 2021) confirmed their identity as similarly observed in natural embryos (
[0930] To characterize and annotate the various cell types present in the advanced synthetic embryos generated herein in a more quantitative and unbiased manner, and to identify to which extent the global transcriptional profile of lineages formed with synthetic embryos is like their natural counterparts, single cell RNA-sequencing (scRNA-seq) was performed using a 10 genomics platform. To this end, cells were collected from synthetic day 8 embryos with E8.5 like morphology: 3 synthetic embryos that were developed from iCdx2 cells following brief 3 day DOX based induction (day 1 until day +2) and 4 embryos that were developed following iCdx2 cells following 10 day DOX based induction (day 7 until day +2) (
[0931] Importantly, the profile of cell types found in the synthetic embryos developing ex utero was highly similar to natural embryos, demonstrating that lineage differentiation and commitment is faithfully recapitulated in the synthetic embryos at the single cell level (
Example 4
Generation of Human Nave PSCs Transiently Expressing GATA4, CDX2 and/or GATA3
Materials and Methods
[0932] Gata4, Cdx2, Gata3 inducible nave human pluripotent stem cellsTo generate human TetON inducible Gata4, Cdx2, Gata3 of Gata3-2A-Cdx2 overexpression inserts the present inventors designed targeting vectors for the safe harbor of the AAVS1 locus in human cells (10.1038/nbt.1927). WIBR3 human ESCs and JH22 human iPSC line were targeted with CRISPR and 2 targeting vectorsone introducing the M2Rtta allele (with neo selection) and the other including the transcriptional factor insert (TF) needed with a vector carrying puromycin selection. Electroporated cells were subjected to double antibiotic selection with puromycin and neomycin for 10-14 days, and clones were picked and validated for correct targeting and overexpression. The targeting schemes, designed plasmids and validation results are presented in
[0933] Expansion and maintenance of human nave pluripotent cellsWIBR3-WT, WIBR3-TetOn-CDX2 and WIBR3-TetOn-Gata 4 were expanded in human nave pluripotency conditions termed HENSM, as described in Bayerl et al. Cell Stem Cell 2021. Briefly, HENSM medium: 240 mL Neurobasal (ThermoFisher 21103049) and 240 mL of DMEM-F12 without HEPES (ThermoFisher 21331020), 5 mL N2 supplement (ThermoFisher 17502048 or in-house prepared), 5 mL (1) GlutaMAX (ThermoFisher 35050061), 1% nonessential amino acids (BI 01-340-1B), 1% Penicillin-Streptomycin (BI 03-031-1B), 10 mL B27 supplement (Invitrogen 17504044), Geltrex (Invitrogen A1413202/A1413302-add 1 mL rapidly in media to obtain 0.2% final conc), 50 mg/ml Vitamin C (L-Ascorbic acid 2-phosphate sesquimagnesium salt hydrateSigma A8950), 20 ng/ml recombinant human LIF (Peprotech 300-05) and the following small molecule inhibitors: FGFRi/MEKi/ERKi (PD0325901 1.25 MAxon Medchem 1408); WNTi/TNKi (XAV939 2 MSigma X3004 or Axon Medchem 1527); PKCi (Go6983 2 MAxon Medchem 2466), SRCi (CGP77675 1.2 MAxon Medchem 2097). Secondary boosting components: P38i/JNKi (BIRB0796 0.8 MAxon Medchem 1358), ROCKi Y27632 (1.2 MAxon Medchem 1683), and ACTIVIN A (ACT) 10 ng/ml. Cells in HENSM were grown on 1% Growth factor reduced Matrigel (BD FAL356231) or 1% GELTREX (ThermoFisher A1413202 orA1413302) or Biolaminin-511 (Biolamina Inc; including for HENSM-XF conditions) coated plates for at least 1 hour in 37 C. After at least 4 passages in HENSM lines acquired uniform human nave pluripotency morphology and molecular validation as described in Bayerl et al. Cell Stem Cell 2021 and Gafni et al. Nature 2013.
[0934] Aggregation medium (AM)1:1 DMEM-F12 (Thermo 11320033) & Neurobasal (Thermo 21103049), Glutamax 1, Sodium pyruvate 1 mM, Pen/Strep 1, NEAA 1, N2 supplement 1 (Thermo 17502048), B27 supplement 1 (Thermo 17504044), beta-mercaptoethanol 0.1 mM (Thermo 31350010) and 0.45% BSA (SigmaAldrich A7979) (For 500 ml Total). The aggregation media was supplemented with Doxycycline (2 g/ml final concentration) and 5 M of Y27632 to increase cell survival for the first 24 hours.
[0935] Co-aggregation and culture-Co-aggregation was defined as time point 0 of the protocol and was made from three starting PSC cell types: [0936] WIBR3-WT nave human ESCs (To give rise to embryo proper); [0937] Dox pre-treated (16 hours) WIBR3-TetOn-Gata4 nave human ESCs (to give rise to extraembryonic primitive endoderm (Pre) lineage); and [0938] DOX pre-treated WIBR3-TetOn-CDX2 nave human ESCs (to give rise to entire extraembryonic trophectoderm lineage).
[0939] Before harvesting cells were pretreated with 20 M of ROCKi Y27632 to increase their survival after single cell passaging. Cells were dissociated into single cells with TryplE for 5 minutes at 37 C. Following, cells were resuspended in PBS, centrifuged, and rewashed with PBS and centrifuged again and PBS discarded, and resuspended in aggregation Media (AM). Following cell count, a total number of 36000 WIBR3-TetOn-Cdx2 and 12,000 WIBR3-TetOn-CDX2 human nave ESCs and 12000 WIBR3-WT (empty) nave human cells were added per well in 400 Microwell AggreWell 24 well plates. In 800 Microwell plates, 9000 WIBR3-TetOn-Cdx2 and 3000 WIBR3-TetOn-CDX2 human nave ESCs and 3000 WIBR3-WT (empty) nave human cells were added per well in AggreWell 24 well. The cell mixture was added as 1 ml per well (final volume of each well of 24 well is 1.5 ml). [0940] Day 0The plate was centrifuged at 100g for 3 minutes and this was marked as day 0, and then placed into static incubator at 37 C. 5% Co2 and 5% 02. [0941] On Day 1, 1 ml of media was gently aspirated from each well and replaced with pre-warmed 1 ml of fresh AM+DOX without ROCKi). This was repeated twice during that day to remove ROCKi. [0942] On Day 2, 1 ml of media was gently aspirated from each well and replaced with pre-warmed 1 ml of fresh AM+DOX. [0943] On days 3 and 4, 1 ml of media was gently aspirated from each well and replaced with pre-warmed 1 ml of fresh AM. [0944] On days 5-8, 1 ml of media was gently aspirated from each well and replaced with pre-warmed 1 ml of fresh EUCM2 (CMRL/advDMEM-F12 based) media with 20% FBS and transfer plate into 5% Co2 and 20% O2. [0945] On days 9-11, 1 ml of media was gently aspirated from each well and replaced with pre-warmed 1 ml of EUCM2 (CMRL/advDMEM-F12 based) media with 30% FBS. [0946] At day 12, embryos were transferred into non-adherent 6 wells plate onto a rotating shaker in static conditions each well with 3 ml EUCM3 (CMRL/advDMEM-F12 based) media with 20% HAS and 20% KSR at 5% Co2 and 20% O2. [0947] On days 13-15, 1.5 ml of media was gently aspirated from each well and replaced with pre-warmed 1.5 ml of EUCM3 (CMRL/advDMEM-F12 based) media with 20% HAS and 20% KSR. [0948] On days 16-18, 1.5 ml of media was gently aspirated from each well and replaced with pre-warmed 1.5 ml of EUCM4 (CMRL/advDMEM-F12 based) media with 30% HAS and 20% KSR. [0949] On days 19-21, 1.5 ml of media was gently aspirated from each well and replaced with pre-warmed 1.5 ml of EUCM5 (CMRL/advDMEM-F12 based) media with 40% HAS and 20% KSR. [0950] At day 22 onwardshigh quality embryos were selected and transferred into previously described ex utero roller culture system (Alejandro-Castrejon et al. Nature 2021) in fresh EUCM media supplemented with D-Glucose 4 mg/ml, sodium-pyruvate 1 mM and 1NEAA and incubated at 20% O.sub.2, 5% Co2 and 6.5 Psi, with the change from mouse EUCM to human embryo EUCM is that the human optimized one contains 50% HAS and 25% KSR (and no RAS).
Results
[0951] Nave human PSCs that transiently overexpress Cdx2 upon addition of DOX in the early stages of embryo aggregation protocol were generated, in order to induce their rapid priming and transition towards early trophectoderm (TE). In addition, nave human PSCs that transiently overexpress Gata4 upon addition of DOX in the early stages of embryo aggregation protocol were generated, in order to induce their rapid priming and transition towards the extraembryonic primitive endoderm lineage.
