FUNCTIONALLY-ENHANCED XNA
20250092406 ยท 2025-03-20
Inventors
Cpc classification
C12N2310/344
CHEMISTRY; METALLURGY
C12N15/115
CHEMISTRY; METALLURGY
International classification
Abstract
Synthetic genetic polymers (XNAs) have the potential to transition aptamers from laboratory tools to therapeutic agents, but additional functionality is needed to compete with antibodies. The present invention features compositions and methods that utilizes a biologically stable artificial genetic system comprised of -L-threofuranosyl nucleic acid (TNA). This system facilitates the production of backbone- and base-modified aptamers termed threomers that function as high quality protein capture reagents.
Claims
1. A based-modified xeno nucleic acid (XNA) nucleoside monomer comprising, a) a synthetic, non-natural sugar, b) a pyrimidine nucleotide base bound to the sugar moiety, wherein the pyrimidine nucleotide base comprises a chemical modification at position C-5 of the nucleobase, and c) a phosphorus group bound to the sugar moiety.
2. The monomer of claim 1, wherein the synthetic, non-natural sugar is a threose sugar or a hexose sugar.
3. (canceled)
4. The monomer of claim 1, wherein the phosphorus group comprises a triphosphate group or a phosphoramidite group.
5. The monomer of claim 4, wherein the triphosphate group is bound to the C6 position on a hexose sugar.
6. (canceled)
7. The monomer of claim 4, wherein the phosphoramidite group is bound to C3 position on a hexose sugar.
8.-9. (canceled)
10. The monomer of claim 4, wherein the triphosphate group is bound to the C3 position on a threose sugar.
11. (canceled)
12. The monomer of claim 4, wherein the phosphoramidite group is bound to the C2 position of a threose sugar.
13. The monomer of claim 1, wherein the pyrimidine nucleotide base is bound to a C1 position on the sugar moiety.
14. The monomer of claim 1, wherein the pyrimidine nucleotide base comprises a uracil base or a cysteine base.
15. The monomer of claim 1, wherein the chemical modification at position C-5 of the nucleobase are selected from a group consisting of phenylalanine side chain, a tryptophan side chain, a methyl side chain, a leucine side chain, a dioxol side chain, an isopentyl side chain, a dioxethyl side chain, a cyclopropyl side chain, a p-methoxy-phenyl side chain, a napthalene side chain, and a phenethyl side chain.
16.-28. (canceled)
29. A single-stranded xeno nucleic acid (XNA) aptamer for binding a target protein, the aptamer comprising one or more based-modified XNA nucleoside monomers comprising, a) a synthetic, non-natural sugar, b) a pyrimidine nucleotide base bound to the sugar moiety, wherein the pyrimidine nucleotide base comprises a chemical modification at position C-5 of the nucleobase, and c) a phosphorus group bound to the sugar moiety.
30. The aptamer of claim 29, wherein the synthetic, non-natural sugar comprises a threose sugar or a hexose sugar.
31. The aptamer of claim 29, wherein the based-modified XNA nucleoside monomer comprises a modified threose nucleic acid (TNA) nucleoside monomer; wherein the modified TNA nucleoside monomer comprises a modified TNA triphosphate monomer.
32.-33. (canceled)
34. The aptamer of claim 29, wherein the phosphorus group comprises a triphosphate group or a phosphoramidite group.
35. The aptamer of claim 34, wherein the triphosphate group is bound to the C3 position of the sugar moiety.
36.-37. (canceled)
38. The aptamer of claim 34, wherein the phosphoramidite group is bound to the C2 position of the sugar moiety.
39. (canceled)
40. The aptamer of claim 29, wherein the pyrimidine nucleotide base is bound to the C1 position on the sugar moiety; wherein the pyrimidine nucleotide base comprises an uracil residue, a cystine residue, or a combination thereof.
41. (canceled)
42. The aptamer of claim 29, wherein the chemical modification at position C-5 of the nucleobase are selected from a group consisting of phenylalanine side chain, a tryptophan side chain, a methyl side chain, a leucine side chain, a dioxol side chain, an isopentyl side chain, a dioxethyl side chain, a cyclopropyl side chain, a p-methoxy-phenyl side chain, a napthalene side chain, and a phenethyl side chain.
43. The aptamer of claim 29, wherein the aptamer comprises 20 to 40 based-modified XNA nucleoside monomers.
44. The aptamer of claim 29, wherein the target protein comprises a spike protein (S1), RBD (receptor binding domain) of S1, tumor necrosis factor (TNF)- protein, HIV (human immunodeficiency virus) reverse transcriptase, human epidermal growth factor receptor 2 (HER2), trypsin, angiotensin-converting enzyme 2 (ACE2), or thrombin.
45.-54. (canceled)
Description
BRIEF DESCRIPTION OF THE SEVERAL VIEWS OF THE DRAWING(S)
[0014] The features and advantages of the present invention will become apparent from a consideration of the following detailed description presented in connection with the accompanying drawings in which:
[0015]
[0016]
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
DETAILED DESCRIPTION OF THE INVENTION
[0028] Before the present compounds, compositions, and/or methods are disclosed and described, it is to be understood that this invention is not limited to specific synthetic methods or to specific compositions, as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting. All embodiments disclosed herein can be combined with other embodiments unless the context clearly dictates otherwise.
Terms
[0029] Unless otherwise explained, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which a disclosed invention belongs. The singular terms a, an, and the include plural referents unless context clearly indicates otherwise. Similarly, the word or is intended to include and unless the context clearly indicates otherwise. The term comprising means that other elements can also be present in addition to the defined elements presented. The use of comprising indicates inclusion rather than limitation. Stated another way, the term comprising means including principally, but not necessary solely. Furthermore, variation of the word comprising, such as comprise and comprises, have correspondingly the same meanings. In one respect, the technology described herein related to the herein described compositions, methods, and respective component(s) thereof, as essential to the invention, yet open to the inclusion of unspecified elements, essential or not (comprising).
[0030] Suitable methods and materials for the practice and/or testing of embodiments of the disclosure are described below. Such methods and materials are illustrative only and are not intended to be limiting. Other methods and materials similar or equivalent to those described herein can be used. For example, conventional methods well known in the art to which the disclosure pertains are described in various general and more specific references, including, for example, Sambrook et al., Molecular Cloning: A Laboratory Manual, 2d ed., Cold Spring Harbor Laboratory Press, 1989; Sambrook et al., Molecular Cloning: A Laboratory Manual, 3d ed., Cold Spring Harbor Press, 2001; Ausubel et al., Current Protocols in Molecular Biology, Greene Publishing Associates, 1992 (and Supplements to 2000); Ausubel et al., Short Protocols in Molecular Biology: A Compendium of Methods from Current Protocols in Molecular Biology, 4th ed., Wiley & Sons, 1999; Harlow and Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, 1990; and Harlow and Lane, Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, 1999, Gene Expression Technology (Methods in Enzymology, Vol. 185, edited by D. Goeddel, 1991. Academic Press, San Diego, Calif.), Guide to Protein Purification in Methods in Enzymology (M. P. Deutshcer, ed., (1990) Academic Press, Inc.); PCR Protocols: A Guide to Methods and Applications (Innis, et al. 1990. Academic Press, San Diego, Calif.), Culture of Animal Cells: A Manual of Basic Technique, 2nd Ed. (R. I. Freshney. 1987. Liss, Inc. New York, N.Y.), Gene Transfer and Expression Protocols, pp. 109-128, ed. E. J. Murray, The Humana Press Inc., Clifton, N.J.), and the Ambion 1998 Catalog (Ambion, Austin, Tex.), the disclosures of which are incorporated in their entirety herein by reference.
