SUPER SYSTEM ON CHIP
20250094380 ยท 2025-03-20
Inventors
Cpc classification
G02F2203/70
PHYSICS
International classification
Abstract
A Super System is disclosed and its inputs/outputs are coupled with a Mach-Zehnder interferometer (MZI), wherein the Mach-Zehnder interferometer (MZI) can be coupled with a first optical waveguide either in a two-dimensional (2-D) or in a three-dimensional (3-D) arrangement. The first optical waveguide can be then coupled with (i) a semiconductor optical amplifier (SOA) and/or (ii) a second optical waveguide (that can include an optical resonator) either in a two-dimensional (2-D) or in a three-dimensional (3-D) arrangement. The Super System can include multipliers of matrices and graphic processors.
Claims
1. A Super System, wherein the Super System is a Super System on Chip (SSoC) or a Super System on Package (SSoP), wherein the Super System comprises: (a) an input of the Super System or an output of the Super System; wherein the input of the Super System or the output of the Super System is coupled with a Mach-Zehnder interferometer (MZI), wherein the Mach-Zehnder interferometer (MZI) is coupled with a first optical waveguide in a three-dimensional (3-D) arrangement, wherein the first optical waveguide is coupled with (i) a semiconductor optical amplifier (SOA) in the three-dimensional (3-D) arrangement and/or (ii) a second optical waveguide in the three-dimensional (3-D) arrangement, wherein the second optical waveguide includes an optical resonator, (b) one or more third optical waveguides; and wherein at least one of the one or more third optical waveguides is coupled with the Super System, wherein at least one of the one or more third optical waveguides comprises a nonlinear optical material, (c) (i) one or more multipliers of matrices and/or (ii) graphic processors, wherein the graphic processors are stacked in the three-dimensional (3-D) arrangement.
2. The Super System according to claim 1, wherein the Super System is coupled with an electronic component selected from the group consisting of a processor-specific electronic integrated circuit (Processor-EIC), an application specific integrated circuit (ASIC) and a field programmable gate array (FPGA).
3. The Super System according to claim 2, wherein the processor-specific electronic integrated circuit (Processor-EIC) comprises (i) a vertically stacked structure or (ii) a three-dimensionally (3-D) stacked structure or (iii) stacked dual layers of ultra-thin film of hexagonal boron nitride.
4. The Super System according to claim 2, wherein the processor-specific electronic integrated circuit (Processor-EIC) comprises a gate oxide that includes zirconium oxide and/or hafnium oxide.
5. The Super System according to claim 2, wherein the processor-specific electronic integrated circuit (Processor-EIC) comprises a material selected from consisting of silicon, germanium, a silicon-germanium (SiGe) composition, a silicon-germanium (SiGe) superlattice, an indium gallium zinc oxide composition, a III-V material, a two-dimensional material, a one-dimensional material and a superatomic material.
6. The Super System according to claim 2, wherein the processor-specific electronic integrated circuit (Processor-EIC) comprises a multi-part gate and a memory element, wherein the memory element includes one or more memory circuits.
7. The Super System according to claim 2, wherein the processor-specific electronic integrated circuit (Processor-EIC) comprises one or more processing cores and one or more memory units, wherein at least one of the one or more processing cores and at least one of the one or more memory units are intertwined either in a two-dimensional (2-D) arrangement or in a three-dimensional (3-D) arrangement, wherein at least one of the one or more memory units includes one or more memory elements, wherein at least one of the one or more memory elements includes one or more memory circuits.
8. The Super System according to claim 2, wherein the processor-specific electronic integrated circuit (Processor-EIC) comprises a cross-bar array, wherein the cross-bar array includes a ferroelectric semiconductor.
9. The Super System according to claim 1, wherein the Super System is further coupled with an optical switch or an optical interface, wherein the optical interface comprises light sources and photodiodes.
10. The Super System according to claim 1, is a part of a multichip module (MCM), wherein the multichip module (MCM) comprises an array of light sources, an array of photodiodes and an array of lenses.
11. The Super System according to claim 1, is further communicatively interfaced with a set of computer implementable instructions in artificial neural networks (ANN), wherein the set of computer implementable instructions is stored in one or more non-transitory storage media.
12. The Super System according to claim 11, wherein the set of computer implementable instructions in the artificial neural networks (ANN) comprises a transformer model based computer implementable instructions or a diffusion model based computer implementable instructions.
13. The Super System according to claim 11, wherein the set of computer implementable instructions in the artificial neural networks (ANN) comprises Kolmogorov-Arnold based neural network architecture (KANN) or Poisson flow generative model++ (PFGM++).
14. The Super System according to claim 11, wherein the set of computer implementable instructions in the artificial neural networks (ANN) comprises an evolutionary algorithm based computer implementable instructions and/or a game theory based computer implementable instructions.
15. The Super System according to claim 1, is further communicatively interfaced with a set of computer implementable instructions in computer vision or Vision Transformer (ViT), wherein the set of computer implementable instructions is stored in one or more non-transitory storage media.
16. The Super System according to claim 1, is further communicatively interfaced with a set of computer implementable instructions in self-learning based on a text, an image, a video and an experience, wherein the set of computer implementable instructions is stored in one or more non-transitory storage media.
17. A Super System, wherein the Super System is a Super System on Chip (SSoC) or a Super System on Package (SSoP), wherein the Super System comprises: (a) an input of the Super System or an output of the Super System; wherein the input of the Super System or the output of the Super System is coupled with a Mach-Zehnder interferometer (First MZI), wherein the Mach-Zehnder interferometer (MZI) comprises a material selected from the group consisting of a phase transition material, a phase change material, a lithium niobate material and a polymeric material, wherein the phase transition material is electrically and/or optically controlled, wherein the phase change material is electrically or optically controlled, wherein the lithium niobate material is electrically controlled, wherein the polymeric material is electrically controlled, wherein the Mach-Zehnder interferometer (MZI) is coupled with a first optical waveguide in a three-dimensional (3-D) arrangement, wherein the first optical waveguide is coupled with (i) a semiconductor optical amplifier (SOA) or a first optical resonator in the three-dimensional (3-D) arrangement and/or (ii) a second optical waveguide in the three-dimensional (3-D) arrangement, wherein the second optical waveguide comprises a second optical resonator, wherein the second optical resonator includes a nonlinear optical material, (b) one or more third optical waveguides; and wherein at least one of the one or more third optical waveguides is coupled with either the input of the Super System or the output of the Super System, (c) one or more (i) multipliers of matrices and/or (ii) graphic processors.
18. The Super System according to claim 17, wherein the Super System is coupled with an electronic component selected from the group consisting of a processor-specific electronic integrated circuit (Processor-EIC), an application specific integrated circuit (ASIC) and a field programmable gate array (FPGA).
19. The Super System according to claim 18, wherein the processor-specific electronic integrated circuit (Processor-EIC) comprises (i) a vertically stacked structure or (ii) a three-dimensionally (3-D) stacked structure or (iii) stacked dual layers of ultra-thin film of hexagonal boron nitride.
20. The Super System according to claim 18, wherein the processor-specific electronic integrated circuit (Processor-EIC) comprises a gate oxide that includes zirconium oxide and/or hafnium oxide.
21. The Super System according to claim 18, wherein the processor-specific electronic integrated circuit (Processor-EIC) comprises a material selected from consisting of silicon, germanium, a silicon-germanium (SiGe) composition, a silicon-germanium (SiGe) superlattice, an indium gallium zinc oxide composition, a III-V material, a two-dimensional material, a one-dimensional material and a superatomic material.
22. The Super System according to claim 18, wherein the processor-specific electronic integrated circuit (Processor-EIC) comprises a multi-part gate and a memory element, wherein the memory element includes one or more memory circuits.
23. The Super System according to claim 18, wherein the processor-specific electronic integrated circuit (Processor-EIC) comprises one or more processing cores and one or more memory units, wherein at least one of the one or more processing cores and at least one of the one or more memory units are intertwined either in a two-dimensional (2-D) arrangement or a three-dimensional (3-D) arrangement, wherein at least one of the one or more memory units includes one or more memory elements, wherein at least one of the one or more memory elements includes one or more memory circuits.
24. The Super System according to claim 18, wherein the processor-specific electronic integrated circuit (Processor-EIC) comprises a cross-bar array, wherein the cross-bar array includes a ferroelectric semiconductor.
25. The Super System according to claim 17, wherein the Super System is further coupled with an optical switch or an optical interface, wherein the optical interface comprises light sources and photodiodes.
26. The Super System according to claim 17, is a part of a multichip module (MCM), wherein the multichip module (MCM) comprises an array of light sources, an array of photodiodes and an array of lenses.
27. The Super System according to claim 17, is further communicatively interfaced with a set of computer implementable instructions in artificial neural networks (ANN), wherein the set of computer implementable instructions is stored in one or more non-transitory storage media.
28. The Super System according to claim 27, wherein the set of computer implementable instructions in the artificial neural networks (ANN) comprises a transformer model based computer implementable instructions or a diffusion model based computer implementable instructions.
29. The Super System according to claim 27, wherein the set of computer implementable instructions in the artificial neural networks (ANN) comprises Kolmogorov-Arnold based neural network architecture (KANN) or Poisson flow generative model++ (PFGM++).
30. The Super System according to claim 27, wherein the set of computer implementable instructions in the artificial neural networks (ANN) comprises an evolutionary algorithm based computer implementable instructions and/or a game theory based computer implementable instructions.
31. The Super System according to claim 17, is further communicatively interfaced with a set of computer implementable instructions in computer vision or Vision Transformer (ViT), wherein the set of computer implementable instructions is stored in one or more non-transitory storage media.
32. The Super System according to claim 17, is further communicatively interfaced with a set of computer implementable instructions in self-learning based on a text, an image, a video and an experience, wherein the set of computer implementable instructions is stored in one or more non-transitory storage media.
33. A Super System, wherein the Super System is a Super System on Chip (SSoC) or a Super System on Package (SSoP), wherein the Super System comprises: (a) an input of the Super System or an output of the Super System; wherein the input of the Super System or the output of the Super System is coupled with a Mach-Zehnder interferometer (MZI), wherein the Mach-Zehnder interferometer (MZI) comprises a material selected from the group consisting of a phase transition material, a phase change material, a lithium niobate material and a polymeric material, wherein the phase transition material is electrically and/or optically controlled, wherein the phase change material is electrically or optically controlled, wherein the lithium niobate material is electrically controlled, wherein the polymeric material is electrically controlled, wherein the Mach-Zehnder interferometer (MZI) is coupled with a first optical waveguide in a three-dimensional (3-D) arrangement, wherein the first optical waveguide is coupled with (i) a semiconductor optical amplifier (SOA) in the three-dimensional (3-D) arrangement and/or (ii) a second optical waveguide in the three-dimensional (3-D) arrangement, wherein the second optical waveguide includes an optical resonator, (b) one or more third optical waveguides; and wherein at least one of the one or more third optical waveguides is coupled with either the input of the Super System or the output of the Super System, (c) one or more (i) multipliers of matrices and/or (ii) graphic processors.
34. A Super System, wherein the Super System is a Super System on Chip (SSoC) or a Super System on Package (SSoP), wherein the Super System comprises: (a) an input of the Super System or an output of the Super System; wherein the input of the Super System or the output of the Super System is coupled with a Mach-Zehnder interferometer (MZI), wherein the Mach-Zehnder interferometer (MZI) is coupled with a first optical waveguide in a two-dimensional (2-D) or a three-dimensional (3-D) arrangement, wherein the first optical waveguide is coupled with (i) a semiconductor optical amplifier (SOA) in the two-dimensional (2-D) arrangement or the three-dimensional (3-D) arrangement and/or (ii) a second optical waveguide in the two-dimensional (2-D) arrangement or the three-dimensional (3-D) arrangement, wherein the second optical waveguide includes an optical resonator, (b) one or more third optical waveguides; and wherein at least one of the one or more third optical waveguides is coupled with either the input of the Super System or the output of the Super System, (c) one or more (i) multipliers of matrices and/or (ii) graphic processors.
35. The Super System according to claim 34, wherein the Super System is coupled with an electronic component selected from the group consisting of a processor-specific electronic integrated circuit (Processor-EIC), an application specific integrated circuit (ASIC) and a field programmable gate array (FPGA).
36. The Super System according to claim 35, wherein the processor-specific electronic integrated circuit (Processor-EIC) comprises (i) a vertically stacked structure or (ii) a three-dimensionally (3-D) stacked structure or (iii) stacked dual layers of ultra-thin film of hexagonal boron nitride.
37. The Super System according to claim 35, wherein the processor-specific electronic integrated circuit (Processor-EIC) comprises a multi-part gate and a memory element, wherein the memory element includes one or more memory circuits.
38. The Super System according to claim 35, wherein the processor-specific electronic integrated circuit (Processor-EIC) comprises one or more processing cores and one or more memory units, wherein at least one of the one or more processing cores and at least one of the one or more memory units are intertwined either in a two-dimensional (2-D) arrangement or a three-dimensional (3-D) arrangement, wherein at least one of the one or more memory units includes one or more memory elements, wherein at least one of the one or more memory elements includes one or more memory circuits.
39. The Super System according to claim 35, wherein the processor-specific electronic integrated circuit (Processor-EIC) comprises a cross-bar array, wherein the cross-bar array includes a ferroelectric semiconductor.
40. The Super System according to claim 34, wherein the Super System is further coupled with an optical switch or an optical interface, wherein the optical interface comprises light sources and photodiodes.
41. The Super System according to claim 34, is a part of a multichip module (MCM), wherein the multichip module (MCM) comprises an array of light sources, an array of photodiodes and an array of lenses.
42. The Super System according to claim 34, is further communicatively interfaced with a set of computer implementable instructions in artificial neural networks (ANN), wherein the set of computer implementable instructions is stored in one or more non-transitory storage media.
43. The Super System according to claim 42, wherein the set of computer implementable instructions in the artificial neural networks (ANN) comprises a transformer model based computer implementable instructions or a diffusion model based computer implementable instructions.
44. The Super System according to claim 42, wherein the set of computer implementable instructions in the artificial neural networks (ANN) comprises Kolmogorov-Arnold based neural network architecture (KANN) or Poisson flow generative model++ (PFGM++).