[0952] Following, co-aggregation of nave human PSCs with these two stem cell populations followed by ex-utero culturing enabled generation of organized embryos, as exemplified in
Example 5
Aggregation of Three Human Nave PSCs Subpopulations Generates an Organized Embryo
Materials and Methods
[0953] Doxycycline inducible expression lines were generated by the PiggyBac approach for transient ectopic expression of CDX2 (inducing trophectoderm lineage specification) and GATA4 (inducing primitive endoderm differentiation), as explained in Example 4 hereinabove. Following, these lines were kept in HENSM medium (5 ng/ml activin) on mouse embryonic fibroblasts. Both generated lines and the wild type line were synchronized to reach confluence on the same day. 24 hours prior to aggregation the iCDX2 line was transferred into TIM (trophoblast inducing media-N2B27 supplemented with PD0325901, A-83, LIF, LPA, Y27632) plus Doxycycline. The iGata4 line was transferred to aggregation medium (1:1 ratio neurobasal DMEM f12, sodium pyruvate, GlutaMAX, penicillin streptomycin, N2 Supplement, B27 supplement, BSA and b-mercaptoethanol) plus Y27632 and Doxycycline. Following 24 hours of induction the three cell lines were harvested using TrypLE enzyme centrifuged and re-suspended in MEF medium (DMEM, sodium pyruvate, Penicillin Streptomycin, L-Glutamine and 20% FBS), posteriorly cells were plated on gelatin coated plates for 30 minutes to deplete MEFs. Afterwards cells in suspension were collected and passed through a 70 m strainer and re-suspended in 1 ml for counting. Cells were plated in AggreWell 400 in concentrations of 36.9 iCDX2, 11.5 iGATA4, 11.5 nave stem cells (also referred to as WT) per 400 m microwell, on N2B27 medium supplemented with Y27632 (10 m final concentration) and Doxycycline, cells were centrifuged to ensure dropping on the microwells. Plate was incubated in a 5% oxygen incubator. Next day the medium was exchanged for N2B27 Medium with Doxycycline and the following day to N2B27 alone. On day +3 aggregates were transferred to a non-adherent 6-well plate (2400 aggregates per well) on EUCM2+20% FBS medium (In this Example, EUCM2 refers to Advanced DMEM f12, T3, extra D-Glucose, 1% CMRL, ITSX, Penicillin Streptomycin, GlutaMAX, progesterone, b-estradiol, n-acetyl-n Cysteine with the indicated percentage of FBS) on day +4 FBS was increased to 30%, on day +5 to 50% and on day +6 to 75%. A schematic representation of the protocol is shown in
Results
[0954] Co-aggregation of the three stem cell populations, all originating from nave ESCs/iPSCs as a starting material, followed by ex-utero culturing enabled generation of organized embryos, as exemplified in
[0955] Specifically, during the second half of day 3 and day 4 (
[0956] On day +5 (
[0957] On Day +6 (
[0958] On day +7 (
[0959] Interestingly, the equivalence between the culturing days and embryonic stages was as follows: Day 0PFD5; Day 1PFD6; Day 2PFD7; Day 3PFD8; Day 4PFD9; Day 5-PFD10; Day 6PFD11; Day 7PFD12; Day 8PFD 13; Day 9PFD14.
Example 6
Generation of Human Nave PSCs Transiently Expressing GATA4, CDX2 and/or GATA3
Materials and Methods
[0960] Gata4, Gata6, Cdx2, Gata3 inducible nave human pluripotent stem cells-A PiggyBac plasmid expressing a cDNA insert of choice under the control of a doxycycline-inducible promotor was designed (
[0961] Expansion and maintenance of human nave pluripotent cellsAs described in Example 4 hereinabove.
[0962] ImmunostainingAs described in Example 1 hereinabove. Antibodies used are shown in Table 1 herein below.
Results
[0963] Nave human PSCs that transiently overexpress Cdx2 or Gata3 upon addition of DOX in the early stages of embryo aggregation protocol were generated, in order to induce their rapid priming and transition towards early trophectoderm (TE). In addition, nave human PSCs that transiently overexpress Gata4 or GATA6 upon addition of DOX in the early stages of embryo aggregation protocol were generated, in order to induce their rapid priming and transition towards the extraembryonic primitive endoderm lineage. As shown in
Example 7
Alternative Conditions for Obtaining Mouse Nave PSCs as the Starting Population for Generating Embryos
[0964] Alternative conditions to generate nave PSCs as the starting population for generating organized embryos was were tested (
[0965]
[0966] WT ESCs were grown in one of the following media: [0967] (i) N2B27 2i/LIF: serum-free chemically defined N2B27-based media: 240 ml Neurobasal (ThermoFisher 21103049) and 240 ml of DMEM-F12 with HEPES (SIGMA D6421), 5 ml N2 supplement (Invitrogen; 17502048), 5-10 ml B27 supplement (Invitrogen; 17504044), 2 mM glutamine or 1 mM GLutamax (Invitrogen), 1% nonessential amino acids (Invitrogen), 0.1 mM -mercaptoethanol (Sigma), 1% penicillin-streptomycin (Invitrogen). Optionally, the medium also included 5 mg/ml BSA (Sigma). Nave 2i/LIF conditions for murine PSCs included 20 ng/ml recombinant human LIF (in-house made). 2i was added: small-molecule inhibitors CHIR99021 (CH, 3 MAxon Medchem) and PD0325901 (PD, 1 MAxon Medchem 1408). [0968] (ii) alternative 2i/LIF conditions (a2i or a2i-Lif conditions): serum-free chemically defined N2B27-based media: 240 ml Neurobasal (ThermoFisher 21103049) and 240 ml of DMEM-F12 with HEPES (SIGMA D6421), 5 ml N2 supplement (Invitrogen; 17502048), 5-10 ml B27 supplement (Invitrogen; 17504044), 2 mM glutamine or 1 mM GLutamax (Invitrogen), 1% nonessential amino acids (Invitrogen), 0.1 mM -mercaptoethanol (Sigma), 1% penicillin-streptomycin (Invitrogen). Optionally, the medium also included 5 mg/ml BSA (Sigma). Nave a2i/LIF conditions for murine PSCs included 20 ng/ml recombinant human LIF (in-house made). Small-molecule inhibitors CHIR99021 (CH, 3 MAxon Medchem) and SRCi CGP77675 1 microM, Axon 2097). This is an example of nave PSCs conditions that do not involve inhibitors of the FGF/MEK/ERK pathway. Validation of this alternative condition to obtain nave PSCs has been described in Choi, J., Huebner, A., Clement, K. et al. Nature 548, 219-223 (2017), www(dot)doi(dot)org/10.1038/nature23274. [0969] (iii) Extended potential LCDM media [as described in Yang et al. Cell (2017) 169 (2): 243-257, www(dot)cell(dot)com/fulltext/S0092-8674% 2817%2930183-6]. Serum-free chemically defined N2B27-based media: 240 ml Neurobasal (ThermoFisher 21103049) and 240 ml of DMEM-F12 with HEPES (SIGMA D6421), 5 ml N2 supplement (Invitrogen; 17502048), 5-10 ml B27 supplement (Invitrogen; 17504044), 2 mM glutamine or 1 mM GLutamax (Invitrogen), 1% nonessential amino acids (Invitrogen), 0.1 mM -mercaptoethanol (Sigma), 1% penicillin-streptomycin (Invitrogen). Optionally, the medium also included 5 mg/ml BSA (Sigma). LCDM (or also known as EPS) conditions for murine PSCs included 20 ng/ml recombinant human LIF (in-house made). Small-molecule inhibitors: CHIR 99021 (C, human: 1 mM, mouse: 3 mM; Tocris, 4423), (S)-(+)-Dimethindene maleate (D, 2 mM; Tocris, 1425) and Minocycline hydrochloride (M, 2 mM; Santa Cruz Biotechnology, sc-203339). [0970] (iv) Serum/Lif (15% FBS/LIF (LIF 10 ng/ml) DMEM based conditions. 450 ml DMEM (TermmoFisher 241965-039), 2 mM glutamine or 1 GLutamax (Invitrogen), 1 nonessential amino acids (NEAA) (Invitrogen), 1 penicillin-streptomycin (Invitrogen), 1% Sodium-pyruvate (BI 03-042-1B), supplemented with 15% (v/v) FBS (Gibco or Biological Industries).
To generate the synthetic embryos, three starting PSC cell types were co-aggregated: [0971] 1) Nave WT BVSC in either 2i/LIF, a2i/LIF, LCDM or serum/Lif conditions as indicated; [0972] 2) Nave iGata4 ESCs in either 2i/LIF, a2i/LIF, LCDM or serum/Lif conditions as indicated, and pre-treated with DOX (2 g/mlSigma D9891) in the same media for 24 hours prior to the co-aggregation; and [0973] 3) Nave iCdx2 ESCs in either 2i/LIF, a2i/LIF, LCDM or serum/Lif conditions as indicated, pre-treated with DOX (2 g/mlSigma D9891) for 24 hours prior to the co-aggregation (from day 1) in TSC media (25 ng/ml FGF4 (Peprotech), 1 /ml Heparin (Sigma)) supplemented with lysophosphatidic acid (LPA, a Hippo pathway inhibitor) 01 M.
[0974] Co-aggregation was defined as time point 0 of the protocol. At the day of aggregation (day 0), the three donor cell populations were trypsinized with 0.05% trypsin-EDTA solution (Biological IndustriesSartorius 03-053-1B) for 4 minutes at 37 C. Trypsin enzymatic reaction was stopped by adding aggregation media. Cells were centrifuged at 1200 rpm for 3 minutes and resuspended in aggregation medium with DOX (2 g/mlSigma D9891) and ROCKi Y27632 (5 nM final concentrationAxon Medchem 1683). Following, cells were plated on gelatinized tissue culture plates for mouse embryonic fibroblast depletion for 20 minutes at 37 C. Supernatant was collected, centrifuged and cells were resuspended. The three cell fractions were counted and resuspended in aggregation media with DOX (2 g/mlSigma D9891) and ROCKi Y27632 (5 nMAxon Medchem 1683). A ratio of (1 WT-ESCs:1 iGata4 ESC:3.33 iCdx2 ESC) was maintained in aggregation experiments, as follows:
TABLE-US-00004 Number of Number of added # of Cells microwells per well cells per each well per single in 24 well plate of a 24 well plate microwell AggreWell 300 1-iCDX2: 4800 cells ~27 cells 800 2-iGATA4: 1500 cells 3-WT ESC 1500 cells
[0975] 1 ml of cell-mix suspension was gently added drop wise to each well of the AggreWell plate followed by centrifugation at 700 rpm for 3 minutes and incubation at 37 C. (total end volume is 1.5 ml).
[0976] On the next day (day 1), 1 ml of media (out of total 1.5 ml) was gently removed from each well and replaced with 1 ml of preheated aggregation media with DOX (2 g/mlSigma D9891).
