Fructophilic lactic acid producing bacteria

12257274 ยท 2025-03-25

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention discloses a novel fructophilic lactic acid producing bacteria Bacillus coagulans strain FF-7 (MTCC 25235) and the process of isolation and characterization of the bacteria.

Claims

1. A fructophilic probiotic bacteria Bacillus coagulans MTCC 25235, isolated from honey, wherein the said bacteria is present in the form of an inoculum, freeze-dried powder, fine powder, tablet, capsule, suspension, solution, emulsion, gummy, chewable or edible foods and administered along with accepted excipients, adjuvants, bioavailability enhancers.

2. The fructophilic bacteria as in claim 1, wherein the said bacteria are isolated from honey using a process comprising steps of: a) Mixing honey with saline in the ratio of 1:10 w/v to obtain a suspension; b) Thoroughly mixing the suspension of step a) and providing heat shock at 50-70 C. for 30 minutes for selective isolation of spores; c) Isolating the bacterial colonies by incubating 1-2 ml of the suspension from step b) in suitable culture media containing fructose for 48 hrs at 35-37 C.; d) Purifying bacterial isolates by selecting and incubating morphologically distinct colonies in a suitable media containing fructose as carbon source; e) Identifying the bacterial strain by biochemical analysis and 16S rRNA sequencing as Bacillus coagulans strain FF7 bearing accession no. MTCC 25235.

3. The method fructophilic bacteria as in claim 2, wherein the honey is selected from the group consisting of, raw honey, filtered honey, acacia honey, alfalfa honey, aster honey, avocado honey, basswood honey, beechwood honey, blueberry honey, bluegum honey, buckwheat honey, clover honey, dandelion honey, eucalyptus honey, fireweed honey, heather honey, ironbark honey, jarrah honey, leatherwood honey, linden honey, macadamia honey, manuka honey, orangeblossom honey, pinetree honey, sourwood honey, sage honey, and tupelo honey.

4. The fructophilic bacteria as in claim 2, wherein the culture media is selected from the group consisting of MRS (De Man, Rogosa and Sharpe agar), GYA (Glucose Yeast Extract Agar), TSB (Tryptone Soya Broth), Sporulation media and Mueller Hinton Agar.

5. The fructophilic bacteria as in claim 2, wherein the isolated probiotic strain returns positive for biochemical tests catalase, oxidase, methyl red, voges proskauers, lactose, xylose, maltose, fructose, dextrose, galactose, raffinose, trehalose, melobiose, sucrose, arabinose, mannose, inulin, sodium gluconate, salicin, sorbitol, mannitol, arabitol, methyl glucoside, rhamnose, cellobiose, ONPG, esculin hydrolysis and negative for biochemical tests sorbose malonate utilization, citrate utilization, xylitol, methyl mannoside, melezitose, erythritol, adonitol, inositol, dulcitol, glycerol, blood hemolysis, citrate and indole.

6. The fructophilic bacteria as claim 1, wherein the optimum pH and temperature for the growth of fructophilic bacteria is 7.5 and 40 C. respectively.

7. The probiotic bacteria as claimed in claim 1, wherein the said fructophilic probiotic bacteria is bile tolerant, gastric acid resistance and produces lactic acid.

Description

BRIEF DESCRIPTION OF DRAWINGS

(1) The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the office upon request and payment of the necessary fee.

(2) FIGS. 1A, 1B, 1C and 1D shows the phase contrast microscopic image (1000 magnification) of Bacillus coagulans MTCC 25235 (FIG. 1A), wet mount of cells with the spores (FIG. 1B), Gram staining of vegetative cells (FIG. 1C), Spore staining of sporulated cells and (FIG. 1D), colony grown on GYE agar plate.

(3) FIG. 2 shows graphical representation of comparison of growth pattern of Bacillus coagulans FF7, MTCC 25235 and B. coagulans ATCC 31284 in presence of fructose and dextrose as carbon source. Values are mean (SD) from three independent determinations.

(4) FIG. 3 shows graphical representation of utilization of fructose by Bacillus coagulans MTCC FF7, 25235 after 24 h of incubation in presence of media and fructose rich foods (Honey, fruit juice). Values are mean (SD) from three independent determinations.

(5) FIG. 4 shows phylogenetic tree based on the sequence of 16S rRNA showing the relative positions of Bacillus coagulans FF7.

(6) FIG. 5 shows effect of different pH on the growth of B. coagulans FF7, MTCC 25235 and B. coagulans ATCC 31284, optimum pH for the growth was found to be pH 7.5 and pH 6.5 respectively. Values are mean (SD) from three independent determinations.

(7) FIG. 6 shows graphical representation of effects of different temperatures on the growth of B. coagulans MTCC FF7, 25235 and B. coagulans ATCC 31284. Values are mean (SD) from three independent determinations.

(8) FIG. 7 shows Effect of GIT hostile conditions on the viability of B. coagulans MTCC 25235 after gastric treatment in an in-vitro experiment mimicking invivo conditions. Sterile saline was taken as untreated control.

(9) FIGS. 8A and 8B shows BSH activity of Bacillus coagulans MTCC 25235. FIG. 8A shows the zone of inhibition (hollow zones) in petridish treated with Bacillus coagulans MTCC 25235, FIG. 8B is a negative control wherein the activity is determined using soft MRS agar supplemented with ox bile (0.3%, w/v) and CaCO3 (0.3%, w/v) and MRS agar without bile salts.

(10) FIG. 9 shows graphical representation of the survival of Bacillus coagulans MTCC FF7, 25235 at various pH values (1.5-8.0) in gastric juice buffer. The values are expressed in Log 10 spores/g. Data represent the mean and standard deviations (SD) of two different experiments performed.