45. The Super System according to claim 42, wherein the set of computer implementable instructions in the artificial neural networks (ANN) comprises an evolutionary algorithm based computer implementable instructions and/or a game theory based computer implementable instructions.
46. The Super System according to claim 34, is further communicatively interfaced with a set of computer implementable instructions in computer vision or Vision Transformer (ViT), wherein the set of computer implementable instructions is stored in one or more non-transitory storage media.
47. The Super System according to claim 34, is further communicatively interfaced with a set of computer implementable instructions in self-learning based on a text, an image, a video and an experience, wherein the set of computer implementable instructions is stored in one or more non-transitory storage media.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
Internet Connected Objects (Sensors), Devices & Systems
[0015]
Intelligent Algorithm
[0016]
[0017]
[0018]
[0019]
Object (Sensor) Enabled Social Commerce
[0020]
[0021]
Intelligent Vehicle
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037] FIG. 3U1 illustrates an embodiment of a standalone computational camera 1. FIG. 3U2 illustrates another embodiment of a standalone computational camera 2. FIG. 3U3 illustrates another embodiment of a standalone computational camera 3. FIG. 3U4 illustrates an embodiment of a high power (wavelength) tunable pulsed laser module (HP-TP-LM). FIG. 3U5 illustrates another embodiment of a high power (wavelength) tunable pulsed laser module (HP-TP-LM).
[0038] FIG. 3V1 illustrates an embodiment combining the low-noise silicon single photon avalanche multiplication with the infrared wavelength detection/absorption of a thick germanium (Ge) layer.
[0039] FIG. 3V2 illustrates a two dimensional array of single photon avalanche diodes (SPADs) in fully parallel processing.
[0040] FIG. 3V3.1 illustrates integration of an image sensor (based on single photon avalanche diodes (SPADs)-including single photon avalanche diodes fabricated/constructed on indium phosphide or germanium-on-silicon (GeSi) material) with a complementary metal-oxide-semiconductor (CMOS) integrated circuit (of control and read-out electronics). FIG. 3V3.2 illustrates integration of an image sensor (based on single photon avalanche diodes-including single photon avalanche diodes fabricated/constructed on indium phosphide or germanium-on-silicon material) with a complementary metal-oxide-semiconductor integrated circuit (of control and read-out electronics) plus a two-dimensional/three-dimensional (3-D) array of memristors/a two-dimensional/three-dimensional network of memristors. FIG. 3V3.3 illustrates integration of an image sensor (based on single photon avalanche diodes-including single photon avalanche diodes fabricated/constructed on indium phosphide or germanium-on-silicon material) with a complementary metal-oxide-semiconductor integrated circuit (of control and read-out electronics) plus the Super System on Chip. This enables an intelligent three-dimensional imaging pixel without utilizing bump bonding package. Typically, single photon avalanche diodes can be a two-dimensional array of 3232 at about 100 microns center-to-center pitch to reduce optical cross-talk. The active area of each single photon avalanche diode can be about 15-20 microns in diameter.
[0041] It should be noted that memristors can be replaced by super memristors. Each super memristor can include (i) a resistor, (ii) a capacitor and (iii) a phase transition/phase change material based memristor. A phase transition material based memristor can be electrically and/or optically controlled. But a phase change material based memristor can be electrically or optically controlled. A super memristor can generally mimic a set of neural activities (such as simple spikes, bursts of spikes and self-sustained oscillations with a DC voltage as an input signal)which can be used for a neuromorphic/neural processing/computing architecture. Furthermore, each super memristor can be electrically/optically controlled.
[0042] Furthermore, to enhance sensitivity built-in optical pre-amplification, a vertical cavity semiconductor optical amplifier (VCSOA) or a semiconductor optical amplifier with an optical waveguide can be integrated with each avalanche photodiode (PD). This configuration can eliminate any need to place an array of microlens in front of the two-dimensional array of avalanche photodiodes. However, an array of microlens in front of the two-dimensional array of single photon avalanche diodes may be needed. Such an array of microlens can be monolithically integrated, using gallium phosphide (GaP) layer with a material stack of the single photon avalanche diode. A photodiode can be considered as a diode that exhibits sensitivity to light, either by varying its electrical resistance like a photoresistor or by generating an electric potential in the manner of a photoelectric cell. But a photodetector can be considered as any device to detect electromagnetic radiation.
[0043] Three-dimensional imaging pixels/intelligent three-dimensional imaging pixels may offer higher image quality. However, germanium-on-silicon material based single photon avalanche diodes or avalanche photodiodes (APDs) offer fabrication and vertical monolithic integration simplicity of the intelligent three-dimensional imaging pixels consisting of single photon avalanche diodes/avalanche photodiodes, control and readout integrated circuit, microprocessor and memristors. It should be noted that memristors can be replaced by super memristors. Each super memristor can include (i) a resistor, (ii) a capacitor and (iii) a phase transition/phase change material based memristor. A phase transition material based memristor can be electrically and/or optically controlled. But a phase change material based memristor can be electrically or optically controlled. Furthermore, each super memristor can be electrically/optically controlled.
[0044] The microprocessor and memristors combination may enable a neural processor. Generally, memristors are electrically controlled. But memristors based on a phase transition/phase change material can be optically controlled. It should be noted that memristors can be replaced by super memristors. Each super memristor can include (i) a resistor, (ii) a capacitor and (iii) a phase transition/phase change material based memristor. A phase transition material based memristor can be electrically and/or optically controlled. But a phase change material based memristor can be electrically or optically controlled. Furthermore, each super memristor can be electrically/optically controlled.
[0045] The above embodiment of single photon avalanche diodes can apply to the intelligent three-dimensional imaging (avalanche photodiodes) pixels consisting of avalanche photodiodes, readout integrated circuit, microprocessor and memristors. It should be noted that memristors can be replaced by super memristors. Each super memristor can include (i) a resistor, (ii) a capacitor and (iii) a phase transition/phase change material based memristor. A phase transition material based memristor can be electrically and/or optically controlled. But a phase change material based memristor can be electrically or optically controlled. Furthermore, each super memristor can be electrically/optically controlled.
[0046] Alternative to monolithic integration, two wafers-one of single photon avalanche diodes/avalanche photodiodes and another one of microprocessor and memristors can be bonded utilizing direct bonding of an array of metal (e.g., copper/nickel) posts (each metal post is 5 microns in diameter) and metal landing pads (each metal landing pad is 10 microns in diameter) (buried in bonding oxide) on each wafer and subsequent annealing. Annealing allows each metal post on one wafer to fuse with the corresponding metal landing pad on another wafer.
[0047] It should be noted that memristors can be replaced by super memristors. Each super memristor can include (i) a resistor, (ii) a capacitor and (iii) a phase transition/phase change material based memristor.
[0048] A phase transition material based memristor can be electrically and/or optically controlled. But a phase change material based memristor can be electrically or optically controlled. Furthermore, each super memristor can be electrically/optically controlled.
[0049] FIGS. 3W1-3W4 illustrate four (4) embodiments of packaging of a computational camera.
[0050] FIG. 3W5 illustrates an embodiment of flip chip mounting a pulsed laser of a computational camera, wherein n-metal contact is fabricated/constructed by metallized via hole(s).
[0051] FIG. 3W6 illustrates an embodiment of flip chip mounting an array of pulsed lasers of a computational camera, wherein n-metal contact is fabricated/constructed by metallized via hole(s).
[0052] FIGS. 3X1-3X10 illustrate ten (10) embodiments of an integrated detection and ranging subsystem on multilayer of polymer/spin-on-glass (SOG) on a substrate (e.g., silicon on insulator (SOI)), utilizing a three-dimensional photonic integrated circuit (PIC) based optical phased array (OPA).
[0053] FIGS. 3Y1-3Y2 illustrate two (2) embodiments for ultrafast laser beam steering (with two different pulsed lasers), utilizing a metamaterial surface.
[0054]
[0055]
Photovoltaic & Artificial Photosynthesis Module
[0056]
[0057]
[0058]
[0059]
Secure Payment System
[0060]
[0061]
[0062]
[0063]
[0064]
[0065]
Object
[0066]
Bioobject
[0067]
[0068]
Intelligent Portable Internet Appliance
[0069]
Super System On Chip
[0070]
[0071]
[0072]
[0073]
[0074]
[0075]
[0076]
[0077]
[0078]
Packaging Of Super System On Chip.
[0079]
[0080]
[0081]
[0082]
[0083]
[0084]
Optical Interconnections Of Multiple Super System On Chips
[0085]
[0086]
[0087]
[0088]
[0089]
[0090]
[0091]
[0092]
[0093]
[0094]
[0095]
Ultrahigh Density Storage Device
[0096]
[0097]
[0098]
[0099]
[0100]
[0101]
[0102]
[0103]
[0104]
[0105]
[0106]
[0107]
[0108]
[0109]
[0110]
[0111]
[0112]
[0113]
[0114]
[0115]
[0116]
[0117]
[0118]
[0119]
[0120]
[0121]
[0122]
[0123]
[0124]
Microprojector
[0125]
[0126]
[0127]
[0128]
Point-Of-Care Diagnostics
[0129]
[0130]
Wearable Personal Health Assistant Device
[0131]
[0132]
[0133]
[0134]
[0135]
[0136]
[0137]
[0138]
[0139]
[0140]
[0141]
Diagnostic System
[0142]
[0143]
[0144]
[0145]
[0146]
Micro/Nano Three-Dimensional Printer
[0147]
Personal (Human) Operating System
[0148]
[0149]
[0150]
Large Scale Network Of Coupling (Electro-Optical/Optical) Of Light Signal (Activated By Weighted Electrical Signals From Neural Processing Hardware Elements) With Qubits
[0151]
[0152]
[0153]
[0154]
[0155]
[0156]
[0157]
Integration/Coupling Of (Above) Coupled Qubits (M/N/T) With Super System On Chip/Photonic Neural Learning Processor
[0158]
[0159]
[0160]
DETAILED DESCRIPTION OF THE DRAWINGS
[0161]
[0162] Additionally, the internet (including the semantic internet and/or the quantum internet) includes a learning algorithm/quantum learning algorithm. A learning algorithm/quantum learning algorithm (including deep learning/meta-learning and self-learning) combines multiple nonlinear processing layers, using simple elements operating in parallel and inspired by biological nervous systems. It consists of an input layer, several hidden layers and an output layer. The layers are interconnected via neuron like nodes, with each hidden layer using the output of the previous layer as its input.
[0163] Biometric Security Implementation (e.g., Fingerprint, Voice Print, Facial Recognition, Iris Scan), Hardware Authentication (e.g., baking authentication into the user's hardware. Downloading an app onto the user's phone and then verifying the phone's Bluetooth signal to verify the user's computer location with respect to Bluetooth signal) and Data Encryption (e.g., encryption keys with public/private key infrastructure can be Lattice based or Multivariate based or Hash based or Coding based or never repeating pattern and they are generally quantum computing resistant cryptography) can be included with the internet (including the semantic internet and/or the quantum internet).
[0164] The internet (including the semantic internet and/or the quantum internet) is coupled with a public/consortium/private blockchain.
[0165] A blockchain does not have a single point of failure. Furthermore, with a blockchain technology, data can be stored in a decentralized and distributed manner. Instead of residing at a single location, data can be stored in an open source distributed ledger. To make updates to a particular piece of data, the owners of that data must add a new block of the data on top of the previous block of the data, creating a specific chain or sequence of codes. Thus, every single alteration or change to any piece of data is tracked and no data is lost or deleted because participants in blockchain can always look at previous versions of a block to identify what is different in the latest version. This distributed record-keeping can detect blocks that have incorrect or false data, preventing loss, damage and corruption. Thus, it renders mass data hacking or data tampering much more difficult, because all participants in the blockchain (network) can see that the ledger had altered in some way in real time/near real time. Thus, a blockchain can enable security of sensitive information.
[0166] With regards to data immutability, it is important to consider how a blockchain can fit side by side with the data privacy lawsthe right to be forgotten in a blockchain technology, wherein the blockchain technology guarantees that nothing will be erased is a challenge, but there are at least two (2) solutions. One solution is to encrypt the personal information written in the system to ensure that, when the time comes, forgetting the keys will ensure that sensitive information is no longer accessible. Another solution is to focus on the value of blockchain to provide unalterable evidence by writing the hash of transactions to it, while the transactions themselves can be stored outside of the system. This maintains the integrity of transactions, while enabling the ability to erase the transactions, leaving only traces of forgotten information in the blockchain.
[0167] Additionally, a learning algorithm/quantum learning algorithm (including deep learning/meta-learning and self-learning) can be coupled/integrated with a topological data analysis (TDA) or a clustering algorithm to analyze a massive set of data (e.g., Big Data). Topological data analysis is an approach to the analysis of a large volume of data, utilizing techniques from topology (e.g., shape of datasets). Topological data analysis can enable the geometric features of a large volume of data, utilizing topology Extraction of information from a large volume of data that is high-dimensional, incomplete and noisy is generally challenging. But topological data analysis provides a general framework to analyze a large volume of data in a manner that is insensitive to the metric chosen and provides dimensionality reduction and robustness to noise. One of the advantages of topological analysis is the low dimensional representation of higher dimensional connectivity.
[0168] The internet (including the semantic internet and/or the quantum internet) includes a built-in search engine and personal data storage.
[0169] The World Wide Web is made with computers but for people. The websites use natural language, images and page layout to present information in a way that is easy for a user to understand, but the computers themselves really can't make sense of any information and cannot read relationships or make decisions like people can. The semantic internet can help computers read and use the web. Metadata added to web pages can make the existing World Wide Web machine readable, so computers can perform more of the tedious work involved in finding, combining and acting upon information on the web.
[0170] The intelligent algorithm 100 is on a cloud server. The cloud server includes a Super System on Chip 400A/400B/400C/400D. The Super System on Chip 400A/400B/400C/400D can include one or more digital processors, one or more memristors and one or more memory components. The Super System on Chip 400A/400B/400C/400D can further electrically couple with a digital storage device, additional memory components and a media server and they can be managed by an embedded operating system algorithm. The cloud server can be connected with a cloud expert system and a cloud quantum computer expert system. It should be noted that memristors can be replaced by super memristors. Each super memristor can include (i) a resistor, (ii) a capacitor and (iii) a phase transition/phase change material based memristor. A phase transition material based memristor can be electrically and/or optically controlled. But a phase change material based memristor can be electrically or optically controlled. Furthermore, each super memristor can be electrically/optically controlled.