[0977] On day 2, 1 ml of media was removed from each well and replaced with 1 ml of preheated aggregation media.
[0978] On day 3, 1 ml of media was removed from each well and replaced with 1 ml of preheated EUCM2 media. In this example, EUCM2 media refers to: Advanced DMEM/F12 (GIBCO 21331-020), 5 ml CMRL media (1% final concentration) as a supplement (5mlGIBCO 11530037), extra added 1 mg/ml D (+)-Glucose Monohydrate (J.T. Baker0113) (add 500 mg per 500 ml media), 100 nM T3 (3,3,5-Triiodo-L-thyronine sodium salt) (Sigma-Aldrich, T6397), 1 mM Sodium pyruvate (Sigma-Aldrich, S8636), 1 mM GlutaMAX (GIBCO, 35050061), 1% penicillin streptomycin (Biological IndustriesSartorius 03-031-1B), 1 of ITS-X supplement (Thermo Fisher Scientific 51500-056), 8 nM B-estradiol (Sigma-Aldrich, E8875), 200 ng/ml progesterone (Sigma-Aldrich, P0130), 25 M N-acetyl-L-cysteine (Sigma-Aldrich, A7250)+20% FBS.
[0979] On day 4, the synthetic embryos were gently transferred to 6-well cell suspension culture plates (Greiner, 657185) with 5 ml of preheated EUCM2 media which comprises 30% FBS per well and placed on shaker rotation 60 rpm/min (Thermo 88881102+88881123).
[0980] On day 5, egg cylinder shape sEmbryos were picked and transferred to glass culture bottles (50-30 embryos per bottle) containing 2 mL of EUCM media (the contents of which are described in Example 1 hereinabove). Following, the bottles were placed on the rolling culture system previously described electronically controlled roller culture platform (Aguilera-Castrejon et al., 2021a), rotating at 30 revolutions per minute at 37 C., and continuously gassed with an atmosphere of 21% O.sub.2, 5% CO.sub.2 at 7-8 pounds per square inch (psi). A black non-transparent cloth was used to cover the incubator from light during unit operation.
[0981] From day 6 to day 8, 1 ml of EUCM was replaced with preheated 1 ml of EUCM and kept on rolling culture system. Culture media was pre-heated for at least an hour by placing it inside a glass bottle on the rotating culture.
[0982] As shown in
Example 8
A Two Steps Aggregation Protocol Enhances Efficiency of Embryos Formation
Materials and Methods
[0983] To generate the synthetic embryos, three starting PSC cell types were co-aggregated (
Co-aggregation was defined as time point 0 of the protocol.
[0987] At the day of aggregation (day 0) or one day later (day 1), either one or two or all three donor cell populations were trypsinized with 0.05% trypsin-EDTA solution (Biological IndustriesSartorius 03-053-1B) for 4 minutes at 37 C. Trypsin enzymatic reaction was stopped by adding aggregation media. Cells were centrifuged at 1200 rpm for 3 minutes and resuspended in aggregation medium with DOX (2 g/mlSigma D9891) and ROCKi Y27632 (5 nM final concentrationAxon Medchem 1683). Following, cells were plated on gelatinized tissue culture plates for mouse embryonic fibroblast depletion for 20 minutes at 37 C. Supernatant was collected, centrifuged and cells were resuspended. The cell fractions were counted and resuspended in aggregation media with DOX (2 g/mlSigma D9891) and ROCKi Y27632 (5 nMAxon Medchem 1683). A ratio of 1 Blue BVSc ESCs:1 Green-iGata4 ESC:3.33 Red-iCdx2 ESC was maintained in aggregation experiments, as follows:
TABLE-US-00005 Number of micro- Number of added cells # of Cells wells per well per each well per single in 24 well plate of a 24 well plate microwell AggreWell 300 1-Red-iCDX2: 4800 cells ~27 cells 800 2-Green-iGATA4: 1500 cells 3-Blue-WT ESC 1500 cells
[0988] 1 ml of cell-mix suspension was gently added drop wise to each well of the AggreWell plate followed by centrifugation at 700 rpm for 3 minutes and incubation at 37 C. (total end volume is 1.5 ml).
[0989] On the next day (day 1), 1 ml of media (out of total 1.5 ml) was gently removed from each well and replaced with 1 ml of preheated aggregation media with DOX (2 g/mlSigma D9891). When one or 2 of the cell fractions was added on day 1 instead of day 0, 1 ml of cell-mix suspension was gently added drop wise to each well of the AggreWell plate followed by centrifugation at 700 rpm for 3 minutes and incubation at 37 C. (total end volume is 1.5 ml).
[0990] On day 2, 1 ml of media was removed from each well and replaced with 1 ml of preheated aggregation media.
[0991] On day 3, 1 ml of media was removed from each well and replaced with 1 ml of preheated EUCM2 media. In this example, EUCM2 media refers to: Advanced DMEM/F12 (GIBCO 21331-020), 5 ml CMRL media (1% final concentration) as a supplement (5mlGIBCO 11530037), extra added 1 mg/ml D (+)-Glucose Monohydrate (J.T. Baker0113) (add 500 mg per 500 ml media), 100 nM T3 (3,3,5-Triiodo-L-thyronine sodium salt) (Sigma-Aldrich, T6397), 1 mM Sodium pyruvate (Sigma-Aldrich, S8636), 1 mM GlutaMAX (GIBCO, 35050061), 1% penicillin streptomycin (Biological IndustriesSartorius 03-031-1B), 1 of ITS-X supplement (Thermo Fisher Scientific 51500-056), 8 nM B-estradiol (Sigma-Aldrich, E8875), 200 ng/ml progesterone (Sigma-Aldrich, P0130), 25 M N-acetyl-L-cysteine (Sigma-Aldrich, A7250)+20% FBS.
[0992] On day 4, the synthetic embryos were gently transferred to 6-well cell suspension culture plates (Greiner, 657185) with 5 ml of preheated EUCM3 media per well and placed on shaker rotation 60 rpm/min (Thermo 88881102+88881123). In this example, EUCM3 media here (EUCM2 media but with 30% FBS is also known as EUCM3) refers to: Advanced DMEM/F12 (GIBCO 21331-020), 5 ml CMRL media (1% final concentration) as a supplement (5mlGIBCO 11530037), extra added 1 mg/ml D (+)-Glucose Monohydrate (J.T. Baker0113) (add 500 mg per 500 ml media), 100 nM T3 (3,3,5-Triiodo-L-thyronine sodium salt) (Sigma-Aldrich, T6397), 1 mM Sodium pyruvate (Sigma-Aldrich, S8636), 1 mM GlutaMAX (GIBCO, 35050061), 1% penicillin streptomycin (Biological IndustriesSartorius 03-031-1B), 1 of ITS-X supplement (Thermo Fisher Scientific 51500-056), 8 nM B-estradiol (Sigma-Aldrich, E8875), 200 ng/ml progesterone (Sigma-Aldrich, P0130), 25 M N-acetyl-L-cysteine (Sigma-Aldrich, A7250)+30% FBS.
[0993] On day 5, egg cylinder shape sEmbryos were picked and transferred to glass culture bottles (50-30 embryos per bottle) containing 2 mL of EUCM media (the contents of which are described in Example 1 hereinabove). Following, the bottles were placed on the rolling culture system previously described electronically controlled roller culture platform (Aguilera-Castrejon et al., 2021a), rotating at 30 revolutions per minute at 37 C., and continuously gassed with an atmosphere of 21% O.sub.2, 5% CO.sub.2 at 6-8 pounds per square inch (psi). A black non-transparent cloth was used to cover the incubator from light during unit operation.
[0994] From day 6 to day 8, 1 ml of EUCM was replaced with preheated 1 ml of EUCM and kept on rolling culture system. Culture media was pre-heated for at least an hour by placing it inside a glass bottle on the rotating culture.
Results
[0995] Four different regimens for co-aggregating the three mouse stem cell populations, all originating from nave ESCs/iPSCs as a starting material, followed by ex-utero culturing were evaluated (
Example 9
Generation of Trophectoderm Primed Cells by Inducing Endogenous Expression of Differentiation Factors in Nave PSCs
Materials and Methods
[0996] Generation of trophectoderm primed cells (
HENSM Media:
[0997] Primary Cytokines+inhibitors: [0998] 1:1 mix of Neurobasal (Invitrogen 21103-049) and DMEM/F12 (Invitrogen 21331)470 ml [0999] Pen-strep 5 ml (Biological Industries 03-033-1B) [1000] Glutamax5 ml (Invitrogen 35050061) [1001] NEAA5 ml (Biological Industries 01-340-1B) [1002] Sodium Pyruvate5 ml (Biological Industries 03-042-1B) [1003] 10 ml B27 supplement: Invitrogen 17504-044 or Xenofree A1486701 [1004] L-ascorbic acid 2-phosphate (SigmaA8960) (50 g/ml final concentration) (1 vial) [1005] Geltrex (Invitrogen A1413202/A1413302) or Matrigel1 ml rapidly in media (0.2% final conc.) [1006] 5 ml Commercial N2 supplement (Invitrogen 17502048) [1007] LIF (in house produced or Peprotech 300-05)20 ng/ml final [1008] WNTi-TNKi=XAV939 (Sigma X3004)2 M final [1009] PKCi Go6983 (Axon 2466)2 M final [1010] FGFRi-MEK1/2i-ERK1/2iPD0325901 (Axon 1408)1-1.2 M final [1011] SRCi CGP77675 (Axon 2097)1 M (1 vial=50 L). [1012] Optionally ACTIVIN A(Peprotech 120-14E)5 ng/ml final. [1013] Optionally ROCKi Y27632 (Axon 1683)1 M. [1014] Optionally BIRB796 P38i (0.4 M)
A 3 days protocol for human trophoblast induction from human PSCs (using media adapted from Shingo Io et al. (2021) Cell Stem Cell, 28 (6): 1023-1039 and Mitsuyoshi Amita et al. (2013) PNAS E1212-1221):
Step 1: In the first 24 hours (B)AP media was used: [1015] 1:1 mix of Neurobasal (Invitrogen 21103-049) and DMEM/F12 (Invitrogen 21331)470 ml [1016] Pen-strep 5 ml (Biological Industries 03-033-1B) [1017] Glutamax5 ml (Invitrogen 35050061) [1018] NEAA5 ml (Biological Industries 01-340-1B) [1019] Sodium Pyruvate5 ml (Biological Industries 03-042-1B) [1020] 10 ml B27 supplement: Invitrogen 17504-044 or Xenofree A1486701 [1021] L-ascorbic acid 2-phosphate (SigmaA8960) (50 g/ml final concentration) (1 vial) [1022] 5 ml Commercial N2 supplement (Invitrogen 17502048) [1023] (A) TGFRi A83-012 M final concentration (Axon Medchem A83-01) [1024] (P) FGFRi/MEKi/ERK PD03259012 M final concentration (Axon Medchem 1408) [FGFRi PD173074 0.5-1 M can be used instead] [1025] (J) human recombinant BMP4 10 ng/ml was optionally included (Peprotech 120-05ET or 120-05).
