COMPOSITIONS AND METHODS USEFUL IN PROMOTING MILK PRODUCTION
20250092129 ยท 2025-03-20
Inventors
- Lindsay Hinck (Santa Cruz, CA, US)
- Sharmila Chatterjee (Santa Cruz, CA, US)
- Oscar Cazares (Santa Cruz, CA, US)
- Min Chen (Santa Cruz, CA, US)
Cpc classification
C07K2319/60
CHEMISTRY; METALLURGY
C07K2319/30
CHEMISTRY; METALLURGY
C12N15/1138
CHEMISTRY; METALLURGY
A01K2207/05
HUMAN NECESSITIES
C07K2317/24
CHEMISTRY; METALLURGY
C07K2317/76
CHEMISTRY; METALLURGY
C07K16/28
CHEMISTRY; METALLURGY
C07K2317/22
CHEMISTRY; METALLURGY
A01K2207/10
HUMAN NECESSITIES
International classification
C07K16/28
CHEMISTRY; METALLURGY
C12N15/113
CHEMISTRY; METALLURGY
Abstract
Methods, agents, and compositions for promoting milk production in a mammal are provided. Agents useful for promoting milk production may include an agent that inhibits NOTCH4 activity. The agent may inhibit NOTCH4 activity by binding to ROBO2 and/or by binding to NOTCH4. The agent may inhibit NOTCH4 by competing with ROBO1 for binding to ROBO2, thereby making ROBO1 available to inhibit NOTCH4 activity. The agent may be a soluble ROBO1 extracellular domain or an anti-NOTCH4 antibody that inhibits NOTCH4 activity. The agent may be an RNAi construct that inhibits expression of NOTCH4 or an RNAi construct that inhibits expression of ROBO2. Also provided herein are transgenic mammals genetically modified for expression of a soluble ROBO1 extracellular domain; inhibition of expression of ROBO2; and/or inhibition of expression of NOTCH4. Methods for promoting milk production in such transgenic mammals by administering one or more of the agents disclosed herein are also provided.
Claims
1-18. (canceled)
19. A polypeptide comprising: a soluble ROBO1 extracellular domain fused to a heterologous polypeptide.
20. The polypeptide of claim 19, wherein the soluble ROBO1 ECD is a murine, bovine, ovine, caprine, or human ROBO1 ECD.
21. The polypeptide of claim 20, wherein the heterologous polypeptide comprises a His tag, a hemagglutinin tag, a human or murine Fc region, a Myc tag, or a fluorescent protein.
22. A pharmaceutical composition comprising: the polypeptide of claim 19 and a pharmaceutically acceptable carrier.
23. (canceled)
24. An anti-NOTCH4 antibody or a NOTCH4 binding fragment thereof that inhibits NOTCH4 activity or a polynucleotide comprising an RNAi construct that inhibits the expression of ROBO2, comprising the nucleic acid sequence of one or more of SEQ ID NO: 34 and 35 or NOTCH4, comprising the nucleic acid sequence of one or more of SEQ ID NO: 32 and 33.
25.-35. (canceled)
36. A transgenic mammal comprising a genetic modification that results in one or more of the following phenotypes: expression of a soluble ROBO1 extracellular domain; inhibition of expression of ROBO2; and inhibition of expression of NOTCH4.
37. The transgenic animal of claim 36, wherein the phenotype is limited to mammary tissue.
38. The transgenic mammal of claim 36- or 37, wherein the transgenic animal is a bovine, ovine, caprine, or camelid.
39.-44. (canceled)
45. The polypeptide of claim 19, wherein the soluble ROBO1 ECD is a bovine ROBO1 ECD.
46. The polypeptide of claim 45, wherein the soluble bovine ROBO1 ECD is fused to a Fc region.
47. The polypeptide of claim 19, wherein the soluble ROBO1 ECD is a human ROBO1 ECD.
48. The polypeptide of claim 47, wherein the soluble human ROBO1 ECD is fused to a Fc region.
49. The pharmaceutical composition of claim 22, wherein the soluble ROBO1 ECD is a bovine ROBO1 ECD.
50. The pharmaceutical composition of claim 49, wherein the soluble bovine ROBO1 ECD is fused to a Fc region.
51. The pharmaceutical composition of claim 22, wherein the soluble ROBO1 ECD is a human ROBO1 ECD.
52. The pharmaceutical composition of claim 51, wherein the soluble human ROBO1 ECD is fused to a Fc region.
Description
DESCRIPTION OF THE DRAWINGS
[0008]
[0009]
[0010]
[0011]
[0012]
[0013]
[0014]
[0015]
[0016]
[0017]
[0018]
[0019]
[0020]
SEQUENCE LISTING
[0021] SEQ ID NO: 1-Bos taurus ROBO1-Ecto [0022] SEQ ID NO: 2-Bos taurus ROBO1-Ig5 [0023] SEQ ID NO: 3-Bos taurus-ROBO1-Ig2 [0024] SEQ ID NO: 4-Homo sapiens ROBO1-Ecto [0025] SEQ ID NO: 5-Homo sapiens ROBO1-Ig5 [0026] SEQ ID NO: 6-Homo sapiens ROBO1-Ig2 [0027] SEQ ID NO: 7-Bison bison ROBO1-Ecto [0028] SEQ ID NO: 8-Bison bison ROBO1-Ig5 [0029] SEQ ID NO: 9-Bison bison ROBO1-Ig2 [0030] SEQ ID NO 10-Camelus bactrianus ROBO1-Ecto [0031] SEQ ID NO: 11-Camelus bactrianus ROBO1-Ig5 [0032] SEQ ID NO: 12-Camelus bactrianus ROBO1-Ig2 [0033] SEQ ID NO: 13-Capra hircus ROBO1-Ecto [0034] SEQ ID NO: 14-Capra hircus ROBO1-Ig5 [0035] SEQ ID NO: 15-Capra hircus ROBO1-Ig2 [0036] SEQ ID NO: 16-Ovis aries ROBO1-Ecto [0037] SEQ ID NO: 17-Ovis aries ROBO1-Ig5 [0038] SEQ ID NO: 18-Ovis aries ROBO1-Ig2 [0039] SEQ ID NO: 19-Bos Mutas ROBO1-Ecto [0040] SEQ ID NO: 20-Bos Mutas ROBO1-Ig5 [0041] SEQ ID NO: 21-Bos Mutas ROBO1-Ig2 [0042] SEQ ID NO: 22-Mus musculus ROBO1-Ecto [0043] SEQ ID NO: 23-Mus musculus ROBO1-Ig5 [0044] SEQ ID NO: 24-Mus musculus ROBO1-Ig2 [0045] SEQ ID NO: 25-Rattus norvegicus ROBO1-Ecto [0046] SEQ ID NO: 26-Rattus norvegicus ROBO1-Ig5 [0047] SEQ ID NO: 27-Rattus norvegicus ROBO1-Ig2 [0048] SEQ ID NO: 28-Rattus norvegicus DCC Ig2 [0049] SEQ ID NO: 29-Rattus norvegicus DCC Ig4 [0050] SEQ ID NO: 30-Robo1 shRNA forward strand [0051] SEQ ID NO: 31-Robo1 shRNA reverse strand [0052] SEQ ID NO: 32-Notch4 shRNA forward strand [0053] SEQ ID NO: 33-Notch4 shRNA reverse strand [0054] SEQ ID NO: 34-Robo2 shRNA forward strand [0055] SEQ ID NO: 35-Robo2 shRNA reverse strand
DETAILED DESCRIPTION
[0056] Methods, agents, and compositions for promoting milk production in a mammal are provided. Agents useful for promoting milk production may include an agent that inhibits NOTCH4 activity. The agent may be a soluble ROBO1 extracellular domain, the agent may inhibit NOTCH4 activity by binding to ROBO2 and/or by binding to NOTCH4. The agent may inhibit NOTCH4 by competing with ROBO1 from binding to ROBO2, thereby making ROBO1 available to inhibit NOTCH4 activity. The agent may be an anti-NOTCH4 antibody that inhibits NOTCH4 activity. The agent may be an RNAi construct that inhibits expression of NOTCH4. The agent may be an RNAi construct that inhibits expression of ROBO2. Also provided herein are transgenic mammals genetically modified for expression of a soluble ROBO1 extracellular domain; inhibition of expression of ROBO2; and/or inhibition of expression of NOTCH4. Methods for promoting milk production in such transgenic mammals by administering one or more of the agents disclosed herein are also provided.
[0057] All publications and patents cited in this specification are herein incorporated by reference as if each individual publication or patent were specifically and individually indicated to be incorporated by reference and are incorporated herein by reference to disclose and describe the materials and/or methods in connection with which the publications are cited. The citation of any publication is for its disclosure prior to the filing date and should not be construed as an admission that the present methods, compositions, and transgenic mammals are not entitled to antedate such publication, as the date of publication provided may be different from the actual publication date which may need to be independently confirmed.
[0058] It is noted that, as used herein and in the appended claims, the singular forms a, an, and the include plural referents unless the context clearly dictates otherwise. It is further noted that the claims may be drafted to exclude any optional element. As such, this statement is intended to serve as antecedent basis for use of such exclusive terminology as solely, only and the like in connection with the recitation of claim elements, or use of a negative limitation.
[0059] As will be apparent to those of skill in the art upon reading this disclosure, each of the individual aspects described and illustrated herein has discrete components and features which may be readily separated from or combined with the features of any of the other several aspects without departing from the scope or spirit of the present methods. Any recited method can be carried out in the order of events recited or in any other order that is logically possible.
Definitions
[0060] The term antibody as used herein refers to an immunoglobulin molecule that recognizes and binds a target through at least one antigen-binding site. Antibody is used herein in the broadest sense and encompasses various antibody structures, including but not limited to, polyclonal antibodies, recombinant antibodies, monoclonal antibodies, chimeric antibodies (e.g., chimera of antibody sequences from two or more different species, such as, human, bovine, ovine, caprine, camelid, etc.), humanized antibodies, human antibodies, bovinized antibodies, ovinized antibodies, caprinized antibodies, camelidized antibodies, bispecific antibodies, multispecific antibodies, diabodies, tribodies, tetrabodies, single chain Fv (scFv) antibodies, single domain antibodies (e.g., camelid/llama antibodies), and antibody fragments.
[0061] The term intact antibody or full-length antibody refers to an antibody having a structure substantially similar to a native antibody structure. This includes an antibody comprising two light chains each comprising a variable region and a light chain constant region (CL) and two heavy chains each comprising a variable region and at least heavy chain constant regions CH1, CH2, and CH3.
[0062] The term antibody fragment as used herein refers to a molecule other than an intact antibody that comprises a portion of an antibody and generally an antigen-binding site. Examples of antibody fragments include, but are not limited to, Fab, Fab, F(ab).sub.2, Fv, disulfide-linked Fv (sdFv), Fd, linear antibodies, single chain antibody molecules (e.g., scFv), diabodies, tribodies, tetrabodies, minibodies, dual variable domain antibodies (DVD), single variable domain antibodies, and multispecific antibodies formed from antibody fragments.
[0063] The term variable region as used herein refers to the region of an antibody light chain or the region of an antibody heavy chain that is involved in binding the antibody to antigen. The variable region of an antibody heavy chain and an antibody light chain have similar structures, and generally comprise four framework regions and three complementarity determining regions (CDRs) (also known as hypervariable regions).
[0064] The term framework regions refers to amino acid residues other than the CDR residues within a variable region. The variable region generally comprises four framework regions, FR1, FR2, FR3, and FR4.
[0065] The term monoclonal antibody as used herein refers to a substantially homogenous antibody population involved in the highly specific recognition and binding of a single antigenic determinant or epitope. The individual antibodies comprising the population are identical, except for possible naturally occurring mutations that may be present in minor amounts. The term monoclonal antibody encompasses intact and full-length monoclonal antibodies as well as antibody fragments (e.g., Fab, Fab, F(ab).sub.2, Fv), single chain (scFv) antibodies, fusion proteins comprising an antibody fragment, and any other modified immunoglobulin molecule comprising an antigen-binding site. Furthermore, monoclonal antibody refers to such antibodies made by any number of techniques, including but not limited to, hybridoma production, phage library display, recombinant expression, and transgenic animals.
[0066] The term chimeric antibody as used herein refers to an antibody in which a portion of the heavy and/or light chain is derived from a particular source or species, while the remainder of the heavy and/or light chain is derived from a different source or species.
[0067] The term humanized antibody as used herein refers to a chimeric antibody that generally comprises human immunoglobulins (e.g., recipient antibody) in which the native CDR residues are replaced by residues from corresponding CDRs from a nonhuman species (e.g., donor antibody) such as mouse, rat, rabbit, or nonhuman primate, wherein the donor antibody has the desired specificity, affinity, and/or activity. In some instances, one or more residues within one or more framework regions of the human immunoglobulin are replaced by corresponding nonhuman residues. Furthermore, humanized antibodies can comprise residues that are not found in the recipient antibody or in the donor antibody. These modifications may be made to further refine and/or optimize antibody characteristics. A humanized antibody may comprise variable regions containing all or substantially all of the CDRs that correspond to those of a nonhuman immunoglobulin and all or substantially all of the framework regions that correspond to those of a human immunoglobulin. In some aspects, the humanized antibody will comprise at least a portion of an immunoglobulin Fc region (e.g., hinge region, CH1, CH2, and/or CH3), typically that of a human immunoglobulin. Similar definition applies to bovinized, ovinized, caprinized, and camelized antibodies.
[0068] The term human antibody as used herein refers to an antibody that possesses an amino acid sequence that corresponds to an antibody produced by a human and/or an antibody that has been made using any of the techniques that are known to those of skill in the art for making human antibodies. These techniques include, but not limited to, phage display libraries, yeast display libraries, transgenic animals, and B-cell hybridoma technology. A human antibody as defined herein excludes a humanized antibody comprising residues from a non-human source.