[0171]
[0172] It should be noted that a neural network may be considered as a multi-layer perception, wherein each synapse learns a number named a weight and each neuron applies a mathematical function to a sum of its inputs. But in Kolmogorov-Arnold based neural network architecture (KANN) each synapse learns a function and the neurons sum the outputs of these functions. Kolmogorov-Arnold based neural network architecture places learnable activation functions along the edges and the nodes sum it up, as opposed to fixed activation functions on the nodes in a traditional neural network/multi-layer perception.
[0173] The fusion of a neural network algorithm and fuzzy logic algorithm is neuro-fuzzy-which can enable both learning as well as approximation of uncertainties. The neuro-fuzzy algorithm can use fuzzy inference engine (with fuzzy rules) for modeling uncertainties, which is further enhanced through learning the various situations with a radial basis function. The radial basis function consists of an input layer, a hidden layer and an output layer with an activation function of hidden units. A normalized radial basis function with unequal widths and equal heights can be written as:
X is the input vector, uil is the center of the ith hidden node (i=1, . . . , 12) that is associated with the lth (l=1,2) input vector, i is a common width of the ith hidden node in the layer and softmax (hi) is the output vector of the ith hidden node. The radial basis activation function is the softmax activation function. First, the input data is used to determine the centers and the widths of the basis functions for each hidden node. Second, it is a procedure to find the output layer weights that minimizes a quadratic error between predicted values and target values. Mean square error can be defined as
[0174] The connections between various algorithm submodules of the intelligent algorithm 100 can be like synaptic networks to enable deep learning/meta-learning and self-learning of the intelligent algorithm 100.
[0175] For example, an autonomous artificial intelligence (AI) agent can plan a vacation with high accuracy rate on each step of a multistep process or very good error correction to get anything valuable out of an autonomous artificial intelligence agent that has to take lots of steps. This is contrary to standard artificial intelligence based processes that are run only when a user triggers them and only to accomplish a specific result and then standard artificial intelligence based processes stop. Characteristics of an autonomous artificial intelligence agent are (i) autonomy, (2) continuous learning and (3) reactive and proactive in an environment.
[0176] Furthermore, the intelligent algorithm 100 that may include (i) the artificial neural networks (including Kolmogorov-Arnold based neural network architecture and evolutionary algorithm based instructions), (ii) natural language processing and (iii) a collection of declarative knowledge (to enable common sense) to design an autonomous artificial intelligence agent.
[0177] An autonomous artificial intelligence agent is a set of computer implementable instructions (an algorithm) and it can have multimodal inputs via text, video and voice. It can analyze the collected data (e.g., from sensors/biosensors) to make informed decisions and take an action or a series of actions to achieve its goals.
[0178] Meta-learning can enable a machine to have some human-level mental agility. It may be useful for achieving machine intelligence at human-level.
[0179] Details of the digital security protection have been described/disclosed in U.S. non-provisional patent application Ser. No. 14/120,835 entitled CHEMICAL COMPOSITION & ITS DELIVERY FOR LOWERING THE RISKS OF ALZHEIMER'S, CARDIOVASCULAR AND TYPE-2 DIABETES DISEASES, filed on Jul. 1, 2014 and in its related U.S. non-provisional patent applications (with all benefit provisional patent applications) are incorporated in its entirety herein with this application.
[0180] Fuzzy means not clear (blurred). A fuzzy logic is a form of approximate reasoning, which can represent variation or imprecision in logic by making use of natural language (NL) in logic. The key idea of the fuzzy logic rule is that it uses a simple/easy way to secure the output(s) from the input(s), wherein the outputs can be related to the inputs by if-statements.
[0181] Fuzzy set theory is a generalization of the ordinary set theory. A fuzzy set is a set whose elements belong to the set with some degree of membership . Let X be a collection of objects. It is called the universe of discourse. A fuzzy set AX is characterized by membership function A(x), which represents the degree of membership, degree of membership maps each element between 0 and 1. It is defined as A={(x, .sub.A(x)); xX}.
[0182] In FIG. IC, crisp inputs are fed into a fuzzification interface. The fuzzification interface algorithm submodule is coupled with (a) a knowledge base and (b) a decision-making logic algorithm submodule. The decision-making logic algorithm submodule is coupled with a defuzzification interface algorithm submodule. The defuzzification interface algorithm submodule is coupled with a fuzzy logic decision flow chart. The defuzzification interface algorithm submodule creates crisp outputs.
[0183]
[0184]
[0185] The intelligent algorithm 100 can then recommend an actionable solution(s) to the user.
[0186] In another application, the intelligent portable internet appliance 160 and/or intelligent wearable augmented reality personal assistant device 180 can contain rich data of the user's activities, including who the user knows (phone/social networking contact lists), who the user talks to (logs of phone calls, texts and e-mails), where the user goes (global positioning system data, Wi-Fi logs, geotagged/bokodes tagged photos) and what the user does (indoor position system, apps he/she uses, payment he/she makes and accelerometer data). Utilizing the above rich data with the intelligent algorithm 100, personal predictive analytics (social graph) of the user can be built.
[0187] Bokodes are tiny barcodes which can encode binary data, the view angle and the distance of a viewer from a thing. A camera (e.g., a 180 degree viewing angle camera) positioned up to four meters away can capture and decode all information. Bokodes can give a robust estimate of geotagged photos.
[0188]
[0189] In
[0190] In
[0191]
[0192]
[0193] A hydrogen fuel cell can consist of two chambersin a first chamber magnesium hydride (MgH.sub.2) powder can chemically react with water (MgH.sub.2+2H.sub.2O=2H.sub.2+Mg(OH).sub.2 magnesium hydroxide) producing hydrogen gas and in a second chamber hydrogen gas can chemically react with oxygen (supplied by an inlet from air to generate electrical power.
[0194] Magnesium hydride powder can be bulk/microsized (microstructured) or nanosized (nanostructured). Magnesium hydride powder can be catalyzed with niobium and/or vanadium. Magnesium hydride powder can also be embedded onto a polymer matrix.
[0195] Alternatively, a powerful laser can fire pulses on a hydrogen capsule, developing a high pressure and high temperature condition. This can allow the tightly bound hydrogen atoms to breaktransforming hydrogen from its gaseous state to a shiny liquid state of metallic hydrogen.
[0196] Magnesium hydride can be replaced by a suitable metal hydride. Thus, an intelligent vehicle can be powered by hydrogen/metallic hydrogen.
[0197] Furthermore, the intelligent vehicle can be fabricated/constructed, utilizing graphene/graphene-like material with carbon-fiber reinforced epoxy resin, as the intelligent vehicle body's material and a curved display device.
[0198] Additionally, graphene/graphene-like material in the intelligent vehicle's body can be integrated/included with one or more ultracapacitors.
[0199] An ultracapacitor fabricated/constructed out of carbon (or graphene/graphene-like material or a mixture of graphene/graphene-like material and carbon nanotube or carbon nanorods) can be coated onto conductive plates, wherein the conductive plates are immersed in an electrolyte solution.
[0200] Furthermore, an ultracapacitor can include a surface active ionic liquid (SAIL). It should be noted that an ultracapacitor is also known as a supercapacitor.
[0201] It should be noted that a photovoltaic module can include a transparent photovoltaic module (e.g., utilizing quantum dots/nanostructured silicon material/silicon microwires/nanowires embedded in a transparent polymer (e.g., poly(dimethylsiloxane) (PDMS)).
[0202]
[0203] Furthermore, the above near real time/real time intention system can consist of multi-sensor (e.g., an imaging camera, a light detection and ranging subsystem, a millimeter wave radar and a computational camera) based perception (data inputs) and control loops. The sensor based perception (data inputs) and control loops can enable a calculated statistical uncertainty range/operational error band for the intelligent vehicle. Furthermore, such a calculated statistical uncertainty range/operational error band is again fed into the above near real time/real time intention system to recalculate a statistical uncertainty range/operational error band for the intelligent vehicle.
[0204] In addition to a machine learning (including artificial neural networks/deep learning/meta-learning and self-learning) algorithm based near real time/real time intention system, a machine learning algorithm can include computer implementable instructions based on a diffusion model or a transformer model.
[0205] In addition to a machine learning (including artificial neural networks/deep learning/meta-learning and self-learning) algorithm based near real time/real time intention system, a machine learning algorithm can include Poisson flow generative model++(PFGM++) or an evolutionary based algorithm (EA).
[0206] For example, such sensor based perception (data inputs) and control loops can estimate how much braking distance that the intelligent vehicle can tolerate to be in safe operational range in rain/fog/snow or sun glare or in traffic.
[0207] Furthermore, the above near real time/real time intention system can be coupled with a collision sensor (as a collision sensor is discussed in the later paragraphs).
[0208] The intelligent vehicle includes high efficiency photovoltaic modules, artificial photosynthesis modules, a battery/ultracapacitor, a hydrogen fuel cell, an array of millimeter wave radars, a light detection and ranging subsystem (e.g., frequency modulated continuous wave (or quasi-continuous in about microsecond pulse duration), optical phased array, a LTE-Direct radio, vehicle to vehicle (V2V) communication (or even vehicle to everything (V2X) communication), an augmented reality enhanced global positioning system (AR-GPS), an augmented reality enhanced indoor positioning system (AR-IPS), stereo cameras/thermal imaging cameras (e.g., a thermal imaging camera may include vanadium dioxide material (VO.sub.2) or nanostructured vanadium oxide)/video cameras (for day and night), a three-dimensional orientation video camera (e.g., a three-dimensional orientation 360 degree angle video camera for day and night), ultrasonic sensors and other sensors (e.g., an anti-lock braking system, anti-collision sensor system, passenger air bags and real time fuel consumption sensor).
[0209] It should be noted that a thermal imaging camera is typically operating in a wavelength range of about 8 microns to 14 microns. Such a thermal imaging camera does not require a light source and a shutter, rather it is a shutter less passive imaging camera, which may image an object in harsh weather/environmental conditionssuch as rain/fog/snow. Such a thermal imaging camera may not be located inside/behind a glass window.
[0210] But it may be necessary to include an imaging camera typically operating in a wavelength range of about 1.3 microns to 1.55 microns. Such an imaging camera may include an array of pixels (a pixel can be made of InP/InGaAsP/InGaAs material or a SiGe material or a pixel made of quantum dots) and a light source (e.g., a laser in a flash illumination). For high resolution imaging, such an imaging camera may require about 1.5 million pixels. Such an imaging camera can be operable/integrated with a Light Detection and Ranging device/computational camera sensor/display (various embodiments of display have been described/disclosed in the later paragraphs). Generally, a display substrate is glass. An imaging camera typically operating in a wavelength range of about 1.3 microns to 1.55 microns can utilize SiGe/polycrystalline SiGe. However, polycrystalline SiGe may utilize an isothermal annealing process at temperatures between 500 C. and 540 C. of co-sputtered Si+Ge on a glass substrate.
[0211] As used in these disclosed specifications, a computational camera sensor is generally equivalent to a Light Detection and Ranging device in practice. However, a video camera/computational camera sensor/Light Detection and Ranging device can include/integrate a hyperspectral imager system for accurate object identification in day and night (as discussed in the later paragraph).
[0212] Furthermore, the hyperspectral imager system can be communicatively interfaced with (i) a first set of computer implementable instructions in artificial intelligence or machine learning or deep learning and/or (ii) a second set of computer implementable instructions in computer vision or Vision Transformer (ViT), wherein the first set of computer implementable instructions and the second set of computer implementable instructions may be stored in a local non-transitory storage media locally or on a cloud based non-transitory storage media.
[0213] Additionally, the communication network of the intelligent vehicle can be coupled with a large scale network of memristors (or memory resistors, wherein each memory resistor switch can remember its state of resistance based on its history of applied voltage and/or current). It should be noted that the battery can include a double-walled silicon nanotube (covered by an ion-permeable thin layer of silicon oxide) as an anode.
[0214] It should be noted that memristors can be replaced by super memristors. Each super memristor can include (i) a resistor, (ii) a capacitor and (iii) a phase transition/phase change material based memristor. A phase transition material based memristor can be electrically and/or optically controlled. But a phase change material based memristor can be electrically or optically controlled. Furthermore, each super memristor can be electrically/optically controlled.
[0215] Furthermore, the augmented reality enhanced global positioning system and the augmented reality enhanced indoor positioning system can be replaced by an augmented reality enhanced hyper accurate positioning (HAP) system.
[0216] The outputs of a large scale network of memristors are extremely difficult to predict based on various inputs-making it secures from external cyber cloning/hacking.
[0217] Additionally, the array of camera pixels of the video camera or the three-dimensional orientation video camera can be coupled with an array of photovoltaic (PV) cells and/or an array of display pixels.
[0218] The light detection and ranging technology subsystem can be coupled or integrated with the millimeter-wave chipset to communicate at a speed higher than 5G.
[0219] The light detection and ranging technology subsystem generally does not work well in harsh weather/environmental conditionssuch as rain/fog/snow. But the millimeter wave radar (e.g., about 75 to 110 GHz range) utilizing silicon-germanium (SiGe) or radio frequency (RF) complementary metal oxide semiconductor (RF-CMOS) process technology may be relatively unaffected by any weather condition (including harsh weather/environmental conditionssuch as rain/fog/snow). The millimeter wave radar can be included with a ground penetrating radar sensor.
[0220] Furthermore, one or more 79-140 GHz high resolution (based on Synthetic Aperture Radar's principle) radars can also be utilized. The range of each high resolution radar can be enhanced by multiple inputs-single output (MISO) sensors or multiple inputs-multiple outputs (MIMO) sensors arranged in a circular manner or frequency modulated continuous wave signal, wherein the frequency modulated continuous wave signal is coupled with a large array of antennas. Furthermore, 79-140 GHz high resolution radar can be either analog or digital and capable of beamforming and beam steering.
[0221] Metamaterials can be fabricated/constructed with an artificial periodic structure. It is the configurations of these periodic structures that result in unnatural material characteristics, including the modification of a material's electrical permittivity () and magnetic permeability (). By designing the configuration of the periodic structures, the dispersion, refraction and reflection of an electromagnetic wave can be controlled.