Step 2: In the following 48 hours (from day 2-day 3 of pretreatment) AP(J) media was used: [1026] 1:1 mix of Neurobasal (Invitrogen 21103-049) and DMEM/F12 (Invitrogen 21331)470 ml [1027] Pen-strep 5 ml (Biological Industries 03-033-1B) [1028] Glutamax5 ml (Invitrogen 35050061) [1029] NEAA5 ml (Biological Industries 01-340-1B) [1030] Sodium Pyruvate5 ml (Biological Industries 03-042-1B) [1031] 10 ml B27 supplement: Invitrogen 17504-044 or Xenofree A1486701 [1032] L-ascorbic acid 2-phosphate (SigmaA8960) (50 g/ml final concentration) (1 vial) [1033] 5 ml Commercial N2 supplement (Invitrogen 17502048) [1034] (A) TGFRi A83-012 M final concentration (Axon Medchem A83-01) [1035] (P) FGFRi/MEKi/ERK PD03259012 M final concentration (Axon Medchem 1408) [FGFRi PD173074 0.5-1 M can be used instead] [1036] (J) human JAK inhibitor I1 M final concentration was optionally included (Calbiochem 420099). [1037] Gelatin/irradiated MEF coated plates or Merck Silk Laminin-511 (Dilute 1:200 in PBC to get working solution: 2.5 microg/ml) can be used instead of the coated Geltrex or Matrigel coated plates.
[1038] ImmunostainingAs described in Example 1 hereinabove. Antibodies used are shown in Table 1 hereinbelow.
[1039] Gata3 inducible expression-A PiggyBac plasmid expressing a cDNA insert of choice under the control of a doxycycline-inducible promotor was designed (
[1040] PCRas described in in Example 1 hereinabove. List of primers is provided in Table 2 hereinbelow.
Results:
[1041] Examples 2-8 hereinabove describe generation of synthetic embryos by co-aggregation of three subpopulations of stem cells all originating from nave PSCs. The trophectoderm primed cells were obtained by transient expression of exogenous CDX2 or Gata3. In the next step, the present inventors developed culturing conditions of naive human PSCs allowing induced expression of endogenous differentiation factors leading to generation of the trophectoderm primed cells without the need for genetic modifications of the cells (
[1042] Immunostaining characterization of the human trophectoderm primed cells induced according to the protocol described hereinabove demonstrated expression of known trophectoderm markersCDX2, GATA2, Periostin, EOMES, CK7 and TFAP2C; and no expression of BST2, which marks extra-embryonic mesoderm and SYNDECAN1, which is known to emerge in later developed TSCs (
Example 10
Generation of Extra Embryonic Primitive Endodermal Primed Cells by Inducing Endogenous Expression of Differentiation Factors in Nave PSCs
Materials and Methods
[1043] Generation of extra embryonic primitive endodermal primed cells (
[1051] FACS analysisCell were immunostained with fluorescent labeled antibodies as indicated in Table 1 hereinbelow, washed with PBS and analyzed on FACS ARIA III and analyzed with a FACS DIVA software.
[1052] ImmunostainingAs described in Example 1 hereinabove. Antibodies used are shown in Table 1 hereinbelow.
[1053] Gata6 inducible expressionAs described in in Example 9 hereinabove but with Gata6 as an insert.
[1054] PCRA described in Example 1 hereinabove. List of primed is provided in Table 2 hereinbelow.
Results:
[1055] Examples 2-8 hereinabove describe generation of synthetic embryos by co-aggregation of three subpopulations of stem cells all originating from nave PSCs. The extra embryonic primitive endodermal primed cells (PRE) were obtained by transient expression of GATA4 or GATA6. In the next step, the present inventors developed culturing conditions of naive human PSCs allowing induced expression of endogenous differentiation factors leading to generation of the extra embryonic primitive endodermal primed cells without the need for genetic modifications of the cells.
[1056] FACS analysis with an anti-PDGFRa antibody after 6 days of induction in the indicated media (some of which were divided into two phases of 3 d and 3 d sequential media,
Example 11
Generation of Organized Synthetic Human Embryos
Materials and Methods
[1057] Co-aggregation and culture (
[1061] All three cell types were supplemented with 5 M ROCKi Y27632 before harvesting for co-aggregation on the next day.
[1062] Co-aggregation was defined as time point 0 of the protocol.
[1063] At the day of aggregation (day 0), AggreWell plates 400, 24 wells (Stemcell technologies) were prepared according to manufacturer instructions and prefilled with 500 L of N2B27 media and kept at 37 C. for medium equilibration. The three cell populations were disaggregated with TrypLE (Thermo Fisher 12604054) for 3 minutes for the WT and Primitive endoderm cells and 5 minutes for the Trophectoderm cells at 37 C. Following, the enzyme was removed and cells were incubated for two minutes at room temperature, afterwards cells were collected with PBS. Cells were centrifuged at 1300 rpm for 3 minutes and resuspended in N2B27 ROCKi Y27632 (10 M final concentration). Following, primitive endoderm cells were plated on gelatinized tissue culture plates for mouse embryonic fibroblast depletion for 30 minutes at 37 C. Supernatant was collected, and all three elements were centrifuged separately and cells were resuspended on N2B27 medium. The three cell fractions were counted and resuspended in N2B27 supplemented with ROCKi Y27632 (10 l). A ratio of 1:1:3 (WT:PRE:TE) was maintained in aggregation experiments, as follows:
TABLE-US-00006 Number of Number of added # of Cells microwells per well cells per each well per single in 24 well plate of a 24 well plate microwell AggreWell 1200 1-WT 27720 cells ~120 cells 400 2-PrE 27720 cells 3-TE 88560 cells
[1064] 0.5 ml of cell-mix suspension was gently added drop wise to each well of the AggreWell plate followed by centrifugation at 700 rpm for 3 minutes and incubation at 37 C. 5% O2 (total end volume is 1 ml).
[1065] On the next day (day 1), 900 L of medium were gently removed from each well and replaced with 1 ml of preheated N2B27 medium. The same procedure was repeated on day 2.
[1066] On day 3 aggregates were gently transferred to 6-well cell suspension culture plates (Greiner, 657185) with 3 ml of preheated EUCM2 (20%-30% FBs) media per well and placed on shaker rotation 60 rpm/min (Thermo 88881102+88881123). Plates were transferred to 21% O2 conditions.
[1067] On day 4, 2 ml of medium were gently removed per six-well and were placed with 2 ml of preheated EUCM2 (with 30% FBS). The same procedure was repeated on day 5
[1068] On day 6, 2 ml of medium were gently removed per six-well and were placed with 2 ml of preheated EUCM2 with 50% FBS. The same procedure was repeated on day 7.
[1069] ImmunostainingAs described in Example 1 hereinabove. Antibodies used are shown in Table 1 hereinbelow.
Results:
[1070] Examples 2-8 hereinabove describe generation of synthetic embryos by co-aggregation of three subpopulations of stem cells all originating from nave PSCs. The trophectoderm primed cells were obtained by transient expression of exogenous CDX2 or Gata3 and the extra embryonic primitive endodermal primed cells were obtained by transient expression of GATA4 or GATA6. Examples 9-10 hereinabove demonstrate culturing conditions of naive PSCs developed by the present inventors allowing induced expression of endogenous differentiation factors leading to generation of the two primed populations without the need for genetic modifications of the cells.
[1071] As exemplified in
Example 12
Generation of Organized Synthetic Rhesus Macaque Embryos
Materials and Methods
[1072] Generation of nave Rhesus Macaque PSCs-HENSM conditions made for human nave ESCs, were adapted for Rhesus Macaque (RM) nave ESC and iPSC line (RM1-ESC and RM1-iPSC lines), by reducing the SRCi concentration down from 1 M to 0.33 M. RM1-iPSc and RM1-ESC were expanded in primed FGF/TGF conditions on mouse irradiated MEFs or in TeSR primed conditions (stem cell technologies). Monkey nave ESC and iPSC nave lines were expanded for at least 3 passages in HENSM conditions either on plates coated with 1% GELTREX (Thermo A1413202/A1413302) or 1% Matrigel or Biolaminin511 (5 g/ml) or MEF/gelatin coated plates. Of note, cells were expanded in 5% O2, but it is also possible in 20% O2.