[0069] The terms epitope and antigenic determinant are used interchangeably herein and refer to that portion of an antigen or target capable of being recognized and bound by a particular binding agent or binding agent (e.g., an antibody). When the antigen or target is a polypeptide, epitopes can be formed both from contiguous amino acids and noncontiguous amino acids juxtaposed by tertiary folding of the protein. Epitopes formed from contiguous amino acids (also referred to as linear epitopes) are typically retained upon protein denaturing, whereas epitopes formed by tertiary folding (also referred to as conformational epitopes) are typically lost upon protein denaturing. An epitope typically includes at least 3, and more usually, at least 5, 6, 7, or 8-10 amino acids in a unique spatial conformation. Epitopes can be predicted using any one of a large number of software bioinformatic tools available on the internet. X-ray crystallography may be used to characterize an epitope on a target protein by analyzing the amino acid residue interactions of an antigen/antibody complex.
[0070] The term specifically binds as used herein refers to a binding agent (e.g., an antibody) that interacts more frequently, more rapidly, with greater duration, with greater affinity, or with some combination of the above to a particular antigen, epitope, protein, or target molecule than with alternative substances. An antibody that specifically binds an antigen can be identified, for example, by immunoassays, ELISAs, surface plasmon resonance (SPR) technology (e.g., Biacore), FACS, or other techniques known to those of ordinary skill in the art.
[0071] The terms polypeptide and peptide and protein are used interchangeably herein and refer to polymers of amino acids of any length. The term peptide may be used to refer to a polymer of less than 50 amino acids, e.g., 5-50 amino acids. The polymer may be linear or branched, it may comprise modified amino acids, and it may be interrupted by non-amino acids. The terms also encompass an amino acid polymer that has been modified naturally or by intervention; for example, by disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation or modification. Also included within the definition are, for example, polypeptides containing one or more analogs of an amino acid, including but not limited to, unnatural amino acids, as well as other modifications known in the art. It is understood that, because some of the polypeptides of this disclosure may be based upon antibodies, the term polypeptide encompasses polypeptides as a single chain and polypeptides of two or more associated chains.
[0072] The terms polynucleotide and nucleic acid and nucleic acid molecule are used interchangeably herein and refer to polymers of nucleotides of any length, and include DNA and RNA. The nucleotides can be deoxyribonucleotides, ribonucleotides, modified nucleotides or bases, and/or their analogs, or any substrate that can be incorporated into a polymer by DNA or RNA polymerase.
[0073] The terms identical or percent identity in the context of two or more nucleic acids or polypeptides, refer to two or more sequences or subsequences that are the same or have a specified percentage of nucleotides or amino acid residues that are the same, when compared and aligned (introducing gaps, if necessary) for maximum correspondence, not considering any conservative amino acid substitutions as part of the sequence identity. The percent identity may be measured using sequence comparison software or algorithms or by visual inspection. Various algorithms and software that may be used to obtain alignments of amino acid or nucleotide sequences are well-known in the art. These include, but are not limited to, BLAST, ALIGN, Megalign, BestFit, GCG Wisconsin Package, and variants thereof. In some aspects, two polynucleotides or polypeptides of the disclosure are substantially identical, meaning they have at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, and in some aspects at least 95%, 96%, 97%, 98%, 99% nucleotide or amino acid residue identity, when compared and aligned for maximum correspondence, as measured using a sequence comparison algorithm or by visual inspection. In some aspects, identity exists over a region of the sequences that is at least about 10, at least about 20, at least about 40-60 nucleotides or amino acid residues, at least about 60-80 nucleotides or amino acid residues in length, or any integral value there between. In some aspects, identity exists over a longer region than 60-80 nucleotides or amino acid residues, such as at least about 80-100 nucleotides or amino acid residues, and in some aspects the sequences are substantially identical over the full length of the sequences being compared, for example, (i) the coding region of a nucleotide sequence or (ii) an amino acid sequence.
[0074] The phrase conservative amino acid substitution as used herein refers to a substitution in which one amino acid residue is replaced with another amino acid residue having a similar side chain. Families of amino acid residues having similar side chains have been generally defined in the art, including basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). For example, substitution of a phenylalanine for a tyrosine is considered to be a conservative substitution. Generally, conservative substitutions in the sequences of polypeptides and/or antibodies do not abrogate the binding of the polypeptide or antibody to the target binding site. Methods of identifying nucleotide and amino acid conservative substitutions that do not eliminate binding are well-known in the art.
[0075] The term vector as used herein means a construct, which is capable of delivering, and usually expressing, one or more gene(s) or sequence(s) of interest in a host cell. Examples of vectors include, but are not limited to, viral vectors, naked DNA or RNA expression vectors, plasmid, cosmid, or phage vectors, DNA or RNA expression vectors associated with cationic condensing agents, and DNA or RNA expression vectors encapsulated in liposomes.
[0076] The term isolated as used herein refers to a polypeptide, peptide, soluble protein, antibody, polynucleotide, vector, cell, or composition that is in a form not found in nature. An isolated antibody is substantially free of material from the cellular source from which it is derived. In some aspects, isolated polypeptides, peptides, soluble proteins, antibodies, polynucleotides, vectors, cells, or compositions are those which have been purified to a degree that they are no longer in a form in which they are found in nature. In some aspects, a polypeptide, peptide, soluble protein, antibody, polynucleotide, vector, cell, or composition that is isolated is substantially pure. A polypeptide, peptide, soluble protein, antibody, polynucleotide, vector, cell, or composition may be isolated from a natural source or from a source such as an engineered cell line.
[0077] The term substantially pure as used herein refers to material which is at least 50% pure (i.e., free from contaminants), at least 90% pure, at least 95% pure, at least 98% pure, or at least 99% pure.
[0078] As used herein, the term derived in the context of a polypeptide refers to a polypeptide that has a sequence that is based on that of a protein from a particular source. A polypeptide derived from a protein from a particular source may be a variant of the protein from the particular source. For example, a polypeptide derived from a protein from a particular source may have a sequence that is modified with respect to the protein's sequence from which it is derived. A polypeptide derived from a protein from a particular source shares at least 50% sequence identity with, at least 60% sequence identity with, at least 70% sequence identity with, at least 80% sequence identity with, or at least 90% sequence identity with the protein from which it is derived.
[0079] The term effective amount as used herein refers to the amount of an agent (e.g., an antibody, polypeptide, nucleic acid, etc.) which is sufficient to produce an intended effect in a subject, such as mammal.
[0080] As used herein, reference to about or approximately a value or parameter includes (and describes) aspects that are directed to that value or parameter. For example, a description referring to about X includes description of X.
[0081] As used in the present disclosure and claims, the singular forms a, an and the include plural forms unless the context clearly dictates otherwise.
[0082] The term and/or as used in a phrase such as A and/or B herein is intended to include both A and B; A or B; A (alone); and B (alone). Likewise, the term and/or as used in a phrase such as A, B, and/or C is intended to encompass each of the following aspects: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); and C (alone).
[0083] As used herein, the term RNAi construct encompasses RNA molecules and vectors whose presence within a cell results in RNA interference (RNAi) and leads to reduced expression of a transcript to which the RNAi construct is targeted. The term includes siRNA, shRNA, and RNAi-inducing vectors.
[0084] As used herein, an RNAi-inducing vector is a vector whose presence within a cell results in transcription of one or more RNAs that self-hybridize or hybridize to each other to form an shRNA or siRNA. This term encompasses plasmids, e.g., DNA vectors or viral vectors. The vector may include a nucleic acid operably linked to expression signal(s) so that one or more RNA molecules that hybridize or self-hybridize to form an siRNA or shRNA are transcribed when the vector is present within a cell. Thus the vector provides a template for intracellular synthesis of the RNA or RNAs or precursors thereof.
[0085] A short, interfering RNA (siRNA) comprises an RNA duplex that is approximately 19 base pairs long and optionally further comprises one or two single-stranded overhangs. An siRNA may be formed from two RNA molecules that hybridize together, or may alternatively be generated from a single RNA molecule that includes a self-hybridizing portion. The duplex portion of an siRNA may, include one or more unpaired nucleotides. One strand of an siRNA includes a portion that hybridizes with a target transcript with perfect complementary or one or two mismatches. In aspects where perfect complementarity is not achieved, any mismatches may be located at or near the siRNA termini.
[0086] The term short hairpin RNA refers to an RNA molecule comprising at least two complementary portions hybridized or capable of hybridizing to form a double-stranded (duplex) structure sufficiently long to mediate RNAi (typically at least 19 base pairs in length), and at least one single-stranded portion, typically between approximately 1 and 10 nucleotides in length that forms a loop. The duplex portion may, but typically does not, contain one or more bulges consisting of one or more unpaired nucleotides.
[0087] Disclosed herein is an examination of the role of ROBO receptors during mammary alveologenesis. In particular, the loss of Robo1 inhibits alveologenesis and the loss of Robo2 enhances alveologenesis. Biochemical studies in cell lines are disclosed that reveal that ROBO1 specifically binds NOTCH4 and inhibits NOTCH4 activation. ROBO1 is shown to be broadly expressed throughout the mammary gland epithelial compartment, while expression of ROBO2 is restricted to alveolar progenitor cells and basal/myoepithelial cells (BCs). Also disclosed are ROBO1 receptor fragments, comprising portions of the ROBO1 extracellular domain (ECD) that inhibit NOTCH4 signaling and promote alveologenesis. It is also disclosed that alveologenesis is enhanced by treatment of cells and mammals with antibodies that inhibit ROBO2 binding to ROBO1. Without being bound by theory, the findings disclosed herein indicate a disinhibitory circuit mechanism (ROBO2-| ROBO1-| NOTCH4) that regulates NOTCH4 signaling and, consequently, the number of alveolar progenitor cells that differentiate into milk-producing alveoli with each pregnancy.
Methods for Enhancing Milk Production in a Mammal
[0088] The present disclosure provides methods of promoting milk production in a mammal. In certain aspects, the method may include administering to the mammal a first agent that inhibits NOTCH4 activity, wherein the first agent is administered in an amount sufficient to inhibit NOTCH4 activity, thereby promoting milk production. The first agent may inhibit NOTCH4 activity by directly binding to NOTCH4 protein, by inhibiting the binding of ROBO2 to ROBO1, by promoting the binding of ROBO1 to NOTCH4, by inhibiting the expression of NOTCH4, or by inhibiting the expression of ROBO2.
[0089] In certain aspects, the first agent may comprise a soluble ROBO1 extracellular domain (ECD). In certain aspects, the soluble ROBO1 ECD may include the entire extracellular domain of ROBO1 or a ROBO2 binding fragment thereof. In certain aspects, the soluble ROBO1 ECD may include at least two immunoglobulin (Ig) domains of ROBO1, e.g., the first two Ig domains of ROBO1. In certain aspects, the soluble ROBO1 ECD may be include at least five immunoglobulin domains of ROBO1. In certain aspects, the soluble ROBO1 ECD may be derived from the extracellular domain of a murine, bovine, ovine, caprine, or human ROBO1. In certain aspects, the soluble ROBO1 ECD may include an amino acid sequence at least 70%, at least 80%, at least 90%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or a 100% identical to the amino acid sequence set forth in any one of SEQ ID NOs: 1-27. In certain aspects, the soluble ROBO1 ECD may include the sequence of any one of SEQ ID NOs: 1-27 with one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or up to 20) conservative amino acid substitutions thereto. In certain aspects, the soluble ROBO1 ECD administered to the mammal may be derived from the sequence of ROBO1 protein expressed by the mammal, to reduce an immune response to the soluble ROBO1 ECD.
[0090] A soluble ROBO1 ECD that may include the entire extracellular region of ROBO1 or a ROBO2 binding fragment thereof may be identified by any means. For example, soluble ROBO1 ECD effective in inhibiting NOTCH4 activity may be identified by performing an assay for measuring binding of the soluble ROBO1 ECD to ROBO2. The assay may include determining whether soluble ROBO1 ECD binds to ROBO2 in the presence of a competitor, such as, a full length ROBO1 or a soluble ROBO1 ECD having the amino acid sequence set forth in any one of SEQ ID NOs. 1-27. In certain aspects, soluble ROBO1 ECD effective in inhibiting NOTCH4 activity may be identified by performing an assay for measuring binding of the soluble ROBO1 ECD to NOTCH4. Binding of soluble ROBO1 ECD to ROBO2 and/or NOTCH4 may be measured by detecting formation of a ROBO1 ECD::ROBO2 complex and/or ROBO1 ECD::NOTCH4 complex. Other methods for identifying binding of a soluble ROBO1 ECD to ROBO2 and/or NOTCH4 may also be used.
[0091] In some aspects, soluble ROBO1 fused or linked to a heterologous polypeptide. In some aspects, the heterologous polypeptide is linked to the amino-terminus, the carboxyl-terminus, or both termini of the soluble ROBO1 ECD. As used herein, the term soluble used in the context of ROBO1 ECD means that the ROBO1 ECD is not localized ECD described herein can be and is not able to localized to the cell surface since it is missing the transmembrane region required for cell surface localization. The soluble ROBO1 ECD is also devoid of the sequence of the intracellular region of ROBO1. In certain aspects, the soluble ROBO1 ECD polypeptide may be fused to an immunoglobulin Fc polypeptide (e.g., human IgG Fc, such as IgG1 Fc), a serum albumin (e.g., human serum albumin, cynomolgus serum albumin or bovine serum albumin), or maltose binding protein. In certain aspects, the soluble ROBO1 ECD may be fused to a protein tag that facilitates purification or tracking of the polypeptide. Such proteins tags include His tag, a hemagglutinin tag, a Fc region (derived from an Ig from a human, bovine, ovine, or caprine antibody, e.g., IgG, IgM, IgA, IgE, or IgD), or a Myc tag.