[0222] As illustrated in
[0223] A pixel (a unit cell of the metamaterial surface) of a plasmonic metasurface for laser beam steering can include (i) a gold nanoantenna, (ii) a thin insulating oxide and (iii) a thin-film (1 to 20 nanometers) transparent metal (e.g., indium tin oxide). By applying a voltage to the gold nanoantenna, a carrier density perturbation is induced in the transparent metal, thus producing a perturbed refractive index (variation) within thin-film (1 to 20 nanometers) transparent metal and steering of the laser beam, utilizing control of amplitude and phase of the laser beam. However, the thin-film (1 to 20 nanometers) transparent metal can be replaced by a phase transitional material (e.g., vanadium dioxide).
[0224] Alternatively, a metasurface can include an array of Mie-Type resonators made of silicon patterned with Cr/Au gold interdigitated electrodes around the Mie-Type resonators and then selectively patterned with a phase change material (e.g., Ge.sub.2Sb.sub.2Te.sub.5 (GST) or GeSbSeTe (GSST)) or Sb.sub.2S.sub.3 (antimony trisulfide) or Sb.sub.2Se.sub.3 (antimony triselenide)) on a suitable substrate (e.g., silicon on insulator).
[0225] Additionally, the millimeter wave radar or high resolution radar (based on Synthetic Aperture Radar's principle) or high resolution radar (based on Synthetic Aperture Radar's principle) with a metamaterial/metamaterial based antenna can be capable to penetrate ground in all weather conditions. The millimeter wave radar can be included with a ground penetrating radar sensor.
[0226] By sending electromagnetic pulses (e.g., very high frequency (VHF)) up to 10 feet below the ground and detecting the reflected electromagnetic pulses bouncing off from dirt, rocks and snow, a near real time/real time three-dimensional roadmap coupled with a global positioning system/an augmented reality enhanced global positioning system can be constructed. The near real time/real time three-dimensional map can be coupled or integrated with the Super System on Chip 400A/400B/400C/400D and/or the artificial eye.
[0227] Furthermore, the Super System on Chip 400A/400B/400C/400D and/or the artificial eye can be coupled with a computer vision algorithm and/or an artificial intelligence algorithm and/or an artificial neural network algorithm and/or a machine learning (including artificial neural networks/deep learning/meta-learning and self-learning) algorithm for ultrafast data processing, image processing/image recognition, deep learning/meta-learning and self-learning.
[0228] The Super System on Chip 400A/400B/400C/400D and/or the artificial eye can be coupled with a hardware security component (HSC). The hardware security component can encrypt communication and prevent the spread of malicious/manipulated software code. It can also secure boot and check that software is authentic, trusted and unaltered.
[0229] The hardware security component can be coupled with a physical un-clonable function device (PUFD) to reduce any risk of cyber security, wherein the physical un-clonable function device includes a two-dimensional (crossbar) array of memristors. It should be noted that memristors can be replaced by super memristors. Each super memristor can include (i) a resistor, (ii) a capacitor and (iii) a phase transition/phase change material based memristor. A phase transition material based memristor can be electrically and/or optically controlled. But a phase change material based memristor can be electrically or optically controlled. Furthermore, each super memristor can be electrically/optically controlled.
[0230] In some light detection and ranging applications, a 905 nanometers laser and a corresponding wavelength photodiode are proper. However, 1550 nanometers or higher wavelength (e.g., 2000 nanometers) is eye safe. For example, a time-of-flight direct flashlight detection and ranging subsystem can be realized by (a) a high power superluminescent diode (SLD) or a high power edge emitting/surface emitting laser, (b) a collimating lens, (c) a two-dimensional array of bandpass optical filters for incident wavelength, (d) a two-dimensional array of image sensors for incident wavelength and (e) a Light-to-Distance System on Chip (L-D SoC). The details of a Light-to-Distance System on Chip have been described/disclosed in the later paragraphs.
[0231] Alternatively, a three-dimensional light detection and ranging subsystem can be realized by utilizing an array of lasers at about 250 microns center-to-center spacing (wherein the outputs from the array of lasers (e.g., broad area lasers or an oscillator-thyristor devices are simultaneously activated by an array of gallium nitride (GaN) field effect transistors (FETs) based integrated circuits (ICs)) are collimated by (a) a fast axis collimating lens, (b) followed by an optical beam folder/twister to fold the outputs from the array of laser, (c) followed by a fast axis collimating lens and (d) finally an optical beam shaper/expander) and a large array of photodetectors (e.g., 128128 avalanche photodiodes).
[0232] An optical beam folder/twister can include mirrors or prisms to fold a rectangular composite output from an array of lasers into a square composite output from an array of lasers.
[0233] It should be noted a proper thermal management is required to manage the heat load from simultaneously activated array of lasers. Various schemes of thermal management have been described/disclosed in the later paragraphs.
[0234] For example, a scanning light detection and ranging subsystem can be realized by coupling (a) a high power pulsed fiber laser or a master oscillator (e.g., a distributed feedback laser (DFB))-integrated with a single pass tapered power amplifier (T-PA) (MOPA), (b) a collimating lens, (c) a wide angle three-dimensional scanner or a one-dimensional (1-D)/two-dimensional array of scanning mirrors (e.g., a digital mirror device (DMD) manufactured by Texas Instrument), (d) an one/two-dimensional array of bandpass optical filters for incident wavelength, (e) a one-dimensional (e.g., 132)/two-dimensional array of avalanche photodetectors (e.g., each photodiode has an active area of about 100 microns) for incident wavelength and (f) a Light-to-Distance System on Chip. A master oscillator-power amplifier can be integrated on a single chip and it can also include an integrated optical mode converter.
[0235] Instead of the wide angle three-dimensional scanner or a one-dimensional/two-dimensional array of scanning mirrors, a single surface emitting photonic crystal (PC) (pulsed) laser or a two-dimensional array of surface emitting photonic crystal (E-PC) (pulsed) lasers, wherein each surface emitting photonic crystal (pulsed) laser can provide a pulse in nanoseconds or in sub-nanoseconds. In this configuration, photonic crystals are electrically controlled by multiple electrodes.
[0236] Furthermore, the high power laser diode can be wavelength specific to filter out background stray light.
[0237] A high power (1000 watts) master oscillator-power amplifier based short pulse fiber laser includes (a) a 980 nanometers pump laser module, (b) a master oscillator-power amplifier module and (c) an actively doped fiber.
[0238] Alternatively, a high power short, pulsed laser can be based on chirped pulse amplification (CPA), wherein a short laser pulse is expanded to larger pulse width, amplified at intensities that are below the amplifier damage threshold and compressed in air or vacuum to a narrow pulse width.
[0239] A master oscillator-power amplifier can include gratings (e.g., distributed Bragg gratings).
[0240] Furthermore, a master oscillator-power amplifier can include a modulator (e.g., phase/intensity/frequency) for accurate ranging. Also, multiple power amplifiers can be coherently combined for higher (exit) optical power.
[0241] An integrated master oscillator-power amplifier based high power laser can include gratings (e.g., about 1 mm in length and 5 microns in width) at the back of the oscillator (e.g., about 1 mm in length), wherein the front/output end of the oscillator can be followed by a 7 degree angle electrically coupled/pumped separator (e.g., about 1 mm in length). The electrically coupled/pumped separator is then followed by a tilted (e.g., about 7 degree angle) and tapered (e.g., 4 to 5 degree angle) power amplifier (e.g., about 4 to 5 mm in length and 500 microns in width). Duty cycle and etch depth of the gratings can be optimized for the proper output laser beam quality and interaction between the gratings and the power amplifier.
[0242] It should be noted that optical cross-talk between an oscillator and an amplifier is a critical aspect of the integrated master oscillator-power amplifier design.
[0243] Duty cycle and etch depth of the gratings can be optimized for the proper output laser beam quality and interaction between the gratings and the power amplifier.
[0244] Alternatively, in some applications, the electrically coupled/pumped separator can be eliminated.
[0245] Alternatively, an oscillator (e.g., a seed laser including an N-i-P) can be coupled/electro-optically coupled with a thyristor current switch (e.g., including an N-p-N transistor-a current pulse generator) within an epitaxially grown vertical heterostructure.
[0246] An oscillator-thyristor vertical heterostructure enables two stable statesturned ON (low resistance) and turned OFF (high resistance). In this case, the feedback is provided by nonlinear optical feedback.
[0247] When a control pulse is applied, the current flows through an oscillator section, spontaneous emission can be partially absorbed in the base region; photogenerated carriers activate impact ionization in the reversed biased collector junction/base.
[0248] Accumulation of nonequilibrium holes in the collector junction/base turns ON oscillator-thyristor vertical heterostructure, the current flows due to the discharge of an external capacitor connected in parallel to an oscillator-thyristor vertical heterostructure. The current pulse flowing through an oscillator-thyristor vertical heterostructure turns ON an oscillator.
[0249] Turning OFF an oscillator-thyristor vertical heterostructure can occur due to the discharge of an external capacitor connected in parallel to an oscillator-thyristor vertical heterostructure, as the pulse current falls below the hold ON current.
[0250] For example, a non-mechanically moving light detection and ranging subsystem can be realized by coupling (a) a high power narrow linewidth (less than 200 Hz) frequency modulated laser (e.g., a distributed feedback laser integrated with a single pass power amplifier), (b) a first lN ultrafast optical switch for transmission, (c) an array of N 3-port optical circulators, (d) an array of N beam collimating lenses, (e) a second lN ultrafast optical switch for reception, (f) an array of N balanced photodetectors (BPDs) and (g) a Light-to-Distance System on Chip.
[0251] A photodetector is generally a photodiode coupled with a transimpedance amplifier (TIA). In a simple form, a balanced photodetector can use two photodiodes connected in series, so that their photocurrents cancel each other when they are equal. The difference in photocurrents can be coupled with a transimpedance amplifier, which can produce an output voltage proportional to the difference. For example, two light beams can be obtained via a beam splitter between a light source and a target. Any intensity noise of the light source can be canceled out with a balanced detection scheme with an improved signal-to-noise ratio (SNR). Such cancellation is known as common mode rejection. Such cancellation can be generally achieved in 50 dB or more.
[0252] This non-mechanically moving light detection and ranging subsystem can be considered as a frequency modulated continuous (or quasi-continuous) wave light detection and ranging subsystem. In this case, the frequency of the laser is ramped linearly in time and the time delay associated with the round trip time to the target produces a beat signal with the frequency proportional to range. Up-down frequency ramps can be used to unambiguously distinguish both target range and target velocity.
[0253] For example, an optical phased array based light detection and ranging chip can be fabricated/constructed as a photonic integrated circuit, integrating (a) a low relative intensity noise (RIN), mod-hop free, ultra-narrow linewidth (less than 50 Hz), wavelength tunable high power 1550 nanometers laser, (b) a low-loss optical waveguide, (c) a semiconductor optical (pre) amplifier/erbium doped optical waveguide based (pre) amplifier, (d) a lN optical power splitter (or a star (optical) coupler), (e) lM multimode interference (optical) coupler (MMI), (f) an array of thermal/electro-optic phase shifters, (g) an array of semiconductor optical (post) amplifiers/erbium doped optical waveguide based (post) amplifiers for optical power equalization, (h) an array of vertical grating (e.g., second-order gratings) (optical) couplers to direct the phased laser beams toward the direction of a target, (i) a graded index lens/diffractive optical elements (DOE), (j) an array of optical waveguide (e.g., germanium waveguide) photodiodes and (k) a Light-to-Distance System on Chip.
[0254] It should be noted that vertical grating (optical) couplers are special purpose grating (optical) couplers.
[0255] The optical phased array can be thermal-optical or liquid crystal (LC) based/liquid crystal optical waveguide based.
[0256] Alternatively, many passive optical components can be fabricated/constructed utilizing silicon on insulator/silicon on silicon nitride substrate and then can be co-packaged with active components (e.g., lasers, semiconductor optical amplifiers and photodiodes).
[0257] Alternatively, an array (one-dimension/two-dimension) of vertical grating (optical) couplers can be replaced by an array (one-dimensional/two-dimensional) of nanoscaled passive antennas (e.g., V-shaped/Yagi-Uda) to direct the laser beams toward a target direction, wherein the nanoscaled antennas are evanescently coupled to an underlying optical waveguide, which is guiding and distributing the laser beam.
[0258] An array of emitters at spacing is larger than /2, with as the wavelength of the optical field in the medium of propagation can create side lobes. Thus, each emitter with an enormously decreased footprint and spacing (e.g., plasmonic/nanoscaled antennas) may be required to eliminate unwanted side lobes. It is desirable to have the maximum dimension of the nanoscaled antenna between 2 nanometers to 1000 nanometers.
[0259] A non-uniform spacing of the emitters may be used to suppress unwanted side lobes.
[0260] Alternatively, an array (one-dimension/two-dimension) of vertical grating (optical) couplers can be replaced by an array (one-dimension/two-dimension) of actively controlled nanoscaled antennas (e.g., actively controlled nanoscaled antennas of vanadium dioxide) to direct the laser beams toward a target direction, wherein the actively controlled nanoscaled antennas are evanescently coupled to an underlying optical waveguide, which is guiding and distributing the laser beam.
[0261] To achieve coherent emitters, a 10-element array of vanadium dioxide slot nanoantennas (e.g., about 30 nanometers wide, about 300 nanometers long at 100 nanometers spacing) may be fed by a single narrow linewidth laser via a multimode interference coupler (or by an array of phase locked/injection locked narrow linewidth lasers). A 10-element array of vanadium dioxide slot nanoantennas can enable about 20 angle. Vertical stacked layers (separated by silicon dioxide thin-film(s)/polymer layer(s)) of a 10-element array of vanadium dioxide slot nanoantennas can be coupled with a narrow linewidth laser and this configuration can enable about 20 angle in horizontal axis and vertical axis to enable three-dimensional optical phased array. Furthermore, an individual vanadium dioxide slot nanoantenna can be electrically controlled (e.g., about 10 nanoseconds switching time) by via metal electrodes/transparent graphene nanoheaters, coupled through metallized via holes.
[0262] Alternatively, an individual vanadium dioxide slot nanoantenna can be optically controlled (e.g., about 1 nanosecond switching time) by via optical waveguides and a laser (e.g., a 1550 nanometers laser).