MENSMmonkey naive pluripotency media contained: [1073] 1:1 mix of Neurobasal (Invitrogen 21103-049) and DMEM/F12 (Invitrogen 21331)470 ml [1074] Pen-strep 5 ml (Biological Industries 03-033-1B) [1075] Glutamax5 ml (Invitrogen 35050061) [1076] NEAA5 ml (Biological Industries 01-340-1B) [1077] Sodium Pyruvate5 ml (Biological Industries 03-042-1B) [1078] 10 ml B27 supplement: Invitrogen 17504-044 or Xenofree A1486701 [1079] L-ascorbic acid 2-phosphate (SigmaA8960) (50 g/ml final concentration) (1 vial) [1080] Optional: Geltrex (Invitrogen A1413202/A1413302) or Matrigel1 ml rapidly in media (0.2% final conc.) [1081] 5 ml Commercial N2 supplement (Invitrogen 17502048) [1082] LIF (in house produced or Peprotech 300-05)20 ng/ml final [1083] WNTi-TNKi=XAV939 (Sigma X3004)2 M final [1084] PKCi Go6983 (Axon 2466)2 M final [1085] FGFRi-MEK1/2i-ERK1/2iPD0325901 (Axon 1408)1-1.2 M final [1086] SRCi CGP77675 (Axon 2097)0.33 M [1087] Optional: ACTIVIN A(Peprotech 120-14E)5-10 ng/ml final. [1088] Optional: BIRB0796 P38i (0.4 M)
[1089] Generation of trophectoderm primed cells and extra embryonic primitive endodermal primed cells (
[1093] Co-aggregation and culture (
TABLE-US-00007 Number of Number of added # of Cells microwells per well cells per each well per single in 24 well plate of a 24 well plate microwell AggreWell 1200 1-WT 27720 cells ~120 cells 400 2-PrE 27720 cells 3-TE 88560 cells
[1094] 0.5 ml of cell-mix suspension was gently added drop wise to each well of the AggreWell plate followed by centrifugation at 700 rpm for 3 minutes and incubation at 37 C. 5% O2 (total end volume is 1 ml).
[1095] On the next day (day 1), 900 L of medium were gently removed from each well and replaced with 1 ml of preheated N2B27 medium. The same procedure was repeated on day 2.
[1096] On day 3, aggregates were gently transferred to 6-well cell suspension culture plates (Greiner, 657185) with 3 ml of preheated EUCM2 (20%-30% FBS) media per well and placed on shaker rotation 60 rpm/min (Thermo 88881102+88881123). Plates were transferred to 21% 02 conditions.
[1097] On day 4, 2 ml of medium were gently removed per six-well and were placed with 2 ml of preheated EUCM 2 (with 30% FBS). The same procedure was repeated on day 5.
[1098] On day 6, 2 ml of medium were gently removed per six-well and were placed with 2 ml of preheated EUCM2 with 50% FBS. The same procedure was repeated on day 7.
Results:
[1099] Nave Rhesus Macaque (RM) PSCs were obtained. Phase Images show typical domed like morphology of RM1 nave hESCs expanded in NENSM conditions at the indicated passages (
[1100] Following, a subpopulation of nave RM1 iPSCs and RM1 ESCs were cultured for 3 days in RCL condition to induce extra embryonic primitive endodermal signature, and a second subpopulation of nave RM1 iPSCs and RM1 ESCs were cultured for 3 days in BAP-APJ protocol to induce trophectoderm signature (
As exemplified in
Example 13
Aggregation of Human Nave PSCs, Pre Cells and TSCs does not Generate an Organized Embryo
Materials and Methods
[1101] Derivation of a stable human TSC line from human nave ESCs expanded in human nave HENSM conditions-WIBR3 WT human female ESC line was expanded for at least 3 passages in HENSM media (as described in Example 9 hereinabove), either on plates coated with 1% GELTREX (Thermo A1413202/A1413302) or 1% Matrigel or Biolaminin511 (5 g/ml) or MEF/gelatin coated plates. Cells were expanded in 5% O2, but it is also possible in 20% O2.
[1102] Generation of trophectoderm stem cells (TSC)Human TSC line derived from WIBR3 nave ESCs at (Passage 5). The latter was generated by transferring human nave WIBR3 expanded in HENSM conditions into TSC media on MEF coated plates and serially passaged in TSC media and validated as TSC line. The TSC line was constitutively labeled with an RFP coding lentivirus (labeling it as RED). Human TSC media was previously described in Okae et al. (10.1016/j.stem.2017.11.004) with slight modifications: [1103] DMEM/F12 (Invitrogen 21331)470 ml [1104] 5 ml commercial N2 supplement (Invitrogen 17502048) [1105] 10 ml B27 supplement (Invitrogen 17504-044) [1106] Sodium Pyruvate5 ml (Biological Industries 03-042-1B) [1107] Pen-strep 5 ml (Biological Industries 03-033-1B) [1108] Glutamax5 ml (Invitrogen 35050061) [1109] NEAA5 ml (Biological Industries 01-340-1B) [1110] L-ascorbic acid 2-phosphate (SigmaA8960) (50 g/ml final concentration) (1 vial) [1111] Human EGF 50 ng/ml final concentration (Peprotech-AF-100-15) [1112] TGFRi A83-010.75-1 M final concentration (Axon Medchem A83-01) [1113] GSK3i CHIR990212 M (Axon medchem 1386) [1114] HDAC inhibitorVPA 0.2 mM final concentration (WAKO #227-01071) [1115] ROCKi Y27632 5 M. (Axon 1683) (1 vial)
[1116] Of note, the medium described in Okae et al. comprises 1 ml of FBS to get 0.2% final FBS, and instead of N2 supplement they use ITS-X supplement and 4 times higher concertation of VPA).
[1117] Co-aggregation and cultureThree starting cell types were co-aggregated: [1118] 1) Nave WT hESCs; [1119] 2) For the primitive endoderm compartmentNave WT cells were plated on mouse embryonic fibroblast conditions on HENSM supplemented with ROCKi 10 M (Axon Medchem 1683), next day medium was replaced by RCL medium, RCL was kept for 72 hours with 24-hour medium exchanges; and [1120] 3) Human TSCs
[1121] All three cell types were supplemented with 5 M ROCKi Y27632 before harvesting for co-aggregation on the next day. Co-aggregation was defined as time point 0 of the protocol. At the day of aggregation (day 0), Aggrewell plates 400, 24 wells (Stemcell Technologies) were prepared according to manufacturer instructions and prefilled with 500 L of N2B27 media and kept at 37 C. for medium equilibration. The three cell populations were disaggregated with TrypLE (Thermo Fisher 12604054) for 3 minutes for the WT and Primitive endoderm cells and 5 minutes for the TSC line cells at 37 C., next the enzyme was removed and cells were incubated for two minutes at room temperature, afterwards cells were collected with PBS. Cells were centrifuged at 1300 rpm for 3 minutes and resuspended in N2B27 ROCKi Y27632 (10 M final concentration). Following, primitive endoderm cells were plated on gelatinized tissue culture plates for mouse embryonic fibroblast depletion for 30 minutes at 37 C. The supernatant was collected, and all three elements were centrifuged separately, and cells were resuspended on N2B27 medium. The three cell fractions were counted and resuspended in N2B27 supplemented with ROCKi Y27632 (10 l). A ratio of 1:1:3 (WT:PRE:TE) was maintained in aggregation experiments, as follows:
TABLE-US-00008 Number of Number of added # of Cells microwells per well cells per each well per single in 24 well plate of a 24 well plate microwell AggreWell 1200 1-WT 27720 cells ~120 cells 400 2-PrE 27720 cells 3-TSC 88560 cells
[1122] 0.5 ml of cell-mix suspension was gently added drop wise to each well of the AggreWell plate followed by centrifugation at 700 rpm for 3 minutes and incubation at 37 C. 5% O2 (total end volume is 1 ml).
[1123] TSCs were introduced in day 0, day 1 and day 2 of the protocol, and protocol adjustment was done accordingly.
[1124] The next day (day 1) 900 L of medium were gently removed from each well and replaced with 1 ml of preheated N2B27 medium. Same procedure was repeated on day 2.
[1125] On day 3 aggregates were gently transferred to 6-well cell suspension culture plates (Greiner, 657185) with 3 ml of preheated EUCM2 (20%-30% FBs) media per well and placed on shaker rotation 60 rpm/min (Thermo 88881102+88881123). Plates were transferred to 21% O2 conditions.
[1126] On day 4, 2 ml of medium were gently removed per six-well and were placed with 2 ml of preheated EUCM 2 (with 30% FBS). Same procedure was repeated on day 5
[1127] On day 6, 2 ml of medium were gently removed per six-well and were placed with 2 ml of preheated EUCM2 with 50% FBS. Same procedure was repeated on day 7.
[1128] ImmunostainingAs described in Example 1 hereinabove. Antibodies used are shown in Table 1 hereinbelow.
Results:
[1129] Human nave WIBr3 ESCs expanded at least 3 passages in HENSM conditions were then transferred into TSC media, and after 3 passages a stable TSC line could be established and passaged for at least 70 more times. Cells were passaged every 5 days with TryplE. Immunostaining confirmed human TSC identity: human TSC cells were CDx2 negative, Cytokeratin7 (CK7) Positive and GATA3/TFAP2C positive consistent with previous reports. 10.1016/j.stem.2017.11.004 and 10.1016/j.stemcr.2022.09.008 (
[1130] As shown in
Example 14
Derivation of a Novel Mouse Extraembryonic Primitive Endodermal Primed Cell
[1131] Generation of extra embryonic primitive endodermal primed cells (PRE) originating from mouse nave ESCs/iPSCs which can be permanently expanded in culture-Previously PRE cells were described to be derived from mouse E3.5 blastocysts (and not from ESCs or iPSCs) (DOI: 10.1126/science.aay3325) and the media used was a commercial base whose base is not commercially disclosed (StemFit Basic02 (Ajinomoto) supplemented with: CHIR99021 10 M, FGF4 50 ng/ml, PDGF 25 ng/ml and Heparin 1 g/ml) and 10 M REPROCELL (Reprocell).
