LIGHT-RECEIVING DEVICE
20250098340 ยท 2025-03-20
Assignee
Inventors
- Yoshiaki SUGIZAKI (Fujisawa Kanagawa, JP)
- Yasutaka Nishida (Tama Tokyo, JP)
- Takashi YOSHIDA (Kashiwa Chiba, JP)
- Akiko YUZAWA (Minato Tokyo, JP)
- Miyu NAGAI (Yokohama Kanagawa, JP)
Cpc classification
H10F77/162
ELECTRICITY
H10F30/282
ELECTRICITY
International classification
H01L31/113
ELECTRICITY
H01L31/028
ELECTRICITY
Abstract
A light-receiving device includes graphene including a light-receiving part; major electrodes electrically connected with the graphene, the major electrodes including a source electrode and a drain electrode, the light-receiving part being positioned between the source electrode and the drain electrode; a gate electrode electrically connected with the light-receiving part of the graphene via capacitive coupling; a circuit part electrically connected with the major electrode and the gate electrode; and an ionic substance contacting the light-receiving part of the graphene. The ionic substance is one of an anion having an acid dissociation constant of not less than 3 or a cation having an acid dissociation constant of not more than 11.
Claims
1. A light-receiving device, comprising: graphene including a light-receiving part, the light-receiving part being configured to receive light; major electrodes electrically connected with the graphene, the major electrodes including a source electrode and a drain electrode, the light-receiving part being positioned between the source electrode and the drain electrode; a gate electrode electrically connected with the light-receiving part of the graphene via capacitive coupling; a circuit part electrically connected with the major electrode and the gate electrode, the circuit part being configured to apply voltages to the major electrodes and the gate electrode, and measure a current flowing in the major electrodes; and an ionic substance contacting the light-receiving part of the graphene, the ionic substance being one of an anion having an acid dissociation constant of not less than 3 or a cation having an acid dissociation constant of not more than 11.
2. The device according to claim 1, wherein the gate electrode includes a substrate supporting the graphene.
3. The device according to claim 1, wherein the gate electrode is electrically connected with the light-receiving part of the graphene via an ionic liquid.
4. The device according to claim 3, wherein the ionic liquid contacts a lower surface of the light-receiving part.
5. The device according to claim 3, wherein the ionic liquid includes a chlorine ion, and the gate electrode is a silver/silver chloride electrode.
6. The device according to claim 1, wherein the light-receiving part is positioned in a humidified space.
7. The device according to claim 1, further comprising: a mechanism configured to expose the light-receiving part to a humidified atmosphere.
8. The device according to claim 1, wherein the light-receiving part is positioned in an electrolyte solution.
9. The device according to claim 1, wherein the ionic substance contacts the light-receiving part together with a hydrophilic substance.
10. The device according to claim 1, wherein the ionic substance is citric acid, phosphoric acid, HEPES (4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid), tris(hydroxymethyl)aminomethane (Tris), nucleic acid, an amino group, or an ethylenediamine derivative.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0004]
[0005]
[0006]
[0007]
[0008]
[0009]
[0010]
[0011]
[0012]
[0013]
[0014]
[0015]
DETAILED DESCRIPTION
[0016] According to one embodiment, a light-receiving device includes graphene including a light-receiving part, the light-receiving part being configured to receive light; major electrodes electrically connected with the graphene, the major electrodes including a source electrode and a drain electrode, the light-receiving part being positioned between the source electrode and the drain electrode; a gate electrode electrically connected with the light-receiving part of the graphene via capacitive coupling; a circuit part electrically connected with the major electrode and the gate electrode, the circuit part being configured to apply voltages to the major electrodes and the gate electrode, and measure a current flowing in the major electrodes; and an ionic substance contacting the light-receiving part of the graphene, the ionic substance being one of an anion having an acid dissociation constant of not less than 3 or a cation having an acid dissociation constant of not more than 11.
[0017] Embodiments will now be described with reference to the drawings.
[0018] The drawings are schematic or conceptual; and the relationships between the thickness and width of portions, the proportions of sizes among portions, etc., are not necessarily the same as the actual values. The dimensions and proportions may be illustrated differently among drawings, even when the same portion is illustrated.
[0019] The same or similar components are marked with the same reference numerals.
[0020]
[0021] The graphene 20 includes a light-receiving part 20A that is optically exposed to be capable of receiving light 80 from a light source 70. The graphene 20 is favorably single-layer graphene. The graphene 20 is located on a substrate 10 with an insulating film 40 interposed. For example, a silicon substrate can be used as the substrate 10. For example, a silicon oxide film can be used as the insulating film 40.