[0263] Alternatively, an acoustic wave from a piezoelectric transducer can scatter (like gratings) a guided laser light in an optical waveguide enabling a photonic-phononic waveguide based optomechanical antenna (OMA) or optoacoustical antenna (OAA). An array of these optomechanical antennas or optoacoustical antennas can steer a laser beam in two-dimensions.
[0264] Generally, a Light-to-Distance System on Chip can include (a) a supply clock circuit, (b) a timing sequencer circuit, (c) a control circuit of 1550 nanometers laser(s), (d) a synchronization circuit of 1550 nanometers laser(s), (e) an analog signal conditioner circuit, (f) an analog-to-digital conversion circuit, (g) a time-to-digital conversion circuit, (h) a first (general) signal processing circuit, (i) a second (specific) signal processing circuit to determine distance output and (j) a diagnostic circuit.
[0265] Frequency change can be utilized to calculate velocity of an object. Similarly, a Light-to-Distance/Velocity System on Chip (L-D/V SoC) can include (a) a supply clock circuit, (b) a timing sequencer circuit, (c) a control circuit of 1550 nanometers laser(s), (d) a synchronization circuit of 1550 nanometers laser(s), (e) an analog signal conditioner circuit, (f) an analog-to-digital conversion circuit, (g) a time-to-digital conversion circuit, (h) a first (general) signal processing circuit, (i) a second (specific) signal processing circuit to determine distance output, (j) a third (specific) signal processing circuit to determine velocity output and (k) a diagnostic circuit.
[0266] To reduce glare of two front head lights (similarly two back lights) from the intelligent vehicle, each head light can include a light source (e.g., a laser/light emitting diode/microlight emitting diode) and/or a digital mirror device (e.g., Texas Instrument's DLP5531-Q1), wherein the digital mirror device can be programmed to project light on the road, not anywhere else or an array of microlight emitting diodes (e.g.,
[0267] The light detection and ranging subsystem and/or high resolution radar and/or metamaterial (based) high resolution radar can be coupled with a gyro sensor (for stability), a global positioning system (GPS), an augmented reality enhanced global positioning system, an augmented reality enhanced indoor positioning system and a hyper accurate positioning system.
[0268] Tracking a moving target is a computationally intensive process that can take seconds, making the technology unreliable for avoiding impending collisions, without the integration of the Super System on Chip 400A/400B/400C/400D for ultrafast data processing, image processing/image recognition, deep learning/meta-learning and self-learning.
[0269] The light detection and ranging subsystem and/or high resolution radar and/or metamaterial (based) high resolution radar can be integrated with a digital signal processor.
[0270] The light detection and ranging subsystem and/or high resolution radar and/or metamaterial (based) high resolution radar can be coupled or integrated with the Super System on Chip 400A/400B/400C/400D and/or the artificial eye. The Super System on Chip 400A/400B/400C/400D can enable ultrafast data processing, image processing/image recognition, deep learning/meta-learning and self-learning.
[0271] Furthermore, the Super System on Chip 400A/400B/400C/400D and/or the artificial eye can be coupled with a computer vision algorithm and/or an artificial intelligence algorithm and/or an artificial neural network algorithm and/or a machine learning (including artificial neural networks/deep learning/meta-learning and self-learning) algorithm for ultrafast data processing, image processing/image recognition, deep learning/meta-learning and self-learning. For example, the artificial eye can be fabricated/constructed utilizing a very large scale integration of the atomic scaled switches. Photocurrent is induced in a photoconductive layer (which is coupled between a metal electrode and a solid-electrolyte electrode) by light irradiation. The photocurrent reduces metal ions with positive charges in the solid-electrolyte electrode and this precipitates as metal atoms to form an atomic scaled metal connection between the metal electrode and the solid-electrolyte electrode-operating as an atomic scaled switch, turned on by light irradiation and/or an applied electrical activation (e.g., voltage). Instead of a photoconducting layer, an array of (fast light) responsive photodiodes (e.g., made of graphene or tungsten diselenide or other suitable (fast light) responsive two-dimensional material) can be utilized also. It should be noted that an array of (fast light) responsive photodiodes coupled with phase transition material/phase change material (a phase transition material can be electrically and/or optically controlled. But a phase change material can be electrically or optically controlled) based switches can enable a fast responsive artificial eye. Generally, a phase transition material is a solid material, wherein its lattice structure can change from a particular solid crystalline form to another solid crystalline form, still remaining crystal-graphically solid. Generally, a phase change material is a material, wherein its phase can change from (i) a solid to liquid or (ii) an amorphous to crystalline or (iii) crystalline to amorphous.
[0272]
[0273] The Super System on Chip 400A/400B/400C/400D can enable ultrafast data processing, image processing/image recognition, deep learning/meta-learning and self-learning.
[0274] Alternatively, by creating more than 10 to 1,000 mini-circuits within a field programmable gate array (FPGA), effectively the field programmable gate array with or without traditional central processing units (CPU) can be turned into 10 or 1,000-core processors with each core processor working on its own instructions in parallel and such a configuration may be utilized instead of (or included with) the Super System on Chip 400A/400B/400C/400D.
[0275] Alternatively, a Bose-Einstein condensate based optical switch may be utilized instead of (or included with) the Super System on Chip 400A/400B/400C/400D. Furthermore, a microprocessor, an application specific integrated circuits (ASIC), a field programmable gate array can be included with the Super System on Chip 400A/400B/400C/400D. Additionally, a microprocessor including a two-dimensional material (e.g., tungsten disulfide or molybdenum disulfide) onto a silicon wafer can enable superior performance. For example, tin thin-film can be deposited onto molybdenum disulfide and then gold thin-film can be deposited onto tin thin-film for achieving an ohmic contact on molybdenum disulfide.
[0276] The near real time/real time structured and unstructured inputs from cameras, three-dimensional cameras, light detection and ranging subsystems, millimeter wave radars, high resolution radars, an augmented reality enhanced global positioning system, vehicle to vehicle communication, a LTE-Direct radio and sensor(s) can be correlated through a computer vision algorithm submodule, a pattern recognition algorithm submodule, a data mining algorithm submodule, Big Data analysis algorithm submodule, a statistical analysis algorithm submodule, a fuzzy logic (including neuro-fuzzy) algorithm submodule, an artificial neural network/artificial intelligence algorithm submodule, a machine learning (including artificial neural networks/deep learning/meta-learning and self-learning) algorithm submodule, a predictive analysis algorithm submodule, a software agent algorithm submodule and a natural language processing algorithm submodule to create an intention output (in natural language) in near real time/real time-thus, a pattern of actions of the intelligent vehicle can be predicted in the near real time/real time.
[0277] For example, the machine learning (including artificial neural networks/deep learning/meta-learning and self-learning) algorithm based near real time/real time intention system coupled with the Super System on Chip 400A/400B/400C/400D can be sensor-aware and/or context-aware (e.g., context-aware can be realized utilizing an artificial intelligence algorithm (integrating Generative Pre-trained Transformer 3 (GPT-3), an autoregressive language model) with ability to recognize its senses beyond computer vision and natural algorithm and it can alert the user (driver) of the intelligent vehicle about the intention of other users (drivers of other intelligent vehicles) in proximity.
[0278] Furthermore, the intelligent vehicle can anticipate the needs of its user/driver by utilizing an application (app) for example, as illustrated in FIG. 1A of U.S. Non-Provisional patent application Ser. No. 13/448,378 entitled SYSTEM AND METHOD FOR INTELLIGENT SOCIAL COMMERCE, filed on Apr. 16, 2012-creating a new subscription based business model. Thus, the intelligent vehicle can recommend a service/offer to a user (a driver) by anticipating the needs of the user and enable the service/offer in near real time.
[0279] The intelligent vehicle includes or couples with an intelligent subsystem, wherein the intelligent subsystem is sensor-aware and/or context-aware, wherein the intelligent subsystem is coupled by (i) a wireless/sensor network with an object 120A and an internet appliance and/or (ii) a biosensor network with a bioobject 120B, wherein the internet appliance includes a microprocessor/microcontroller and a radio transceiver, wherein the intelligent subsystem includes [0280] A radio transceiver/electromagnetic induction module/sensor module, [0281] An internet protocol address and an algorithm, wherein the algorithm is selected from group consisting only one of the following a user specified safety control algorithm, an authentication algorithm of the user, an in-situ diagnostics algorithm of the intelligent subsystem and a remote diagnostics algorithm of the intelligent subsystem, wherein the above algorithm includes a first set of computer implementable instructions, stored in a non-transitory media of the intelligent subsystem and [0282] A learning algorithm or an intelligence rendering algorithm (e.g., the social wallet 100N2/natural language activated/voice activated Fazila as described/illustrated in
[0283] The intelligent subsystem can provide an automatic search on the internet in response to the user's interest or preference (via inputs of voice/text commands).
[0284] It should be noted that the social wallet can be web based, as an application or as an electronic module (hardware) and the social wallet electronic module (hardware) can be realized as the intelligent subsystem.
[0285] Details of the social wallet (e.g., as an application in FIG. 1A of U.S. non-provisional patent application Ser. No. 13/448,378 or as an electronic module (hardware)) have been described/disclosed in U.S. non-provisional patent application Ser. No. 13/448,378 entitled SYSTEM AND METHOD FOR INTELLIGENT SOCIAL COMMERCE, filed on Apr. 16, 2012 and in its related U.S. non-provisional patent applications (with all benefit provisional patent applications) are incorporated in its entirety herein with this application.
[0286] Details of an intelligent subsystem have been described/disclosed in U.S. non-provisional patent application Ser. No. 14/014,239 entitled DYNAMIC INTELLIGENT BIDIRECTIONAL OPTICAL ACCESS COMMUNICATION SYSTEM WITH OBJECT/INTELLIGENT APPLIANCE-TO-OBJECT/INTELLIGENT APPLIANCE INTERACTION, filed on Aug. 29, 2013 and in its related U.S. non-provisional patent applications (with all benefit provisional patent applications) are incorporated in its entirety herein with this application.
[0287] The intelligent vehicle can also couple with an object (e.g., Internet of Things (IoT)), wherein an object is described/disclosed in the previous paragraph.
[0288] Details of the objects have been described/disclosed in U.S. non-provisional patent application Ser. No. 13/448,378 entitled SYSTEM AND METHOD FOR INTELLIGENT SOCIAL COMMERCE, filed on Apr. 16, 2012 and in its related U.S. non-provisional patent applications (with all benefit provisional patent applications) are incorporated in its entirety herein with this application.
[0289] Furthermore, the machine learning (including artificial neural networks/deep learning/meta-learning and self-learning) algorithm based near real time/real time intention system can be connected with a cloud quantum computer for near real time/real time risk/scenario analysis.
[0290] The machine learning (including artificial neural networks/deep learning/meta-learning and self-learning) algorithm based near real time/real time intention system of the Super System on Chip 400A/400B/400C/400D can be applied to both semi-autonomous intelligent vehicles and autonomous intelligent vehicles.
[0291]
[0292]
[0293] The LTE-Direct radio can enable (a) wireless devices to communicate directly or discover services in 500-meter proximity without any cellular reception (b) the distribution of customer-profiled advertising/coupons (e.g., vehicle/customer recognition) with instant updates. On-demand near real time delivery of goods can be realized by utilizing an LTE-Direct radio and a global positioning system.
[0294]
[0295]
[0296]
[0297] Additionally, any relevant information from the internet connection of the intelligent vehicle and/or intelligent portable internet appliance 160 and/or intelligent wearable augmented reality personal assistant device 180 can be augmented and projected via a head-up display (HUD) onto the smart anti-glare window, wherein the head-up display includes a microprojector 560, as described/illustrated in
[0298] Details of the augmented reality personal assistant device 180 are illustrated in
[0299]
[0300]
[0301] Additionally, the millimeter wave radar or high resolution radar or a high resolution radar with metamaterial can be capable to penetrate ground in all weather conditions.
[0302] The frequency modulated continuous (or quasi-continuous) wave light detection and ranging subsystem can enable faster acquisition, better resolution, better dynamic range and longer distance measurement capability, compared to a time-of-flight direct flashlight detection and ranging subsystem.
[0303] The frequency modulated continuous (or quasi-continuous) wave light detection and ranging subsystem can be a coherent subsystem. Alternatively, homodyne/heterodyne coherent light detection and ranging subsystem can be considered.
[0304] The frequency modulated continuous (or quasi-continuous) wave light detection and ranging subsystem can be Synthetic Aperture based. A Synthetic Aperture based light detection and ranging subsystem can be integrated with a computational camera. The computational camera can be a standalone device. The computational camera may be considered as a femotosecond time-of-flight light detection and ranging subsystem.
[0305]
[0306] The balanced photodetector can be electro-optically coupled with a Light-to-Distance/Velocity System on Chip.
[0307] The Light-to-Distance/Velocity System on Chip can be coupled with the machine learning (including artificial neural networks/deep learning/meta-learning and self-learning) algorithm based intention system of the Super System on Chip 400A/400B/400C/400D, utilizing the algorithm 100 in
Thus, Target Distance=(Beat frequency*Speed of Light in Free Space)/(2*Frequency of Laser Modulation).
[0308] In an optical phased array, the frequency modulated continuous (or quasi-continuous) wave light beam is phase modulated by an array of phase modulators, then the phase modulated light beams (from the array of phase modulators) are beam steered by the optical phased array.
[0309] Alternatively, instead of the optical phased array, an array of antennas/vertical grating (optical) couplers/holographic optical elements (HOEs)/mirrors/collimating lenses can be utilized for beam steering toward the target.
[0310] It should be noted that the frequency modulated continuous (or quasi-continuous) wave light beam can be based multiple distinct wavelengths (e.g., based on wavelength division multiplexing (WDM)).
[0311]
[0312]
[0313] The linearity of the frequency modulation of a frequency modulated continuous (or quasi-continuous) wave tunable light source is a critical factor. The linearity of the frequency modulation of a frequency modulated continuous (or quasi-continuous) wave tunable light source may be improved by an optical phase-locked loop.
[0314]
[0315] The lN optical switch can be based on two-optical waveguides based directional (optical) coupler/three-optical waveguides based directional (optical) coupler/Mach-Zehnder type interferometer.
[0316] To reduce the size and electrical power consumption of the lN optical switch, it can include one-dimensional/two-dimensional photonic crystals.
[0317] For low-insertion loss and high extinction ratio, one-dimensional/two-dimensional photonic crystals may be useful.