(11) FIG. 10 shows graphical representation of in-vitro effect of ox bile salt on the growth of B. coagulans FF7, MTCC 25235 and B. coagulans ATCC 31284. The overnight grown fresh culture of B. coagulans MTCC 25235 and B. coagulans ATCC 31284 were inoculated in MRS broth with (0.1, 0.3, 0.4, 0.5, 0.6, 0.8, 0.9 and 1%, w/v) and without ox bile salt (%, w/v). Values are mean (SD) from three independent determinations.

(12) FIG. 11 shows graphical presentation of production of L-Lactic acid by B. coagulans FF7, MTCC 25235 in presence of two standardized preparations equivalent to 610.sup.9 (preparation 1) and 1510.sup.9 cfu/g (preparation 2) were studied. Values are mean (SD) from three independent determinations.

(13) FIGS. 12A, 12B and 12 C shows graphical presentation of Acetic FIG. 12A, butyric FIG. 12 B and propionic acid FIG. 12C production from the Bacillus coagulans MTCC 25235 while fermenting fructose, FOS, cranberry seed fiber, fenugreek seeds fiber. Samples were collected after 4, 8, 12, 18 and 24 h of fermentation. Values are average mean of triplicate performed at two different occasions and represented in mg/g.

(14) FIG. 13 shows graphical presentation of Viability of B. coagulans MTCC 25235 during the storage at temperature 402 C. with RH 60%5%. Two standardized preparations equivalent to 1510.sup.9 (preparation 1) and 610.sup.9 cfu/g (preparation 2) were studied. Average means of spore viable counts are expressed in log 10 cfu/g. Each time point represents the mean Log.sub.10 standard deviations (SD) of three different experiments performed in duplicate.

DESCRIPTION OF THE MOST PREFERRED EMBODIMENTS

(15) In the most preferred embodiment, the present invention discloses a method for isolating and identifying novel fructose utilizing probiotic bacteria from honey, comprising step of: a) Mixing honey with saline in the ratio of 1:10 w/v to obtain a suspension; b) Thoroughly mixing the suspension of step a) and providing heat shock at 50-70 C. for 30 minutes for selective isolation of spores; c) Isolating the bacterial colonies by incubating 1-2 ml of the suspension from step b) in suitable culture media containing fructose for 48 hrs at 35-37 C.; d) Purifying bacterial isolates by selecting and incubating morphologically distinct colonies in a suitable media containing fructose as carbon source; e) Identifying the bacterial strain by biochemical analysis and 16S rRNA sequencing as Bacillus coagulans strain FF7 bearing accession no. MTCC 25235.

(16) In a related aspect, the honey is selected from the group comprising, but not limited to, raw honey, filtered honey, acacia honey, alfalfa honey, aster honey, avocado honey, basswood honey, beechwood honey, blueberry honey, bluegum honey, buckwheat honey, clover honey, dandelion honey, eucalyptus honey, fireweed honey, heather honey, ironbark honey, jarrah honey, leatherwood honey, linden honey, macadamia honey, manuka honey, orangeblossom honey, pinetree honey, sourwood honey, sage honey, and tupelo honey. In another related aspect, the culture media is selected from the group comprising MRS (De Man, Rogosa and Sharpe agar), GYA (Glucose Yeast Extract Agar), TSB (Tryptone Soya Broth), Sporulation media and Mueller Hinton Agar.

(17) In another related aspect, the isolated probiotic strain returns positive for biochemical tests catalase, oxidase, methyl red, voges proskauers, lactose, xylose, maltose, fructose, dextrose, galactose, raffinose, trehalose, melobiose, sucrose, arabinose, mannose, inulin, sodium gluconate, salicin, sorbitol, mannitol, arabitol, methyl glucoside, rhamnose, cellobiose, ONPG, esculin hydrolysis and negative for biochemical tests sorbose malonate utilization, citrate utilization, xylitol, methyl mannoside, melezitose, erythritol, adonitol, inositol, dulcitol, glycerol, blood hemolysis, citrate and indole.

(18) In another preferred embodiment, the invention discloses a novel probiotic bacteria of the genus Bacillus, isolated from honey for increased utilization of fructose from foods rich in fructose. In another related aspect, the fructophilic probiotic bacterium is Gram positive. In yet another aspect, optimum pH and temperature recorded for the growth of fructophilic bacteria is 7.5 and 40 C. respectively. In another aspect, the fructophilic probiotic bacteria is bile tolerant, gastric acid resistance and produces lactic acid. In a related aspect, the fructophilic probiotic bacteria is Bacillus coagulans. In yet another related embodiment, the Bacillus coagulans strain is Bacillus coagulans MTCC 25235. In a related aspect, the foods rich in fructose are selected from the group comprising high fructose corn syrup, honey, Agave, Maple syrup, Coconut sugar, Palm sugar, Molasses, Soda, Candies, sweetened yogurt, frozen foods, canned foods, cereals, fruit juices, coffee creamer, jams and jellies, energy drinks, condiments, ice cream. In a related aspect, the fructophilic probiotic bacteria is used for the therapeutic management of disorders related to high fructose intake. In a related aspect, diseases related to high fructose intake are selected from the group comprising, but not limited, obesity, non-alcoholic steatohepatitis (NASH), insulin resistance, metabolic syndrome, cardio-vascular complications, diabetes, hyperlipidemia, hypertension, inflammation and hyperuricemia. In another related aspect, the fructophilic probiotic bacteria is present in the form of an inoculum, freeze-dried powder, fine powder, tablet, capsule, suspension, solution, emulsion, gummy, chewable or edible foods and administered as a stand-alone or in combination with foods rich in fructose selected from the group comprising high fructose corn syrup, honey, Agave, Maple syrup, Coconut sugar, Palm sugar, Molasses, Soda, Candies, sweetened yogurt, frozen foods, canned foods, cereals, fruit juices, coffee creamer, jams and jellies, energy drinks, condiments, ice cream.