[1132] To derive PRE cells from in vitro expanded mouse ESCs and iPSCs that that can be permanently expanded in PRE media, three strategies were used (
[1133] In the top and middle panels of
[1134] When iGata4 cells were used (top panel of
[1135] In both top and middle panels of
[1136] In the bottom panel of
[1137] In the bottom panel of
[1138] Generation of synthetic embryosTo generate the synthetic embryos, three starting cell types were co-aggregated: [1139] 1) nave WT BVSC in 2i/LIF, as indicated. [1140] 2) CD1 iPSc derived Pre cell line expanded in PRE media as described hereinabove. [1141] 3) nave iCdx2 ESCs in 2i/LIF, pretreated with DOX (2 g/mlSigma D9891) for 24 h before aggregation (from day 1) in TSC media (25 ng/ml FGF4 (Peprotech), 1 /ml Heparin (Sigma)) supplemented with lysophosphatidic acid (LPA, a Hippo pathway inhibitor) 01 M.
[1142] Co-aggregation was defined as time point 0 of the protocol
[1143] At the day of aggregation (day 0), the three donor cell populations were trypsinized with 0.05% trypsin-EDTA solution (Biological IndustriesSartorius 03-053-1B) for 4 minutes at 37 C. Trypsin enzymatic reaction was stopped by adding aggregation media. Cells were centrifuged at 1200 rpm for 3 minutes and resuspended in aggregation medium with DOX (2 g/mlSigma D9891) and ROCKi Y27632 (5 nM final concentrationAxon Medchem 1683). Following, cells were plated on gelatinized tissue culture plates for mouse embryonic fibroblast depletion for 20 minutes at 37 C. Supernatant was collected, centrifuged and cells were resuspended. The three cell fractions were counted and resuspended in aggregation media with DOX (2 g/mlSigma D9891) and ROCKi Y27632 (5 nMAxon Medchem 1683). A ratio of (1 WT-ESCs:1 Pre cells: 3.33 iCdx2 ESC) was maintained in aggregation experiments, as follows:
TABLE-US-00009 Number of Number of added # of Cells microwells per well cells per each well per single in 24 well plate of a 24 well plate microwell AggreWell 300 1-iCDX2: 4800 cells ~27 cells 800 2-Pre cells: 1500 cells 3-WT ESC 1500 cells
[1144] 1 ml of cell-mix suspension was gently added drop wise to each well of the AggreWell plate followed by centrifugation at 700 rpm for 3 minutes and incubation at 37 C. (total end volume is 1.5 ml).
[1145] On the next day (day 1), 1 ml of media (out of total 1.5 ml) was gently removed from each well and replaced with 1 ml of preheated aggregation media with DOX (2 g/mlSigma D9891).
[1146] On day 2, 1 ml of media was removed from each well and replaced with 1 ml of preheated aggregation media.
[1147] On day 3, 1 ml of media was removed from each well and replaced with 1 ml of preheated EUCM2 media. In this example, EUCM2 media refers to: Advanced DMEM/F12 (GIBCO 21331-020), 5 ml CMRL media (1% final concentration) as a supplement (5mlGIBCO 11530037), extra added 1 mg/ml D (+)-Glucose Monohydrate (J.T. Baker0113) (add 500 mg per 500 ml media), 100 nM T3 (3,3,5-Triiodo-L-thyronine sodium salt) (Sigma-Aldrich, T6397), 1 mM Sodium pyruvate (Sigma-Aldrich, S8636), 1 mM GlutaMAX (GIBCO, 35050061), 1% penicillin streptomycin (Biological IndustriesSartorius 03-031-1B), 1 of ITS-X supplement (Thermo Fisher Scientific 51500-056), 8 nM B-estradiol (Sigma-Aldrich, E8875), 200 ng/ml progesterone (Sigma-Aldrich, P0130), 25 M N-acetyl-L-cysteine (Sigma-Aldrich, A7250)+20% FBS.
[1148] On day 4, the synthetic embryos were gently transferred to 6-well cell suspension culture plates (Greiner, 657185) with 5 ml of preheated EUCM2 media containing 30% FBS per well and placed on shaker rotation 60 rpm/min (Thermo 88881102+88881123).
[1149] On day 5, egg cylinder shape sEmbryos were picked and transferred to glass culture bottles (50-30 embryos per bottle) containing 2 mL of EUCM media (the contents of which are described in Example 1 hereinabove). Following, the bottles were placed on the rolling culture system previously described electronically controlled roller culture platform (Aguilera-Castrejon et al., 2021a), rotating at 30 revolutions per minute at 37 C., and continuously gassed with an atmosphere of 21% O.sub.2, 5% CO.sub.2 at 7-8 pounds per square inch (psi). A black non-transparent cloth was used to cover the incubator from light during unit operation.
[1150] From day 6 to day 8, 1 ml of EUCM was replaced with preheated 1 ml of EUCM and kept on rolling culture system. Culture media was pre-heated for at least an hour by placing it inside a glass bottle on the rotating culture.
[1151] FACS analysisCell were immunostained with fluorescent labeled antibodies as indicated in Table 1 hereinbelow, washed with PBS and analyzed on FACS ARIA III and analyzed with a FACS DIVA software.
[1152] ImmunostainingAs described in Example 1 hereinabove.
Results:
[1153] The present inventors obtained novel extra embryonic primitive endodermal primed cells (PRE) originating from mouse nave ESCs/iPSCs which can be permanently expanded in culture without losing their phenotype (
[1154] As exemplified in
Example 15
Generation of Organized Synthetic Human Embryos
Materials and Methods
[1155] Co-aggregation and culture (
[1159] All three cell types were supplemented with 5 M ROCKi Y27632 before harvesting for co-aggregation on the next day. Co-aggregation was defined as time point 0 of the protocol. At the day of aggregation (day 0), Aggrewell plates 400, 24 wells (Stemcell Technologies) were prepared according to manufacturer instructions and prefilled with 500 L of N2B27 media and kept at 37 C. for medium equilibration. The three cell populations were disaggregated with TrypLE (Thermo Fisher 12604054) for 3 minutes for the WT and Primitive endoderm cells and 5 minutes for the Trophectoderm cells at 37 C., next the enzyme was removed and cells were incubated for two minutes at room temperature, afterwards cells were collected with PBS. Cells were centrifuged at 1300 rpm for 3 minutes and resuspended in N2B27 ROCKi Y27632 (10 M final concentration). Following, primitive endoderm cells were plated on gelatinized tissue culture plates for mouse embryonic fibroblast depletion for 30 minutes at 37 C. Supernatant was collected, and all three elements were centrifuged separately and cells were resuspended on N2B27 medium. The three cell fractions were counted and resuspended in N2B27 supplemented with ROCKi Y27632 (10 l). A ratio of 1:1:3 (WT:PRE:TE) was maintained in aggregation experiments, as follows:
TABLE-US-00010 Number of Number of added # of Cells microwells per well cells per each well per single in 24 well plate of a 24 well plate microwell AggreWell 1200 1-WT 27720 cells ~120 cells 400 2-PrE 27720 cells 3-TE 88560 cells
[1160] 0.5 ml of cell-mix suspension was gently added drop wise to each well of the AggreWell plate followed by centrifugation at 700 rpm for 3 minutes and incubation at 37 C. 5% O2 (total end volume is 1 ml).
[1161] On the next day (day 1), 900 L of medium were gently removed from each well and replaced with 1 ml of preheated N2B27 medium. Same procedure was repeated on day 2.
[1162] On day 3 aggregates were gently transferred to 6-well cell suspension culture plates (Greiner, 657185) with 3 ml of preheated EUCM2 (20%-30% FBs) media per well and placed on shaker rotation 60 rpm/min (Thermo 88881102+88881123). Plates were transferred to 21% O2 conditions.
[1163] On day 4, 2 ml of medium were gently removed per six-well and were placed with 2 ml of preheated EUCM 2 (with 30% FBS). The same procedure was repeated on day 5
[1164] On day 6, aggregates were collected and transferred into 4 ml of H-EUCM media and placed in Ex Utero electronically controlled Ex Utero Culture Device. Every 24 hours, aggregates were transferred into a new bottle with fresh 4 ml of HEUCM media until day 8 or later.
[1165] Electronically controlled ex utero roller culture platform (
[1166] Adequate and stable control of the pressure of the gas flowing from the mixing box outlet into the water bottle inside the incubator should be measured by using a pressure gauge before each experiment. The main components of the system are the following: Oxygen and CO.sub.2 controller, pressure pump, vacuum pump, oxygen and CO.sub.2 sensors, power supply, check valve, mix gas box, pressure transmitter, limit flow, adapter control for gases, 1 m filters, centrifugal blower. Gas flows from the mix box through the inlet into the water bottle, and the speed of gas flowing into the bottle can be controlled with a valve on the lid of the water bottle. The bubble rate (which indicates the speed of gas flowing into the bottles) can be adjusted as needed by the user by closing/opening the valve. Ideally, the flow of bubbles should be such to allow formation of individual bubbles at a rate of 3-4 bubbles per second in the water-filled test tube outlet, or to the first point where continuous bubbling is observed. Humidified gas circulates to a glass test tube and then to the inside of the bottles in the rotating drum. Gas flow speed can be monitored by the rate of bubbles created inside the outlet water-filled test tube. A black nontransparent cloth is used cover the incubator to provide phototoxicity protection for the ex utero cultured embryos and sEmbryos.