[0318] The lN optical switch can be an ultrafast optical switch incorporating a phase transition material (e.g., vanadium dioxide) or a phase change material (e.g., Ge.sub.2Sb.sub.2Te.sub.5 (GST), Ge.sub.2Sb.sub.2Se.sub.4Te.sub.1 (GSST) or Ag.sub.4In.sub.3Sb.sub.67Te.sub.26 (AIST)) or a nonlinear polymer with Kerr effect (e.g., p-Toluene Sulfonate (PTS)) or lithium niobate thin-film.
[0319] Furthermore, by fusing data from multiple light detection and ranging subsystems and multiple far infrared (in a wavelength range of about 8 microns to 14 microns) thermal imaging cameras, imaging cameras typically operating in a wavelength range of about 1.3 microns to 1.55 microns, a real time 360-degree angular image/three-dimensional map of (recognized) objects can be constructed. The real time 360-degree angular image/three-dimensional map (of recognized objects) can be coupled with natural language activated/voice activated Fazila as described/illustrated in
[0320]
[0321] By reducing the length of the electrical wires and optical fibers in the feedback path, the dynamics of the optical phase-locked loop can be improved to suppress the higher frequency errors. Furthermore, close integration of the electronic circuits with photonic integrated circuits/devices can enable sophisticated control mechanisms, three-dimensional imaging with micrometer level precision for three-dimensional copy machine, corneal imaging and robotic microsurgery.
[0322]
[0323]
[0324]
[0325]
[0326] A pulsed laser will periodically emit light in the form of optical pulses in ultra-short time duration, rather than a continuous wave (CW). The duration or pulse width of the pulsed laser can range from 10's of nanoseconds to 10's of picoseconds. There are several things to consider with the properties and characteristics of the pulsed laser, such as peak power (which is the maximum amount of power that a single pulse delivers), average power, pulse width and pulse energy.
[0327] Gain-switching is a technique by which a laser can be made to produce pulses of light of extremely short duration of the order of picoseconds. For example, a quantum well AlGaAs/InGaAs laser with a very large ratio of active layer thickness to optical confinement factor can result in single, high-energy short (e.g., about 10-100 picoseconds) single optical pulses. This will require an injection current pulse of 10 Amp and pulse duration of 1.5-2 nanoseconds. A narrow asymmetric optical waveguide design is a way of implementing such a structure while maintaining good far-field properties of the single emitted mode.
[0328] A modulated diode laser is a continuous laser in which its output optical power can be manipulated in accordance with an input signal triggering it. One of the most common applications for a modulated diode laser is to input a periodic analog or digital signal, such that it will be modulated between an on state and off state. The main difference between the modulated laser and pulsed laser is the modulated laser is simply turning on and off periodically. A pulsed laser will release bursts of energy periodically. A modulated laser will only turn on to a set maximum output power, regardless of how quickly or slowly the laser is modulating between the on and off states.
[0329] FIG. 3U1 illustrates a standalone computational camera 1. The computational camera may be considered as a nanosecond/picosecond time-of-flight (ToF) light detection and ranging subsystem. In FIG. 3U1, a discrete pulsed laser (e.g., a pulsed optically pumped vertical cavity surface emitting laser or a pulsed electrically pumped vertical cavity surface emitting laser or a pulsed electrically pumped photonic crystal vertical cavity surface emitting laser or a pulsed electrically pumped discrete gain-switched semiconductor laser) and a two-dimensional array of single photon avalanche diodes of InGaAs/InP material or InAlAs or germanium-on-silicon material are utilized. A pulsed electrically pumped photonic crystal vertical cavity surface emitting laser (PC-VCSEL) can be fabricated/constructed as follows in a sandwiched structure: a bottom electrodea semiconductor substratea bottom cladding layeran active material layera photonic crystal layera top cladding layera reflector layera top electrode. The discrete pulsed laser can be coupled with a spatial light modulator (SLM), if needed and a diffractive/refractive optics based beam expander. The single photon avalanche diode may require cooling by a thermoelectric cooler (TEC). For example, a spatial light modulator based on a multi quantum well (MQW) AlGaAs or InGaAs on a silicon substrate can enable faster response time.
[0330] Alternatively, the two-dimensional array of single photon avalanche diodes of InGaAs/InP material or Al.sub.0.8In.sub.0.2As.sub.0.23Sb.sub.0.77 material (generally AlInAsSb material on GaSb substrate) or germanium-on-silicon material can be replaced by a two-dimensional array of avalanche photodiodes of InGaAs/InP material or Al.sub.0.8In.sub.0.2As.sub.0.23Sb.sub.0.77 material (generally AlInAsSb material on GaSb substrate) or AlAs.sub.0.56Sb.sub.0.44 material or InAs material or InAlAs material or germanium-on-silicon material. It should be noted that above material based avalanche photodiode can be realized at about 1550 nanometers wavelength. Furthermore, Al.sub.0.8In.sub.0.2As.sub.0.23Sb.sub.0.77 material (generally AlInAsSb material on GaSb substrate) based avalanche photodiode can be realized at about 2000 nanometers wavelength. Al.sub.0.5In.sub.0.5As.sub.0.47Sb.sub.0.53 material (generally AlInAsSb material on GaSb substrate) based avalanche photodiode can be realized at about 1550 wavelength. Additionally, quantum dots can be utilized to fabricate/construct a low dark current an avalanche photodiode. Furthermore, cascaded lateral avalanche region in avalanche photodiodes can be utilized to fabricate/construct a solid state photomultiplier device.
[0331] Alternatively, the two-dimensional array of single photon avalanche diodes of InGaAs/InP material or Al.sub.0.8In.sub.0.2As.sub.0.23Sb.sub.0.77 material (generally AlInAsSb material on GaSb substrate) or germanium-on-silicon material can be replaced by a two-dimensional array of single photon avalanche diodes of germanium-tin-on-silicon (GeSnSi) material on silicon on insulator substrate, wherein the input of each single photon avalanche diode of germanium-tin-on-silicon is coupled with an optical waveguide (typically a silicon optical waveguide).
[0332] Furthermore, a single photon avalanche diode of germanium-tin-on-silicon material can be fabricated by selective epitaxial growth or wafer bonding. Another benefit of the optical waveguide is to incorporate other optical components (e.g., an optical filter/optical switch).
[0333] Alternatively, the two-dimensional array of single photon avalanche diodes of InGaAs/InP material or Al.sub.0.8In.sub.0.2As.sub.0.23Sb.sub.0.77 material (generally AlInAsSb material on GaSb substrate) or AlAs.sub.0.56Sb.sub.0.44 material or InAs material or germanium-on-silicon material can be replaced by a two-dimensional array of avalanche photodiodes of germanium-tin-on-silicon material.
[0334] The material layer structure is as follows: N+ silicon contact layer on high resistive silicon substrate. On top of N+ contact layer, there is an i-silicon multiplication layer of 500 nanometers. On top of the i-silicon multiplication layer, there is a p-silicon charge layer of 100 nanometers, after which there is a germanium buffer layer of 200 nanometers, after which there is a i-germanium tin (typically 3% tin concentration for 1550 nanometers wavelength) absorption layer of 300 nanometers, after which there is a P++ contact layer by shallow ion implantation.
TABLE-US-00001 P++ Contact Layer (Ion Implantation) i-Germanium-Tin (Tin 3%-10%) Absorption Layer (300 nanometers Thick) Germanium Buffer Layer (200 nanometers Thick) i-Silicon Charge Layer (100 nanometers Thick) i-Silicon Multiplication Layer (500 nanometers Thick) N+ Silicon Layer (500 nanometers Thick) High Resistivity Silicon Substrate
[0335] Alternatively, an avalanche photodiode/single photon avalanche diodes layer structure can be as follows:
TABLE-US-00002 P+ Contact Layer Blocking Layer (e.g., Digital Alloy Composition) Graded Bandgap (e.g., Digital Alloy Composition) Absorption Layer (e.g., Digital Alloy/MQW Composition) Graded Bandgap (e.g., Digital Alloy Composition) Charge Layer (e.g., Digital Alloy Composition) Charge Multiplication Layer (e.g., Digital Alloy/ Superlattice Composition) N+ Substrate
[0336] An avalanche photodiode material stack can be a (a) PiN structure based or (b) a separate absorption, charge and multiplication structure based or (c) multi staircase based. Generally, a separate absorption, charge and multiplication (SACM) structure based avalanche photodiode material stack can enable higher performance (especially the excess noise factor and the dark current). Similarly, a multi staircase (band structure) based avalanche photodiode material can enable low noise and higher gain.
[0337] A multi-quantum well composition based absorption layer can reduce thickness required for higher quantum efficiency at a certain wavelength. Furthermore, multi-quantum well composition based absorption layer can be embedded within expitaxially grown metasurface to produce multiple passes. Furthermore, an avalanche photodiode can include lens to improve directivity.
[0338] It should be noted that a superlattice composition based charge multiplication layer produce less excess noise than a digital alloy, because hot electrons can impact ionize from the lowest conduction miniband and holes can scatter among multiple minibands, before reaching their impact ionization threshold.
[0339] For fabrication/construction of a two-dimensional array of avalanche photodiodes either planar or mesa device geometry/structure can be utilized. It should be noted that a triple mesa etched geometry/structure (e.g., 40 microns (at the base) followed by 34 microns, then followed by 28 microns) or a double mesa etched geometry/structure (e.g., 65 microns followed by 105 microns) can enable higher reliability and low dark current avalanche photodiode. It should be noted that a triple mesa/double mesa etched geometry/structure can also be utilized in single photon avalanche diode.
[0340] A circular mesa device geometry/structure can be defined by standard photolithography and inductive coupled plasma (ICP) dry etching. Etching can be terminated with a surface-smoothing treatment of bromine methanol. Furthermore, to reduce the surface leakage current, buffered HF and/or ammonium sulfide (NH4).sub.2S) and/or zinc sulfide (ZnS) surface passivation treatment can be utilized, followed by an SU-8 spin-on coating after the surface passivation treatment. Titanium/gold metal based p-contact and n-contact can be deposited by e-beam evaporation on top of the mesa and at the back of n+ substrate, wherein n-contact is electrically coupled with a read-out and control electronic integrated circuit (ROIC) via an array of indium bumps. The read-out and control electronic integrated circuit can be integrated with a microprocessor/neural processor, wherein the neural processor (for electrical/optical neural processing) includes memristors or super memristors. Each super memristor can include (i) a resistor, (ii) a capacitor and (iii) a phase transition/phase change material based memristor. A phase transition material based memristor can be electrically and/or optically controlled. But a phase change material based memristor can be electrically or optically controlled. Furthermore, each super memristor can be electrically/optically controlled.
[0341] A multi-pixel photon counter (MPPC) can consist of many pixels, wherein each pixel has at least one Geiger mode avalanche photodiode (Gm APD), wherein each Geiger mode avalanche photodiode is integrated with a self-quenching/quenching resistor. Many pixels can be electrically connected and arranged in two dimensions. Each pixel independently works in limited Geiger mode with an applied voltage (typically a few volts above the breakdown voltage). When a photoelectron is produced, it induces a Geiger avalanche. The avalanche is passively quenched by a resistor integral to each pixel. The output charge from a single pixel is independent of the number of produced photoelectrons within the pixel. The multi-pixel photon counter's each pixel is vertically connected to a pad of a read-out and control electronic integrated circuit's metal layer by flip chip bonding. It should be noted that a Geiger mode avalanche photodiode is a single photon avalanche diode.
[0342] The read-out and control electronic integrated circuit can be integrated with a microprocessor/neural processor, wherein the neural processor (for electrical/optical neural processing) includes memristors or super memristors. Each super memristor can include (i) a resistor, (ii) a capacitor and (iii) a phase transition/phase change material based memristor. A phase transition material based memristor can be electrically and/or optically controlled. But a phase change material based memristor can be electrically or optically controlled. Furthermore, each super memristor can be electrically/optically controlled.
[0343] By shaping the spatial wavefront through a spatial light modulator, the pulsed laser beam can propagate through a strongly scattering medium (e.g.; harsh weather/environmental conditionsfog/rain/snow) without lateral diffusion. Furthermore, the backscattering of the pulsed laser beam can be suppressed. A spatial light modulator can modulate amplitude, phase or polarization of the pulsed laser beam in space and time. The spatial light modulator can consist of 40 pairs of InGaAs/GaAs/GaAsP multiple quantum wells embedded in an asymmetric Fabry-Perot (FP) cavity formed by highly reflective back distributed Bragg reflectors and moderate reflective top distributed Bragg reflectors. The computational camera can include an algorithm for image reconstruction to detect an object in any weather condition (including harsh weather/environmental conditionssuch as rain/fog/snow) or around the corner (not in line-of-sight).
[0344] The pulsed laser of the standalone computational 1 can have a full width at half maximum (FWHM) rise time of an optical (laser) pulse or a full width at half maximum fall time of an optical (laser) pulse from about 0.01 nanoseconds to about 10 nanoseconds. The full width at half maximum is given by the difference between the two extreme values of an independent variable at which a dependent variable is equal to half of its maximum value. In other words, the full width at half maximum can describe the width of a bump on a curve or function. It is given by the distance between points on the curve at which the function reaches half its maximum value. For Gaussian function
the full width at half maximum is 2{square root over (2 ln 2)} .
[0345] However, it should be noted that to observe around the corner (non line-of-sight) by the standalone computational camera 1, pulsed laser of the standalone computational 1 should have a full width at half maximum rise time of an optical pulse or a full width at half maximum fall time of an optical pulse at less than 1 nanosecond.
[0346] The fast rise/fall time can be realized by incorporating using a laser incorporating a laser structure integrated with a voltage controlled modulator and/or a saturable absorber (SA).
[0347] The saturable absorber is generally 20 microns, 40 microns or 100 microns in length. The saturable absorber can be realized by ion implantation of a laser structure. The saturable absorber can be an actively biased optical waveguide or an unbiased electrically isolated (from the main laser structure) optical waveguide.
[0348] It should be noted that the saturable absorber realized in the form an unbiased electrically isolated (from the main laser structure) optical waveguide may require bulk active layers (as opposed to quantum well layers) otherwise similar to gain section of the laser structure.