[0031] All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety for all purposes. In case of conflict, the present specification, including explanations of terms, will control.
[0032] Although methods and materials similar or equivalent to those described herein can be used to practice or test the disclosed technology, suitable methods and materials are described below. The materials, methods, and examples are illustrative only and not intended to be limiting
[0033] As used herein, the term XNA or xeno-nucleic acids may refer to artificial genetic polymers with novel sugar-phosphate backbones that harbor unique physicochemical properties relative to natural deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) (e.g., properties may include nuclease stability, acid stability, increased thermodynamics of hybridization, or a combination thereof).
[0034] As used herein, the term TNA or -L-threofuranosyl nucleic acid or threose nucleic acid refers to an artificial nucleic acid wherein the sugar portion of the nucleic acid is threose.
[0035] As used herein, the term threomers are backbone- and base-modified aptamers comprising a TNA sugar moiety and at least one base-modified TNA nucleotide monomer.
[0036] Referring now to
[0037] The present invention features base-modified xeno nucleic acid (XNA) nucleoside monomers. The base-modified XNA nucleoside monomers may comprise a synthetic, non-natural sugar (e.g., a threose or a hexose sugar), a pyrimidine nucleotide base bound to the sugar moiety (i.e., the synthetic non-natural sugar), and a phosphorus group also bound to the sugar moiety. The pyrimidine nucleotide base may comprise a chemical modification, e.g., at position C-5 of the nucleobase.
[0038] Non-limiting examples of xeno nucleic acids (XNA) nucleoside monomers may include but are not limited to threose nucleic acids (TNA) nucleoside monomers, hexose nucleic acids (HNA) nucleoside monomers, locked nucleic acids (LNA) nucleoside monomers, arabino nucleic acid (ANA) nucleoside monomers, fluoroarabino nucleic acid (FANA) nucleoside monomers, or mirror-image DNA or L-DNA nucleoside monomers. In some embodiments, the synthetic, non-natural sugar (i.e., the sugar moiety) is a threose sugar. In other embodiments, the synthetic, non-natural sugar is hexose sugar. In further embodiments, the synthetic, non-natural sugar comprises a modified ribose sugar where the 2 oxygen and 4 carbon are connected. In some embodiments, the synthetic, non-natural sugar comprises a ribose sugar or a deoxyribose sugar.
[0039] The present invention may also feature a base-modified threose nucleic acid (TNA) nucleoside monomer. The base-modified TNA nucleoside monomer may comprise a threose sugar, a pyrimidine nucleotide base bound to the sugar moiety (i.e., the threose sugar), and a phosphorus group also bound to the sugar moiety. The pyrimidine nucleotide base comprises a chemical modification, e.g., at position C-5 of said pyrimidine nucleotide base.
[0040] In some embodiments, the phosphorus group comprises a triphosphate group. In other embodiments, the phosphorus group comprises a phosphoramidite group. The position of where the phosphorus group (e.g., either the triphosphate group or the phosphoramidite group) binds to the sugar moiety of the nucleoside monomers described herein depends on the sugar therein. As used herein, for nucleic acid numbering a prime () is used to distinguish atoms on the sugar moiety from those on the nucleobase. The triphosphate group may be bound to the C3 position on a threose sugar. Or, the triphosphate group may be bound to the C6 position on a hexose sugar. In some embodiments, the triphosphate group is bound to the C5 position on a ribose sugar or a deoxyribose sugar. The phosphoramidite group may be bound to the C2 position on a threose sugar. In an alternative embodiment, the phosphoramidite group may be bound to the C3 position on a threose sugar. The phosphoramidite group may be bound to the C3 position on a hexose sugar. In some embodiments, the phosphoramidite group is bound to the C3 position on a ribose sugar or a deoxyribose sugar.
[0041] The nucleotide base of the nucleoside monomers described herein may be bound to the C1 position of the sugar moiety (e.g., the synthetic, non-natural sugar (e.g., threose or hexose)). In some embodiments, the modified pyrimidine nucleotide base (i.e., the pyrimidine nucleotide base comprising a chemical modification at position C-5 of the nucleobase) is bound to the C1 position of the sugar moiety. The pyrimidine nucleotide base (e.g., the modified pyrimidine nucleotide base) may comprise a uracil base or a cysteine base. In some embodiments, the pyrimidine nucleotide base may comprise a thymine base. In some embodiments, the pyrimidine nucleotide base (e.g., the modified pyrimidine nucleotide base) may comprise a modified uracil base or a modified cysteine base.
[0042] In some embodiments, the pyrimidine nucleotide base described herein comprises a chemical modification at position C-5 of the nucleobase. In some embodiments, the chemical modification at position C-5 of the pyrimidine nucleotide base is a planar aromatic side chain (e.g., a phenylalanine side chain or a tryptophan side chain). Non-limiting examples of the chemical modification include, but are not limited to, phenylalanine side chain, a tryptophan side chain, a leucine side chain, a dioxol side chain, an isopentyl side chain, a dioxethyl side chain, a cyclopropyl side chain, a p-methoxy-phenyl side chain, a napthalene side chain, or a phenethyl side chain (see
[0043] In some embodiments, the present invention may also feature modified purine nucleotide bases. In some embodiments, the purine nucleotide base can be modified at the N-7 position of the ring system. In further embodiments, the chemistry involves synthesizing the purine nucleotide as a 7-deaza-7-modified base.
[0044] Additionally, the present invention may feature single-stranded oligonucleotide aptamer (e.g., threomers) for binding a target protein. The aptamers may comprise one or more of the base-modified nucleoside monomers described herein. For example, the present invention may feature a single-stranded threose nucleic acid (TNA) aptamer (i.e., a threomer) for binding a target protein comprising one or more of the base-modified TNA nucleoside monomers as described herein.
[0045] The present invention may feature a single-stranded threose nucleic acid (TNA) aptamer (e.g., a threomer) for binding a target protein. The aptamer may comprise one or more of the base-modified TNA nucleotides (i.e., a base-modified TNA nucleoside monomer). The base-modified TNA nucleotide comprising a threose sugar, a pyrimidine nucleotide base comprising a chemical modification at position C-5 bound to the sugar moiety, and a phosphorous group bound to the threose group.