(19) In yet another preferred embodiment, the invention discloses a method of inhibiting pathogenic microbes said method comprising step of bringing to contact said microbes with the fructophilic probiotic bacteria Bacillus coagulans MTCC 25235. In a related aspect, the pathogenic microbes are selected from the group comprising Salmonella abony, Micrococcus luteus, Escherichia coli, Pseudomonas aeruginosa, Bacillus cereus, Propionibacterium acnes, Streptococcus mutans, Staphylococcus aureus, Staphylococcus epidermidis.

(20) In another preferred embodiment, the invention discloses a method of producing short chain fatty acids by culturing the fructophilic probiotic bacteria Bacillus coagulans MTCC 25235 along with plant fibers selected from the group consisting of fructose, fenugreek seed fibers, cranberry seed fibers, fructooligosaccharides (FOS).

(21) The specific examples included herein below illustrate the aforesaid most preferred embodiments of the present invention.

EXAMPLES

Example 1: Isolation and Identification of Fructophilic Bacteria

(22) Methods

(23) Raw unfiltered honey was used in this study to isolate the spore forming fructophilic lactic acid bacteria. For the isolation of fructophilic bacteria, de Man, Rogosa and Sharpe (MRS) (dextrose replaced by fructose) was used in this study (table 1).

(24) TABLE-US-00001 TABLE 1 Media composition Sr. No. Ingredients Gms/Liter 1 Proteose peptone 10.000 2 Beef extract 10.000 3 Yeast extract 5.000 4 Fructose 20.000 5 Polysorbate 80 1.000 6 Ammonium citrate 2.000 7 Sodium acetate 5.000 8 Magnesium sulphate 0.100 9 Manganese sulphate 0.050 10 Dipotassium phosphate 2.000 11 Agar 12.000 12 Final pH (at 25 C.) 6.5 0.2

(25) One gm of unfiltered raw honey was taken into the test tubes containing 10 ml of saline. This was mixed well and heat shock was given at 70 C. for 30 minutes for selective isolation of spores. Isolation of bacteria was carried out by adding 1 ml of above sample from each dilution onto the MRS agar plates containing fructose. Plates were further incubated at 37 C. for 48 h. After incubation, morphologically distinct colonies were picked up for further testing and purification of bacterial isolates. Bacillus coagulans MTCC 25235 was isolated and streaked on other MRS agar plate containing fructose as carbon source.

(26) Biochemical Characterization of Fructophilic Bacteria

(27) Bacterial isolates were grown in de Man, Rogosa and Sharpe Agar (MRSA) for 24 h at 37 C. Bacterial inoculums were prepared by picking 1 to 3 well isolated colonies and a homogenous suspension in sterile saline was prepared. The density of suspension was >0.5 OD at 620 nm. This inoculum (50 l) of was used and test was performed as per the kit manufacturer's instructions (HiMedia, Mumbai, India). Biochemical characterization of Bacillus coagulans MTCC 25235 and B. coagulans ATCC 31284 was performed by the method described (Majeed, M., Nagabhushanam, K., Natarajan, S., Sivakumar, A., Eshuis-de Ruiter, T., Booij-Veurink, J., Janine Booij-Veurink, Ynte P. de Vries, Ali, F. (2016); Evaluation of genetic and phenotypic consistency of Bacillus coagulans MTCC 5856: A commercial probiotic strain. World Journal of Microbiology & Biotechnology, 32,60). HiCarbohydrate Kit (code-KB009) was procured from HiMedia, Mumbai, India and tests were performed as per the manufacturer's instructions. Bacterial suspension of Bacillus coagulans MTCC 25235 and B. coagulans ATCC 31284 was prepared as mentioned in above section. Further, IMViC (indole, methyl red, Voges Proskauer, Citrate utilization) test, oxidase and Gram staining of and B. coagulans ATCC 31280 were performed as per the method Majeed et al., (2016); (Cappucino G and Natalie Sherman. Microbiology: A Laboratory manual 5th edition. 1998).

(28) 16S rDNA Sequencing

(29) 16S rDNA sequencing Genomic DNA of the B. coagulans MTCC 5856 was prepared as previously described by (William J. Bruno, Nicholas D. Socci, and Aaron L. Halpern (2000). Weighted Neighbor Joining: A Likelihood-Based Approach to Distance-Based Phylogeny Reconstruction, Mol. Biol. Evol. 17 (1): 189-197). A fragment of the 16S rDNA gene was sequenced using an ABI 3500 genetic analyser automated DNA sequencer as described earlier (Heyrman and Swings 2001). The sequencing primers used were 5-AGHGTBTGHTCMTGNCTCAS-3 (Forward Primer) and 5-TRCGGYTMCCTTGTWHCGACTH-3 (Reverse Primer). The amplified DNA fragment of approximately 1.5 kb separated on a 1% agarose gel and purified by using Qiagen spin columns.

(30) The purified fragment was used directly for DNA sequencing. This sequence was used in a BLAST search (blast.ncbi.nlm.nih.gov/Blast.cgi).

(31) Growth Conditions of Bacillus coagulans MTCC 25235

(32) The optimization of growth conditions for Bacillus coagulans MTCC 25235 was analyzed for different temperature and pH. MRSB media was prepared and adjusted pH to 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5 and 8.0 with 2 N HCl and 2N NaOH. Overnight grown culture (1%, v/v) inoculated to pH adjusted media and incubated for 24 h in a shaking incubator at 120 rpm. Growth was monitored at every six hour interval of time by measuring absorbance at 600 nm using spectrophotometer (Shimadzu Corporation, Kyoto, Japan). MRSB media was prepared adjusted pH to 6.5 and inoculated with overnight grown culture (1%, v/v). Further, flasks were incubated for 24 h in shaking incubator at 120 rpm at different temperatures (20, 30, 37, 40, 50 and 60 C.). Growth was monitored at every six hour interval of time by measuring absorbance at 600 nm using spectrophotometer (Shimadzu Corporation, Kyoto, Japan).