[0349] It should be noted that there can be (a) a diffuser/diverging lens after the collimated laser beam to capture the entire field of view of the object and (b) an imaging lens (for the scattered laser beam from the object) prior to the two-dimensional array of single photon avalanche diodes. The diffuser/diverging lens can be refractive optics based or diffractive optics based.
[0350] It should be noted that instead of a discrete pulsed laser, an array of pulsed lasers can be utilized. The laser beam from each pulsed laser in the array of pulsed lasers can be collimated. Additionally, a laser beam consisting of single photons can split on the larger number of small laser beams (utilizing a spatial mode demultiplexer e.g., that may include a volume holographic demultiplexer (VHDM) with a phase plate) propagating toward a target. Thus, this can be thought of an array of sub-laser pulses on a target. Then, an array of single photon detectors can detect returning (single photon level) signals. After collecting sufficient data statistics, characteristics of a target can be inferred.
[0351] A first prism can deflect a first collimated laser beam (from a first pulsed laser) down and a second prism can deflect the first laser beam upward toward the center. Finally, a third prism can deflect the first collimated laser beam parallel to and under the second collimated undeviated laser beam.
[0352] Thus, utilizing a set of right angle deflections, the shape of the laser beam from an array of pulsed laser can be changed from rectangular shape to square shape or to a desired shape for higher composite pulsed laser output power (from an array of lasers) by a beam shaping optical subsystem. Thus, the beam shaping optical subsystem can include one or more prisms or lens (typically three or five lenses with a separation of 1.5 mm between them and separation tolerance of +/50 microns. A lens surface can be aspherical and/or biconical and/or conical and/or cylindrical) or tunable (e.g., electrically controlled) lenses or mirrors (e.g., microelectromechanical system (MEMS) based mirrors).
[0353] Alternatively, the beam shaping optical subsystem can include a diffractive optical element/refractive optical element (ROE)/holographic optical element (HOE) based diffuser. In general, a complex pattern of microscaled and nanoscaled patterned structures in a diffractive optical element can modulate and transform light in a predetermined way. The tunable lenses have a variable focal length that can be controlled by applying appropriate electrical signals. By using two such tunable lenses one after the other the direction and focus of a laser beam can be controlled. The tunable lenses, along with other optical elements can be used to create a wide-angle scan.
[0354] Furthermore, prisms can be replaced by flat mirrors or a metamaterial surface for beam deflection with minimum loss of output power from the array of pulsed lasers.
[0355] Furthermore, this scheme may enable redundancy of a pulsed laser. The failure of a pulsed laser can be detected by a photodiode, placed behind each pulsed laser.
[0356] Alternatively, bare unprocessed indium phosphide based epitaxial materials/layers on indium phosphide substrate can be bonded onto a silicon wafer. Then indium phosphide substrate can be removed and then InGaAs/InP based single photon avalanche diode can be fabricated/constructed. Conventional gold metal based contact on indium phosphide based epitaxial materials/layers can be replaced by nickel based alloyed contact compatible with complementary metal-oxide-semiconductor fabrication on silicon. This scheme can eliminate direct (chip-to-wafer bonding) of InGaAs/InP based single photon avalanche diode chip with the wafer of complementary metal-oxide-semiconductor fabrication on silicon.
[0357] The array of single photon avalanche diodes and the pulsed laser can be coupled with the Super System on Chip 400A/400B/400C/400D, which is then coupled with a machine learning (including artificial neural networks/deep learning/meta-learning and self-learning) algorithm based intention system.
[0358] Alternatively, a single electrically controlled photonic-crystal (pulsed) laser or a two-dimensional array of electrically controlled photonic crystal (pulsed) lasers can be utilized, wherein each electrically controlled photonic-crystal (pulsed) laser can provide a pulse in nanoseconds or in sub-nanoseconds.
[0359] It should be noted that a discrete pulsed electrically pumped vertical cavity surface emitting laser has limited output power, however can be scaled in arrays with tens to thousands of pulsed electrically pumped vertical cavity surface emitting lasers on one single wafer for higher power density at a pulse duration in nanoseconds or sub-nanoseconds.
[0360] Gain-switching utilizes the structure with an extremely large equivalent spot size. In dynamic behavior, the use of extremely large equivalent spot size results in enhanced gain-switching and eventually in an efficient picosecond operation mode. This principle can work with bulk, quantum well and vertical cavity surface emitting laser.
[0361] Alternatively, a picoseconds high optical output power pulsed laser can be a mode locked (e.g., passively mode locked) integrated external-cavity surface emitting laser. It can contain a highly reflective bottom distributed Bragg reflector, a quantum-well/quantum dot absorber, a pump distributed Bragg reflector and a gain region of multiple quantum-well/quantum dot layers and an anti-reflection (AR) section and it is optically pumped approximately at a 45 degree angle. But it can be electrically pumped also.
[0362] For example, an optically pumped mode locked integrated external-cavity surface emitting laser is an ultrafast semiconductor disk laser (SDL), where the saturable absorber can be integrated in the semiconductor gain structure. But the absorber needs to be protected from the pump excitation and thus, the absorber should be located beneath the gain structure and separated by a pump-reflecting mirror.
[0363] Furthermore, a transparent wafer based mode locked integrated external-cavity surface emitting laser structure can enable higher exit output power and wafer-level integration of an output (optical) coupler with etched mirrors (facets) and electrical pumping of the gain section of the mode locked integrated external-cavity surface emitting laser.
[0364] An ammonium hydroxide dip, followed by (NH4).sub.2S.sub.x and KrF pulsed laser (at a low intensity) treatments or alternatively, argon/nitrogen ion beam treatment on etched mirrors (facets), then deposition of about 2 nanometers of silicon/amorphous silicon/hydrogenated amorphous silicon/zinc selenide and 20 nanometers of aluminum oxide under vacuum can reduce surface defects. The ion beam energy, the ion beam density, the ion beam exposure time and the composition of the background gas mixture are critical in argon/nitrogen ion beam treatment. Typically, the entire etching of mirrors (facets) and passivation process of mirrors (facets) can be performed under ultrahigh vacuum (UHV) to reduce any possibility of surface oxidation prior to passivation. Alternatively, regrowth of passivation material (e.g., semi-insulating indium phosphide) around the etched mirrors (facets) can reduce surface defects.
[0365] For heat dissipation, a mode locked integrated external-cavity surface emitting laser can be attached/bonded to a heat spreader (e.g., a diamond heat spreader). It should be noted that the diamond heat spreader can be a synthetically grown diamond.
[0366] For reduction of costs, a vertical cavity surface emitting laser at 850 nanometers wavelength and a two-dimensional array of single photon silicon avalanche diodes at 850 nanometers wavelength can be utilized. But for the reduced reflection, 1550 nanometers wavelength may be ideal.
[0367] FIG. 3U2 illustrates another embodiment of a standalone computational camera 2. This is similar to the embodiment illustrated in FIG. 3U1, except there is an additional metamaterial surface for ultrafast laser beam steering. Furthermore, instead of the metamaterial surface, an array of phase modulators (either electrically controlled or optically controlled) can be utilized. It should be noted that instead of a discrete pulsed laser, an array of pulsed lasers can be utilized and the parallel beam from the array of pulsed lasers can be shaped from rectangular to square by right angle prisms/rotators/metamaterial surface.
[0368] FIG. 3U3 illustrates another embodiment of a standalone computational camera 3. A high peak (e.g., 2 to 10 watts) power wavelength tunable (multi-wavelength) pulsed laser (TL) (e.g., with a wavelength span at 850 nanometers+/20 nanometers or 1550 nanometers+/20 nanometers or 2000 nanometers+/20 nanometers and pulse duration in nanoseconds or sub-nanoseconds) is coupled in a hybrid master oscillator-power amplifier configuration. However, the wavelength tunable laser is optically isolated from the power amplifier by an isolator. The output of the power amplifier is coupled with a lN cyclic arrayed waveguide grating router (Cyclic-AWGR) (wherein the optical energy of different wavelengths is uniformly distributed to N output waveguides). The N output waveguides (each output waveguide can be integrated with a semiconductor optical amplifier) of the cyclic arrayed waveguide grating router coupled with N 3-port optical circulators. Each 3-port optical circulator has three (3) ports, the first port of the 3-port optical circulator is optically coupled with the output waveguide of the lN cyclic arrayed waveguide grating router, the second port of the 3-port optical circulator is optically coupled with a single photon avalanche diode and the third port of the 3-port optical circulator is optically coupled with a diverging lens for viewing a stationary or moving target and an imaging lens. The single photon avalanche diode is detecting the scattered light from a stationary or moving target. However, the single photon avalanche diode can be replaced by an avalanche photodiode.
[0369] It should be noted that a cyclic arrayed waveguide grating router can be replaced by an arrayed waveguide grating router. An arrayed waveguide grating router can act as a prism.
[0370] Each single photon avalanche diode and the high peak power wavelength tunable pulsed laser are coupled with the Super System on Chip 400A/400B/400C/400D, which is then coupled with a machine learning (including artificial neural networks/deep learning/meta-learning and self-learning) algorithm based intention system.
[0371] Alternatively, a modulated optical signal (from a wavelength tunable (multi-wavelength) continuous wave laser) may be utilized in lieu of a pulsed optical signal (from a wavelength tunable (multi-wavelength) pulsed wave laser). The modulation scheme may contain a suitable modulation pattern (e.g., Hamiltonian codes). The single photon avalanche diode will then detect the (incident) modulation pattern, which can be shifted in time, upon scattering from a stationary or moving target.
[0372] FIG. 3U4 illustrates an embodiment of a high power (e.g., up to 100 watts) wavelength tunable pulsed laser module. The output beam of a first (wavelength) tunable pulsed (e.g., about 1 nanosecond or 10-100 picoseconds) laser diode 1 (e.g., a distributed feedback laser/gain-switched laser/
[0373] Alternatively, the first wavelength tunable pulsed laser diode 1 and the second wavelength tunable pulsed laser diode 2 can be optically coupled with a Y-branched waveguide (optical) coupler or a multimode interference (optical) coupler, eliminating both the special purpose non-polarizing beam optical splitter 1 and non-polarizing beam optical splitter 2.
[0374] The special purpose non-polarizing beam optical splitter (Special BS) 1 allows the output laser beam (of the wavelength tunable pulsed laser diode 2) from the non-polarizing optical beam splitter (BS) 2 to pass through and both the output laser beams (of the wavelength tunable pulsed laser diodes 1 and 2) are reflected by a non-polarizing optical beam splitter 3, then collimated by a collimating lens 3 and passed through an electrically biased tapered power amplifier integrated with an electrically biased optical gate (OG). The output laser beam of the tapered power amplifier is collimated by a collimating lens 4 and passed through a 60 dB isolator 3. Furthermore, the output laser beam can be coupled with volume Bragg gratings for wavelength stability and the whole module namely the high power (wavelength) tunable pulsed laser module can be temperature stabilized by a thermoelectric cooler.
[0375] Furthermore, a high power pulsed laser can be a Febry Perot broad area (FP-BA) laser diode or a broad area laser diode with on-chip V-junction angled (e.g., about 15 degree angle) waveguide cavity. The angled waveguide can also include photonic crystals or microstructures. The p-contact layer of the Febry Perot broad area laser diode can be fabricated/constructed as thin as possible, which may reduce electrical resistance and optical losses. This can be combined with an asymmetry in the design of the cladding and waveguide inside the Febry Perot broad area laser diode. The clad/guide asymmetry can help to couple unwanted optical modes into the substrate, preventing them from lasing. Furthermore, a graded profile of the refractive index for the layers on either side of the quantum well can be introduced, allowing for fine tuning of the optical field. Limits to efficiency may also lie in the lateral structure, as significant levels of electrical current can be lost on either side of the electrically coupled stripe, even in a Febry Perot broad area laser diode. A current blocking buried mesa structure can eliminate this lost current. A buried mesa structure can be fabricated/constructed using a two-step in-situ etched metal organic chemical vapor deposition (MOCVD) process.
[0376] Furthermore, a Febry Perot broad area laser diode with monolithically integrated surface-etched uniform/non-uniform gratings can be fabricated/constructed in which the feedback is provided by surface-etched uniform/non-uniform gratings. The grating strength can be varied along the resonator, thus significantly increasing fabrication yield and performance. Furthermore, a Febry Perot broad area laser diode can be replaced by a vertical cavity surface emitting laser.
[0377] Furthermore, a pulsed optical signal of a pulsed wave laser can include a unique (short) modulated or a unique (short) coded pulse sequence (generally as an electrical waveform input to a pulsed laser) to reduce any interference.
[0378] This unique (short) modulated or a unique (short) coded pulse sequence may be identified generally by a photodetector/photodetector array, receiving the reflected/scattered light.
[0379] Alternatively, any interference may be reduced by utilizing a historical map or an augmented reality enhanced historical map optimized via an algorithm and viewed on a display/head-up display.
[0380] A pulsed wave laser can also include a first bandpass optical filter (or even a first tunable optical filter for a first wavelength) to reduce any interference. A pulsed wave laser can also include a wavelength (stabilization) locker.
[0381] Alternatively, a detector can include a time gating circuit and/or a (matching) second band pass optical filter (or even a second tunable optical filter to specifically match at the first wavelength) to reduce any interference.
[0382] It should be noted that a time gating circuit may be easier to implement with a single photon avalanche diode.
[0383] Alternatively, a continuous/quasi-continuous wave (wavelength tunable) laser (e.g., as illustrated generally in
[0384] Furthermore, wavelength tuneability can be narrow (e.g., about 10 nanometers) or wide (e.g., about 30 nanometers). Such a continuous/quasi-continuous wave (wavelength tunable) laser can be frequency modulated.
[0385]
[0386] Various combinations/arrangements of a modulator and a semiconductor optical amplifier are also possible to maximize the (exit) output power and reduce the back reflection from the semiconductor optical amplifier into a distributed feedback laser.