[0046] In some embodiments, the aptamers (e.g., threomers) described herein comprise about 20 to 40 nucleoside monomers (e.g., TNA nucleoside monomer) in length. In other embodiments, the aptamers (e.g., threomers) described herein comprise about 15 to 50, or about 15 to 45, or about 15 to 40, or about 15 to 35, or about 15 to 30, or about 15 to 25, or about 15 to 20, or about 20 to 50, or about 20 to 45, or about 20 to 40, or about 20 to 35, or about 20 to 30, or about 20 to 25, or about 25 to 50, or about 25 to 45, or about 25 to 40, or about 25 to 35, or about 25 to 30, or about 30 to 50, or about 30 to 45, or about 30 to 40, or about 30 to 35, or about 35 to 50, or about 35 to 45, or about 35 to 40, or about 40 to 50, or about 40 to 45, or about 45 to 50 nucleoside monomers (e.g., TNA nucleoside monomer) in length. In some embodiments, the aptamers (e.g., threomers) described herein are about 15, or about 20, or about 25, or about 30, or about 35, or about 40, or about 45, or about 50 nucleoside monomers (e.g., TNA nucleoside monomer) in length.
[0047] In some embodiments, the aptamers (e.g., threomers) described herein comprise at least one base-modified nucleoside monomer (e.g., a nucleoside monomer with a pyrimidine nucleotide base comprising a chemical modification). In some embodiments, the aptamers comprise at least one modified cysteine monomer. In some embodiments, the aptamers comprise at least one modified uracil monomer. In other embodiments, the aptamers comprise at least one modified cysteine monomer, and at least one modified uracil monomer. In alternative embodiments, the aptamers comprise at least one modified thymine monomer.
[0048] In some embodiments, the aptamers (e.g., threomers) described herein is comprised of 25-35% base-modified nucleoside monomer (e.g., a nucleoside monomer with a pyrimidine nucleotide base comprising a chemical modification). In other embodiments, the aptamer is comprised of about 10% to 50%, or about 10% to 45%, or about 10% to 40%, or about 10% to 35%, or about 10% to 30%, or about 10% to 25%, or about 10% to 20%, or about 10% to 15%, or about 15% to 50%, or about 15% to 45%, or about 15% to 40%, or about 15% to 35%, or about 15% to 30%, or about 15% to 25%, or about 15% to 20%, or about 20% to 50%, or about 20% to 45%, or about 20% to 40%, or about 20% to 35%, or about 20% to 30%, or about 20% to 25%, or about 25% to 50%, or about 25% to 45%, or about 25% to 40%, or about 25% to 35%, or about 25% to 30%, or about 30% to 50%, or about 30% to 45%, or about 30% to 40%, or about 30% to 35%, or about 35% to 50%, or about 35% to 45%, or about 35% to 40%, or about 40% to 50%, or about 40% to 45%, or about 45% to 50% base-modified nucleoside monomer (e.g., a nucleoside monomer with a the pyrimidine nucleotide base comprising a chemical modification).
[0049] In some embodiments, the nucleoside monomers comprise nucleoside triphosphate monomers. In some embodiments, nucleoside triphosphate monomers comprises base-modified nucleoside triphosphate monomers (e.g., a nucleoside triphosphate monomer with a pyrimidine nucleotide base comprising a chemical modification) (
[0050] In some embodiments, the aptamers described herein are for binding a target protein. Non-limiting examples of target proteins include, but are not limited to, a spike protein (S1), a RBD (receptor binding domain) of S1, a tumor necrosis factor (TNF)- protein, HIV (human immunodeficiency virus) reverse transcriptase, human epidermal growth factor receptor 2 (HER2), trypsin, angiotensin-converting enzyme 2 (ACE2), or thrombin. Other proteins may be targeted in accordance with the composition and methods described herein.
[0051] Non-limiting examples of aptamers for binding a spike protein (S1) include, but are not limited to SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, or SEQ ID NO: 20. Non-limiting examples phosphonamidite of aptamers for binding a tumor necrosis factor (TNF)- protein include but are not limited to SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, or SEQ ID NO: 32.
[0052] In some embodiments, the present invention features nucleoside monomers according to the structure structures displayed in Table 1.
TABLE-US-00001 TABLE 1 Shows C-5 base-modified nucleoside monomers as described by the present invention. The R group may be selected from a group consisting of a methyl side chain, a phenylalanine side chain, a tryptophan side chain, a methyl side chain, a leucine side chain, a dioxol side chain, an isopentyl side chain, a dioxethyl side chain, a cyclopropyl side chain, a p-methoxy-phenyl side chain, a napthalene side chain, and a phenethyl side chain (see FIG. 6B or 6C). Nucleoside Triphosphate Monomers C-5 modified tUTP C-5 modified tCTP
[0053] The single-stranded threose nucleic acid (TNA) aptamer (e.g., threomer) and/or the single stranded XNA aptamers described herein may be generated through enzymatic and/or chemical synthesis protocols. In some embodiments, the single-stranded threose nucleic acid (TNA) aptamer for binding a target protein comprising one or more base-modified threose nucleic acid (TNA) monomers, is created by using enzymatic synthesis using an engineered TNA polymerase and chemically synthesized TNA triphosphates. In other embodiments, the single-stranded threose nucleic acid (TNA) aptamer for binding a target protein comprising one or more base-modified threose nucleic acid (TNA) monomers, is created by automated solid phase oligonucleotide synthesis using chemically synthesized TNA phosphoramidites.
Example
[0054] The following is a non-limiting example of the present invention. It is to be understood that said example is not intended to limit the present invention in any way. Equivalents or substitutes are within the scope of the present invention.