(33) Results

(34) Identification of Fructophilic Bacteria

(35) The spores of Bacillus coagulans MTCC 25235 were ellipsoidal terminal spores (FIG. 1A) and vegetative cells were Gram positive rod shaped as indicated in Gram's stain (FIG. 1B). Colonies from B. coagulans MTCC 25235 were grown on media, yielding uniform, 1-3 mm in diameter, white to cream, smooth colonies that contain vegetative rod shaped cells (FIGS. 1C and D). The growth of the isolated bacteria was better in fructose rich media rather than dextrose rich media (FIG. 2), indicating its fructophilic nature and fructose utilization potential when compared to other Bacillus coagulans strains. The growth of the bacterial was also tested in fructose rich food stuff and showed a deduction in the fructose content (FIG. 3) implying that the bacterium utilizes fructose as a carbon source for its growth and development. Thus, the bacterium can be used in managing and preventing disorders related to high fructose intake by utilizing the excess fructose in the food stuff for its metabolism. The bacteria can be administered as a stand alone or in combination with foods rich in fructose which include high fructose corn syrup, honey, Agave, Maple syrup, Coconut sugar, Palm sugar, Molasses, Soda, Candies, sweetened yogurt, frozen foods, canned foods, cereals, fruit juices, coffee creamer, jams and jellies, energy drinks, condiments, ice cream (Braverman J, List of Foods high in fructose, livestrong.com/article/30454-list-foods-high-fructose/, accessed 3 May 2019)

(36) Biochemical Characterization

(37) Biochemical characterization of Bacillus coagulans MTCC 25235 and B. coagulans ATCC 31284 was performed by the method described (Majeed, M., Nagabhushanam, K., Natarajan, S., Sivakumar, A., Eshuis-de Ruiter, T., Booij-Veurink, J., Janine Booij-Veurink, Ynte P. de Vries, Ali, F. (2016); Evaluation of genetic and phenotypic consistency of Bacillus coagulans MTCC 5856: A commercial probiotic strain. World Journal of Microbiology & Biotechnology, 32,60). The results were compared with commercial strain B. coagulans ATTCC 3128 and tabulated in Table 2.

(38) TABLE-US-00002 TABLE 2 Biochemical characterization of B. coagulans ATTCC 3128 and Bacillus coagulans MTCC 25235 B. coagulans B. coagulans S.No. Tests ATTCC 3128 MTCC 25235 1. Catalase Positive Positive 2. Oxidase Positive Positive 3. Indole Negative Negative 4. Methyl Red Positive Positive 5. Voges Proskauers Positive Positive 6. Citrate Negative Negative 7. Blood Hemolysis Negative Negative 8. Gram staining Gram Positive Gram Positive 9. Lactose Positive Positive 10. Xylose Positive Positive 11. Maltose Positive Positive 12. Fructose Positive Positive 13. Dextrose Positive Positive 14. Galactose Positive Positive 15. Raffinose Positive Positive 16. Trehalose Positive Positive 17. Melobiose Positive Positive 18. Sucrose Positive Positive 19. L-Arabinose Positive Positive 20. Mannose Positive Positive 21. Inulin Positive Positive 22. Sodium gluconate Positive Positive 23. Glycerol Negative Negative 24. Salicin Positive Positive 25. Dulcitol Negative Negative 26. Inositol Negative Negative 27. Sorbitol Positive Positive 28. Mannitol Positive Positive 29. Adonitol Positive Negative 30. Arabitol Positive Positive 31. Erythritol Negative Negative 32. -Methyl-D-glucoside Positive Positive 33. Rhamnose Positive Positive 34. Cellobiose Positive Positive 35. Melezitose Negative Negative 36. -Methyl-D- Negative Negative mannoside 37. Xylitol Negative Negative 38. ONPG Positive Positive 39. Esculin hydrolysis Positive Positive 40. D-Arabinose Positive Positive 41. Citrate utilization Negative Negative 42. Malonate utilization Negative Negative 43. Sorbose Negative Negative

(39) The results indicated that the isolated probiotic strain is positive for biochemical tests catalase, oxidase, methyl red, voges proskauers, lactose, xylose, maltose, fructose, dextrose, galactose, raffinose, trehalose, melobiose, sucrose, melobiose, arabinose, mannose, inulin, sodium gluconate, salicin, sorbitol, mannitol, arabitol, methyl glucoside, rhamnose, cellobiose, ONPG, esculin hydrolysis and negative for biochemical tests sorbose malonate utilization, citrate utilization, xylitol, methyl mannoside, melezitose, erythritol, adonitol, inositol, dulcitol, glycerol, blood hemolysis, citrate and indole.

(40) 16S rDNA Sequencing

(41) The bacterial 16S rDNA was sequenced and the sequence information (SEQ ID) was obtained as below:

(42) TABLE-US-00003 LOCUSseq_FF71437bp ORIGIN 1ACTTGCAAGTCGTGCGGCCCTTTTTTAAAA GCTTGCTTTTTAAAAGGTTAGCGGCGGACG 61GGTGAGTAACACGTGGGCACCCTGCCTGTA AGATCGGGATAACGCCGGGAAACCGGGGCT 121AATACCGGATAGTTTTTTCCTCCGCATGGA GGAAAAAGGAAAGACGGCTTCTGCTGTCAC 181TTACAGATGGGCCCGCGGCGCATTAGCTAG TTGGTGGGGTAACGGCTCACCAAGGCAACG 241ATGCGTAGCCGACCTGAGAGGGTGATCGGC CACATTGGGACTGAGACACGGCCCAAACTC 301CTACGGGAGGCAGCAGTAGGGAATCTTCCG CAATGGACGAAAGTCTGACGGAGCAACGCC 361GCGTGAGTGAAGAAGGCCTTCGGGTCGTAA AACTCTGTTGCCGGGGAAGAACAAGTGCCG 421TTCGAACAGGGCGGCGCCTTGACGGTACCC GGCCAGAAAGCCACGGCTAACTACGTGCCA 481GCAGCCGCGGTAATACGTAGGTGGCAAGCG TTGTCCGGAATTATTGGGCGTAAAGCGCGC 541GCAGGCGGCTTCTTAAGTCTGATGTGAAAT CTTTGCGGGCTCACCCGCAAGCGGTCATTG 601GAAACTGGGAGGGCTTTGAGTGCAAGAAAG AGGAGAGTGGAATTTCCACGTGTAGCGGTG 661AAATGCGTAAAGATGTGGAGGAACACCAGT GGCGAAGGCGGCTCTCTGGTCTGTAACTGA 721CGCTGAGGCGCGAAAGCGTGGGGAGCAAAC AGGATTAGATACCCTGGTAGTCCACGCCGT 781AAACGATGAGTGCTAAGTGTTAGAGGGTTT CCGCCCTTTAGTGCTGCAGCTAACGCATTA 841AGCACTCCGCCTGGGGAGTACGGCCGCAAG GCTGAAACTCAAAGGAATTGACGGGGGCCC 901GCACAAGCGGTGGAGCATGTGGTTTAATTC GAAGCAACGCGAAGAACCTTACCAGGTCTT 961GACATCCTCTGACCTCCCTGGAGACAGGGC CTTCCCCTTCGGGGGACAGAGTGACAGGTG 1021GTGCATGGTTGTCGTCAGCTCGTGTCGTGA GATGTTGGGTTAAGTCCCGCAACGAGCGCA 1081ACCCTTGACCTTAGTTGCCAGCATTCAGTT GGGCACTCTAAGGTGACTGCCGGTGACAAA 1141CCGGAGGAAGGTGGGGATGACGTCAAATCA TCATGCCCCTTATGACCTGGGCTACACACG 1201TGCTACAATGGATGGTACAAAGGGCTGCGA GACCGCGAGGTTAAGCCAATCCCAGAAAAC 1261CATTCCCAGTTCGGATTGCAGGCTGCAACC CGCCTGCATGAAGCCGGAATCGCTAGTAAT 1321CGCGGATCAGCATGCCGCGGTGAATACGTT CCCGGGCCTTGTACACACCGCCCGTCACAC 1381CACGAGAGTTTGTAACACCCGAAGTCGGTG AGGTAACCTTACGGAGCCAGCCGCCGA //
A BLAST (Basic local alignment search tool) search was performed with the above sequence and results of the first 10 alignment sequences are tabulated in table 3.

(43) TABLE-US-00004 TABLE 3 Alignment view using combination of NCBI GenBank - Distribution of 10 Blast Hits on the Query Sequence Max Total Query S. No. Description score score cover E value Ident Accession 1 Bacillus coagulans 2562 2562 100% 0.0 98.96% MF077122.1 strain 55-LR4 16S ribosomal RNA gene, partial sequence 2 Bacillus coagulans 2556 2556 100% 0.0 98.89% MF992239.1 strain KCCM203098 16S ribosomal RNA gene, partial sequence 3 Bacillus sp. MC-02 2556 2556 99% 0.0 98.95% AB849115.1 gene for 16S ribosomal RNA, partial sequence 4 Bacillus coagulans gene 2556 2556 100% 0.0 98.89% AB696800.1 for 16S ribosomal RNA, partial sequence, strain: NTUIOB YUN2 5 Bacillus coagulans gene 2556 2556 100% 0.0 98.89% AB240205.1 for 16S rRNA, strain: T5 6 Bacillus coagulans 2553 2553 100% 0.0 98.82% MH392659.1 strain ICMP 22322 16S ribosomal RNA gene, partial sequence 7 Bacillus sp. IMM05 2553 2553 100% 0.0 98.82% FR727705.1 partial 16S rRNA gene, strain IMM05 8 Uncultured Bacillus sp. 2551 2551 100% 0.0 98.82% MG557779.1 clone Bco 16S ribosomal RNA gene, partial sequence 9 Bacillus coagulans 2529 2529 100% 0.0 98.54% CP009709.1 DSM 1 = ATCC 7050, complete genome 10 Bacillus coagulans 2505 2505 100% 0.0 98.19% NR_115727.1 strain ATCC 7050 16S ribosomal RNA gene, partial sequence

(44) The results indicated that the isolated organism is a new strain of Bacillus coagulans having 98.96% identity with Bacillus coagulans strain 55-LR4. The results of the phylogenetic analysis also indicated that the organism is a new strain of Bacillus coagulans (FIG. 4)

(45) Optimum of the Growth Conditions for Fructophilic Bacteria

(46) The optimum pH and temperature recorded for the growth of fructophilic bacteria was 7.5 and 40 C. respectively (FIG. 5 and FIG. 6)

Example 2: In Vitro Probiotic Evaluation of Bacillus coagulans MTCC 25235

(47) Resistance to Gastric Acid

(48) The survival of Bacillus coagulans MTCC 25235 spores was studied by addition of 1 ml of suspension into 100 ml of a sterile electrolyte solution (6.2 g/L NaCl, 2.2 g/L KCl, 0.22 g/L CaCl.sub.2), and 1.2 g/L NaHCO.sub.3) containing 0.01% lysozyme (Sigma-Aldrich) and 0.3% pepsin (Sigma-Aldrich) and incubated for 5 min. Further, pH was adjusted to 1.5, 3, 4, 5, 6, 7 and 8 (adjusted using 1 N NaOH and 1 N HCl). Incubation temperature was monitored to 37 C. for 4 h. One ml of sample was withdrawn at different time intervals at 0, 1.0, 2.0, 3.0 and 4.0 h. After incubation, serial dilution was done in sterile saline (0.89% w/v) and the viable count was enumerated by plating on glucose yeast extract agar (HiMedia). Experiments were performed in triplicate at two different occasions.