[0022] The major electrodes include the source electrode 31 and the drain electrode 32, and are electrically connected with the graphene 20. The source electrode 31 and the drain electrode 32 are separated from each other on the insulating film 40. A portion of the source electrode 31 contacts the graphene 20; and a portion of the drain electrode 32 contacts the graphene 20. The light-receiving part 20A of the graphene 20 is positioned between the source electrode 31 and the drain electrode 32.
[0023] The gate electrode 91 is electrically connected with the light-receiving part 20A of the graphene 20 via capacitive coupling by the insulating film 40. In the example, the gate electrode 91 includes the substrate 10 supporting the graphene 20, and a conductive film 50 located at the lower surface (the back surface) of the substrate 10. The substrate 10 is conductive. For example, a stacked film of titanium, nickel, and gold, etc., can be used as the material of the conductive film 50. By using such a conductive film 50, ohmic contact with the substrate 10, which is made of silicon, is obtained, and excellent adhesion is obtained. The insulating film 40 is positioned between the gate electrode 91 and the graphene 20, and functions as a gate insulating film.
[0024] The circuit part 60 is electrically connected with the source electrode 31, the drain electrode 32, and the gate electrode 91. The circuit part 60 includes a power supply 61 configured to apply a voltage to the source electrode 31 and the drain electrode 32, a variable power supply 63 configured to apply a voltage to the source electrode 31 and the gate electrode 91, and a current measurement part 62 configured to measure the drain current flowing between the source electrode 31 and the drain electrode 32.
[0025] A drain current flows in the graphene 20 because a potential difference is applied between the source electrode 31 and the drain electrode 32 via the power supply 61. Here, because the graphene 20 has field-effect transistor (FET) characteristics, the magnitude of the drain current is determined by the potential difference with the gate electrode 91 applied from the power supply 63. Here, photoexcitation of the graphene 20 occurs when the light-receiving part 20A is irradiated with the light 80 from the light source 70. At least one of excited electrons generated by the photoexcitation or their holes causes charge transfer with the ionic substance 100; and the electrostatic potential of the ionic substance 100 changes. Because the ionic substance 100 is capacitively coupled with the graphene 20, the change of the electrostatic potential of the ionic substance 100 is added to the gate voltage from the gate electrode 91 as a bias; and the net gate voltage applied to the graphene 20 changes abruptly. Here, the drain current also changes abruptly due to the FET characteristics of the graphene 20. The current measurement part 62, which measures the drain current, measures this series of drain current changes.
[0026] The circuit part 60 includes a gate wiring part 64 that electrically connects the source electrode 31 and the gate electrode 91. The variable power supply (the gate voltage application device) 63 is connected to the gate wiring part 64. The gate wiring part 64 is connected to the conductive film 50; and the gate wiring part 64 and the gate electrode 91 have an ohmic contact due to the conductive film 50. The gate voltage is applied from the gate electrode 91 to the graphene 20. The Fermi level of the graphene 20 is modulated by controlling the gate voltage.
[0027] The ionic substance 100 is positioned at the light-receiving part 20A of the graphene 20, and contacts the light-receiving part 20A. The acid dissociation constant of the ionic substance 100 is not less than 3 and not more than 11. The light-receiving device 1 includes the ionic substance 100 that is one of an anion having an acid dissociation constant of not less than 3 or a cation having an acid dissociation constant of not more than 11. The ionic substance is citric acid, phosphoric acid, HEPES (4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid), tris(hydroxymethyl)aminomethane (Tris), nucleic acid, an amino group, or an ethylenediamine derivative.
[0028]
[0029] The gate electrode 92 of the light-receiving device 2 is located on the substrate 10 with the insulating film 40 interposed, and is electrically connected with the gate wiring part 64. An ionic liquid 101 is positioned in a recess of the insulating film 40 formed in the lower surface of the graphene 20; and the ionic liquid 101 contacts the lower surface of the light-receiving part 20A. The ionic liquid 101 also contacts the gate electrode 92 on the insulating film 40. The gate electrode 92 is electrically connected with the light-receiving part 20A of the graphene 20 via the ionic liquid 101. However, because the ionic liquid 101 forms an electric double layer at the contact portion with the light-receiving part 20A, it is more accurate to say that the ionic liquid 101 and the light-receiving part 20A are electrically connected via capacitive coupling due to the electric double layer.