[0055] In an effort to improve the quality of TNA aptamers produced by in vitro selection, the potential for aromatic side chains to enhance the functional properties of large random-sequence TNA libraries was evaluated. The present study focused on tUTP derivatives that are chemically modified at the C5 position with Phe and Trp side chains (
[0056] First, the desired C5 modified tUTP substrates were synthesized (
[0057] The starting 5-iodo-1-(2-O-benzoyl-L-threofuranosyl)-uracil nucleoside was prepared in eight steps from L-ascorbic acid (vitamin C) using a Vorbrggen reaction to conjugate 5-iodo-uracil to an orthogonally protected threose sugar (
[0058] It was determined that the base modified TNA triphosphates were viable substrates for TNA synthesis by evaluating their incorporation into TNA oligonucleotides using a standard primer extension assay. Accordingly, an IR-labeled DNA primer annealed to a DNA template was incubated with a mixture of chemically synthesized tNTPs and Kod-RSGA for 2 hours at 55 C. In these reactions, the tNTP mixture contained either standard bases only or a tNTP solution in which the tTTP substrate was replaced with either tUTP.sup.Phe or tUTP.sup.Trp. Analysis of the primer extension reactions by denaturing polyacrylamide gel electrophoresis (PAGE) indicates that the primer was extended to full-length product in all cases, as evidenced by the presence of a discrete slower moving band in each lane of the gel (
TABLE-US-00002 TABLE2 MassspectrometrydataofTNAoligonucleotides SEQID Theoretical NO: Sequence mass Observedmass.sup.a 1 GGATACCACCGAGACGACACACAATAGAGA 8951.31 8958.0[M+7H.sup.+] 2 GGATACCACCGAGACGACACACAAU.sup.PheAGAGA 9071.36 8984.0[MC7H8+5H.sup.+].sup.b 3 GGATACCACCGAGACGACACACAAU.sup.TrpAGAGA 9123.37 9242.0[M+5Na.sup.++4H.sup.+] Underlined: DNA primer region; bold: unmodified base (T) or base modified with benzyl (U.sup.Phe) or indole (U.sup.Trp) moieties. .sup.aLC-ESI-Q-TOF, .sup.bPartial fragmentation of the benzyl moiety (C.sub.7H.sub.8), similar observation with MALDI-ToF
[0059] Encouraged by the synthesis and successful enzymatic incorporation of base-modified tNTPs into TNA, three chemically distinct libraries containing 1014 TNA oligonucleotides were prepared, each displayed on their encoding double-stranded (ds) DNA (
[0060] As a model system, TNA sequences were enriched for that bound to the glycosylated form of the S1 subunit of the spike protein of SARS-CoV-2 (
[0061] For each round of selection, the TNA libraries were incubated with free Ni-NTA beads to remove any TNA sequences that bound nonspecifically to the solid-support matrix. In round 1, a second negative selection step was performed on the nave library using His-tagged hemagglutinin (HA), which was chosen as a generic off-target viral-coat protein. The eluted material was incubated with the S1 protein containing a C-terminal His-6 tag. Aptamers that bound specifically to the S1 protein were partitioned away from the unbound material by passing the solution over Ni-NTA beads to capture the aptamer-protein complexes. The beads were washed under high ionic strength conditions to remove weak affinity sequences that bound primarily through electrostatic interactions and the bound material was eluted from the Ni-NTA beads with imidazole. The eluted fractions were exchanged into water and amplified by PCR. Regeneration of the ssDNA library required a second PCR step using a PEG-modified DNA primer that allows for size separation of the PEGylated DNA template by denaturing PAGE. The ssDNA material served as the starting point for the next round of in vitro selection and amplification.
[0062] After round 4, the evolving pools of TNA sequences were subjected to high throughput next-generation DNA sequencing (NGS) using an Illumina NovaSeq platform to sequence the elution fractions from each round of selection (Table 3). The combined power of DNA display and NGS bypasses the need for extensive rounds of selection by identifying sequences with enrichment profiles that are indicative of high affinity binders. Bioinformatic analysis of the data reveals that populations containing the Phe and Trp side chains converged more rapidly toward a smaller number of unique sequences as compared to the unmodified library composed entirely of standard bases (
TABLE-US-00003 TABLE 3 Sequencing reads obtained by NovaSeq. Unique Protein Base Round Processed Reads Sequences S1 Standard 1 26,286,663 20,412,876 2 102,327,271 61,923,742 3 71,836,059 42,735,631 4 67,706,251 35,428,544 Total 268,156,244 160,500,793 Phe 1 23,583,405 20,059,840 2 73,162,007 11,267,290 3 73,322,141 13,938,779 4 40,614,749 4,959,383 Total 210,682,302 50,225,292 Trp 1 30,106,901 23,793,731 2 94,452,041 22,026,578 3 68,928,155 29,680,238 4 71,299,717 17,979,790 Total 264,786,814 93,480,337 TNF Standard 1 518,460,356 266,703,781 2 367,601,928 189,040,364 3 591,683,108 188,726,113 Total 1,477,745,392 644,470,258 Phe 1 505,151,129 63,166,002 2 483,294,442 84,340,855 3 69,009,793 21,768,993 Total 1,057,455,364 169,275,850 Trp 1 369,586,308 98,436,052 2 129,108,753 44,024,662 3 217,754,947 59,876,218 Total 716,450,008 202,336,932
[0063] To better illuminate the relationship between sequence enrichment and function, members of each chemotype family were screened for affinity to the S1 protein. In this experiment, 65 sequences with promising enrichment profiles were selected and individually synthesized by polymerase-mediated primer extension on complementary DNA templates. Estimated binding affinities (K.sub.D) were determined by biolayer interferometry (BLI) using biotinylated aptamers that were immobilized onto the surface of streptavidin-coated biosensors and assayed for binding activity to S1 poised at a protein concentration of 100 nM. The screen revealed striking differences in the number of high-affinity aptamers produced from the modified libraries versus those obtained from the standard base library. A plot of estimated K.sub.D value versus library chemotype highlights these differences, which bin according to 3380 nM (n=30), 910 nM (n=20), and 430 nM (n=15) for the average binding affinities observed for the standard, Phe, and Trp libraries, respectively (