[0092] In some aspects, the first agent may be an anti-NOTCH4 antibody or a NOTCH4 binding fragment thereof that inhibits NOTCH4 activity. As used herein, the term antibody encompasses antigen-binding fragment thereof unless the context clearly dictates otherwise. In some aspects, the antibody comprises a plurality of polyclonal antibodies that bind to different epitopes on the antigen. In some aspects, the antibody is a recombinant antibody. In some aspects, the antibody is a monoclonal antibody. In some aspects, the antibody is a chimeric antibody. In certain aspects, the antibody is modified to provide for decreased immunogenicity in the mammal receiving the antibody. In some aspects, the antibody is a humanized antibody. In some aspects, the antibody is a human antibody. In some aspects, the antibody is a bovinized antibody. In some aspects, the antibody is a bovine antibody. In some aspects, the antibody is an ovinized antibody. In some aspects, the antibody is an ovine antibody. In some aspects, the antibody is a caprinized antibody. In some aspects, the antibody is a caprine antibody. In some aspects, the antibody is a camelized antibody. In some aspects, the antibody is a camelid antibody. In some aspects, the antibody is an IgA, IgD, IgE, IgG, or IgM antibody. In some aspects, the antibody is an IgG antibody. In some aspects, the antibody is an IgG1, IgG2, IgG3, or IgG4 antibody. In some aspects, the antibody is an antibody fragment comprising at least one antigen-binding site. In some aspects, the antibody is a scFv. In some aspects, the antibody is a disulfide-linked scFv. In some aspects, the antibody is a Fab. In some aspects, the antibody is a bispecific antibody or a multispecific antibody.
[0093] In some aspects, the first agent is a polyclonal antibody that binds to NOTCH4. Polyclonal antibodies can be prepared by any method known to those of skill in the art. In some aspects, polyclonal antibodies are produced by immunizing an animal (e.g., a cow, sheep, camel, rabbit, rat, mouse, goat, donkey) with an antigen of interest (e.g., a purified peptide fragment, a recombinant protein, or a fusion protein) using multiple subcutaneous or intraperitoneal injections. In some aspects, the antigen is conjugated to a carrier such as keyhole limpet hemocyanin (KLH), serum albumin, bovine thyroglobulin, or soybean trypsin inhibitor. The antigen (with or without a carrier protein) is diluted in sterile saline and usually combined with an adjuvant (e.g., Complete or Incomplete Freund's Adjuvant) to form a stable emulsion. After a period of time, polyclonal antibodies are recovered from the immunized animal (e.g., from blood or ascites). In some aspects, the polyclonal antibodies are purified from serum or ascites according to standard methods in the art including, but not limited to, affinity chromatography, ion-exchange chromatography, gel electrophoresis, and/or dialysis.
[0094] In some aspects, first agent is a monoclonal antibody that binds to NOTCH4. Monoclonal antibodies can be prepared by any method known to those of skill in the art. In some aspects, monoclonal antibodies are prepared using hybridoma methods known to one of skill in the art. A mouse, rat, rabbit, hamster, or other appropriate host animal, is immunized as described above. In some aspects, lymphocytes are immunized in vitro. In some aspects, the immunizing antigen is a human protein or a fragment thereof. Following immunization, lymphocytes are isolated and fused with a suitable myeloma cell line using, for example, polyethylene glycol. The hybridoma cells are selected using specialized media as known in the art and unfused lymphocytes and myeloma cells do not survive the selection process. Hybridomas that produce monoclonal antibodies directed to a chosen antigen can be identified by a variety of methods including, but not limited to, immunoprecipitation, immunoblotting, and in vitro binding assays (e.g., flow cytometry, FACS, ELISA, SPR (e.g., Biacore), and radioimmunoassay). Once hybridoma cells that produce antibodies of the desired specificity, affinity, and/or activity are identified, the clones may be subcloned by limiting dilution or other techniques. The hybridomas can be propagated either in in vitro culture using standard methods or in vivo as ascites tumors in an animal. The monoclonal antibodies can be purified from the culture medium or ascites fluid according to standard methods in the art including, but not limited to, affinity chromatography, ion-exchange chromatography, gel electrophoresis, and dialysis.
[0095] In some aspects, monoclonal antibodies are made using recombinant DNA techniques as known to one skilled in the art. For example, the polynucleotides encoding an antibody are isolated from mature B-cells or hybridoma cells, such as by RT-PCR using oligonucleotide primers that specifically amplify the genes encoding the heavy and light chains of the antibody and their sequence is determined using standard techniques. The isolated polynucleotides encoding the heavy and light chains are then cloned into suitable expression vectors that produce the monoclonal antibodies when transfected into host cells such as E. coli, simian COS cells, Chinese hamster ovary (CHO) cells, or myeloma cells that do not otherwise produce immunoglobulin proteins.
[0096] In some aspects, recombinant monoclonal antibodies are isolated from phage display libraries expressing variable domains or CDRs of a desired species (e.g., cow or human). Screening of phage libraries can be accomplished by various techniques known in the art.
[0097] In some aspects, a monoclonal antibody is modified by using recombinant DNA technology to generate alternative antibodies. In some aspects, the constant domains of the light chain and heavy chain of a mouse monoclonal antibody are replaced with the constant regions of a human antibody, ovine antibody, bovine antibody, caprine antibody, or camelid antibody to generate a chimeric antibody. In some aspects, the constant regions are truncated or removed to generate a desired antibody fragment of a monoclonal antibody. In some aspects, site-directed or high-density mutagenesis of the variable region(s) is used to optimize specificity and/or affinity of a monoclonal antibody.
[0098] In some aspects the anti-NOTCH4 antibody is a humanized antibody. Various methods for generating humanized antibodies are known in the art. In some aspects, a humanized antibody comprises one or more amino acid residues that have been introduced into its sequence from a source that is non-human. In some aspects, humanization is performed by substituting one or more amino acids of a CDR sequence of a human antibody with the corresponding amino acids from a non-human antibody (e.g., a mouse antibody). In some aspects, the humanized antibodies are constructed by substituting all six CDRs of a human antibody with corresponding amino acids from the CDRs of a non-human antibody (e.g., a mouse antibody).
[0099] The choice of which human heavy chain variable region and/or light chain variable region are used for generating humanized antibodies can be made based on a variety of factors and by a variety of methods known in the art. In some aspects, the best-fit method is used where the sequence of the variable region of a non-human (e.g., rodent) antibody is screened against the entire library of known human variable region sequences. The human sequence that is most similar to that of the non-human (e.g., rodent) sequence is selected as the human variable region framework for the humanized antibody. In some aspects, a particular variable region framework derived from a consensus sequence of all human antibodies of a particular subgroup of light or heavy chains is selected as the variable region framework. In some aspects, the variable region framework sequence is derived from the consensus sequences of the most abundant human subclasses. In some aspects, human germline genes are used as the source of the variable region framework sequences.
[0100] In some aspects, the anti-NOTCH4 antibody is a human antibody. Human antibodies can be prepared using various techniques known in the art. In some aspects, human antibodies are generated from immortalized human B lymphocytes immunized in vitro. In some aspects, human antibodies are generated from lymphocytes isolated from an immunized individual. In any case, cells that produce an antibody directed against a target antigen can be generated and isolated. In some aspects, a human antibody is selected from a phage library, where that phage library expresses human antibodies. Alternatively, phage display technology may be used to produce human antibodies and antibody fragments in vitro, from immunoglobulin variable region gene repertoires from unimmunized donors. Techniques for the generation and use of antibody phage libraries are well-known in the art. Once antibodies are identified, affinity maturation strategies known in the art, including but not limited to, chain shuffling and site-directed mutagenesis, may be employed to generate higher affinity human antibodies. In some aspects, human antibodies are produced in transgenic mice that contain human immunoglobulin loci. Upon immunization these mice are capable of producing the full repertoire of human antibodies in the absence of endogenous immunoglobulin production.
[0101] In certain aspects, the antibodies may be bovinized antibodies or fully bovine antibodies. Methods for producing a bovinized antibody from a non-bovine antibody may comprise forming a chimeric antibody that retains CDRs from the non-bovine antibody while other regions of the antibody may be replaced with corresponding sequences from a bovine antibody. introducing one or more amino acid residues into it from a bovine antibody. In certain aspects, the non-bovine antibody may be bovinized by replacing the constant regions with constant regions from a bovine antibody. In certain aspects, the non-bovine antibody may be bovinized by replacing the constant regions with constant regions from a bovine antibody and replacing the framework regions with framework regions from a bovine antibody. In certain aspects, a bovinized antibody may be generated by replacing the CDRS of a bovine antibody with the CDRs from a non-bovine antibody. In certain cases, the antibody may be a fully bovine antibody that is produced using gene sequences encoding a bovine antibody. A fully bovine antibody may be produced in a bovine, in a bovine cell line, in a non-bovine cell lines genetically modified to express bovine antibodies, or in a transgenic non-bovine animal genetically modified to express bovine antibodies. Similar methods may be used to generate species specific antibodies that when administered to the species produces reduced immune response to the antibody. For example, ovinized antibodies, caprinized antibodies, camelized antibodies may be produced for purpose of administering the antibody to an ovine, caprine, and camelid, respectively.
[0102] CDRs of an antibody are defined by those skilled in the art using a variety of methods/systems. These systems and/or definitions have been developed and refined over a number of years and include Kabat, Chothia, IMGT, AbM, and Contact. The Kabat definition is based on sequence variability and is commonly used. The Chothia definition is based on the location of the structural loop regions. The IMGT system is based on sequence variability and location within the structure of the variable domain. The AbM definition is a compromise between Kabat and Chothia. The Contact definition is based on analyses of the available antibody crystal structures. An Exemplary system is a combination of Kabat and Chothia. Software programs (e.g., abYsis) are available and known to those of skill in the art for analysis of antibody sequence and determination of CDRs.
[0103] The specific CDR sequences defined herein are generally based on a combination of Kabat and Chothia definitions (Exemplary system). However, it will be understood that reference to a heavy chain CDR or CDRs and/or a light chain CDR or CDRs of a specific antibody will encompass all CDR definitions as known to those of skill in the art.
[0104] In some aspects, an anti-NOTCH4 antibody comprises an antibody in which at least one or more of the constant regions has been modified or deleted. In some aspects, the antibodies may comprise modifications to one or more of the three heavy chain constant regions (CH1, CH2 or CH3) and/or to the light chain constant region (CL). In some aspects, the heavy chain constant region of the modified antibodies comprises at least one human constant region. In some aspects, the heavy chain constant region of the modified antibodies comprises more than one human constant region. In some aspects, modifications to the constant region comprise additions, deletions, or substitutions of one or more amino acids in one or more regions. In some aspects, one or more regions are partially or entirely deleted from the constant regions of the modified antibodies. In some aspects, the entire CH2 domain has been removed from an antibody (CH2 constructs). In some aspects, a deleted constant region is replaced by a short amino acid spacer that provides some of the molecular flexibility typically imparted by the absent constant region. In some aspects, a modified antibody comprises a CH3 domain directly fused to the hinge region of the antibody. In some aspects, a modified antibody comprises a peptide spacer inserted between the hinge region and modified CH2 and/or CH3 domains.
[0105] It is known in the art that the constant region(s) of an antibody mediates several effector functions and these effector functions can vary depending on the isotype of the antibody. For example, binding of the C1 component of complement to the Fc region of IgG or IgM antibodies (bound to antigen) activates the complement system. Activation of complement is important in the opsonization and lysis of cell pathogens. The activation of complement also stimulates the inflammatory response and can be involved in autoimmune hypersensitivity. In addition, the Fc region of an antibody can bind a cell expressing a Fc receptor (FcR). There are a number of Fc receptors that are specific for different classes of antibody, including IgG (gamma receptors), IgE (epsilon receptors), IgA (alpha receptors) and IgM (mu receptors). Binding of antibody to Fc receptors on cell surfaces triggers a number of important and diverse biological responses including engulfment and destruction of antibody-coated particles, clearance of immune complexes, lysis of antibody-coated target cells by killer cells (called antibody-dependent cell cytotoxicity or ADCC), release of inflammatory mediators, placental transfer, and control of immunoglobulin production.
[0106] In some aspects, an anti-NOTCH4 antibody comprises a variant Fc region. The amino acid sequences of the Fc region of human IgG1, IgG2, IgG3, and IgG4 are known to those of ordinary skill in the art. In some aspects, the variant Fc region provide for altered effector functions that, in turn, affect the biological profile of the antibody. For example, in some aspects, the deletion or inactivation (through point mutations or other means) of a constant region reduces or eliminates Fc receptor binding of the modified antibody as it circulates. In some aspects, the constant region modifications increase the serum half-life of the antibody. In some aspects, the constant region modifications reduce the serum half-life of the antibody. In some aspects, the constant region modifications decrease, reduce, or remove ADCC and/or complement dependent cytotoxicity (CDC) of the antibody. In some aspects, specific amino acid substitutions in a human IgG1 Fc region with corresponding IgG2 or IgG4 residues may reduce effector functions (e.g., ADCC and CDC) in the modified antibody. In some aspects, an antibody does not have one or more effector functions. In some aspects, the antibody has no ADCC activity and/or no CDC activity. In some aspects, the antibody does not bind an Fc receptor and/or complement factors. In some aspects, the antibody has no effector function(s) (e.g., effectorless antibodies). In some aspects, the constant region modifications increase or enhance effector functions of the antibody. In some aspects, the constant region modifications increase or enhance ADCC and/or CDC of the antibody. In some aspects, the constant region is modified to eliminate disulfide linkages or oligosaccharide moieties. In some aspects, the constant region is modified to add/substitute one or more amino acids to provide one or more cytotoxin, oligosaccharide, or carbohydrate attachment sites.