[0030] The ionic liquid 101 includes a chlorine ion; and the gate electrode 92 is a silver/silver chloride electrode that includes silver chloride at the surface. The silver/silver chloride electrode (the gate electrode 92) applies a potential to the ionic liquid 101, which includes the chlorine ion, by contacting the ionic liquid 101 and causing an oxidation-reduction reaction. The potential of the ionic liquid 101 is controlled to have a constant potential difference with respect to the potential of the silver/silver chloride electrode (the gate electrode 92) according to the Nernst equation. Due to the oxidation-reduction reaction with silver chloride (AgCl) (AgCl+e.sup..fwdarw.Ag+Cl.sup.), the chlorine ions (Cl.sup.) in the ionic liquid 101 move between the ionic liquid 101 and the surface of the silver/silver chloride electrode (the gate electrode 92) until the potential of the ionic liquid 101 stabilizes.
[0031]
[0032]
[0033]
[0034]
[0035] To adhere citric acid, a gold nanoparticle solution (100 nm-diameter citric acid dispersion made by CytoDiagnostics) including citric acid as a stabilizing agent was added dropwise and dried. Accordingly, gold nanoparticles also adhered in addition to citric acid, but scanning electron microscope observation performed beforehand shown that almost no gold nanoparticles were adhered. It was found that the contribution to the photoresponse was substantially due to the citric acid because after the gold nanoparticle solution was added dropwise, the few gold nanoparticles that were present before washing also remained when the citric acid, which is water-soluble, was replaced with purified water by washing; however, a photoresponse was not observed for the remaining gold nanoparticles, whereas a photoresponse was observed when citric acid (citric acid monohydrate by FUJIFILM Wako Chemicals Corporation) was added dropwise as an aqueous solution and dried. Hereinbelow, a sample in which citric acid is similarly adhered using citrate-stabilized gold nanoparticles is called graphene with citric acid adhered.
[0036]
[0037]
[0038]
[0039]
[0040]
[0041] Here, a scaffold peptide having an amino acid sequence of ECKEKCEKECKEKCEKECKEKCEKECK from the N-terminal toward the C-terminal was used as the zwitterionic oligomer including equal amounts of glutamic acid and lysine. Pyrenylmaleimide was mixed with the scaffold peptide aqueous solution in a molar ratio of 3 to pyrene-modify substantially half of the thiol groups of cysteine in the scaffold peptide to be adhered to the graphene surface by a - interaction. Subsequently, a TMEA (tris(2-maleimidoethyl)amine (Thermo Fisher Scientific)) solution was added dropwise to maleimide-modify the remaining substantially half of the thiol groups of the scaffold peptide to bond the peptide to have a peptide of sequence CGGGRRRRRRRRRRRRRRRRRRRR from the N-terminal toward the C-terminal, and in which the N-terminal and the C-terminal are cyclized with a peptide bond.
[0042] From the measurement results of
[0043] The reason is explained below with reference to
[0044]
[0045] When light having a wavelength of 650 nm is irradiated on graphene, electrons are excited as illustrated by the arrows in
[0046] For citric acid without acid dissociation in
[0047] On the other hand, the HOMO was present at the Fermi level vicinity for the acid-dissociated citrate ions shown in
[0048] The mechanism by which negative doping may occur in the graphene FET due to light irradiation in the presence of a divalent acid-dissociated citrate ion will now be described with reference to
[0054] A mechanism by which positive doping may occur in the graphene FET due to light irradiation in the presence of a trivalent acid-dissociated citrate ion will now be described with reference to
[0060] By changing the acid dissociation state of citric acid as described above, a state in which a positive charge is injected and a state in which a negative charge is injected are possible for graphene when light is irradiated. The acid dissociation constant of citric acid changing from divalent to trivalent is 6.41, which is substantially neutral. In other words, citric acid may be divalent or trivalent according to a slight presence of impurity ions, etc. It is considered that this is the reason that both a photoresponse in the positive doping direction and a photoresponse in the negative doping direction occur. Phosphoric acid also dissociates in multiple stages similarly to citric acid, and therefore can be estimated to have a similar behavior. When the pH is at the vicinity of the acid dissociation constant, ions with valences around the vicinity will be present. In such a case, positive doping and negative doping due to the light irradiation is expected to compete. The co-expression of the positive doping and the negative doping shown in
[0061] In the mechanism of the photoresponse described above, the graphene side of the zero-gap material is excited by the light irradiation; and the citric acid is not affected directly by the light irradiation. As a result, the photoresponse has no wavelength dependence, and is not affected by the HOMO-LUMO bandgap of citric acid.