[1167] H-EUCM is based on EUCM was previously established in Aguilera-Castrejon (Aguilera-Castrejon et al., 2021) for mouse embryos, with adaptation to be more suitable for human sEmbryos. Specifically, the H-EUCM is composed of: [1168] 1) 25% DMEM (GIBCO 11880DMEM, low glucose, with pyruvate, no glutamine, no phenol red (and no HEPES)) or Advanced DMEM-F12 (Invitrogen 12634010) or CMRL (Invitrogen 11530037) or TCM199 media (Gibco 11150059 or Sigma M2520); [1169] 2) 50% Fetal Bovine Serum (FBS) (GIBCO) and 25% Human Umbilical Cord Blood Serum (HUS) (or Human Adult Blood Serum (HAS)) that is prepared in-house; and [1170] 3) supplemented with a final concentration of 1 GlutaMAX (GIBCO, 35,050,061), 50 units/ml penicillin50 mg/ml streptomycin (Biological industries, 030311B), extra added 1 mM sodium pyruvate (Biological industries, 030421B), extra added 4 mg/mL of D-glucose (J.T. Baker), and added HEPES (11 mM final concentration) (GIBCO 15630056). Alternatively, EUCM2 media composed of 50% FBS or 50% FBs and 25% HAS could also be used in the roller culture on days 6 onwards.
Results:
[1171] Co-aggregation of the nave PSCs with the two stem cell populations, followed by ex-utero culturing according to the protocols described hereinabove and in
Example 16
Generation of Organized Synthetic Human Embryos
Materials and Methods
[1172] Co-aggregation and culture (
[1175] Both cell types were supplemented with 5 M ROCKi Y27632 before harvesting for co-aggregation on the next day. Co-aggregation was defined as time point 0 of the protocol. At the day of aggregation (day 0), Aggrewell plates 400, 24 wells (Stemcell Technologies) were prepared according to manufacturer instructions and prefilled with 500 L of N2B27 media and kept at 37 C. for medium equilibration. The two cell populations were disaggregated with TrypLE (Thermo Fisher 12604054) for 3 minutes for the WT PSC cells and 5 minutes for the Trophectoderm cells at 37 C., next the enzyme was removed and cells were incubated for two minutes at room temperature, afterwards cells were collected with PBS. Cells were centrifuged at 1300 rpm for 3 minutes and resuspended in N2B27 ROCKi Y27632 (10 M final concentration). The supernatant was collected, and all elements were centrifuged separately, and cells were resuspended on N2B27 medium. The two cell fractions were counted and resuspended in N2B27 supplemented with ROCKi Y27632 (10 l). A ratio of 2:3 (WT:TE) was maintained in aggregation experiments, as follows:
TABLE-US-00011 Number of Number of added # of Cells microwells per well cellsper each well per single in 24 well plate of a 24 well plate microwell AggreWell 1200 1-WT 55440 cells ~120 cells 400 2-TE 88560 cells [1176] 0.5 ml of cell-mix suspension was gently added drop wise to each well of the AggreWell plate followed by centrifugation at 700 rpm for 3 minutes and incubation at 37 C. 5% O2 (total end volume is 1 ml).
[1177] On the next day (day 1), 900 L of medium were gently removed from each well and replaced with 1 ml of preheated N2B27 medium. The same procedure was repeated on day 2.
[1178] On day 3 aggregates were gently transferred to 6-well cell suspension culture plates (Greiner, 657185) with 3 ml of preheated EUCM2 (20%-30% FBs) media per well and placed on shaker rotation 60 rpm/min (Thermo 88881102+88881123). Plates were transferred to 21% O2 conditions.
[1179] On day 4, 2 ml of medium were gently removed per six-well and were placed with 2 ml of preheated EUCM 2 (with 30% FBS). The same procedure was repeated on day 5.
[1180] On day 6, aggregates were collected and transferred into 4 ml of H-EUCM media and placed in Ex Utero electronically controlled Ex Utero Culture Device. Every 24 hours, aggregates were transferred into a new bottle with fresh 4 ml of HEUCM media until day 8 or later.
[1181] Electronically controlled ex utero roller culture platform (
Results:
[1182] Co-aggregation of the nave PSCs with the trophectoderm-primed population, followed by ex-utero culturing according to the protocols described hereinabove and in
TABLE-US-00012 TABLE 1 Primary antibodies Working Ab name Conc. Volume Aliquots Cat no. Type Host Company dilution Oct4 (C-10 clone) 200 g/ml 100 l No SC5279 Monoclonal Mouse Santa cruz 1:100 E-cadherin [HECD-1] 0.05 mg/ml 500 l No ab1416-500 Monoclonal Mouse abcam 1:200 PDGFR-A 0.5 mg/ml 100 l No 14-140-182 Monoclonal Rat eBioscience Gata4 1 mg/ml 100 l 5 l ab84593 Polyclonal Rabbit abcam 1:100/1:200 CDX2 0.1 mg/ml 100 l #3977 Polyclonal Rabbit Cell signaling 1:100/1:200 GFP ND 50 l 10 l ab290 Polyclonal Rabbit abcam 1:250-1:500 GFP 1 mg/ml 100 l 10 l ab6673 Polyclonal Goat abcam 1:250 MF 20-s (myosin) 26 g/ml 1 ml 100 l monoclonal Hybridoma DHSB 1:250 human/mouse CDX2 50 mg/ml 1 ml 50 l AU392A-UC monoclonal mouse Biogenex 1:100 mSox2 0.2 mg/ml 100 l 25 l AF2018 polyclonal Goat R&D 1:200 Gata4 0.2 mg/ml 1 ml No sc-1237 polyclonal Goat Santa Cruz 1:200 Nanog 0.5 mg/ml 8 l 14-5761 polyclonal Rat eBioscience 1:250-1:500 SOX9 1 mg/ml 100 ug No ab5535 polyclonal Rabbit Millipore 1:100-1:200 Anti-PKC (H-1) 0.2 mg/ml 1 ml N/A sc-17781 Monoclonal Mouse Santa Cruz Anti-AP-2 (3B5) 0.2 mg/ml 1 ml N/A sc-12726 Monoclonal Mouse Santa Cruz Gata4 0.2 mg/ml 1 ml sc-25310 Monoclonal Mouse Santa Cruz 1:100 Gata4 0.5 mg/ml 100 ug 14-9980-82 Monoclonal Rat invitrogen Anti-PKC (H-1) 0.2 mg/ml 1 ml N/A sc-17781 Monoclonal Mouse Santa Cruz Anti-TFAP2a 0.2 mg/ml 1 ml N/A sc-12726 Monoclonal Mouse Santa Cruz (AP-2) (3B5) Human Otx2 0.2 mg/ml 500 l 20 l AF1979 Polyclonal Goat R&D 1:200 Pax6 2 mg/ml 100 l not Poly901301 Polyclonal Rabbit Biolegend 1:100 aliquoted TUJ1 1 mg/ml 250 ul not 801202 monoclonal Mouse Biolegend 1:100 aliquoted FOXA2 ND 100 l 10 ul ab108422 Monoclonal Rabbit abcam 1:100 TBR2 (EOMES) 1 mg/ml 100 l 8 l AB2283 Polyclonal Rabbit millipore 1:50 Low signal Sox17 0.2 mg/ml 100 l 10 l AF1924 Polyclonal Goat R&D 1:100-1:50 Lefty 1 mg/ml 100 l 10 l ab22569 Polyclonal Rabbit abcam 1:100 Brachyury(D2Z3J) 100 l #81694 monoclonal Rabbit Cell signaling 1:100 mAb Human KLF17 0.5 mg/ml 100 l 10 l ab84196 Polyclonal Rabbit abcam [N-terminus 2-51 aa Human KLF17 400 l 20 l ab174956 Polyclonal Rabbit abcam [C-terminus 250-279 aa] (KLF17 C)] Human KLF17 0.6 mg/ml 100 ul HPA024629 Polyclonal Rabbit sigma TFAP2c (AP2) #2320 Polyclonal rabbit cell signaling Middle background Myosin heavy chain 0.2 mg/ml 500 l 20 l MAB470 monoclonal mouse R&D 1:250 (clone MF20) CK8 Cytokeratin 8 1 mg/ml 100 ul MABT329 monoclonal Rat Millipore Lefty 0.2 mg/ml 500 l 20 l AF746 polyclonal Goat R&D 1:100 mCHERRY/tdTomato 10 ul AB0040200 polyclonal Goat SICGEN 1:200 ANTIBODIES TBR2/Eomes 1 mg/ml 100 ul 5 ul ab23345 Polyclonal Rabbit abcam 1:50/1:100 Cdx2 1 mg/ml 100 ul 5 ul ab76541 Monoclonal Rabbit abcam 1:200/1:500 DKK1 0.2 mg/ml 500 ul 20 ul AF1096 Polyclonal Goat R&D 1:100 AP2gamma (Tfap2c) 0.2 mg/ml 500 ul 10 ul AF5059 monoclonal Goat R&D 1:100/1:200 cytokeratin7 CK7 100 ul 9 ul ab181598 Monoclonal Rabbit abcam 1:200 NR2F2 100 ul 9 ul ab211776 Monoclonal Rabbit abcam nanog 100 ul 9 ul ab109250 Monoclonal Rabbit abcam TBX3 100 ul 9 ul ab99302 