[0107] Modifications to the constant region of antibodies described herein may be made using well-known biochemical or molecular engineering techniques. In some aspects, antibody variants are prepared by introducing appropriate nucleotide changes into the encoding DNA, and/or by synthesis of the desired antibody or polypeptide. Using this technique, it may be possible to disrupt the activity or effector function provided by a specific sequence or region while substantially maintaining the structure, binding activity, and other desired characteristics of the modified antibody.
[0108] The present disclosure further embraces additional variants and equivalents that are substantially homologous to the recombinant, monoclonal, chimeric, humanized, and human antibodies, or antibody fragments thereof, described herein. In some aspects, it is desirable to improve the binding affinity of the antibody. In some aspects, it is desirable to modulate biological properties of the antibody, including but not limited to, specificity, thermostability, expression level, effector function(s), glycosylation, immunogenicity, and/or solubility. Those skilled in the art will appreciate that amino acid changes may alter post-translational processes of an antibody, such as changing the number or position of glycosylation sites or altering membrane anchoring characteristics. Variations may be a substitution, deletion, or insertion of one or more nucleotides encoding the antibody or polypeptide that results in a change in the amino acid sequence as compared with the native antibody or polypeptide sequence. In some aspects, amino acid substitutions are the result of replacing one amino acid with another amino acid having similar structural and/or chemical properties, such as the replacement of a leucine with a serine, e.g., conservative amino acid replacements. The variant antibodies or polypeptides described herein may be generated using methods known in the art, including but not limited to, site-directed mutagenesis, alanine scanning mutagenesis, and PCR mutagenesis.
[0109] In some aspects, an agent that inhibits NOTCH4 activity as described herein is chemically modified. In some aspects, the soluble ROBO1 ECD and/or the anti-NOTCH4 antibody that has been chemically modified by glycosylation, acetylation, pegylation, phosphorylation, amidation, derivatization by known protecting/blocking groups, proteolytic cleavage, and/or linkage to a cellular ligand or other protein. Any of numerous chemical modifications may be carried out by known techniques.
[0110] In some aspects, the method may involve increasing milk production in a mammalian species, where the mammalian species comprises human, bovine, ovine, caprine, or camelid and the method may include administering to the mammalian species a soluble ROBO1 ECD derived from a human ROBO1, a bovine ROBO1, a ovine ROBO1, a caprine ROBO1, or a camelid ROBO1, respectively. In certain aspects, the mammal is a female at a stage of development suitable for milk production. For example, the mammal may be a female that has developed mammary glands. In certain aspects, the mammal is a woman, a cow, a doe, an ewe, or a female camel. In certain aspects, the mammal may be pregnant when an agent that inhibits NOTCH4 activity is administered to the mammal. In certain aspects, the mammal may have given birth prior to the administering of an agent that inhibits NOTCH4 activity. For example, the mammal may have given birth within 1-2 years of the administering, e.g., within 3 months, 6 months, 1 year, or 18 months. In other aspects, the mammal is not pregnant. In some aspects, the mammal has not given birth prior to the administering of an agent that inhibits NOTCH4 activity. For example, the mammal has not given birth within 1-2 years of the administering, e.g., within 3 months, 6 months, 1 year, or 18 months.
[0111] In some aspects, an agent that inhibits NOTCH4 activity as described herein may be an RNAi construct that binds to NOTCH4 mRNA and decreases expression of NOTCH4. In some aspects, an agent that inhibits ROBO2 activity as described herein may be an RNAi construct that binds to ROBO2 mRNA and decrease expression of ROBO2. The RNAi construct may be a short interfering RNA (siRNA). The siRNA may be a short hairpin RNA (shRNA). The RNAi construct may be a micro RNA (miRNA). Methods for making RNAi constructs to inhibit expression of any known gene sequence are known to those of skill in the art. In certain aspects, the siRNA for decreasing expression of NOTCH4 may include a nucleic acid sequence set forth in SEQ ID NOs: 32 or 33. In certain aspects, the siRNA for decreasing expression of ROBO2 may include a nucleic acid sequence set forth in SEQ ID NOs: 34 or 35. In certain aspects, the RNAi construct may be administered to the mammal. In other aspects, a nucleic acid
[0112] In certain aspects, the method for promoting milk production in a mammal may involve administering one or more of the agents that inhibit NOTCH4 activity. In certain aspects, the method may include administering at least one of a first agent and a second agent, where the first agent and the second agent is independently selected from a soluble ROBO1 ECD, an anti-NOTCH4 antibody, an RNAi construct that inhibits the expression of NOTCH4, or an RNAi construct that inhibits the expression of ROBO2. In certain aspects, the method may include administering at least one of first agent, a second agent, and a third agent where the first agent, the second agent, and the third agent is independently selected from a soluble ROBO1 ECD, an anti-NOTCH4 antibody, an RNAi construct that inhibits the expression of NOTCH4, or an RNAi construct that inhibits the expression of ROBO2. In certain aspects, the method may include administering a first agent, a second agent, a third agent, and a fourth agent where the first agent, the second agent, the third agent, and the fourth agent is independently selected from a soluble ROBO1 ECD, an anti-NOTCH4 antibody, an RNAi construct that inhibits the expression of NOTCH4, or an RNAi construct that inhibits the expression of ROBO2.
[0113] One or more agents for inhibiting NOTCH4 activity may be administered to a mammal for promoting milk production via any suitable route including parenteral (e.g., intramuscular, intravenous, subcutaneous (e.g., injection or implant), intraperitoneal, intracisternal, intraarticular, intraperitoneal, intracerebral (intraparenchymal) and intracerebroventricular), oral, nasal, vaginal, sublingual, intraocular, rectal, topical (e.g., transdermal), sublingual and inhalation. In certain aspects, the one or more agents may be administered via direct injection, e.g., injection into mammary tissue, e.g., intraductal injection.
Agents for Inhibiting NOTCH4 Activity and Compositions Thereof
[0114] Also provided herein are agents and compositions thereof that may be used for performing the methods disclosed herein.
[0115] In certain aspects, a polypeptide comprising a soluble ROBO1 ECD polypeptide as disclosed herein is provided. The soluble ROBO1 ECD polypeptide may be fused to a heterologous polypeptide as disclosed herein. In certain aspects, a nucleic acid encoding a soluble ROBO1 ECD polypeptide as disclosed herein is provided. Description of soluble ROBO1 ECD polypeptides is provided in the preceding sections and elsewhere herein and is not reiterated here for brevity. A soluble ROBO1 ECD can be produced using methods known in the art. Polypeptides can be produced, in whole or in part, using standard recombinant DNA technology or using chemical methods. Chemical methods for synthesizing polypeptides may involve using various solid-phase techniques that may be performed using an automated peptide synthesizer (e.g., a Biotage instrument). Chemical methods for synthesizing polypeptides may involve using combinatorial methodologies. In addition, polypeptides can be modified by a wide variety of chemical methods known to those of skill in the art. Polypeptide sequence variations, substitutions, and/or modifications can also be made using methods such as site-directed mutagenesis, alanine scanning, and/or PCR-based mutagenesis. Site-directed mutagenesis, cassette mutagenesis, restriction selection mutagenesis, and other techniques can be performed on cloned DNA to produce soluble ROBO1 ECD, variants, fusions, chimeras, and other derivatives thereof. A produced or synthesized polypeptide sequence is a polypeptide made by any method involving manipulation by the hand of man. Such methods include but are not limited to, chemical synthesis, recombinant DNA technology, biochemical or enzymatic fragmentation of larger molecules, and combinations of the foregoing.
[0116] Where a polypeptide, e.g., soluble ROBO1 ECD polypeptide is produced using recombinant techniques, the polypeptide may be produced as an intracellular protein or as a secreted protein, using any suitable construct and any suitable host cell, which can be a prokaryotic or eukaryotic cell, such as a bacterial (e.g., E. coli) or a yeast host cell, respectively. In certain aspects, eukaryotic cells that are used as host cells for production of the polypeptide include insect cells, mammalian cells, and/or plant cells. In certain aspects, mammalian host cells are used and may include human cells (e.g., HeLa, 293, H9 and Jurkat cells); mouse cells (e.g., NIH3T3, L cells, and C127 cells); primate cells (e.g., Cos 1, Cos 7 and CV1) and hamster cells (e.g., Chinese hamster ovary (CHO) cells). In specific aspects, the polypeptides disclosed herein are produced in CHO cells or HEK cells. In certain aspects, the polypeptides of the present disclosure, e.g., soluble ROBO1 ECD, are produced in cells cultured in the presence of heparin. For example, about 300 ng/ml of heparin may be included in the culture medium. In other aspects, the polypeptides of the present disclosure, e.g., soluble ROBO1 ECD, are produced in cells cultured in a culture medium not containing significant amounts of heparin, e.g., the culture medium may contain less than 300 ng/ml, 100 ng/ml, 50 ng/ml, 25 ng/ml, 10 ng/ml, or 1 ng/ml heparin, or no heparin.
[0117] A variety of host-vector systems suitable for the expression of a polypeptide may be employed according to standard procedures known in the art. See, e.g., Sambrook et al., 1989 Current Protocols in Molecular Biology Cold Spring Harbor Press, New York; and Ausubel et al. 1995 Current Protocols in Molecular Biology, Eds. Wiley and Sons. Methods for introduction of genetic material into host cells include, for example, transformation, electroporation, conjugation, calcium phosphate methods and the like. The method for transfer can be selected so as to provide for stable expression of the introduced polypeptide-encoding nucleic acid. The polypeptide-encoding nucleic acid can be provided as an inheritable episomal element (e.g., a plasmid) or can be genomically integrated. A variety of appropriate vectors for use in production of a polypeptide of interest are commercially available.
[0118] Vectors can provide for extrachromosomal maintenance in a host cell or can provide for integration into the host cell genome. The expression vector provides transcriptional and translational regulatory sequences and may provide for inducible or constitutive expression where the coding region is operably-linked under the transcriptional control of the transcriptional initiation region, and a transcriptional and translational termination region. In general, the transcriptional and translational regulatory sequences may include, but are not limited to, promoter sequences, ribosomal binding sites, transcriptional start and stop sequences, translational start and stop sequences, and enhancer or activator sequences. Promoters can be either constitutive or inducible, and can be a strong constitutive promoter (e.g., T7).
[0119] Also provided herein are nucleic acids encoding the polypeptides disclosed herein. In certain aspects, a nucleic acid encoding the polypeptides disclosed herein is operably linked to a promoter sequence that confers expression of the polypeptides. In certain aspects, the sequence of the nucleic acid is codon optimized for expression of the polypeptide in a mammalian cell. In certain aspects, the nucleic acid is a deoxyribonucleic acid (DNA). In certain aspects, the nucleic acid is a ribonucleic acid (RNA). Also provided herein is a vector comprising the nucleic acid encoding the polypeptide for promoting milk productions, as described herein. In certain aspects, the vector is a viral vector.
[0120] In certain aspects, an anti-NOTCH4 antibody as disclosed herein is provided. Description of anti-NOTCH4 antibodies is provided in the preceding sections and elsewhere herein and is not reiterated here for brevity. An anti-NOTCH4 antibody for inhibiting NOTCH4 activity may be identified by using any suitable means, such as, assays and/or cells and animal models disclosed herein.
[0121] In certain aspects, an RNAi construct that inhibits expression of NOTCH4 or an RNAi construct that inhibits expression of ROBO2 as disclosed herein is provided. Description of such RNAi constructs is provided in the preceding sections and elsewhere herein and is not reiterated here for brevity. RNAi constructs for inhibiting NOTCH4 activity may be identified by using any suitable means, such as, assays and/or cells and animal models disclosed herein.
[0122] Also disclosed herein are pharmaceutical compositions comprising one or more inhibitors of NOTCH4 activity as disclosed herein and a pharmaceutically acceptable carrier. The term pharmaceutically acceptable as used herein refers to a substance approved or approvable by a regulatory agency or listed in the U.S. Pharmacopeia, European Pharmacopeia, or other generally recognized pharmacopeia for use in animals, including humans.
[0123] The terms pharmaceutically acceptable excipient, carrier, or adjuvant or acceptable pharmaceutical carrier as used herein refer to an excipient, carrier, or adjuvant that can be administered to a subject, together with at least one agent, and which does not have an effect on the pharmacological activity of the agent. In general, those of skill in the art and the U.S. FDA consider a pharmaceutically acceptable excipient, carrier, or adjuvant to be an inactive ingredient of any formulation.
[0124] The term pharmaceutical formulation or pharmaceutical composition as used herein refers to a preparation that is in such form as to permit the biological activity of the agent (e.g., an antibody) to be effective. A pharmaceutical formulation or composition generally comprises additional components, such as a pharmaceutically acceptable excipient, carrier, adjuvant, buffers, etc.
[0125] In certain aspects, the polypeptides and the nucleic acids (e.g., encoding the polypeptides or RNAi) are present in a therapeutically effective amount in the pharmaceutical composition. A therapeutically effective amount can be determined based on an observed effectiveness of the composition. A therapeutically effective amount can be determined using assays that measure the desired effect in a cell, e.g., in a reporter cell line in which expression of a reporter is modulated in response to the polypeptides of the present disclosure. The pharmaceutical compositions can be administered ex vivo or in vivo to a mammal in order to practice the methods and uses described herein.
[0126] The pharmaceutical compositions of the present disclosure can be formulated to be compatible with the intended method or route of administration; exemplary routes of administration are set forth herein. Suitable pharmaceutically acceptable or physiologically acceptable diluents, carriers or excipients include, but are not limited to, nuclease inhibitors, protease inhibitors, a suitable vehicle such as physiological saline solution or citrate buffered saline.