[0062] The reason that the HOMO level of citric acid is expressed at the Fermi level vicinity of graphene when acid-dissociated citric acid is at the graphene vicinity will now be described. First, charge density analysis using Mulliken charges of the results of the density of states calculation for the composite system of graphene and citric acid was performed, and the number of electrons held by citric acid was determined. From these results, the results of determining the actual valence of the citrate ion coexisting with graphene and the change number from the state before the interaction with graphene, i.e., the charge transfer number with graphene, are shown in Table 1.
TABLE-US-00001 TABLE 1 (Mulliken charge) Initial Valence State citrate (1) citrate (2) citrate (3) Actural Number of Valences 0.2 1.0 1.3 Number of Electron Transfer 0.8 1.0 1.7 (Citrate to Graphene)
[0063] As a result, it was found that monovalent citrate ion had a valence of 0.2 after the interaction with graphene; divalent citrate ion became monovalent; and trivalent citrate ion had a valence of 1.3. In other words, it can be seen that for the citrate ion of each valence, the number of electrons was reduced from the initial state, and electrons moved into the graphene. It can also be seen that the number of electrons transferred increased as the valence increased from monovalent to trivalent.
[0064] Here, both monovalent and trivalent citrate ions have HOMO levels at the Fermi level vicinity of graphene. From the results described above, it can be estimated that the energy level of the HOMO in the initial state was higher because more electrons were held in the initial state.
[0065]
[0066] The mechanism described above is due to citric acid holding more electrons due to acid dissociation which increases the energy level of the HOMO; therefore, acid dissociation is a requirement. As shown in
[0067] The explanation above is for anions that form weak acids, but it is estimated that a similar phenomenon occurs for cations forming weak bases as well. In such a case, the cation emits electrons due to acid dissociation, and the state of the cation becomes slightly unstable, i.e., an electron-accepting state. In the electron-accepting state, the LUMO is at a low energy level; and the Fermi level is at the vicinity of the even lower HOMO level. Here, when the LUMO level of the cation is lower than or near the Fermi level of graphene, electrons are donated from the graphene to the LUMO of the cation; the Fermi level of the cation that was much lower than the Fermi level of graphene is increased; and the two match. At this time, the electrons of the LUMO are in a partially occupied state, and are at the Fermi level vicinity. When light is irradiated in this state, the excited electrons generated by the photoexcitation at the graphene side are at a higher level than the partially-occupied LUMO level, and so electrons move from the graphene to the cation. Because the cation changes in the negative charge direction, a positive charge is induced in the graphene via the capacitive coupling with the graphene. It is estimated that the positive doping that occurred in
[0068] Similar photoresponses may be expressed for tris(hydroxymethyl)aminomethane (Tris), a cation having an acid dissociation constant of 8.06 (25 C.), and an ethylenediamine derivative, which is a cation having a multistage acid dissociation. Examples of ethylenediamine derivatives include ethylenediamine having acid dissociation constants f 4.42 and 9.21, diethylenetriamine having acid dissociation constants of 4.42, 9.21, and 10.02, triethylenetetraamine having acid dissociation constants of 3.32, 6.67, 9.2, and 9.92, etc. Nucleic acid also is a weak base having acid dissociation constants of 4.4 for adenine, 4.6 for cytosine, 2.9 for guanine, and 0.8 for thymine and exhibits a similar photoresponse.
[0069]
[0070] Here, to adhere DNA, an aqueous solution of DNA having a base sequence of GACAAGGAAAATCCTTCAATGAAGTGGGTC from the 5 end toward the 3 end and having a thiol-modified 5 end was added dropwise and dried.
[0071] From the description above, in a graphene FET with an ionic substance having an acid dissociation constant of not less than 3 and not more than 11 adhered, light irradiation modulates the Fermi level of the graphene FET and causes the expression of a drain current change. More accurately, in a graphene FET to which one of an anion having an acid dissociation constant of not less than 3 or a cation having an acid dissociation constant of not more than 11 is adhered, light irradiation modulates the Fermi level and causes the expression of a drain current change.
[0072] The phenomenon that is expressed by the direct action of the light irradiation is photoexcitation in graphene, which is a zero-gap material; and the light irradiation has no direct effect on the ionic substance. Accordingly, a strong response is independent of specific wavelengths, and is possible for light of a wide wavelength range. Based on the mechanism described above, if the Fermi level of graphene is adjusted to the Dirac point by controlling the gate voltage applied to the graphene, a response is possible even for infrared. In other words, the gate voltage is set to a voltage so that the electrical resistance between the source electrode 31 and the drain electrode 32 is a maximum.
[0073] Substantially no photoresponse was observed when the density of the ionic substance contacting the graphene was not more than 0.3 ions/nm.sup.2. A photoresponse was confirmed when the density of the ionic substance contacting the graphene was not less than 0.6 ions/nm.sup.2 and not more than 1 ion/nm.sup.2.