(49) Bile Salt Tolerance

(50) Bile tolerance of Bacillus coagulans MTCC 25235 cells was determined by the method described earlier (Gilliland et al. 1984; Hyronimus et al. 2000). MRS broth (HiMedia) was inoculated with approximately 10.sup.6 cfu mL.sup.1 of Bacillus coagulans MTCC 25235 overnight grown culture and then supplemented with (0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.5 and 2.0%, w/v) bile salt and without bile salt as control in the experiment. Samples were incubated for 24 h at 37 C. with shaking at 120 rpm. Growth in control (no bile) and test cultures at different concentrations of bile was monitored hourly by measuring absorbance at 600 nm using spectrophotometer (Shimadzu Corporation, Kyoto, Japan).

(51) Production of Lactic Acid

(52) Lactic acid production by Bacillus coagulans MTCC 25235 was estimated by using a Megazyme kit. A loopful of an overnight grown culture of Bacillus coagulans MTCC 25235 was added to glucose yeast extract broth (HiMedia) and incubated at 37 C. for 18 h with 120 rpm. After incubation, the broth was filtered through 0.22 micron (Sartorius, India) and analyzed for lactic acid content by using Megazyme kit (K-DLATE 10/04) as per instructions (Megazyme International Ireland, IDA Business Park, Wicklow, Ireland). GYE media was taken as blank in the assay.

(53) Simulated Gastric Juice Tolerance

(54) The survival of Bacillus coagulans MTCC 25235 spores was studied to represent buccal digestion conditions. One mL of the suspension of Bacillus coagulans MTCC 25235 was subjected to stimulated salivary juice contents consist of KCl (0.8946 g/l), CO(NH.sub.2).sub.2 (0.1981 g/L), Na.sub.2SO.sub.4 (0.5681 g/L), NaHCO; (1.680 g/L), NaH.sub.2PO.sub.4 (0.8878 g/L), pH adjusted to 6.80.2 and incubated at 37 C. for 5 min. Further, simulated gastric juice was prepared by adding 9 g/L of sodium chloride and 3 g/L of pepsin (Sigma-Aldrich, St. Louis, MO, USA) and then the pH was adjusted to aseptically 3.00.2 by using 2 N HCl. Samples were further incubated at 37 C. for 3 h with low r.p.m. After 3 h of incubation, pH was adjusted aseptically to 7.0 using 2 N NaOH. Ox bile (5 g/L) this was further incubated at 37 C. for 24 h. After final step of the simulated digestion process, samples were collected and evaluated for the spore survival of Bacillus coagulans MTCC 25235 was enumerated by serial dilution method using glucose yeast extract agar media (HiMedia) (FIG. 7).

(55) Antibiotic Resistance Pattern

(56) MIC was determined as per the guidelines of Clinical and Laboratory Standards Institute (CLSI 2012). Bacillus coagulans MTCC 25235 suspensions were prepared by suspending 18 h grown bacterial culture in sterile normal saline (0.89% NaCl wt/vol; Himedia, Mumbai India). The turbidity of the bacterial suspension was adjusted to 0.5 McFarland standards (equivalent to 1.510.sup.8 colony forming units (CFU)/ml). The antibiotics stock solutions were prepared as per CLSI guidelines and 2-fold serial dilutions were prepared in broth medium (glucose yeast extract acetate broth [GYEA, HiMedia, Mumbai India for Bacillus coagulans MTCC 25235 and Mueller Hinton Broth [MHB, Difco Laboratories, Detroit, Mich USA] for S. aureus) in 100 l volume in 96-well U bottom microtiter plates (BD Labware, NJ USA). The above-mentioned bacterial suspension was further diluted in the MHB and 100 l volume of this diluted inoculum was added to each well of the plate resulting in the final inoculum of 510.sup.5 CFU/ml in the well and the final concentration of antibiotics ranged from 0.0078 to 4 g/ml. S. aureus ATCC 6538 was used as reference culture in this study. The plates were incubated at 37 C. for 24 h and were visually read for the absence or presence of turbidity. The minimum concentration of the compound concentration showing no turbidity was recorded as MIC.

(57) Ames Test

(58) The data of the experiment suggested that the B. coagulans MTCC 25235 spores did not increase the number of revertants in five Salmonella strains (TA98, TA100, TA102, TA1535 and TA1537), compared with their negative controls, either absence or presence of the S9 metabolic activation system. Further, no dose-dependent mutagenic effects were caused by the B. coagulans MTCC 25235 spores (up to 5000 g/plate). B. coagulans MTC 25235 spores did not show any mutagenic activity under the experimental conditions.

(59) BSH Activity

(60) Bacillus coagulans MTCC 25235 growth was observed on an agar plate containing ox bile and calcium carbonate, which indicates its tolerance against ox bile and the presence of BSH activity. There was 192 mm clear zone in the soft agar plate as shown in (FIGS. 8A and 8B) which indicated the presence of BSH activity.

(61) Antimicrobial Activity Against Human Pathogens

(62) The antimicrobial activity was performed by a well diffusion assay as previously described with minor modifications (Cintas L M, Rodriguez J M, Fernandez M F, Sletten K, Nes I F, Hernandez P E, Holo H (1995) Isolation and characterization of pediocin L50, a new bacteriocin from Pediococcus acidilactici with a broad inhibitory spectrum. Appl Environ Microbiol 61:2643-2648). Briefly, a 5 mL lawn of soft (0.7% agar) glucose yeast extract (HiMedia, India), containing 10.sup.6 cfu mL.sup.1) of the indicator strains (S. epidermidis ATCC 14990, S. mutans MTCC 1943, S. aureus ATCC 29213, B. cereus ATCC 14579, P. acnes ATCC 11827, E. coli ATCC 25922, P. aeruginosa ATCC 9027, M. luteus NCIM 216 and S. abony NCIM 2257) was poured on top of an enriched hard (1.5% agar) tryptic soya agar (HiMedia, India). A loopful of overnight grown culture B. coagulans MTCC 25325 was added to MRS media and incubated for 24 h at 37 C. with 120 rpm. After 24 h, the culture was centrifuged (10,0009 g) to remove the cells and the supernatant was collected, concentrated tenfold by lyophilization and filter-sterilized through a 0.22 micron filter (Sartorius, India). Concentrated supernatant (50 L) was added to 6-mm wells punched in the solidified bi-layer agar. Plates were kept in the refrigerator (42 C.) for 5 h to allow the sample to diffuse into the agar and subsequently incubated at 37 C. for 18-20 h. After incubation, the zone of inhibition was measured and recorded in mm.