[0127] Solutions or suspensions used for parenteral, intradermal, or subcutaneous administration can include the following components: a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerine, propylene glycol or other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid; buffers such as acetates, citrates or phosphates and agents for the adjustment of tonicity such as sodium chloride or dextrose. pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide. The parenteral preparation can be enclosed in ampoules, disposable syringes or multiple dose vials made of glass or plastic.
[0128] Pharmaceutical compositions suitable for injectable use typically include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor EL (BASF, Parsippany, N.J.) or phosphate buffered saline (PBS).
[0129] Sterile injectable solutions can be prepared by incorporating the active compound in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle which contains a basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and freeze-drying which yields a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.
[0130] Oral compositions generally include an inert diluent or an edible carrier. For the purpose of oral therapeutic administration, the active compound can be incorporated with excipients and used in the form of tablets, troches, or capsules, e.g., gelatin capsules. Oral compositions can also be prepared using a fluid carrier for use as a mouthwash. Pharmaceutically compatible binding agents, and/or adjuvant materials can be included as part of the composition. The tablets, pills, capsules, troches and the like can contain any of the following ingredients, or compounds of a similar nature: a binder such as microcrystalline cellulose, gum tragacanth or gelatin; an excipient such as starch or lactose, a disintegrating agent such as alginic acid, Primogel, or corn starch; a lubricant such as magnesium stearate or Sterotes; a glidant such as colloidal silicon dioxide; a sweetening agent such as sucrose or saccharin; or a flavoring agent such as peppermint, methyl salicylate, or orange flavoring. Formulations for oral delivery may advantageously incorporate agents to improve stability within the gastrointestinal tract and/or to enhance absorption.
[0131] For administration by inhalation, the compositions are formulated with a delivery agent for delivery in the form of an aerosol spray from a pressured container or dispenser which contains a suitable propellant, e.g., a gas such as carbon dioxide, or a nebulizer.
[0132] Systemic administration can also be by transmucosal or transdermal means. For transmucosal or transdermal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art, and include, for example, for transmucosal administration, detergents, bile salts, and fusidic acid derivatives. Transmucosal administration can be accomplished through the use of nasal sprays or suppositories. For transdermal administration, the active compounds and delivery agents are formulated into ointments, salves, gels, or creams as generally known in the art. The compositions can also be prepared in the form of suppositories (e.g., with conventional suppository bases such as cocoa butter and other glycerides) or retention enemas for rectal administration.
[0133] In one aspect, the compositions are prepared with carriers that will protect the compound against rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems. Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Methods for preparation of such formulations will be apparent to those skilled in the art. The materials can also be obtained commercially from Alza Corporation and Nova Pharmaceuticals, Inc. Liposomal suspensions (including liposomes targeted to infected cells with monoclonal antibodies to viral antigens) can also be used as pharmaceutically acceptable carriers.
[0134] Oral or parenteral compositions may be formulated in dosage unit form for ease of administration and uniformity of dosage. Dosage unit form as used herein refers to physically discrete units suited as unitary dosages for the intended subject; each unit containing a predetermined quantity of active compound calculated to produce the desired effect in association with the required pharmaceutical carrier.
[0135] As described above, nucleic acid molecules that serve as templates for transcription of siRNA or shRNA can be inserted into vectors which can be used as gene therapy vectors. Nucleic acid molecules encoding soluble ROBO1 ECD may also be can be inserted into vectors which can be used as gene therapy vectors. In general, gene therapy vectors can be delivered to a subject by, for example, intravenous injection, local administration, or by stereotactic injection. In certain aspects, compositions comprising gene therapy vectors and a delivery agent may be delivered orally or via inhalation and may be encapsulated or otherwise manipulated to protect them from degradation, etc. The pharmaceutical compositions comprising a gene therapy vector can include an acceptable diluent, or can comprise a slow release matrix in which the gene delivery vehicle is imbedded. Alternatively, where the complete gene delivery vector can be produced intact from recombinant cells, e.g., retroviral or lentiviral vectors, the pharmaceutical preparation can include one or more cells which produce the gene delivery system.
[0136] Pharmaceutical compositions can be included in a container, pack, or dispenser together with instructions for administration.
Transgenic Mammals
[0137] In certain aspects, a transgenic mammal comprising a genetic modification that results in one or more of the following phenotypes: expression of a soluble ROBO1 extracellular domain; inhibition of expression of ROBO2; and inhibition of expression of NOTCH4 is provided. In certain aspects, the transgenic mammal may be a murine, bovine, ovine, caprine, or camelid.
[0138] In certain aspects, the phenotype is limited to mammary tissue. In certain aspects, the phenotype is limited to mammary tissue by using a mammary tissue specific promoter to induce the expression of the phenotype.
[0139] In certain aspects, the transgenic mammal may include two genetic modifications that result in two of the listed phenotypes. In certain aspects, the transgenic mammal may include three genetic modifications that result in all three of the listed phenotypes.
[0140] In certain aspects, the methods for promoting milk production as disclosed herein may involve administering to the transgenic mammal at least one of the pharmaceutical compositions that inhibits NOTCH4 activity, as disclosed herein.
[0141] In certain aspects, the transgenic animal may include a genetic modification that results in expression of a soluble ROBO1 extracellular domain, the method may further include administering the pharmaceutical composition comprising an anti-ROBO1 antibody, and anti-NOTCH4 antibody, or an RNAi construct that inhibition of expression of ROBO2 and/or NOTCH4 to the transgenic animal.
[0142] In certain aspects, the transgenic animal may include a genetic modification that results in inhibition of expression of ROBO2 and/or NOTCH4, the method may further include administering to the transgenic animal the pharmaceutical composition comprising a soluble ROBO1 ECD as disclosed herein.
[0143] A transgenic mammal may be produced using methods known in the art. Exemplary methods for making a transgenic mammal may include the following steps: 1) producing a gene construct containing a nucleic acid encoding a soluble ROBO1 ECD or a nucleic acid sequence transcribed into a siRNA or shRNA targeting NOTCH4 or ROBO2 under the control of a promoter. The promoter can be a mammary gland specific promoter or a ubiquitously active promoter. 2) transfecting the gene construct into a cell from a mammal, e.g., a cow cell and selecting for transgenic cells that have incorporated the gene construct. 3) fusing (e.g., by applying an electrical pulse) the transgenic cell with an enucleated oocyte from the same species as the transgenic cell (e.g. cow) and allowing the oocyte to develop into an embryo. 4) Transplanting the embryo into a recipient mammal of the same species as the embryo (e.g. cow). 5) Confirming that the embryo developed into a transgenic mammal.
EXPERIMENTAL
ROBO1 is Expressed in Both Luminal and Basal Compartments and Upregulated During Pregnancy:
[0144] Previously published studies have focused on the role of SLIT/ROBO1 signaling during the period of branching morphogenesis in the virgin animal.sup.11,15,16. To investigate the role of ROBO1 during pregnancy, Robo1 mRNA levels in cells isolated from mammary glands were measured using RT qPCR (
[0145] To evaluate the expression of ROBO1 and ROBO2 proteins in tissue, immunohistochemistry (
ROBO1 Enhances Alveologenesis:
[0146] To investigate ROBO1 function during alveologenesis, Robo1 gene expression was inhibited in HC11 cells (Robo1 KD). HC11 cells are a well-established, prolactin-responsive model of lactation.sup.19,20 Cells in which Robo1 gene expression was not inhibited are referred to as WT or Robo1+/+ herein. To measure milk production, cells were grown to confluence and then primed by treatment with epidermal growth factor (EGF, 10 ng/ml). The EGF is administered for three days in combination with charcoal-stripped fetal bovine serum, followed by one day of charcoal-stripped fetal bovine serum in the absence of EGF. These primed cells are then differentiated by treatment with dexamethasone (1 g/ml), insulin (5 g/ml) and prolactin (Prl, 5 g/ml) media (DIP media) for between 3 and 5 days (
[0147] To ensure this defect was due to Robo1 inhibition in mammary epithelia and not due to its global deletion that can affect hormone production.sup.21, tissue from Robo1/ and littermate Robo1+/+ mice were contralaterally transplanted into hosts that had been pre-cleared of endogenous mammary epithelium following standard protocols.sup.22. After ten weeks, the animals were mated and the tissue examined at pregnant day 18. Significantly less alveolar area was observed in transplanted Robo1/ KO mammary glands (
[0148] Selected markers were further evaluated using immunohistochemistry. WAP expression in Robo1/ and WT pregnant day 18 mammary glands showed less WAP immunostaining staining in the Robo1/ tissue (
[0149] In addition, whole organ tissue clearing was used to optimize optical clarity and morphological preservation of the tissue. This was followed by dual immunohistochemistry using an antibody specific to the transcription factor ELF5, which is required for alveologenesis.sup.6, and using an antibody specific to the cell-cell adhesion protein E-cadherin (CDH1) (
Loss of Robo1 Hampers Milk Production In Vivo:
[0150] To assess the effect of Robo1 expression on milk production, crosses were performed to generate heterozygous pups that were then fed by either a Robo1/ or WT dam. Heterozygous pups were generated by crossing a WT male with a Robo1/ female and by crossing a Robo1/ male with a WT female. The litter size was restricted to five pups and these pups were weighed daily (
ROBO1 Interacts with and Inhibits NOTCH4 Signaling:
[0151] Notch signaling is exquisitely sensitive to dosage, with the outcome depending on the level of receptor activity.sup.23. After ligand binding, Notch receptors are activated by cleavage. First there is an extracellular cleavage, followed by a -secretase-mediated, intracellular cleavage that releases the Notch intracellular domain (ICD), which enters the nucleus and regulates transcription. RNA-sequencing analysis of FACS-purified subpopulations isolated from virgin mammary glands reveal higher expression of Notch signaling effector Hey1 in the Robo1/ luminal progenitor (LP) subpopulation, relative to Robo1+/+ (
[0152] The Sca/CD54 marker was used to enrich alveolar progenitor cells (AVPs) from the FACS-purified pool of luminal progenitor cells. Similar to the data from the bulk luminal progenitor cells (
[0153] Previous studies have shown that alveologenesis requires the downregulation of Notch signaling.sup.6, particularly Notch4.sup.7-9. Alveolar progenitor cells (AVPs) were FACS-purified from virgin (Virg) and pregnant day 18 (PD18) animals and expression of the Notch4 target genes Hes1 and Hey1 examined by RT-qPCR (
[0154] The effect of Notch in the HC11 cell differentiation assay was also assessed. Inhibition of Robo1 expression (KD) resulted in significantly less HC11 milk dome formation relative to controls (Scr) (
[0155] In additional experiments, Notch4 expression was inhibited in HC11 cells (siN4). These cells displayed greater WAP and Lalba expression relative to control cells (Scr). In still other experiments both Robo1 and Notch4 expression were inhibited in HC11 cells (dKD), resulting in increased WAP and Lalba expression relative to control cells (Scr), similar to the levels of WAP and Lalba expression observed with Robo1 inhibition plus GSI treatment (siR1+GSI) (
[0156] Notch receptor activation can be regulated through direct interactions with binding partners.sup.24. Consequently, it is possible that ROBO1 binds to and directly inhibits the cleavage and activation of NOTCH4. To address this possibility, co-immunoprecipitation experiments were performed using MBA-MD-231 cells lysates, which express detectable levels of all four Notch receptors (NOTCH1-4). Endogenous ROBO1 co-immunoprecipitated with NOTCH4, but not NOTCH1, NOTCH2 or NOTCH3 (
[0157] Additional work addressed how the formation of the ROBO1/NOTCH4 complex is regulated over the time course of HC11 differentiation. An expression analysis was performed during the stages of HC11 differentiation (confluence, primed, milk dome formation).sup.19,20. Analysis of ROBO1, pSTAT5 and the intracellular domain of NOTCH4 by Western blot over this time course revealed higher levels of ROBO1 (R1) and pSTAT5 during the milk dome formation stage, compared to other stages. In contrast, the NOTCH4 intracellular domain (N4-ICD) was expressed at lower levels during the milk dome formation stage (
ROBO1 Inhibits Notch Signaling in Primary Cells and Mammals:
[0158] Because loss of Robo1 enhances NOTCH4 signaling and inhibits the differentiation of HC11 cells, this process was further evaluated in primary cells and animals. Alveolar progenitor cells were FACS-purified, plated at single cell density in Matrigel, and then allowed to grow in media supplemented with neuregulin (100 ng/ml) and R-spondin (42.5 ng/ml) for 5 days. The cells were then switched to a DIP media and allowed to differentiate for an additional 5 days 25. Colonies grown from Robo1/ alveolar progenitor cells were observed to be smaller than colonies grown from WT alveolar progenitor cells and the Robo1/ colonies did not produce WAP (
[0159] In further work, Notch signaling was inhibited to attempt to reverse the Robo1/ phenotype. A -inhibitor that has been previously employed successfully in vivo to inhibit Notch in several different organs 26-28, including the mammary gland 29, was selected. Mature virgin animals were treated for seven days with 10 mg/kg of the GSI or vehicle control 29 (
[0160] Examination of the expression of Notch effector genes (Hey1 and Hes1) revealed less expression of Notch effectors in GSI-treated, compared to vehicle-treated, animals (
ROBO2 Inhibits Alveologenesis:
[0161] Inhibition of Robo2 in animals and cells resulted in the opposite phenotype as that resulting from the inhibition of Robo1 expression. In HC11 cells, the inhibition of Robo2 expression (Robo2 KD) led to faster differentiation, higher WAP expression and greater milk dome number as compared to a control cells (Scr). Inhibition of Robo1 and Robo2 in the same cells resulted in a milk dome number indistinguishable from the negative control (
[0162] Alveologenesis was evaluated in both intact Robo2/ mammary glands and contralaterally transplanted Robo2/ outgrowths. Significantly faster alveologenesis was observed in both intact Robo2/ mammary glands and in Robo2/ transplants relative to Robo2+/+ control mammary glands as measured by alveolar area (
[0163] Robo2 expression was assessed by RT-qPCR in FACS-purified subpopulations from virgin mammary epithelial cells. Unlike Robo1, which is expressed in all subpopulations, Robo2 expression is more restrictedit is expressed at a high level in alveolar progenitor cells (AVPs) and at a lower level in basal cells (BCs) (
[0164] One interpretation of these phenotypic and expression data is that ROBO2 inhibits ROBO1 in alveolar progenitor cells. During differentiation, ROBO2 is downregulated, releasing ROBO1, which then inhibits NOTCH4, creating a disinhibitory circuit (ROBO2-| ROBO1-| NOTCH4) (
The Interaction Between ROBO1 and ROBO2 is Potentiated by SLIT:
[0165] The interactions between SLIT and ROBO proteins are evolutionarily conserved, as evidenced by studies showing that human SLIT2 binds Drosophila Robo1 with similar affinity as its mammalian receptor, and, vice versa, that Drosophila Slit binds rat ROBO1 and ROBO2.sup.30. Biochemical studies show the interaction between this receptor/ligand pair involves the highly conserved second LRR domain of Slit and the conserved Ig1 domain of Robo, while the Ig2-Ig5 domains and all FN3 domains of ROBO1 appear dispensable for binding.sup.31-34. In addition, studies have shown that ROBO1 and ROBO2 can bind to each other, both in cis.sup.32,35,36 and in trans.sup.37. This interaction also depends on the Ig domains. Recent crystallography experiments show that unliganded ROBOs form a compact homotypic dimer that opens in response to SLITs, allowing the formation of a dimer-of-dimers between ROBOs.sup.38.