[0064] To more precisely evaluate the binding properties of the in vitro selected TNA aptamers isolated from the three chemotype libraries, full kinetic measurements were performed on a subset of the sequences that were predicted to bind S1 with a K.sub.D value of <50 nM. In total, 24 TNA aptamers were re-synthesized for further characterization by BLI (
TABLE-US-00004 TABLE4 BLIanalysisofS1aptamerschosenforfullkinetics. SEQID TNASequence K.sub.D k.sub.on k.sub.off Fit Variance NO: Entry (3to2) (nM) (M.sup.1s.sup.1) (s.sup.1) (R.sup.2) (Chi.sup.2) Standard 4 1 TGGCGAGGGGTAGTGAGCTG 17.6 1.6 2.7 0.99 0.20 ACGGATAGGGCTAGTGGAAC 10.sup.4 10.sup.4 5 2 CGTGCACGATCTAGCCAGT 27.3 9.0 2.5 0.99 0.16 GCTCGCTTGAAATGGGCGC 10.sup.3 10.sup.4 AG Phe 6 3 TATTGGAACTCCCGAGCAGG 2.6 9.0 2.4 0.99 0.43 CTGTCCCATGGAAGACTACA 10.sup.4 10.sup.4 7 4 AGGCTTATGAAATCTTATGT 5.2 1.4 7.5 0.99 2.69 GAACCGGGCATACGGGCGA 10.sup.4 10.sup.5 7 5* AGGCTTATGAAATCTTATGT 10.0 1.8 1.8 0.99 0.41 GAACCGGGCATACGGGCGA 10.sup.4 10.sup.4 T 8 6 GAGAGTCATAGTAGTTCACG 11.3 1.5 1.7 0.99 0.70 GGTCTGCAGCTTACGCATGT 10.sup.4 10.sup.4 8 7* GAGAGTCATAGTAGTTCACG 12.0 2.5 3.0 0.99 0.61 GGTCTGCAGCTTACGCATGT 10.sup.4 10.sup.4 6 8* TATTGGAACTCCCGAGCAGG 16.3 1.2 2.0 0.99 0.22 CTGTCCCATGGAAGACTACA 10.sup.4 10.sup.4 9 9 TGTACGCCATATAGGCAGTC 16.7 1.2 1.9 0.99 0.29 ATCGAGCAACGAAGTAATGG 10.sup.4 10.sup.4 7 10* AGGCTTATGAAATCTTATGT 21.8 1.2 2.7 0.99 4.30 GAACCGGGCATACGGGCGA 10.sup.4 10.sup.4 T 10 11 ACGATGGACTTGGGTAGCTA 22.1 9.5 2.1 0.99 0.73 GTCAGGTTAGGCTGTTTGGA 10.sup.3 10.sup.4 11 12 AGAACTTCGTCAGCGTCTTA 28.8 9.1 2.6 0.99 0.71 CCGAGTCCAAGGACTGGCT 10.sup.3 10.sup.4 A 12 13 ATCGAGTTGTGACGTTAACG 31.0 2.0 6.2 0.99 0.14 ATAATAGCCCGCTCCGATTC 10.sup.4 10.sup.4 13 14 TACATTACGCGTTAGCGTTA 36.0 9.4 3.3 0.99 26.65 ATGGGTATGTCCGGACAGT 10.sup.3 10.sup.4 G 14 15 GGTGTAATAAGGAGAGTACG 39.0 4.3 1.7 0.99 40.40 TCGTTTGGTGGGACCGGGT 10.sup.3 10.sup.4 A 13 16* TACATTACGCGTTAGCGTTA 42.0 5.2 2.2 0.99 3.30 ATGGGTATGTCCGGACAGT 10.sup.3 10.sup.4 G Trp 15 17 TTGGCGAGATCCCCTATACG 2.0 6.7 1.3 0.99 2.94 TGAGCTTCCTTTTATCCTTT 10.sup.4 10.sup.4 16 18 CGTACAACTCCGGTTTCGGG 2.7 5.2 1.4 0.99 0.52 CGGCCCGTTCTTCAGTTTGA 10.sup.4 10.sup.4 17 19 TAAGGAAAGGGGAGCGGGT 4.2 3.3 1.4 0.99 0.73 AGGAGGTTCGTCGGGTGCG 10.sup.4 10.sup.4 AC 18 20 ATTGTGCGAAGTATACATAG 5.1 2.1 1.1 0.99 0.12 CAGATGCGTGACATAACAAG 10.sup.4 10.sup.4 16 21* CGTACAACTCCGGTTTCGGG 6.9 9.7 6.7 0.99 2.02 CGGCCCGTTCTTCAGTTTGA 10.sup.4 10.sup.4 19 22 AAACTGTTGGGACTTGTAAT 21.1 8.7 1.8 0.72 16.72 GTCGTCATCAGCTAAGAGTC 10.sup.4 10.sup.3 20 23 TTTCTATGCATCTCGGGGAT 29.1 3.9 1.1 0.97 1.85 GCGGGATATAAAAGAGAGA 104 10.sup.3 C 20 24* TTTCTATGCATCTCGGGGAT 76.0 7.0 5.4 0.98 30.24 GCGGGATATAAAAGAGAGA 10.sup.3 10.sup.4 C *Signifies an independent replicate, PBS8 primer sequence not shown (SEQ ID NO: 37)
TABLE-US-00005 TABLE5 BLIanalysisofTNFaptamerschosenforfullkinetics. OTHERindicatesabasemodifiedwithbenzylmoeity alpha-L-threofuranosylnucleicacid SEQ ID K.sub.D k.sub.on k.sub.off Fit Variance NO: Entry TNASequence(3to2) (nM) (M.sup.1s.sup.1) (s.sup.1) (R.sup.2) (Chi.sup.2) Standard 21 1 GCGGGGGGTGTTGTGTAACTGTT 42 1.110.sup.5 4.4 0.88 0.20 TTTTGCCGGAAAGACGC 10.sup.3 22 2 GACGCTATGACTGGTATGGTGTG 109 1.210.sup.5 1.3 0.92 0.15 TGAGCTTCGAGGTCTGA 10.sup.2 23 3 CGCGGCGTTGCGTAGCGCCAAT 141 7.510.sup.4 1.1 0.88 0.11 CCTGCACAGAGGCGGGCG 10.sup.2 Phe 24 4 TGACACCTGGCACGAATGCGCA 19 2.610.sup.5 5.0 0.89 0.07 GACGACGTTGTTTTGCGT 10.sup.3 25 5 ACTTTTGCTTGAGATTCGGCGCA 27 2.910.sup.5 7.8 0.91 0.15 TTTCGTGCAGTGATGTA 10.sup.3 26 6 CTTAGGTCGGCCTTTGACCATTC 41 3.010.sup.5 1.2 0.94 0.18 GTGCAAAACTTAGCGAA 10.sup.2 27 7 GAATGCGCTTGAGCGCGCCCGA 54 1.710.sup.5 9.1 0.87 0.11 TGATATAGCGAACCAAGC 10.sup.3 28 8 TTAATTTTGAGATCTTTGTCGAGT 70 2.210.sup.5 1.5 0.98 0.24 TGCTCGGTGAAAAGTC 10.sup.2 29 9 AGAGCAAGTCATGATCGCGAGTT 86 2.310.sup.5 2.0 0.97 0.14 TAGCTTTTTCATTTCCC 10.sup.2 Trp 30 10 GGCACTATCGATTATCGTGCGCA 7.3 9.8105 7.1 0.97 0.07 TTGGTTGTGTCCAGGCT 10.sup.3 31 11 TCACGTCTGTTGTACACTTGTGC 12 4.6105 5.4 0.99 0.17 AATGCAAGGACGGAAAA 10.sup.3 32 12 ACGAGTAGGCCGCATTATGATGA 16 3.3105 5.2 0.99 0.37 TTTAAACTGTTTCATGC 10.sup.3 PBS8 primer sequence not shown (SEQ ID NO: 37)
[0065] To confirm the reproducibility of the data, a representative high performance S1 aptamer was evaluated from the standard and modified chemotype libraries in triplicate using independently synthesized material for each kinetic binding assay. The best modified and unmodified S1 aptamers (designated Trp-1 and standard-2, respectively) have average affinity values of 3.11.0 nM and 3411 nM, respectively, for the S1 protein of SARS-CoV-2 (
TABLE-US-00006 TABLE6 BLIanalysisofhighperformingstandardandmodifiedS1andTNFaptamerschosen forreplicativetrials. SEQID K.sub.D k.sub.on k.sub.off Fit Variance NO: Aptamer TNASequence(3-2) (nM) (M.sup.1s.sup.1) (s.sup.1) (R.sup.2) (Chi.sup.2) S1proteinTarget 5 Standard-2 CGTGCACGATCTAGCC 27 9.0 2.5 0.99 0.16 AGTGCTCGCTTGAAAT 10.sup.3 10.sup.4 GGGCGCAG 46 5.5 2.6 0.99 0.58 10.sup.3 10.sup.4 28 9.8 2.7 0.99 0.74 10.sup.3 10.sup.4 avgstd 3411 15 Trp-1 TTGGCGAGATCCCCTA 2.0 6.7 1.3 0.99 2.94 10.sup.4 10.sup.4 TACGTGAGCTTCCTTTT 3.8 3.6 1.4 0.99 0.23 10.sup.4 10.sup.4 ATCCTTT 3.5 3.6 1.3 0.99 0.66 10.sup.4 10.sup.4 avgstd 3.11.0 TNF 22 Standard-2 GACGCTATGACTGGTA 109 1.2 1.3 0.92 0.15 TGGTGTGTGAGCTTCG 10.sup.5 10.sup.2 AGGTCTGA 76 7.5 5.7 0.94 0.28 10.sup.4 10.sup.3 62 9.2 5.7 0.95 0.20 10.sup.4 10.sup.3 avgstd 8224 32 Trp-3 ACGAGTAGGCCGCATT 16 3.3 5.2 0.99 0.37 ATGATGATTTAAACTGT 10.sup.5 10.sup.3 TTCATGC 17 5.8 9.9 0.99 0.09 10.sup.5 10.sup.3 27 2.6 7.1 0.99 0.23 10.sup.5 10.sup.3 avgstd 206.1 avg, average; std, standard deviation Each data set represents an independent replicate with freshly synthesized aptamer PBS8 primer sequence not shown (SEQ ID NO: 3)
[0066] Next, the binding affinity of threomers were improved by comparing experimental and computational methods for directed evolution. A doped library based on the Trp-1 sequence was synthesized that contained 85% identity and 15% diversity at each nucleotide position with a theoretical diversity of 310.sup.9 unique members. The library was subjected to 1 round of selection for binding to S1 followed by NGS analysis to identify individual sequences present in the eluted material. The best experimental aptamer identified from 30 candidate sequences identified through a combination of enrichment and sequence context exhibited a K.sub.D of 850160 M for S1 (