(63) Production of Short Chain Fatty Acids

(64) The in vitro fermentation with the Bacillus coagulans MTCC 25235 was carried out by following method described by McBurney and Thompson (1987) with some modifications. Briefly, 2.0 g of fructose, fenugreek seeds, cranberry seed fiber, FOS, were added to 100 ml of demineralised water. The pH was adjusted to 7.00.2 and autoclaved at 121 C. for 20 min. After sterilization, oxygen reducing enzyme Oxyrase (Oxyrase for Broth, Oxyrase, Inc, OH, USA) was added to each flask, to induce anaerobic conditions. Five percent of overnight grown Bacillus coagulans MTCC 25235 culture was inoculated to all the flasks and incubated at 37 C. with gentle shaken rpm for 24 h. The bottles were tightly closed and sealed with parafilm to maintain anaerobic conditions generated by the enzyme supplement. The pH values at 0 h of incubation and after fermentation (24 h) were also recorded. One ml of copper sulphate (10 g/L) was added to each sample to inhibit further microbial growth (Sigma-Aldrich, St. Louis, MO, USA). Further, 5.0 ml of samples were added to 5 ml of distilled water and pH was adjusted to 1.5 using 3 M H.sub.2SO.sub.4. 10 ml of chilled diethyl ether (20 C.) was added to samples and then vortex for 1 minute. Sodium chloride was added and then centrifuged at 3000g for 10 minutes. After centrifugation, organic layer was separated and transferred to the fresh vial. This was used to quantify SCFAs. The SCFA standards were purchased from Sigma-Aldrich (St. Louis, MO, USA) and similarly processed. SCFA production (acetate, propionate and butyrate) was measured by gas chromatography (GC) with the use of a Agilent technologies 6890N gas chromatograph (Stevens Creek Blvd Santa Clara, CA, USA) containing a DB-FFAP (Terephthalic acid modified poly ethylene Glycol) column. The column temperature was 200 C. The injector and detector port temperatures were 250 C. The carrier gas was N.sub.2 at a flow rate of 1.0 ml/min. SCFA standards were purchased from Sigma-Aldrich (St. Louis, Mo., USA). SCFA (Acetate, propionate and butyrate) concentrations were expressed in mg/gram of galactomannan from fenugreek seeds.

(65) Result

(66) Resistance to Gastric Acid

(67) There was no significant difference (2-5%) in spore count at pH 3 to pH 8.0 in comparison to the initial spore count up to 4 h of the study (FIG. 9). However, 0.44 and 2.036 log.sub.10 reduction was observed at pH 1.5 in 1 and 4 h respectively. Results of the study confirmed the stability of Bacillus coagulans MTCC 25235 spores in acidic as well as alkaline pH conditions.

(68) Bile Tolerance Test

(69) Bacillus coagulans MTCC 25235 growth was observed on the agar plate containing bile salt (1% w/v) which indicated its tolerance against bile salt. Further, bile tolerance assay was performed by supplementing (0.1-2.0%) ox bile to the MRS broth in different flask. Bacillus coagulans MTCC 25235 growth observed in presence and absence of ox bile up to 2%, w/v. Whereas, growth of B. coagulans ATCC 31284 was found in 0.8% w/v (FIG. 10). Similarly, there was no significant difference in the viability of Bacillus coagulans MTCC 25235 and B. coagulans ATCC 31284 in the presence and absence of bile salt.

(70) Production of Lactic Acid

(71) Lactic acid production by Bacillus coagulans MTCC 25235 was estimated by using a Megazyme kit. The total lactic acid produced by Bacillus coagulans MTCC 25235 was 4.487 g/L. L-form of lactic acid was 4.12 g/L. Whereas, D-form of lactic acid Bacillus coagulans MTCC 25235 is 0.367 g/L. (FIG. 11)

(72) Antibiotic Resistance

(73) MIC results of clindamycin, kanamycin, ampicillin, streptomycin, vancomycin, erythromycin, gentamicin, tetracycline and chloramphenicol against the Bacillus coagulans MTCC 25235 and S. aureus ATCC 6538 is given in table 4. All the antibiotics tested showed a MIC range of 0.0078 to 1.0 g/ml against Bacillus coagulans MTCC 25235. All tested antibiotics exhibited a MIC range of 0.031 to 2 g/ml against S. aureus ATCC 6538.

(74) TABLE-US-00005 TABLE 4 Minimum inhibitory concentrations of antibiotics against Bacillus coagulans MTCC 25235 cultures and S. aureus ATCC 6538 MIC (g/ml)* Bacillus coagulans S. aureus S.No. Antibiotics MTCC 25235 ATCC 6538 1 Clindamycin hydrochloride 0.25 0.062 2 Kanamycin sulphate 0.062 7.0 3 Ampicillin sodium salt 0.125 0.031 4 Streptomycin sulphate 0.062 4.0 5 Vancomycin hydrochloride 0.25 0.5 6 Erythromycin 0.125 0.125 7 Gentamicin sulphate 0.06 0.25 8 Tetracycline hydrochloride 0.03 0.062 9 Chloramphenicol 0.031 2.0
Antimicrobial Activity

(75) The antimicrobial activity of B. coagulans MTCC 25235 was evaluated. Anti-microbial activity was determined by well diffusion assay as described by Cintas et al. (1995). The results indicated that the probiotic bacteria is an effective antimicrobial agent against Salmonella abony, Micrococcus luteus, Escherichia coli, Pseudomonas aeruginosa, Bacillus cereus, Propionibacterium acnes, Streptococcus mutans, Staphylococcus aureus, Staphylococcus epidermidis.