[0166] The disclosed model indicates that ROBO2 inhibits ROBO1. To investigate whether this inhibition is due to a direct interaction, a co-immunoprecipitation experiment was performed on endogenous proteins in HEK cells using a ROBO1 antibody. A band that is bound by a ROBO2 antibody, which appears to be a glycosylated form, co-immunoprecipitated, with ROBO1. This band is lower in intensity when the immunoprecipitation is performed using cells in which Robo1 expression is inhibited (
ROBO1 Receptor Extracellular Domain Fragments Bind ROBO2:
[0167] The experiments disclosed herein suggest that ROBO1 and NOTCH4 form a complex that inhibits NOTCH4 activation, suggesting a direct interaction between the two proteins. Previous studies have shown that soluble extracellular domain fragments of many transmembrane receptors act to block both homophilic and heterophilic interactions between transmembrane receptors as well as interactions between transmembrane receptors and their ligands.sup.39. It can be hypothesized that soluble ROBO1 extracellular domains (ECDs) can similarly interfere with the interaction between ROBO1 and ROBO2. Constructs comprising ROBO1 ECDs can compete for ROBO2 binding with endogenous ROBO1, thereby allowing the endogenous ROBO1 to bind NOTCH4 and inhibit NOTCH4 activation, thereby enhancing alveolar differentiation and promoting milk production (
[0168] Three recombinant ROBO1 ECD constructs were constructed: one comprising two immunoglobulin (Ig) domains (ROBO1-Ig2), another comprising all five Ig domains (ROBO1-Ig5), and another comprising the entire extracellular domain (ROBO1-Ecto) (
[0169] Soluble ROBO1 ECD fragments ROBO1-Ig2 and ROBO1-Ig5 generated in the presence of heparin were used in a dome assay. The results indicated that soluble ROBO1 ECD fragments generated in the presence of heparin formed fewer domes than the same fragments generated in the absence of heparin (
ROBO1 Extracellular Domain Fragments Enhance HC11 Cell Differentiation:
[0170] To determine whether the ROBO1 ECD fragments influence NOTCH4 signaling, HC11 assays were performed to monitor dome formation using both phase contrast microscopy (
[0171] Dome number formation in response to a titration of ROBO1 ECD fragments was quantified. Higher concentrations of ROBO1-Ig2, ROBO1-Ig5, and ROBO-1-Ecto significantly correlated with higher rates of dome formation. This result was not observed in response to treatment with either DCC-Ig2 or DCC-Ig4 control ECD fragments (
[0172] To determine whether the promotion of dome formation also results in higher milk production, HC11 cells were differentiated in the presence or absence of ROBO1-ECD fragments that were added to cells simultaneously with DIP media. Cells were harvested and the expression of WAP and Lalba assessed by RT-qPCR. Treatment with different ROBO1-ECDs resulted in 6-9 fold greater expression relative to no treatment controls (
ROBO1 Extracellular Domain Fragments Inhibit Notch Signaling:
[0173] To examine the effects of ROBO1-ECD fragments on Notch signaling, HC11 cells were treated with ROBO1-ECD fragments and Notch effector expression assessed. ROBO1-Ig5 and ROBO1-Ecto treatment resulted in lower expression of Hey1 and Hes1 (
[0174] Disclosed herein is a model whereby soluble ROBO1 ECD fragments bind ROBO2, preventing it from binding endogenous transmembrane ROBO1 and thereby promoting formation of ROBO1/NOTCH complexes that interfere with Notch signaling (
ROBO1 Extracellular Domain Fragments Enhance Organoid Formation and Mammary Gland Branching:
[0175] The influence of ROBO1 ECD fragments in vitro on primary alveolar progenitor cell growth and in vivo on branching morphogenesis was tested. FACS-purified murine and bovine alveolar progenitor cells (AVPs) were plated as single cells in Matrigel and grown for 10 days in the absence and presence of ROBO1-ECDs fragments (
ROBO1 Extracellular Domain Fragments Increase Lobulo-Alveolar Mammary Development and Milk Production:
[0176] The influence of ROBO1 ECD-Fc fragments in vivo on lobulo-alveolar development during pregnancy was investigated. ROBO1 ECD fragments (7.5 mg/kg) and mock-injected control were subcutaneously injected three times (pregnant day (PD) 8.5, PD 11.5 and PD 14.5) during pregnancy (
[0177] To further evaluate milk production, RT-qPCR on milk protein genes whey acidic protein (WAP), Xanthine Dehydrogenase (XDH) and beta-casein (CSN2) was performed. Compared to control treatment, there are significant increases in milk protein gene expression with ROBO1 ECD-Fc treatment (
ROBO1 is Required in Basal Cells of the Mammary Gland for Alveolar Differentiation and Milk Production:
[0178] The mammary gland is a bi-layered tissue composed of outer basal cells (basal compartment) and inner luminal cells (luminal compartment) (
ROBO1 Inhibits Jagged1 Expression in Basal Cells:
[0179] One way to regulate Notch expression is to control the expression levels of Notch ligands Jagged1, Jagged2 or Delta. To investigate if ROBO2 regulated Notch ligand expression, cells were transfected with increasing amount of a plasmid expressing Robo1. After 48H, the cells were harvested and immunoblotting performed with antibodies directed against ROBO1, JAGGED1 (JAG1) and GAPDH (loading control) (
Materials and Methods
Animals:
[0180] All animal procedures were performed in accordance with the University of California, Santa Cruz (UCSC) Institutional Animal Care and Use Committee (IACUC). All Robo1 mice were generated and genotyped as previously described.sup.11.
Mammary Fat Pad Clearing, and Transplantation:
[0181] A small mammary gland tissue fragment from an 8-week-old WT and Robo1 KO mouse was contralaterally transplanted into pre-cleared fat pads of Foxn1.sup.nu. Contralateral outgrowths were harvested at pregnant day 18.5 and subjected to carmine staining.
Mammary Gland Whole-Mount Carmine-Alum Assays:
[0182] Mouse mammary glands were surgically dissected, spread onto a glass slide, and fixed in Carnoy's solution (25% glacial acetic acid and 75% ethanol). Following a briefly dehydration, glands were stained overnight in 0.2% carmine and 0.5% aluminum potassium sulphate, dehydrated in graded solutions of ethanol (70%, 95% and 100%), cleared in toluene; and mounted with per mount.
Fat Pad Filling Analysis:
[0183] Paraffin embedded Robo1 KO or WT littermate tissue or contralateral outgrowths were sectioned and subjected to hematoxylin and eosin (H&E) staining. Images were analyzed using ImageJ, and percentage fat pad filling was calculated by measuring the area occupied by the alveoli.
Immunohistochemistry and Beta-Galactosidase Staining:
[0184] Tissue was fixed in 4% paraformaldehyde. Paraffin embedded tissue was sectioned at 6 m and mounted serially. Standard protocols were followed for immunohistochemistry. For beta-galactosidase staining, 40 mg/ml 5-bromo-4-chloro-3-indolyl--D-galactopyranoside was prepared in a 1M phosphate buffer containing 1M MgCl2 and 10 mM potassium ferrous cyanide. Cryosections of tissue is treated with attain solution at 37 C. for 1.5-24H, washed with PBS, dehydrated through ethanol, fixed with xylene and coverslipped.sup.42.
Microscopy:
[0185] Brightfield imaging was performed on a Biorevo BZ-9000 Digital Microscope (Keyence) and confocal microscopy performed on a Nikon C2 Confocal, Leica SP5 confocal. Collected data were analyzed using ImageJ.
Co-Immunoprecipitation:
[0186] Adherent cells were lysed in 1 mL of 1 lysis buffer (137 nM NaCl, 10 mM Tris-HCl pH8, 2 nM EDTA, 1 mM sodium orthovanadate) supplemented with 1 percent Igepal NP40 (Sigma), 1 mM phenylmethanesulfonylfluoride (PMSF), 1 mM leupeptin, 1 mM aprotinin, and phosphatase inhibitors (Roche Complete). Cell lysate was incubated for 15 minutes at 4 C. with gentle rocking followed by centrifugation at 12,000 rpms for 10 minutes. Soluble phase was incubated with Dynabeads protein A (Thermo-fisher) conjugated with 1 g of antibody as per company protocol for 1 hr at room temp or 4 hr at 4 C. Samples were washed and eluted as per protocol. Eluted protein complex was mixed with 2 Lysis buffer and incubated at 70 C. for 10 minutes and 100 C. for 5 minutes.
Western Blotting:
[0187] Protein lysates were prepared by directly lysing adherent cells in 1 sample buffer supplemented with 5% beta-mercaptoethanol and boiled for 5 minutes. Protein lysate was resolved by SDS-PAGE and transferred to a PVDF for 90 minutes at 400 mA or overnight at 30 mA. Primary antibodies were used at the concentration indicated in Table 1 and incubated overnight at 4 C. HRP conjugated secondary antibodies (Jackson Labs) were used at 1:3000 and incubated for 45 minutes at room temp. All proteins were detected using Clarity ECL (BioRad) using a BioRad Chemi-Doc MP Imager and quantified using ImageLab software as previously described.sup.43.
2D Cell Cultures:
[0188] All cell lines were obtained American Type Culture Collection. MDA-MB-231 cells were cultured in DMEM growth medium (Gibco) supplemented with 10% heat-inactivated FBS (Seradigm) and 1 antibiotic-antimycotic (Gibco). Undifferentiated HC11 cells were cultured in RPMI-1640 growth medium (Gibco) and supplemented with 10 g/mL bovine insulin (Sigma-Aldrich) and 10 ng/ml human EGF (Peprotech). Primary LECs were harvested from 8-week-old Robo1 KO or WT littermate as previously described.sup.15.
3D Cell Cultures:
[0189] FACS purified AVPs were cultured in Matrigel (BD Bioscience) at a density of 5000 cell/100 uL and cultured in basal medium; DMEM: F12 phenol-free, 10 mM HEPES, N2 (Gibco), B27 (Gibco) supplemented with 100 ng/ml Neuregulin (R&D), 42.5 ng/mL R-Spondin1 (Peprotech) for 5 days. To differentiate cultured AVPs were grown in basal medium supplemented with 10.sup.6 M dexamethasone (Sigma), 10 g/mL bovine insulin (Sigma) and 5 g/mL prolactin (National Hormone and Peptide program) for an additional 5 days. Acini were fixed and processed as previously described.sup.44.
HC11 Dome Assay:
[0190] HC11 cells were grown in RPMI 1640 media (Gibco) supplemented with 10% fetal bovine serum (BioFluid Technologies), 5 g/mL insulin (Sigma), and 10 ng/ml epidermal growth factor (EGF; Sigma). To induce differentiation in HC11 cells, confluent plates were given fresh media (RPMI 1640 media supplemented with 5% charcoal-stripped fetal bovine serum (BioFluid Technologies), 5 g/mL insulin, and 10 ng/ml epidermal growth factor (EGF; Sigma) for 3 days followed by 24 hours of priming in priming medium (RPMI 1640 media supplemented with 5% charcoal-stripped fetal bovine serum (BioFluid Technologies), and 5 g/ml insulin. After priming, DIP medium (RPMI 1640 media supplemented with 5% charcoal-stripped fetal bovine serum (BioFluid Technologies), 10.sup.6 M dexamethasone (Sigma), 5 g/mL insulin, and 5 g/mL prolactin (National Hormone and Peptide program) was added with fresh media every 24 hours.
Lentiviral Production:
[0191] Production of lentiviral particles for scrambled, Robo1, Robo2 and Notch4, knockdown experiments involved combination transfection of psPAX2, pMD2.G, and pLVTHM-scrambled-GFP (SCR) or pLVTHM-sh-target GFP into HEK293T cells. Filtered (0.45 um) viral particles were then diluted in media to infect target mammary lines (MDA-MB-231 and HC11 cells).
Isolation of Mammary Epithelial Cells and Flow Cytometry:
[0192] Mechanically dissociated inguinal and thoracic mammary fat pads were prepared into cell suspension for FACS as described.sup.17. AVPs were isolated using FITC-CD14 (clone Sa14-2; BioLegend) and ACP-Cy7-CD117 (clone 2B8; BioLegend) as described.sup.14.