Monoclonal Rabbit abcam Mouse Anti-Zo-1 0.5 mg/mL 100 ul Zy-339100 Monoclonal Mouse invitrogen 1:200 Brachyury 0.2 mg/ml 100 l 10 l AF2085 Polyclonal Goat R&D 1:100 Lefty 0.2 mg/ml 500 l 20 l AF746 polyclonal Goat R&D 1:100 RUNX1/AML1 100 ul 5 ul ab240639 Monoclonal Rabbit Abcam 1:100 [clone EPR23044-100] HOXB4 100 ul 5 ul ab133521 Monoclonal Rabbit Abcam 1:100 [clone EPR1917] FoxG1 0.57 mg/ml 100 ul 6 ul ab196868 Monoclonal Rabbit abcam 1:100 (clone EPR18987) GATA3 AF2605 Polyclonal Goat R&D 1:200 GATA3 MA1-028 monoclonal Mouse invitrogen 1:200 Anti hCG beta 0.2 mg/ml 100 ul 10 ul ab9582 Monoclonal Mouse abcam 1:200 Anti-PKC (H-1) 0.2 mg/ml 1 ml N/A sc-17781 Monoclonal Mouse Santa Cruz Anti-AP-2 (3B5) 0.2 mg/ml 1 ml N/A sc-12726 Monoclonal Mouse Santa Cruz Cerberus 1 0.2 mg/ml 200 ul 7.5 ul AF1075 Polyclonal Goat R&D TROP-2 0.2 mg/ml 200 ul 7.5 ul MAB650 Polyclonal Goat R&D [Clone 77220] Gata6 (clone D61E4) 100 ul Not #5951 Monoclonal Rabbit Cell Signaling aliquoted Blimp1/PDRI-BF1 100 ul Not #9115 Monoclonal Rabbit Cell Signaling [Clone C14A4] aliquoted E-Cadherin 100 ul Not #3195 Monoclonal Rabbit Cell Signaling [Clone 24E10] aliquoted Collagen VI 100 ul 7 ul ab6588 Polyclonal Rabbit Abcam Wnt5a [Clone 24E10] 100 ul 7 ul ab235966 Polyclonal Rabbit Abcam Cytokeratin 7 100 ul 7 ul ab68459 Monoclonal Rabbit Abcam 1:200 [EPR1619Y] FoxA1 [clone 1B1] 1 mg/ml 200 ul 7.5 ul ab55178 Monoclonal Mouse Abcam VEGFR2/KDR/Flk-1 0.2 mg/ml 200 ul 10 ul AF357 Polyclonal Goat R&D Oct3/4 0.2 mg/ml 200 ul 7.5 ul AF1759 Polyclonal Goat R&D Gata6 0.2 mg/ml 500 ul 10 ul AF1700 Polyclonal Goat R&D Syndecan1 [EPR6454] 100 ul 5.5 ul ab128936 Monoclonal Rabbit Abcam 1:250/1:500 Islet1 [EP4182] 100 ul 5.5 ul ab109517 Monoclonal Rabbit Abcam PDGFR-alpha 100 ul 5.5 ul ab230457 Polyclonal Rabbit Abcam PDGFR-alpha 100 ul 5.5 ul ab134123 Monoclonal Rabbit Abcam [EPR5480] MIXL1 100 ul 5.5 ul HPA005662 Polyclonal Rabbit SIGMA Nidogen-2 100 ul 5.5 ul AF3385 Polyclonal Goat R&D GABRP 0.5 mg/ml 100 ul 6.5 ul PA5-46830 Polyclonal Rabbit Invitrogen Hesx1 100 ul 6.5 ul ab246949 Polyclonal Rabbit Abcam Periostin 0.5 mg/ml 100 ul 10 ul ab14041 Polyclonal Rabbit Abcam Vimentin [RV202] 1 mg/ml 100 ul 10 ul ab8978 Monoclonal Mouse Abcam Tetherin/BTS2 0.75 mg/ml 100 ul 10 ul ab243230 Monoclonal Rabbit Abcam [EPR20202] GATA2 [EPR2822] 0.325 mg/ml 100 ul 10 ul ab109241 Monoclonal Rabbit Abcam
TABLE-US-00013 TABLE2 Listofprimers: Primer Sequence SEQIDNO: Primer:humanGATA2 ACTGACGGAGAGCATGAAGAT 131 (Forward): Primer:humanGATA2 CCGGCACATAGGAGGGGTA 132 (Reverse): Primer:humanGATA3 GCCCCTCATTAAGCCCAAG 133 (Forward): Primer:humanGATA3 TTGTGGTGGTCTGACAGTTCG 134 (Reverse): Primer:humanENPEP TCCCAAAGAATACGGAGCACT 135 (Forward): Primer:humanENPEP TCATGGGGACAGACTTCTCAA 136 (Reverse): Primer:humanELF5 TAGGGAACAAGGAATTTTTCGGG 137 (Forward): Primer:humanELF5 GTACACTAACCTTCGGTCAACC 138 (Reverse): Primer:humanDAB2 ACCACCCTTTCACAAGCAAC 139 (Forward): Primer:humanDAB2 TGTGCCCATTTGCAATTCTA 140 (Reverse): Primer:humanTACSTD2 ACAACGATGGCCTCTACGAC 141 (Forward): Primer:humanTACSTD2 AGTTCACGCACCAGCACAC 142 (Reverse): Primer:humanTFAP2A GTTACCCTGCTCACATCACTAG 143 (Forward): Primer:humanTFAP2A TCTTGTCACTTGCTCATTGGG 144 (Reverse): Primer:humanSIGLEC6 TCACAACCCTGGTTTTCCTC 145 (Forward): Primer:humanSIGLEC6 CTGTCTGGAACTGGTGCTGA 146 (Reverse): Primer:humanCDX2-F TCACCATCCGGAGGAAAGCC 147 (Forward): Primer:humanCDX2-R CTCTCCTTTGCTCTGCGGTT 148 (Reverse): Primer:humanHAND1 CCAAGGATGCACAGTCTGG 149 (Forward): Primer:humanHAND1 AGGAGGAAAACCTTCGTGCTG 150 (Reverse): Primer:humanTFAP2C ACGAAATGAGATGGCAGCTAGGAAGA 151 (Forward): Primer:humanTFAP2C TGTCCGGTCTTGGCTGAGAAGTTC 152 (Reverse): Primer:humanABCG2 ACGAACGGATTAACAGGGTCA 153 (Forward): Primer:humanABCG2 CCTCCAGACACACCACGGATA 154 (Reverse): Primer:humanKRT19 ACCTGGAGATGCAGATCGAA 155 (Forward): Primer:humanKRT19 AATCCACCTCCACACTGACC 156 (Reverse): Primer:humanVGLL1 TGCCTCCCGGCTCAGTTCACT 157 (Forward): Primer:humanVGLL1 CCCAGTGGTTTGGTGGTGTA 158 (Reverse): Primer:humanNR2F2 GCCATAGTCCTGTTCACCTCA 159 (Forward): Primer:humanNR2F2 AATCTCGTCGGCTGGTTG 160 (Reverse): Primer:humanSOX17 TGGCGCAGCAGAATCCAGAC 161 (Forward): Primer:humanSOX17 TTGGGGTGGTCCTGCATGTG 162 (Reverse) Primer:humanPDGFR- TGCCTGACATTGACCCTGT 163 alpha(Forward): Primer:humanPDGFR- CCGTCTCAATGGCACTCTC 164 alpha(Reverse): Primer:humanCXCR4 CCTGCCTGGTATTGTCATCC 165 (Forward): Primer:humanCXCR4 GATGGGGATGATTGTGGTCT 166 (Reverse): Primer:humanHHEX1 GCGGACGGTGAACGACTA 167 (Forward): Primer:humanHHEX1 GGCCGCCTTTCCTTTTAT 168 (Reverse): Primer:humanGSC CCTCCGCGAGGAGAAAGT 169 (Forward): Primer:humanGSC CGTTCTCCGACTCCTCTGAT 170 (Reverse): Primer:human GTGTCAGGCTTGAGGTGGAG 171 Nidogen-2(Forward): Primer:human TGCCTGACATTGACCCTGT 172 Nidogen-2(Reverse): Primer:humanGATA6 GCGGGCTCTACAGCAAGAT 173 (Forward): Primer:humanGATA6 TGGCACAGGACAATCCAAG 174 (Reverse): Primer:humanGATA4 GGAAGCCCAAGAACCTGAAT 175 (Forward): Primer:humanGATA4 GTTGCTGGAGTTGCTGGAA 176 (Reverse): Primer:humanFOXA2 TGAAGATGGAAGGGCACGAGC 177 (Forward): Primer:humanFOXA2 CCGACATGCTCATGTACGTGTTCAT 178 (Reverse): Primer:humanVIM AGTCCACTGAGTACCGGAGAC 179 (Forward): Primer:humanVIM CATTTCACGCATCTGGCGTTC 180 (Reverse): Primer:humanGAPDH AGGGCTGCTTTTAACTCTGGT 181 (Forward): Primer:humanGAPDH CCCCACTTGATTTTGGAGGGA 182 (Reverse): Primer:humanACTIN CCACGAAACTACCTTCAACTCC 183 (Forward): Primer:humanACTIN GTGATCTCCTTCTGCATCCTGT 184 (Reverse): Primer:humanPSG3 TCGTAAAGCGAGGTGATGGG 185 (Forward): Primer:humanPSG3 AAGCTCACAGCCTCCATGTC 186 (Reverse): Primer:humanEGFR AACTGTGAGGTGGTCCTTGG 187 (Forward): Primer:humanEGFR GTTGAGGGCAATGAGGACAT 188 (Reverse): Primer:humanDPP4 TGGTCTCCAAACGGCACTTT 189 (Forward): Primer:humanDPP4 AACTGTGAGGTGGTCCTTGG 190 (Reverse): Primer:humanCGA CACTCCACTAAGGTCCAAGAA 191 (Forward): GA Primer:humanCGA CCGTGTGGTTCTCCACTTTGA 192 (Reverse): Primer:humanCDH10 AGATGCCGATGACCCTTCATA 193 (Forward): Primer:humanCDH10 TGTTCGGTAAAGCAGTCCTGA 194 (Reverse):
[1183] Although the invention has been described in conjunction with specific embodiments thereof, it is evident that many alternatives, modifications and variations will be apparent to those skilled in the art. Accordingly, it is intended to embrace all such alternatives, modifications and variations that fall within the spirit and broad scope of the appended claims.
[1184] It is the intent of the applicant(s) that all publications, patents and patent applications referred to in this specification are to be incorporated in their entirety by reference into the specification, as if each individual publication, patent or patent application was specifically and individually noted when referenced that it is to be incorporated herein by reference. In addition, citation or identification of any reference in this application shall not be construed as an admission that such reference is available as prior art to the present invention. To the extent that section headings are used, they should not be construed as necessarily limiting. In addition, any priority document(s) of this application is/are hereby incorporated herein by reference in its/their entirety.