(76) TABLE-US-00006 TABLE 4 Antimicrobial activity of B. coagulans MTCC 25235 against tested bacteria Zone of S. no. Tested organism inhibition 1 Salmonella abony NCIM 2257 14.00 1.0 2 Micrococcus lutens NCIM 2169 18.50 1.6 3 Escherichia coli ATCC 25922 19.00 2.0 4 Pseudomonas aeruginosa ATCC 9027 17.42 1.8 5 Bacillus cereus ATCC 14579 17.00 2.1 6 Propionibacterium acnes ATCC 11827 16.50 1.2 7 Streptococcus mutans MTCC 1943 17.50 1.75 8 Staphylococcus aureus ATCC 29213 15.85 1.25 9 Staphylococcus epidermidis ATCC 14990 14.85 1.40 Data represent the mean SD of three independent experiments performed in triplicate
Short Chain Fatty Acid Production

(77) The results of the analysis are presented in FIGS. 12A, 12B and 12C. The production of acetic acid was high for B. coagulans MTCC 25235 with FOS, followed by fenugreek seed fibers, cranberry fibers and fructose (FIG. 12 A). Similarly, the production of butyric acid was high for B. coagulans MTCC 25235 with fructose, followed by FOS, fenugreek seed fibers and cranberry fibers (FIG. 12 B). The production of propionic acid was similar for B. coagulans MTCC 25235 cultured with fructose, FOS and cranberry seed fibers and lower for fenugreek seed fibers (FIG. 12 C).

(78) Storage and Viability

(79) Two standardized preparations equivalent to 1510.sup.9 (preparation 1) and 610.sup.9 cfu/g (preparation 2) were studied. B. coagulans MTCC 25235 showed enhanced viability during the storage at temperature 402 C. with RH 60%5% (FIG. 13)

Example 3: Compositions/Formulations Containing Bacillus coagulans

(80) The fructophilic probiotic bacteria can be in the form of an inoculum, freeze-dried powder, fine powder, tablet, capsule, suspension, solution, emulsion, gummy, chewable or edible foods and administered along with accepted excipients, adjuvants, bioavailability enhancers as a stand-alone or in combination with foods rich in fructose selected from the group comprising high fructose corn syrup, honey, Agave, Maple syrup, Coconut sugar, Palm sugar, Molasses, Soda, Candies, sweetened yogurt, frozen foods, canned foods, cereals, fruit juices, coffee creamer, jams and jellies, energy drinks, condiments, ice cream.

(81) In another related aspect, one or more anti-oxidants and anti-inflammatory agents are selected from the group consisting of, but not limited to, vitamin A, D, E, K, C, B complex, rosmarinic acid, Alpha Lipoic Acid, oxyresveratrol, Ellagic Acid, Glycyrrhizinic Acid, Epigallocatechin Gallate, plant polyphenols, Glabridin, moringa oil, oleanolic acid, Oleuropein, Carnosic acid, urocanic acid, phytoene, lipoid acid, lipoamide, ferritin, desferal, billirubin, billiverdin, melanins, ubiquinone, ubiquinol, ascorbyl palmitate, Mg ascorbyl phosphate, ascorbyl acetate, tocopherols and derivatives such as vitamin E acetate, uric acid, -glucosylrutin, calalase and the superoxide dismutase, glutathione, selenium compounds, butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT), sodium metabisulfite (SMB), propyl gallate (PG) and amino acid cysteine.

(82) In a related aspect the bioavailability enhancer is selected from the group of piperine (BioPerine), quercetin, garlic extract, ginger extract, and naringin. In another related aspect, the stabilizing agent is selected from the group consisting rosmarinic acid, butylated hydroxyanisole, butylated hydroxytoluene, sodium metabisulfite, propyl gallate, cysteine, ascorbic acid and tocopherols.

(83) In yet another related aspect, the dispersible gums are selected from the group consisting of Agar, Alginate, Carrageenan, Gum Arabic, Guar Gum, Locust Bean Gum, Konjac Gum, Xanthan Gum and Pectin.

(84) Tables 5-9, provide illustrative examples of formulations containing Bacillus coagulans

(85) TABLE-US-00007 TABLE 5 Bacillus coagulans Tablet Active Ingredients Bacillus coagulans MTCC 25235: 2 billion cfu Plant fiber Excipients Microcrystalline cellulose, Colloidal silicon dioxide, Magnesium stearate

(86) TABLE-US-00008 TABLE 6 Bacillus coagulans Tablet Active Ingredients Bacillus coagulans MTCC 25235: 2 billion cfu Plant fiber Simethicone Excipients Microcrystalline cellulose, Colloidal silicon dioxide, Magnesium stearate

(87) TABLE-US-00009 TABLE 7 Bacillus coagulans Capsule Active Ingredients Bacillus coagulans MTCC 25235: 2 billion cfu Plant fiber Excipients Microcrystalline cellulose

(88) TABLE-US-00010 TABLE 8 Bacillus coagulans Capsule Active Ingredients Bacillus coagulans MTCC 25235: 2 billion cfu Plant fiber Simethicone Excipients Microcrystalline cellulose

(89) TABLE-US-00011 TABLE 9 Bacillus coagulans Powder Active Ingredients Bacillus coagulans MTCC 25235: 2 billion cfu Plant fiber Excipients Sodium bicarbonate, citric acid, tartaric acid, Polyvinyl pyrrolidone K-30/ Hydroxypropyl Cellulose, Lactose/Mannitol, Sucralose/Sodium Saccharin/ Aspartame, Flavouring agents, Colouring agents

(90) The above formulations are just illustrative examples, any formulation containing the above active ingredient intended for the said purpose will be considered equivalent.

(91) Other modifications and variations to the invention will be apparent to those skilled in the art from the foregoing disclosure and teachings. Thus, while only certain embodiments of the invention have been specifically described herein, it will be apparent that numerous modifications may be made thereto without departing from the spirit and scope of the invention. The scope of the invention is to be interpreted only in conjunction with the appended claims.