[0074] The acid dissociation of an ionic substance is promoted by humidification. Therefore, an amplification of the photoresponse by humidifying the light-receiving part 20A of the graphene 20 was confirmed compared to when humidification was not performed.
[0075] For example, the light-receiving part 20A can be positioned in a humidified space by sealing the light-receiving part 20A inside a container in a humidified atmosphere.
[0076] For example, a mechanism that exposes the light-receiving part 20A to a humidified atmosphere may be included.
[0077] For example, the light-receiving part 20A may be positioned in an electrolyte solution.
[0078] For example, the ionic substance 100 may contact the light-receiving part 20A together with a hydrophilic substance.
[0079] A method for manufacturing the light-receiving device 1 shown in
[0080] Graphene is formed by CCVD (Carbon Chemical Vapor Deposition) on a Cu foil. The graphene is transferred to the front surface of a silicon wafer including the conductive film 50 formed at the back surface and a silicon oxide film formed at the front surface; and the graphene is patterned. Subsequently, conductive films used to form the source electrode 31, the drain electrode 32, wiring parts, etc., are formed at the front surface of the wafer, and are patterned. After hydrophilizing treatment of the graphene surface, an aqueous solution that includes the desired ionic substance is added dropwise to the graphene surface and dried to position the ionic substance at the graphene surface. In the hydrophilizing treatment of the graphene surface, for example, an aqueous solution of pyrene-modified PEG (polyethylene glycol) or pyrene-modified zwitterion is added dropwise to the graphene surface, left for not less than 30 minutes, and then washed.
[0081] The method for manufacturing the light-receiving device 2 shown in
[0082] Graphene is formed by CCVD on a Cu foil. The graphene is transferred to the front surface of a silicon wafer including the conductive film 50 formed at the back surface and a silicon oxide film formed at the front surface; and the graphene is patterned. Subsequently, conductive films used to form the source electrode 31, the drain electrode 32, wiring parts, etc., are formed at the front surface of the wafer, and are patterned. The gate electrode 92 is formed at the front surface of the wafer. The process of forming the gate electrode 92 can include a process of forming AgCl by forming a Ag film and then patterning. AgCl can be formed by treating the Ag surface with 1,3-diaminopropanetetraacetic acid ferric ammonium salt monohydrate (PDTA.Math.Fe(III)) to cause the following reaction. PDTA.Math.Fe.sup.3++Ag+NaCl.fwdarw.PDTA.Math.Fe.sup.2++AgCl+Na.sup.+. After a protective film of the gate electrode 92 is formed, buffered hydrofluoric acid is used to remove the silicon oxide film under the graphene and form a recess. Subsequently, an organic solvent is used to remove the protective film of the gate electrode. Subsequently, supercritical cleaning and drying are performed. Here, the process from buffered hydrofluoric acid treatment to supercritical cleaning is a continuous process and does not allow drying partway. Subsequently, after hydrophilizing treatment of the graphene surface, an aqueous solution that includes the desired ionic substance is added dropwise to the graphene surface, and then supercritical cleaning and drying are performed to position the ionic substance at the graphene surface. Here as well, the process from hydrophilizing treatment to supercritical cleaning is a continuous process and does not allow drying partway. Finally, the recess formed under the graphene is filled with an ionic liquid; and the ionic liquid is filled to contact the gate electrode.
[0083] For graphene, the law of conservation of momentum does not hold and photoexcitation does not occur when the light energy is less than 2 times the energy level difference between the Fermi level and the Dirac point. By scanning the gate voltage to scan the Fermi level toward the Dirac point from a lower energy level than the Dirac point, photoexcitation occurs at the wavelength of the irradiated light. The wavelength of the irradiated light can be identified by scanning the gate voltage. When the wavelength of the received light is known, a photoresponse can be expressed by causing the Fermi level to approach the Dirac point within an energy range that is not more than of the light energy at the wavelength. Also, the light of not less than a certain wavelength can be cut by applying the gate voltage to cause the Fermi level of graphene to be distant to the Dirac point by not less than of the light energy at the wavelength.
[0084] While certain embodiments have been described, these embodiments have been presented by way of example only, and are not intended to limit the scope of the inventions. Indeed, the novel embodiments described herein may be embodied in a variety of other forms; furthermore, various omissions, substitutions and changes in the form of the embodiments described herein may be made without departing from the spirit of the inventions. The accompanying claims and their equivalents are intended to cover such forms or modification as would fall within the scope and spirit of the inventions.