In-Vivo Gamma Secretase Inhibitor (GSI):
[0193] GSI inhibitor (RO4929097; MedchemExpress) was orally administer at 10 mg/kg for 5 days as described.sup.29. Mammary glands were harvest after 5 days of GSI or vehicle treatment and prepared for single cell analysis. Purified populations were collected and processed for RNA. Purified population numbers were analyzed using FlowJo.
RNA Extraction and RT-qPCR:
[0194] Total RNA was harvested from cells lysed in TRIzol reagent (Invitrogen) and phase separated according to manufacturer's protocol with an additional overnight RNA precipitation stem in ethanol (Macias et al., 2011). The RNA was further purified with TURBO DNase (Ambion) treatment. Total RNA quality was analyzed by agarose gel electrophoresis and quantified with an ND-1000 spectrophotometer (NanoDrop). cDNA libraries were prepared from 1 g of total RNA using iScript cDNA synthesis kit (BioRad). Quantitative RT-PCR was performed in triplicates using light Cycler 480 SYBR Green I Master (Roche) and quantified using BioRad CFXConnect Real-Time System and CFX Manager software (BioRad). Results were normalized to GAPDH.
ROBO1 Extracellular Domain Generation:
[0195] To generate protein fragments, HEK cells were transfected with plasmids corresponding to the fragment of interest. PEI transfection was performed according to the Cytographica protocol. 24 hours after transfection, the media was changed to OptiMEM. 8 days after transfection, the media was collected and centrifuged at 3000g for 10 minutes. The supernatant was then filtered through a 0.45 m PVDF filter.
TCA Precipitation:
[0196] Add 1 volume of TCA stock to 4 volumes of protein sample. Incubate 10 min at 4 C. Spin tube in microcentrifuge at 14K rpm, 5 min. Remove supernatant, leaving protein pellet intact Wash pellet with 200 l cold acetone. Spin in microfuge at 14K rpm, 5 min. Repeat steps 4-6 for a total of 2 acetone washes. Dry pellet prior to suspending in sample buffer.
Bodipy 493/503 Staining:
[0197] Place cells in a half-volume of buffer or media. Make a 2 solution (2 g/ml=7.6 M) of Invitrogen BODIPY 493/503 dye in 0.5 mL volume of the same pre-warmed buffer or media (no cells, no BSA or serum) and mix vigorously to mechanically emulsify this solution. Immediately add to the solution of cells, mix and incubate up to 30 min.
CUBIC Immunofluorescence:
[0198] Glands were harvested and fixed with 10% neutral buffer formalin (Sigma) overnight at 4 C. Fixation was quenched with PBST (0.1% Triton X-100; Sigma) containing 0.2% Glycine (Fisher Scientific) for 210 minutes. The glands were then incubated in CUBIC reagent 1A at 37 C. for 48 hours, followed by 310 minute washes with PBST as described.sup.45. Glands were blocked with PBST/10% donkey serum (Sigma) overnight at 4 C. and then, incubated with primary antibodies in PBST/5% donkey serum for 48 hours at 4 C. Glands were then washed with PBST for 31 hour and incubated with secondary antibodies diluted in PBST/5% donkey serum for 24 hours at 4 C. To counterstain for DNA, glands were incubated with Hoechst diluted in PBST for 1 hour, then washed with PBST for 21 hour. Finally, glands were incubated with CUBIC reagent 2 at 4 C. until they were cleared, typically 24 hours.
Intraductal Injection:
[0199] Preparation for the injection: Mice were anesthetized using an isoflurane chamber and eye lubricant applied. Mice were continuously anesthetized with 2-4% isoflurane in oxygen via a nose cone. Hair is removed from the nipple areas with Nair chemical hair remover. Injection: At pregnant day 7, PBS or ROBO2 mAb is bilaterally injected into the nipples of glands #3, #4, #5 with 33-gauge beveled-ended needles (Hamilton) attached to a 50 l syringe. Injection was performed very slowly (approximately 40 l/min) to minimize potential damage caused by rapidly moving fluid within the ductal lumens. After injection: The animal is removed from the nose cone and moved to a separate cage for recovery.sup.46.
Ovariectomy, Hormone Treatments and Subcutaneous Injection:
[0200] C57BL mice (8-10 weeks old) were bilaterally ovariectomized and allowed to recover for 1 week.sup.47. During the recovery, mice were trained with oral administration Nutella. Mice were fed Nutella mixed with 17beta-estradiol (E, 1 g, Sigma)+progesterone (P, 1 mg, Sigma) for three weeks (daily). For ROBO1-Ig5 ECD, prolactin (Prl, 200 g, NHPP) was given by Nutella oral administration over one week (daily), starting after 1 week E+P. For ROBO2 mAb, prolactin (Prl, 50 g) was injected by intraperitoneal injection over 2.5 weeks (daily), starting after 1 week E+P. ROBO1-Ig5 ECD was injected subcutaneously (7.5 mg/kg ROBO1-Ig5 ECD or PBS; daily) over the 2 weeks period, starting after 1 week of E+P. ROBO2 mAbs or IgG isotype control mAbs (250 g/mouse) were injected subcutaneously twice/week over 17 days, starting after 1 week of E+P.sup.48.
Primers:
TABLE-US-00001 Gene Forwardsequence Reversesequence mHes1 GTGGGTCCTAACGCAGTGTC ACAAAGGCGCAATCCAATAT (SEQIDNO:36) G (SEQIDNO:37) mHey1 TGAGCTGAGAAGGCTGGTAC ACCCCAAACTCCGATAGTCC (SEQIDNO:38) (SEQIDNO:39) mHey1 CCGCATCAACAGTAG TGCAAGACCTCAGCT CCTTT TTCTC (SEQIDNO:40) (SEQIDNO:41) mWap TCTGCCAAACCAACGAGGAG AGAAGCCAGCTTTCGGAACA TG CC (SEQIDNO:42) (SEQIDNO:43) mLalba GAGTCGGAGAACATCTGTGG CTTCTCAGAGCACATGGGCT CA TG (SEQIDNO:44) (SEQIDNO:45) mXdh GCTCTTCGTGAGCACCAGAA CCACCCATTCTTTTCACTCG C GAC (SEQIDNO:46) (SEQIDNO:47) mBtn1 AGACAACGACGACTTCGAGG GTACCATCCAGAGGAGGTGC AG AAC (SEQIDNO:48) (SEQIDNO:49) mRobo1 TTATGGTGATGTGGACCTTA GGTTGTATGGGATGGTTGGA GTA G (SEQIDNO:50) (SEQIDNO:51) mElf5 ACCCTGCCTTTGAGCATCAG GCTTGTACTGGTCGCAGCAG AC AA (SEQIDNO:52) (SEQIDNO:53) mGapdh CATGGCCTTCCGTGTTCCTA CCTGCTTCACCACCTTCTTG (SEQIDNO:54) AT (SEQIDNO:55)
Antibodies:
TABLE-US-00002 Antibody Clone Catalog Number Company Species Dilution -ER HC-20 sc-543 Santa Cruz Rabbit 1:1000 -WAP M-16 sc-14832 Santa Cruz Goat 1:250 -ELF5 N-20 sc-9645 Santa Cruz Goat 1:250 -PLIN2 5205 Gift: Rabbit 1:100 McManaman lab -SMA 1A4 A2547 Sigma Mouse 1:500 -CK8 TROMA-1 DSHB Rat 1:500 -CK5 ab53121 Abcam Rabbit 1:1000 -ROBO1 ab7279 Abcam Rabbit 1:500 -ROBO2 ab75014 Abcam Rabbit 1:500 -NOTCH4 ICD H-225 sc-5594 Santa Cruz Rabbit 1:250 -NOTCH4 ECD EPR18049 ab184742 Abcam Rabbit 1:1000 -NOTCH4 EPNCIR101 ab166605 Abcam Rabbit 1:250 -NOTCH1 C-20-R sc-6014-R Santa Cruz Rabbit 1:250 -NOTCH2 M-20 sc-7423 Santa Cruz Goat 1:250 -NOTCH3 D11B8 mAb#5276 Cell Signaling Rabbit 1:200 -STAT5a C-6 sc-271542 Santa Cruz Mouse 1:250 -pSTAT5a/b 5G4 sc-81524 Santa Cruz Mouse 1:250 -HES1 E-5 sc-166410 Santa Cruz Mouse 1:250 -Histone H1 FL-219 sc-10806 Santa Cruz Rabbit 1:1000 -GAPDH-HRP FL-335 HRP sc-25778 HRP Santa Cruz Rabbit 1:1000 -EGFP GFP-1020 Aves lab Inc Chicken 1:500 -Myc 9E10 Sc-40 Santa Cruz mouse 1:1000
REFERENCES
[0201] 1 Macias, H. & Hinck, L. Mammary gland development. Wiley interdisciplinary reviews. Developmental biology 1, 533-557, doi: 10.1002/wdev.35 (2012). [0202] 2 Raafat, A. et al. Expression of Notch receptors, ligands, and target genes during development of the mouse mammary gland. J Cell Physiol 226, 1940-1952, doi: 10.1002/jcp.22526 (2011). [0203] 3 Dontu, G. et al. Role of Notch signaling in cell-fate determination of human mammary stem/progenitor cells. Breast Cancer Res 6, R605-615, doi: 10.1186/bcr920 (2004). [0204] 4 Bouras, T. et al. Notch signaling regulates mammary stem cell function and luminal cell-fate commitment. Cell stem cell 3, 429-441, doi: 10.1016/j.stem.2008.08.001 (2008). [0205] 5 Raouf, A. et al. Transcriptome analysis of the normal human mammary cell commitment and differentiation process. Cell stem cell 3, 109-118, doi: 10.1016/j.stem.2008.05.018 (2008). [0206] 6 Chakrabarti, R. et al. Elf5 regulates mammary gland stem/progenitor cell fate by influencing notch signaling. Stem Cells 30, 1496-1508, doi: 10.1002/stem.1112 (2012). [0207] 7 Jhappan, C. et al. Expression of an activated Notch-related int-3 transgene interferes with cell differentiation and induces neoplastic transformation in mammary and salivary glands. Genes Dev 6, 345-355 (1992). [0208] 8 Gallahan, D. et al. Expression of a truncated Int3 gene in developing secretory mammary epithelium specifically retards lobular differentiation resulting in tumorigenesis. Cancer Res 56, 1775-1785 (1996). [0209] 9 Smith, G. H. et al. Constitutive expression of a truncated INT3 gene in mouse mammary epithelium impairs differentiation and functional development. Cell Growth Differ 6, 563-577 (1995). [0210] 10 Marlow, R. et al. SLITs suppress tumor growth in vivo by silencing Sdf1/Cxcr4 within breast epithelium. Cancer Res 68, 7819-7827, doi: 10.1158/0008-5472.CAN-08-1357 (2008). [0211] 11 Strickland, P., Shin, G. C., Plump, A., Tessier-Lavigne, M. & Hinck, L. Slit2 and netrin 1 act synergistically as adhesive cues to generate tubular bi-layers during ductal morphogenesis. Development 133, 823-832 (2006). [0212] 12 Borrell, V. et al. Slit/Robo signaling modulates the proliferation of central nervous system progenitors. Neuron 76, 338-352, doi: 10.1016/j.neuron.2012.08.003 (2012). [0213] 13 Biteau, B. & Jasper, H. Slit/Robo signaling regulates cell fate decisions in the intestinal stem cell lineage of Drosophila. Cell reports 7, 1867-1875, doi: 10.1016/j.celrep.2014.05.024 (2014). [0214] 14 Shore, A. N. et al. Pregnancy-induced noncoding RNA (PINC) associates with polycomb repressive complex 2 and regulates mammary epithelial differentiation. PLOS Genet 8, e1002840, doi: 10.1371/journal.pgen.1002840 (2012). [0215] 15 Macias, H. et al. SLIT/ROBO1 signaling suppresses mammary branching morphogenesis by limiting basal cell number. Dev Cell 20, 827-840, doi: 10.1016/j.devcel.2011.05.012 (2011). [0216] 16 Ballard, M. S. et al. Mammary Stem Cell Self-Renewal Is Regulated by Slit2/Robo1 Signaling through SNAI1 and mINSC. Cell reports 13, 290-301, doi: 10.1016/j.celrep.2015.09.006 (2015). [0217] 17 Shackleton, M. et al. Generation of a functional mammary gland from a single stem cell. Nature 439, 84-88, doi: 10.1038/nature04372 (2006). [0218] 18 Stingl, J. et al. Purification and unique properties of mammary epithelial stem cells. Nature 439, 993-997, doi: 10.1038/nature04496 (2006). [0219] 19 Ball, R. K., Friis, R. R., Schoenenberger, C. A., Doppler, W. & Groner, B. Prolactin regulation of beta-casein gene expression and of a cytosolic 120-kd protein in a cloned mouse mammary epithelial cell line. EMBO J 7, 2089-2095 (1988). [0220] 20 Desrivieres, S. et al. Comparative proteomic analysis of proliferating and functionally differentiated mammary epithelial cells. Mol Cell Proteomics 2, 1039-1054, doi: 10.1074/mcp.M300032-MCP200 (2003). [0221] 21 Dickinson, R. E. & Duncan, W. C. The SLIT-ROBO pathway: a regulator of cell function with implications for the reproductive system. Reproduction 139, 697-704, doi: 10.1530/REP-10-0017 (2010). [0222] 22 Deome, K. B., Faulkin, L. J., Jr., Bern, H. A. & Blair, P. B. Development of mammary tumors from hyperplastic alveolar nodules transplanted into gland-free mammary fat pads of female C3H mice. Cancer Res 19, 515-520 (1959). [0223] 23 Andersson, E. R., Sandberg, R. & Lendahl, U. Notch signaling: simplicity in design, versatility in function. Development 138, 3593-3612, doi: 10.1242/dev.063610 (2011). [0224] 24 Chillakuri, C. R., Sheppard, D., Lea, S. M. & Handford, P. A. Notch receptor-ligand binding and activation: insights from molecular studies. Semin Cell Dev Biol 23, 421-428, doi: 10.1016/j.semcdb.2012.01.009 (2012). [0225] 25 Jarde, T. et al. Wnt and Neuregulin1/ErbB signalling extends 3D culture of hormone responsive mammary organoids. Nat Commun 7, 13207, doi: 10.1038/ncomms13207 (2016). [0226] 26 Bi, P. et al. Inhibition of Notch signaling promotes browning of white adipose tissue and ameliorates obesity. Nat Med 20, 911-918, doi: 10.1038/nm.3615 (2014). [0227] 27 Huang, R., Zhou, Q., Veeraragoo, P., Yu, H. & Xiao, Z. Notch2/Hes-1 pathway plays an important role in renal ischemia and reperfusion injury-associated inflammation and apoptosis and the gamma-secretase inhibitor DAPT has a nephroprotective effect. Ren. Fail. 33, 207-216, doi: 10.3109/0886022X.2011.553979 (2011). [0228] 28 Chen, Y. et al. Inhibition