TABLE-US-00007 TABLE7 BLIanalysisofdirectedevolutionaptamersbyexperimentalandcomputational approaches: SEQID K.sub.D k.sub.on k.sub.off Fit Variance NO: Aptamer TNASequence(3-2) (nM) (M.sup.1s.sup.1) (s.sup.1) (R.sup.2) (Chi.sup.2) S1protein 33 TNA913 GCGGCCAGATCCCCGA 0.96 1.2 1.2 0.99 0.53 (experimental) TATGTTAACGTCCTTTT 10.sup.5 10.sup.4 ATGCGGG 0.73 1.2 8.9 0.99 0.42 10.sup.5 10.sup.5 avgstd 0.850.16 34 TNA949 TTAGTATTATTATGGGT 0.67 1.3 8.8 0.99 0.96 (computational) GCGTGAGTTTCCAAGA 10.sup.5 10.sup.5 AGCGCGT 0.73 1.7 1.2 0.99 1.7 10.sup.5 10.sup.4 avgstd 0.7+0.04 avg, average; std, standard deviation Each data set represents an independent replicate with freshly synthesized aptamer PBS8 primer sequence not shown (SEQ ID NO: 37) Kinetic plots provided in FIG. 8A and 8B.
[0067] To evaluate the generality of functionally enhanced TNA libraries as a rich source of chemical diversity for producing superior TNA-based affinity reagents, a similar in vitro selection experiment was performed against a different protein target. For this study, tumor necrosis factor-alpha (TNF,
[0068] Last, the contribution of the modified side chains toward the activity and specificity of threomer binding to the S1 and TNF- target proteins was evaluated. The importance of the hydrophobic amino acid side chains was evaluated by measuring the binding affinity of modified and unmodified versions of the Trp-1 and Trp-3 aptamers selected to bind S1 and TNF-, respectively. In both cases, the resulting BLI sensorgrams clearly show that protein binding affinity is completely abrogated when the in vitro selected TNA sequences are synthesized with the natural base chemotype (
[0069] The data collected in the present study provides compelling evidence that functionally enhanced TNA libraries produce higher affinity binders than standard TNA libraries carrying only natural bases. This result was achieved through a combination of DNA display and high throughput NGS sequencing, which allowed for the isolation of base-modified threomers with K.sub.D values in the low nM range after only 3-4 rounds of selective amplification. The absence of significant numbers of high affinity binders from the unmodified library supports the hypothesis that planar aromatic side chains have the ability to mimic amino acid residues that are overrepresented at the paratope-epitope interface of antibody-antigen complexes. The generality of the conjugation chemistry established to construct uniformly modified TNA libraries is sufficiently versatile that it should be possible to explore new regions of chemical space by synthesizing a broader range of C5 modified tUTP substrates.
[0070] The path to functionally enhanced XNA libraries was limited by a number of synthetic challenges that are less severe for DNA-based affinity reagent technologies. TNA, like most XNAs, is assembled from building blocks that are not commercially available, and thus, must be obtained by chemical synthesis. In this case, a complete monomer set of all four TNA nucleoside triphosphates (tNTPs) requires 52 chemical transformations to convert vitamin C into each of the four tNTPs (tATP, tCTP, tTTP, and tGTP). The tUTP.sup.Phe and tUTP.sup.Trp substrates demanded an additional 30 chemical transformations (15 steps each) with the critical step being the palladium-catalyzed cross-coupling reaction required to functionalize the uracil nucleobase with an aromatic side chain. Once the substrates are prepared, it then becomes necessary to identify a polymerase that can synthesize functionally enhanced TNA oligonucleotides. In the current study, this was accomplished using Kod-RSGA, a recently evolved TNA polymerase developed for enhanced TNA synthesis activity on DNA templates.
[0071] Although antibodies remain the gold standard as protein affinity reagents, aptamers have a number of advantages that have caused them to grow in popularity. In addition to prolonged storage and shipping at ambient temperature, aptamers are produced by cell-free synthesis (chemical or enzymatic), which avoids viral or bacterial contamination problems associated with cellular protein production systems and allows for greater scalability. Aptamers have low immunogenicity, low batch-to-batch variability, and greater ease of chemical modifications than antibodies and other protein-based affinity reagents. However, despite these advantages, aptamers have historically suffered from poor biological stability and fast off-rates. The current study is part of a program of research designed to narrow the gap between antibodies and aptamers. The goal has been to establish an artificial genetic system that is both biologically stable and amenable to Darwinian evolution, and then to augment this system with the chemical functionality required to achieve high affinity interactions that are driven by slow off-rate binding kinetics.
[0072] In conclusion, the present invention has established threomers as a new class of biologically stable affinity reagents that function with enhanced target-binding activity.
General Information
[0073] Taq DNA polymerase, Bst 3.0 DNA polymerase, T4 DNA ligase, 10T4 DNA ligase buffer, and 10 ThermoPol buffer were purchased from New England Biolabs (Ipswich, MA). PCRBIO HiFi polymerase was purchased from PCRBiosystems (Wayne, PA). Kod RSGA TNA polymerase was expressed and purified. Experiments were performed in DNA LoBind tubes, purchased from Eppendorf (Hamburg, Germany). DNA triphosphates were purchased from Thermo Fisher Scientific (Waltham, MA). TNA triphosphates bearing natural bases were synthesized. DNA oligonucleotides were purchased from Integrated DNA Technologies (Coralville, IA), purified by denaturing polyacrylamide gel electrophoresis (PAGE), electroeluted, buffer exchanged and concentrated using Millipore YM-3 or YM-30 Centricon centrifugal filter units, and quantified by UV absorbance via NanoDrop (Thermo Fisher Scientific). For the aptamer selection, Ni-NTA agarose resin was purchased from Qiagen (Hilden, Germany). His-tagged SARS-CoV-2 spike glycoprotein subunit 1 (S1), SARS-CoV-2 receptor binding domain (RBD) of spike glycoprotein subunit 1, and SARS-CoV-1 spike glycoprotein subunit 1 (S1) were purchased from ACROBiosystems (Newark, DE). His-tagged TNF was expressed from E. coli as previously described. His-tagged TNF was purchased from Sino Biological (Wayne, PA). Streptavidin and Ni-NTA biosensor were purchased from ForteBio (Fremont, CA).
TABLE-US-00008 TABLE8 DNAoligonucleotidesusedinthestudy Sequence(5.fwdarw.3)ModificationsinIDTnomenclature.Nrepresents SEQID a30A:20C:20G:30Tcombination.Nrepresentsacombinationof NO: Name 85parentnucleobase:15otherthreenucleobases(5each). 35 PBS7 GGATCGTCAGTGCATTGAGA 36 PEGPBS7 AACAAACAAACAAACAAACAAACAAACAAACA/iSp9/GGATCGTCAGTG CATTGAGA 37 PBS8 GTCCCCTTGGGGATACCACC 38 PBS12 TTCTCATGTTTGACAGCTTA 39 PEGPBS12 AACAAACAAACAAACAAACAAACAAACAAACA/iSp9/TTCTCATGTTTGA CAGCTTA 40 PBS13 TCATCGATAAGCTTTAATGC 41 PEGPBS13 AACAAACAAACAAACAAACAAACAAACAAACA/iSp9/TCATCGATAAGC TTTAATGC 42 PBS15 TTGCTAACGCAGTCAGGCAC 43 PEGPBS15 AACAAACAAACAAACAAACAAACAAACAAACA/iSp9/TTGCTAACGCAG TCAGGCAC 44 DNADisplay /5Phos/ACTACGTACCCACAACCTCGGCCGTACCACGGTACGTAGTGT Hairpin CCCCTTGGGGATACCACC 45 Displacement /5IRD700/GGTGGTATCCCCAAGGGGACACTACGTACCGTGGTACGGC Primer CGAGGTTGTG 46 3TIncorporation TCTCTATTGTGAGTCGTCTAGGTGGTATCCTTTTTTTTTTTTTTTTTTTT Template 47 S1StdLibrary TTCTCATGTTTGACAGCTTAATTCCT-N40- GGTGGTATCCCCAAGGGGAC 48 S1PheLibrary TCATCGATAAGCTTTAATGCCACTCA-N40- GGTGGTATCCCCAAGGGGAC 49 S1TrpLibrary TTGCTAACGCAGTCAGGCACCCAACA-N40- GGTGGTATCCCCAAGGGGAC 50 TNFaStdLibrary GGATCGTCAGTGCATTGAGAattcct-N40- GGTGGTATCCCCAAGGGGAC 51 TNFaPheLibrary GGATCGTCAGTGCATTGAGAcactca-N40- GGTGGTATCCCCAAGGGGAC 52 TNFaTrpLibrary GGATCGTCAGTGCATTGAGAccaaca-N40- GGTGGTATCCCCAAGGGGAC 53 DopedTrp-1 TTGCTAACGCAGTCAGGCACTGGCCT-N40- Library GGTGGTATCCCCAAGGGGAC *Lower case letters denote barcode sequence of the std, phe, and trp libraries. */iSp9/ indicates a polyethylene glycol (PEG) spacer
Library Synthesis
[0074] Three libraries were synthesized at the DNA level using a custom nucleotide distribution to minimize the occurrence of G-quadruplex structures. Each library contained a unique 6 nt barcode located between the forward primer and random region to signify the library chemotype (standard, Phe, and Trp). The initial libraries comprised an internal variable region of 40 nucleotides (30% A, 30% T, 20% G, 20% C) flanked on both sides by fixed-sequence primer binding sites. The libraries were purchased from the Keck Oligonucleotide Synthesis Facility (Yale University) and purified by 10% denaturing PAGE. The band corresponding to full-length product was excised, electroeluted, desalted, and quantified by UV absorbance. The phosphorylated DNA hairpin primer was ligated to the library by combining 5 nmol DNA library with 6 nmol of DNA hairpin in a final volume of 1 mL of 1T4 DNA ligase buffer. The solution was denatured for 5 min at 95 C. and then annealed by incubating for 30 min at room temperature. Once annealed, 10,000 U of T4 DNA ligase was added and the reaction was incubated overnight at 24 C. The following day, the hairpin library was purified by 10% denaturing PAGE and quantified by UV absorbance.
[0075] The hairpin library was extended with tNTPs to form a chimeric TNA:DNA hairpin heteroduplex. In a 1 mL reaction volume containing 1 nmol hairpin library and 1 ThermoPol buffer was heated for 5 min at 95 C. to denature and then annealed by incubating for 30 min at 24 C. TNA polymerization was initiated by adding Kod RSGA (1 UM) and 100 M of each tNTP (tATP:tCTP:tGTP:tTTP or tUTP.sup.Phe or tUTP.sup.Trp) and incubating for 2 h at 55 C. Excess polymerase was extracted with phenol:chloroform:isoamyl alcohol (25:24:1, saturated with 10 mM Tris, pH 8.0, 1 mM EDTA). Following extraction, the TNA:DNA hairpin library was concentrated and the remaining tNTPs were removed by buffer exchange into water using a YM-30 Centricon filter device. Library was quantified by UV absorbance.
[0076] Next, the TNA strand was displaced by extending a DNA primer annealed to the hairpin loop with dNTPs. Accordingly, the TNA:DNA library (1 M final) was resuspended in 1 ThermoPol buffer containing 500 UM dNTPs and 2 M strand displacement primer. After heating for 5 min at 95 C. and slowly cooling to room temperature, the displacement reaction was initiated by adding Bst 3.0 DNA polymerase to a final concentration of 80 U/mL. The reaction was incubated for 1 h at 50 C. Bst polymerase was extracted with phenol:chloroform as described above. The TNA library was separated from the residual phenol and reaction components in a YM-30 Centricon. Any remaining phenol was removed by adding 900 L of ethanol to the solution and drying completely. The libraries were resuspended in a selection buffer (S1: 150 mM NaCl, 25 mM Tris pH 8.0, TNF: 20 mM imidazole, 450 mM NaCl, 20 mM Tris pH 8.0).