of Notch signaling by a gamma-secretase inhibitor attenuates hepatic fibrosis in rats. PloS one 7, e46512, doi: 10.1371/journal.pone.0046512 (2012). [0229] 29 Regan, J. L. et al. Aurora A kinase regulates mammary epithelial cell fate by determining mitotic spindle orientation in a Notch-dependent manner. Cell reports 4, 110-123, doi: 10.1016/j.celrep.2013.05.044 (2013). [0230] 30 Brose, K. et al. Slit proteins bind Robo receptors and have an evolutionarily conserved role in repulsive axon guidance. Cell 96, 795-806 (1999). [0231] 31 Howitt, J. A., Clout, N. J. & Hohenester, E. Binding site for Robo receptors revealed by dissection of the leucine-rich repeat region of Slit. EMBO J 23, 4406-4412, doi: 10.1038/sj.emboj.7600446 (2004). [0232] 32 Liu, Z. et al. Extracellular Ig domains 1 and 2 of Robo are important for ligand (Slit) binding. Mol Cell Neurosci 26, 232-240, doi: 10.1016/j.mcn.2004.01.002 (2004). [0233] 33 Morlot, C. et al. Structural insights into the Slit-Robo complex. Proc Natl Acad Sci USA 104, 14923-14928, doi: 10.1073/pnas.0705310104 (2007). [0234] 34 Fukuhara, N., Howitt, J. A., Hussain, S. A. & Hohenester, E. Structural and functional analysis of slit and heparin binding to immunoglobulin-like domains 1 and 2 of Drosophila Robo. J Biol Chem 283, 16226-16234, doi: 10.1074/jbc.M800688200 (2008). [0235] 35 Hivert, B., Liu, Z., Chuang, C. Y., Doherty, P. & Sundaresan, V. Robo1 and Robo2 are homophilic binding molecules that promote axonal growth. Mol Cell Neurosci 21, 534-545 (2002). [0236] 36 Evans, T. A. & Bashaw, G. J. Functional diversity of Robo receptor immunoglobulin domains promotes distinct axon guidance decisions. Curr Biol 20, 567-572, doi: 10.1016/j.cub.2010.02.021 (2010). [0237] 37 Evans, T. A., Santiago, C., Arbeille, E. & Bashaw, G. J. Robo2 acts in trans to inhibit Slit-Robo1 repulsion in pre-crossing commissural axons. Elife 4, e08407, doi: 10.7554/eLife.08407 (2015). [0238] 38 Aleksandrova, N. et al. Robo1 Forms a Compact Dimer-of-Dimers Assembly. Structure 26, 320-328 e324, doi: 10.1016/j.str.2017.12.003 (2018). [0239] 39 Peschon, J. J. et al. An essential role for ectodomain shedding in mammalian development. Science 282, 1281-1284 (1998). [0240] 40 Lupu, C. et al. Cellular effects of heparin on the production and release of tissue factor pathway inhibitor in human endothelial cells in culture. Arterioscler Thromb Vasc Biol 19, 2251-2262 (1999). [0241] 41 Richter, W. F. & Jacobsen, B. Subcutaneous absorption of biotherapeutics: knowns and unknowns. Drug Metab. Dispos. 42, 1881-1889, doi: 10.1124/dmd.114.059238 (2014). [0242] 42 Brisken, C. et al. Prolactin controls mammary gland development via direct and indirect mechanisms. Dev Biol 210, 96-106. (1999). [0243] 43 Le, L. T. et al. Loss of miR-203 regulates cell shape and matrix adhesion through ROBO1/Rac/FAK in response to stiffness. J Cell Biol 212, 707-719, doi: 10.1083/jcb.201507054 (2016). [0244] 44 Harburg, G. et al. SLIT/ROBO2 signaling promotes mammary stem cell senescence by inhibiting Wnt signaling. Stem cell reports 3, 385-393, doi: 10.1016/j.stemcr.2014.07.007 (2014). [0245] 45 Lloyd-Lewis, B. et al. Imaging the mammary gland and mammary tumours in 3D: optical tissue clearing and immunofluorescence methods. Breast Cancer Res 18, 127, doi: 10.1186/s13058-016-0754-9 (2016). [0246] 46 Krause, S., Brock, A. & Ingber, D. E. Intraductal injection for localized drug delivery to the mouse mammary gland. J Vis Exp, doi: 10.3791/50692 (2013). [0247] 47 Strom, J. O., Theodorsson, A., Ingberg, E., Isaksson, I. M. & Theodorsson, E. Ovariectomy and 17beta-estradiol replacement in rats and mice: a visual demonstration. J Vis Exp, e4013, doi: 10.3791/4013 (2012). [0248] 48 Machholz, E., Mulder, G., Ruiz, C., Corning, B. F. & Pritchett-Corning, K. R. Manual restraint and common compound administration routes in mice and rats. J Vis Exp, doi: 10.3791/2771 (2012).
[0249] While preferred aspects of the present invention have been shown and described herein, it will be apparent to those skilled in the art that such aspects are provided by way of example only. Numerous variations, changes, and substitutions will now occur to those skilled in the art without departing from the invention. It should be understood that various alternatives to the aspects of the invention described herein may be employed in practicing the invention. It is intended that the following claims define the scope of the invention and that methods and structures within the scope of these claims and their equivalents be covered thereby.
[0250] For reasons of completeness, certain aspects of the polypeptides, composition, and methods of the present disclosure are set out in the following numbered clauses: [0251] 1. A method of promoting milk production in a mammal, the method comprising: [0252] administering to the mammal a first agent that inhibits NOTCH4 activity in an amount sufficient to inhibit NOTCH4 activity, thereby promoting milk production. [0253] 2. The method of clause 1, wherein the first agent inhibits NOTCH4 activity by directly binding to NOTCH4 protein, by inhibiting the binding of ROBO2 to ROBO1, by promoting the binding of ROBO1 to NOTCH4, by inhibiting the expression of NOTCH4, or by inhibiting the expression of ROBO2. [0254] 3. The method of clause 1, wherein the first agent comprises a soluble ROBO1 extracellular domain (ECD). [0255] 4. The method of clause 3, wherein the soluble ROBO1 ECD is a murine, bovine, ovine, caprine, camelid, or human ROBO1 ECD. [0256] 5. The method of clause 3 or 4, wherein the ROBO1 ECD comprises a heterologous polypeptide. [0257] 6. The method of clause 5, where the heterologous polypeptide comprises a His tag, a hemagglutinin tag, an immunoglobulin (Ig) Fc region, or a Myc tag. [0258] 7. The method of clause 1, wherein the first agent comprises an RNAi construct that inhibits the expression of NOTCH4 or ROBO2. [0259] 8. The method of clause 7, wherein the RNAi construct is a short interfering RNA. [0260] 9. The method of clause 1, wherein the first agent comprises an anti-NOTCH4 antibody or a NOTCH4 binding fragment thereof. [0261] 10. The method of clause 9, wherein the first agent comprises a plurality of polyclonal anti-NOTCH4 antibodies. [0262] 11. The method of clause 9, wherein the anti-NOTCH4 antibody or a NOTCH4 binding fragment thereof is a monoclonal antibody or a NOTCH4 binding fragment thereof. [0263] 12. The method of clause 10, wherein the polyclonal anti-NOTCH4 antibodies are murine, bovine, ovine, caprine, camelid, or human polyclonal antibodies and wherein the species in which the polyclonal antibodies are generated matches the species of the mammal administered the first agent. [0264] 13. The method of clause 11, wherein the monoclonal antibody or a NOTCH4 binding fragment thereof is a bovine, ovine, caprine, or human monoclonal antibody or a NOTCH4 binding fragment thereof, and wherein the species from which the monoclonal antibody is derived matches the species of the mammal administered the first agent. [0265] 14. The method of clause 13, wherein the anti-NOTCH4 monoclonal antibody or a NOTCH4 binding fragment thereof is a bovinized, ovinized, caprinized, camelized, or humanized. [0266] 15. The method of clause 1, wherein the first agent comprises a soluble ROBO1 extracellular domain, the method further comprising administering a second agent that inhibits NOTCH4 activity to the mammal in an amount sufficient to inhibit NOTCH4 activity. [0267] 16. The method of clause 15, wherein the second agent comprises an RNAi construct that inhibits the expression of NOTCH4 or ROBO2. [0268] 17. The method of clause 16, further comprising a third agent comprises an RNAi construct that inhibits the expression of NOTCH4 or ROBO2. [0269] 18. The method of clause 1, wherein the method comprises administering at least one of a first agent, a second agent, a third agent, and a fourth agent that inhibits NOTCH4 activity, wherein each of the first agent, the second agent, the third agent, and the fourth agent is independently selected from a soluble ROBO1 ECD, an anti-NOTCH4 antibody, RNAi construct that inhibits the expression of NOTCH4, and RNAi construct that inhibits the expression of ROBO2. [0270] 19. A polypeptide comprising: [0271] a soluble ROBO1 extracellular domain fused to a heterologous polypeptide. [0272] 20. The polypeptide of clause 19, wherein the soluble ROBO1 ECD is a murine, bovine, ovine, caprine, or human ROBO1 ECD. [0273] 21. The polypeptide of clause 20, wherein the heterologous polypeptide comprises a His tag, a hemagglutinin tag, a human or murine Fc region, a Myc tag, or a fluorescent protein. [0274] 22. A pharmaceutical composition comprising: [0275] the polypeptide of any one of clauses 19-21 and a pharmaceutically acceptable carrier. [0276] 23. The pharmaceutical composition of clause 22 for use in promoting milk production in a mammal. [0277] 24. An anti-NOTCH4 antibody or a NOTCH4 binding fragment thereof that inhibits NOTCH4 activity. [0278] 25. The antibody of clause 24, wherein the antibody comprises a plurality of polyclonal antibodies. [0279] 26. The antibody of clause 24, wherein the antibody is a monoclonal antibody or a NOTCH4 binding fragment thereof. [0280] 27. The antibody of any one of clauses 24-26, wherein the antibody comprises a bovine, ovine, caprine, camelid, or human polyclonal antibodies or a monoclonal antibody where at least part of the monoclonal antibody comprises an antibody sequence from a bovine, ovine, caprine, or human antibody. [0281] 28. The antibody of clause 26, comprising a bovinized, ovinized, caprinized, camelized, or humanized antibody or any antigen binding fragment thereof. [0282] 29. A pharmaceutical composition comprising the antibody of any one of clauses 24-28 and a pharmaceutically acceptable carrier. [0283] 30. The pharmaceutical composition of clause 29 for use in promoting milk production in a mammal. [0284] 31. A polynucleotide comprising an RNAi construct that inhibits the expression of ROBO2 or NOTCH4. [0285] 32. The polynucleotide of clause 31 comprising at least one non-naturally occurring nucleotide. [0286] 33. The polynucleotide of clause 31 or 32, comprising one or more of SEQ ID NO: 32-SEQ ID NO: 35. [0287] 34. A pharmaceutical composition comprising the polynucleotide of any one of clauses 31-33. [0288] 35. The pharmaceutical composition of clause 34 for use in promoting milk production in a mammal. [0289] 36. A transgenic mammal comprising a genetic modification that results in one or more of the following phenotypes: expression of a soluble ROBO1 extracellular domain; inhibition of expression of ROBO2; and inhibition of expression of NOTCH4. [0290] 37. The transgenic animal of clause 36, wherein the phenotype is limited to mammary tissue. [0291] 38. The transgenic mammal of clause 36 or 37, wherein the transgenic animal is a bovine, ovine, caprine, or camelid. [0292] 39. The transgenic mammal of any one of clauses 36-38 comprising two genetic modifications that result in two of the listed phenotypes. [0293] 40. The transgenic mammal of any one of clauses 36-38 comprising three genetic modifications that result in all three of the listed phenotypes. [0294] 41. A method of promoting milk production, the method comprising: [0295] administering to the transgenic mammal of any one of claims 36-40 a pharmaceutical composition that inhibits NOTCH4 activity. [0296] 42. The method of clause 41, wherein the pharmaceutical composition is the composition of any one of clauses 22-23, 29-30, and 34-35. [0297] 43. The method of claim 41, wherein the transgenic animal comprises a genetic modification that results in expression of a soluble ROBO1 extracellular domain, the method further comprising administering the pharmaceutical composition of any one of clauses 22-23, 29-30 and 34-35 to the transgenic animal. [0298] 44. The method of claim 41, wherein the transgenic mammal comprises a genetic modification that results in inhibition of expression of ROBO2 and/or NOTCH4, the method further comprising administering to the transgenic animal the pharmaceutical composition of clause 34 or 35.