Aptamer Selection
[0077] Aptamer selections were performed by passing each library through unmodified Ni-NTA agarose beads for 30 minutes at 24 C. with rotation to remove any sequences that bound to the affinity matrix. This step was performed for each round of selection. For the S1 selection, an additional negative selection step was performed with 1 M hemagglutinin (HA) for 30 minutes at 24 C. with rotation, chosen as a generic viral coat protein. For this step, the flow through from the empty beads was passed through Ni-NTA beads containing the HA protein. The negative HA selection step was only performed in the first round of the S1 selection. The material collected from the flow-through of the negative selection was incubated with the appropriate His-tagged protein (either the S1 protein from SARS-CoV-2 or TNF) poised at a concentration of 1 UM for 15 minutes at 24 C. with rotation. The mixture was incubated in a disposable plastic column with Ni-NTA beads for 15 minutes at 24 C. with rotation. The column was drained and washed three times with 400 L of selection buffer to remove unbound and weakly bound molecules. A more stringent wash step was performed with 1 M NaCl to reduce the occurrence of nonspecific electrostatic interactions (S1: 1 M NaCl, 25 mM Tris pH 8.0, TNF: 20 mM imidazole, 1 M NaCl, 20 mM Tris pH 8.0), followed by an additional wash with selection buffer to return to baseline salt concentrations before elution. Six 250 L elutions were performed with elution buffer (S1: 500 mM imidazole, 150 mM NaCl, 25 mM Tris pH 8.0, TNF: 100 mM imidazole, 450 mM NaCl, 20 mM Tris pH 8.0). Elution fractions were imaged on a LI-COR Odyssey CLx. The two elution fractions with the highest fluorescence were pooled and desalted using a NAP-5 DNA purification column (Cytiva, Marlborough, MA). TNA aptamers were amplified by PCR with library-specific PCR primers and purified using DNA Clean and Concentrator columns (Zymo Research, Irvine, CA). The single-stranded DNA library was regenerated through a second PCR using a PEGylated forward primer and the high fidelity PCRBIO HiFi polymerase, then purifying by 10% denaturing PAGE, cutting the corresponding band with a scalpel and recovering by electroelution.
NGS Sequencing & Analysis
[0078] 86 bp library members that remained in the pool after each round of selection were PCR amplified and purified as above. Amplicons were prepared as barcoded libraries and sequenced on a NovaSeq6000 with the S4 flow cell with the paired end setting for 200 cycles for an estimated 2-400 M reads per library, per round.
[0079] Sequencing data was parsed by filtering, trimming and aligning reads. Enrichment scores over the course of the selection were calculated for the top 10,000 most abundant sequences in the final round.
Directed Evolution of Trp-1
[0080] A doped library of Trp-1 was synthesized at the DNA level with 15% doping of the other 3-nts at each position in the aptamer sequence. The DNA displayed TNA library was generated and taken through one round of selection exactly as described above with the exception that the S1 protein was poised at a concentration of 0.5 M. TNA aptamers collected in the elution fractions were amplified by PCR with library-specific PCR primers, purified using DNA Clean and Concentrator columns (Zymo Research, Irvine, CA), and submitted for NGS analysis.
Aptamer Preparation for Kinetic Analysis
[0081] Aptamers identified by sequencing were prepared as biotin-labeled TNA molecules using the PBS8 biotin 20mer DNA primer and the corresponding template. A 500 L reaction volume containing 0.5 nmol of both primer and template as well as 1 ThermoPol Buffer was heated for 5 min at 95 C. to anneal. TNA polymerization was initiated by adding 100 UM of each tNTP and Kod RSGA polymerase (1 UM for standard bases or Phe, 2 UM for Trp) and then incubated for 2 h at 55 C. Full length biotin-labeled aptamers were purified by 10% denaturing polyacrylamide gel electrophoresis for 1.5 h at 18 W constant. TNA was recovered from the gel by electroelution and then buffer exchanged into water and concentrated using a YM-3 Centricon centrifugal filter device. TNA concentration was quantified by NanoDrop absorbance. Aptamers at a concentration of 100 nM were folded in BLI binding buffer (125 mM NaCl, 20 mM HEPES pH 7.5, 2 mM CaCl2, 0.05% Tween 20) by denaturing for 15 min at 95 C. and then cooling for 1 h at room temperature.
BLI Screening
[0082] TNA aptamers were screened to identify sequences of interest for further characterization. Prior to testing, all sensors were equilibrated in BLI binding buffer for 1 h. Aptamers at a concentration of 100 nM were loaded on a single biosensor. A fixed target concentration of 100 nM for S1 and 1000 nM for TNF was used. The BLI run was performed with the following steps: a buffer only baseline for 60 sec to equilibrate sensors, loading the aptamer for 200 sec, a second buffer only baseline for 200 sec, an association phase with the target protein for 600 sec for S1 or 120 sec for TNF, and a dissociation phase for 600 sec for S1 or 120 sec for TNF. The plate and reagents were incubated at 30 C. for S1 samples or 24 C. for TNF for the duration of the experiment and for 10 min prior to each run. Data was analyzed using the Octet Data Analysis HT software. For screens, Savitzky-Golay filtering was applied before fitting both association and dissociation curves together to calculate approximate KD values.
Full Kinetic Measurements for S1
[0083] Aptamer sequences of interest were characterized with four different concentrations of target and one buffer only sensor to determine background. Prior to testing, all sensors were equilibrated in BLI binding buffer (defined above) for 1 h. After aptamer folding, the BLI run was performed with the following steps: a buffer only baseline for 60 sec to equilibrate sensors, loading the aptamer for 200 sec, a second buffer only baseline for 200 sec, an association phase with the target protein for 600 sec for S1 or 120 sec for TNF, and a dissociation phase for 600 sec for S1 or 120 sec for TNF. The plate and reagents were incubated at 30 C. for S1 or 24 C. for TNF for the duration of the experiment and for 10 min prior to each run. Data was analyzed using the Octet Data Analysis HT software. For full kinetics measurements, the buffer only baseline sample was used to subtract background from all samples before applying Savitzky-Golay filtering and fitting both the association and dissociation curves together and applying a global fit to determine KD and other metrics.
Computational Method for Evolving Aptamers
[0084] A machine learning model based on the previously described Transformer architecture was trained using TensorFlow on the NGS data described above to predict the relative fraction of reads in the elution and flow-through pools from a TNA sequence. The Transformer encoder was trained with 8 attention heads per multiheaded layer and 3 encoder layers.
[0085] The model achieved a Most abundant versus Least abundant AUC of 0.69 and Most abundant vs Random AUC of 0.71 for the held out NGS test set. 10 k sequences were used for each of the Most abundant, Least abundant and Random pools.
[0086] Using this model, an in silico genetic algorithm was used to evolve a threomer with an estimated KD of 27 nM to the aforementioned threomer TNA 949 with a KD of 70040 M.
[0087] As used herein, the term about refers to plus or minus 10% of the referenced number.
[0088] Although there has been shown and described the preferred embodiment of the present invention, it will be readily apparent to those skilled in the art that modifications may be made thereto which do not exceed the scope of the appended claims. Therefore, the scope of the invention is only to be limited by the following claims. In some embodiments, the figures presented in this patent application are drawn to scale, including the angles, ratios of dimensions, etc. In some embodiments, the figures are representative only and the claims are not limited by the dimensions of the figures. In some embodiments, descriptions of the inventions described herein using the phrase comprising includes embodiments that could be described as consisting essentially of or consisting of, and as such the written description requirement for claiming one or more embodiments of the present invention using the phrase consisting essentially of or consisting of is met.