[0387] When utilizing a continuous/quasi-continuous wave laser, the coherence length of the continuous/quasi-continuous wave laser should be long and reflected laser from an object can be detected by one or more photodetectors/balanced photodetectors (e.g., utilizing a low cost epitaxial material such as germanium on silicon for a cost sensitive application). For example, with 1% antireflective coating at about 1550 nanometers center wavelength, a 6 microns thick germanium layer as (an i-region of a Fabry Perot PiN photodiode structure) may be required to achieve about 70% external quantum efficiency (EQE). However, this 70% external quantum efficiency may fall off within +/30 nanometers from 1550 nanometers center wavelength, especially around at 1580 nanometers wavelength. Furthermore with 1% antireflective coating at about 1550 nanometers center wavelength, an 8 microns thick germanium layer may be required to achieve about 80% external quantum efficiency. It should be noted that it may be difficult to epitaxially grow such a thick (e.g., 6 microns or 8 microns) germanium layer (an i-region of a Fabry Perot PiN photodiode structure) on a silicon wafer due to about 4.2% lattice mismatch between germanium lattice and silicon lattice.
[0388] A continuous/quasi-continuous wave laser should also have (i) large (e.g., about 30 nanometers) continuous wavelength tunability (e.g., a distributed feedback laser/distributed Bragg reflector laser) (i) narrow laser linewidth (e.g., 50 Hz to 30 KHz range) (ii) high linearity, (iii) high side mode suppression ratio (e.g., 40 dB to 50 dB range) and (iv) high exit facer/mirror optical power may require a semiconductor optical amplifier, for example as illustrated in
[0389] It is possible to fabricate/construct a continuous/quasi-continuous wave narrow linewidth laser by coupling a distributed feedback laser with one or more microring optical resonators of high Q-factor (e.g., 10.sup.5 to 10.sup.6) wherein each microring optical resonator can consist of a low loss waveguide, a resistive heating element and an electrode.
[0390] In static operation, a microring optical resonator can be regarded as a filter/mirror which can reflect/inject the selective wavelength into a distributed feedback laser, while outputting the filtered light. The efficiency of self-injection can be decided by the ratio of Q of a distributed feedback laser and an external cavity.
[0391] By altering the voltage on the electrodes on a microring optical resonator and a distributed feedback laser's operation temperature, the distributed feedback laser can meet the self-injection equilibrium condition and enter the self-injection locking mode. By injecting optical power at about 30%, this self-injection locking mode can reduce the linewidth of a distributed feedback laser by 1000.
[0392] Alternatively, instead of a distributed feedback laser, a distributed feedback laser coupled with a modulator (as illustrated in
[0393]
[0394] Various combinations/arrangements of a modulator and a semiconductor optical amplifier are also possible to maximize the (exit) output power and reduce the back reflection from the semiconductor optical amplifier into a distributed feedback laser.
[0395] Additionally, one or more photodetector/balanced photodetectors can be coupled with an electrical signal processor chipset (e.g. a digital signal processor (DSP) chipset).
[0396] Furthermore, it should be noted that to achieve ultra-narrow linewidth (e.g., less than 50 Hz), an external cavity (EC) laser coupled with a (volume) Bragg gratings (VBG/BG) (for wavelength stabilization) should be utilized. Alternatively, an external cavity laser can include a gain chip and a planar lightwave circuit (PLC) that includes a Bragg grating. An external cavity laser can be coupled with a separate frequency modulator for frequency and/or intensity modulator for intensity modulation.
[0397] It should be noted that for stability of operation/wavelength a distributed feedback laser/distributed Bragg reflector laser or an external cavity may be cooled/temperature stabilized by a thermoelectric controller at the expense of electrical power consumption. It should be noted that (simultaneously activated) an array (e.g., 8 or 12) of distributed feedback lasers can extend a range, as a range is generally limited by a specific laser's coherence length.
[0398] An output of a (linearly frequency chirped) continuous/quasi-continuous wave laser can be split into a reference optical signal as a local oscillator and a target optical signal transmitting toward an object.
[0399] The interference signal of the above two signals can generate a sinusoidal beat signal, on a photodetector/balanced photodetector. The frequency of sinusoidal beat signal is proportional to the distance to the target. A Fourier Transform can convert this time domain sinusoidal beat signal into a peak in the frequency domain to mathematically extract the distance.
[0400] But, if the target is moving, its velocity and distance can be detected simultaneously by utilizing both up-chirp and down-chirp of the continuous/quasi-continuous wave laser.
[0401] Furthermore (i) a first iterative learning pre-distortion compensation algorithm can be utilized to linearize the laser frequency chirp and (ii) also a second post processing algorithm be utilized to compensate for the phase noisethus reducing a need for an expensive wavelength tunable and narrow linewidth continuous/quasi-continuous wave laser and its precision control system.
[0402] Furthermore, as described/disclosed in the later paragraphs, the continuous/quasi-continuous wave laser can include/couple with a Lorentzian Least Squares Fitting Processor (LLSF Processor) to improve precision and sensitivity beyond the coherence length of the narrow linewidth laser.
[0403] A Lorentzian Least Squares Fitting Processor can include an integrated electronic circuit that performs the calculations to improve precision and sensitivity beyond the coherence length of the narrow linewidth laser.
[0404] Alternatively to improve coherence length of the narrow linewidth laser (in particular a chirped distributed feedback laser e.g., chirped gratings S-bend distributed feedback laser), two feedback loops can be utilizeda first feedback loop may be used to control a distributed feedback laser's injection current to compensate for sweep nonlinearity and a second feedback loop may be used to control the frequency of an acousto-optic frequency shifter (AOFS) with a fast response time to compensate for broadband stochastic frequency noise.
[0405] For transmitting continuous/quasi-continuous wave laser toward an object, a first array/network of optical switches (e.g., a Mach-Zehnder based optical switch) or a first arrayed waveguide grating router or a first cyclic arrayed waveguide grating router can be utilized. Similarly, for receiving reflected light from an object to one or more balanced photodetectors, a second array/network of optical switches or a second arrayed waveguide grating router or a second cyclic arrayed waveguide grating router can be utilized.
[0406] The first array/network of optical switches and the second array/network of optical switches can be coupled with an array 3-port optical circulators (or equivalently waveguide based optical triplexers with high isolation or low cross-talk) and an array of lenses. It is possible to fabricate/construct a 3-port optical circulator as a (high isolation or low cross-talk) waveguide based triplexer.
[0407] Alternatively, the first arrayed waveguide grating router/first cyclic arrayed waveguide grating router and the second arrayed waveguide grating router/second cyclic arrayed waveguide grating router can be coupled with an array 3-port optical circulators (or equivalently waveguide based optical triplexers with high isolation or low cross-talk) and an array of lenses.
[0408] Furthermore, the first arrayed waveguide grating router/first cyclic arrayed waveguide grating router can be coupled with a first optical splitter/optical coupler (e.g., Y splitter or MMI splitter). Similarly, the second arrayed waveguide grating router/second cyclic arrayed waveguide grating router can be coupled with a second optical combiner/optical coupler.
[0409] Alternatively, the first array/network of optical switches/first arrayed waveguide grating router can be coupled with a first beam shaping optical system (generally can consist of a lens) or 3-port optical circulator (or equivalently waveguide based optical triplexer with high isolation or low cross-talk) coupled with a lens.
[0410] Similarly, the second array/network of optical switches/second arrayed waveguide grating router can be coupled with a second beam shaping optical system (can generally consist of a lens) or a 3-port optical circulator (or equivalently waveguide based optical triplexers with high isolation or low cross-talk) coupled with a lens.
[0411] A continuous/quasi-continuous wave (wavelength tunable) laser based computational camera can integrate/couple one or more continuous/quasi-continuous wave (wavelength tunable) lasers, one or more photodetectors/balanced photodetectors and one or more optical switches/optical couplers on a common substrate.
[0412] Alternatively, the first beam shaping optical system and the second beam shaping optical system can be replaced by an optical phased array (various embodiments of an optical phased array have been described/disclosed in this specification) or an array of vertical couplers or an array of nanoscaled antennas or a metamaterial surface or a Rotman lens, [0413] or [0414] a microelectromechanical system based mirror to deflect a light beam, [0415] or [0416] a microelectromechanical system based switchable grating for optical beam steering; wherein the microelectromechanical system based switchable grating includes a grating, and an optical waveguide, wherein the grating is suspended above the optical waveguide, wherein the grating is vertically positioned up to transmit the light beam or vertically positioned down to couple the light beam with the optical waveguide.
[0417] A continuous/quasi-continuous wave can be programmed to sequentially illuminate an object with different wavelengths of laser beam from several different angles and a photodetector or an array of balanced photodetectors can record images each time. These images are then combined to reconstruct a high-resolution image. A photodetector or an array of balanced photodetectors can be coupled with an electrical signal processor (e.g., a digital signal processor).
[0418] A continuous/quasi-continuous wave (wavelength tunable) laser based computational camera can be operable/integrated with a digital optical phase conjugator. A digital optical phase conjugator can generally include at least a spatial light modulator (for time reversal of optical wavefronts in any weather condition (including harsh weather/environmental conditionssuch as rain/fog/snow). A spatial light modulator may be replaced by a deformable mirror.
[0419] It should be noted that in a cot sensitive application, A continuous/quasi-continuous wave (wavelength tunable) laser based computational camera can be integrated on a common optical platform such as utilizing silicon photonics on silicon substrate on a silicon substrate or photonic integrated circuit on an indium phosphide substrate.
Any weather condition (including harsh weather/environmental conditionssuch as rain/fog/snow) can be dynamically changing. In such situations an optical coherence tomography (OCT) based system (or a module in a miniature form factor) may be useful. A continuous/quasi-continuous wave (wavelength tunable) laser based computational camera can be operable/integrated with an optical coherence tomography based system (or a module in a miniature form factor). It should be noted that an optical coherence tomography combined with adaptive optics and/or Doppler imaging and/or terahertz imaging may enable ophthalmic diagnostic imaging to unprecedented levels of precision
[0420] Alternatively, an optical diffuse tomography (ODT) based system (or a module in a miniature form factor) can be utilizedwhich can generally include a short (e.g., 30 picoseconds) pulsed (high output power) laser and one or more single photon avalanche diodes. It should be noted that (i) a Febry Perot laser electrically coupled with a thyristor or (ii) a master oscillator-power amplifier electrically coupled with a thyristor can enable a short (e.g., 30 picoseconds) pulsed (semiconductor) laser. Alternatively, (even though in a large form factor) a pulsed laser in a suitable wavelength range from NKT Photonics company may be a solution.
[0421] The following formula may enable to determine a suitable wavelength range for reduced atmospheric attenuation/scattering coefficient.
[0422] For example, 6 values at about 1550 nanometers (nm) wavelength are 0.0004 in air, 4-80 in fog (fog droplets are about 1-20 microns in radial size), 400-40,000 in rain (rain droplets are about 100-10,000 microns in radial size), 4000-20,000 in snow (snow droplets are 1,000-5,000 microns in radial size) and 20,000-400,000 in hail (hail droplets are 5,000-50,000 microns in radial size).
[0423] But the corresponding (values at about 780 nanometers wavelength can be about 2 times higher than at about 1550 nanometers. It should be noted that one or more single photon avalanche diodes or an array of single photon avalanche diodes in visible wavelength are commercially available.
[0424] A continuous/quasi-continuous wave (wavelength tunable) laser based computational camera can be operable/integrated with an optical time gated imaging system (OTGS) that includes a laser (e.g., a pulsed laser or a cooled/uncooled distributed feedback laser within a suitable wavelength range) and a first imager/camera (which is time synchronized with respect to the laser). A first imager/camera can include one or more photodiodes/single photon avalanche diodes.
[0425] Furthermore, by setting a delay between the laser illumination and image acquisition by a first imager/camera, the viewing environment can be sliced into images that contain only a certain distance range.
[0426] Alternatively to an optical time gated imaging system, an optical interference imaging system (OHS) may also include (i) a laser of a suitable coherence length, (ii) an optical beam splitter, (iii) an amplitude (intensity) modulator and/or a phase modulator (generally in a reference arm for wavefront shaping), (iv) an optical path length matching element (generally in a reference arm), wherein the optical path length and/or polarization are matched to the backscattered light (due to scattering of the transmitted laser beam in the viewing environment via destructive interference) and (v) a second imager/camera.
[0427] An optical interference imaging system generally splits a beam of a pulsed laser into twin parallel laser beamsa first laser beam and a second laser beam, wherein the first laser beam can be utilized to illuminate a target and the second laser beam can be utilized to clean up an image by superimposing the first laser beam with the second laser beam by destructive interference.
[0428] It should be noted that an optical interference imaging system may be limited in its performance, if both shock and vibration are prevalent in the operating environment.
[0429] Vibration can be either random and/or sinusoidal. A well-designed rugged chassis may be needed to protect an optical interference imaging system against random vibration and sinusoidal vibration per MIL-STD 810F, MIL-STD-167 and MIL-STD 901D. Air springs may be used for low-frequency applications on the order of just a few Hertz. Elastomeric isolators may be useful. if only vibration isolation is needed. For heavy shock and vibration, wire rope coil isolators may be effective and rope coil isolators are not affected by temperature extremes.
[0430] A second imager/camera can include one or more photodiodes. A second imager/camera can be charged coupled device (CCD) based. However, a charged coupled device based camera may require cooling to about(minus) 110 C.
[0431] In general, a complementary metal oxide semiconductor camera is the first choice for high frame rates and especially low noise at high frame rates. A charged coupled device based camera may be replaced by a complementary metal oxide semiconductor camera.
[0432] Furthermore, a compact image correlator (for comparing two optical signals by utilizing the Fourier Transforming properties of a lens) can be fabricated/constructed by stacking one more first plane of diffractive lenses on top of a second plane consisting of (i) one or more compact/faster spatial light modulators and (ii) a second imager/camera.
[0433] A compact/faster spatial light modulator can be fabricated/constructed utilizing a two-dimensional array of Fabry Perot PiN diodes, wherein the two-dimensional array of Fabry Perot PiN diodes is electrically driven by (bump bonded) complementary metal oxide semiconductor application specific integrated circuit chip.
[0434] An image correlator can automatically recognize or identify the contents of an image by combining an incoming image with a reference image and the degree of correlation after combining the images determining the intensity of an output light beam. An image correlator can be used for target tracking and identification. An image correlator can be coupled with a System on Chip 400A/400B/400C/400D and/or a photonic neural learning processor (various embodiments of a photonic neural learning processor have been described/disclosed in the later paragraphs) and/or a deep learning (neural networks).
[0435] It should be noted that a System on Chip 400A/400B/400C/400D and/or a photonic neural learning processor may be replaced by a System on Chip (SoC), wherein the System on Chip can include (via integration, co-integration on a same platform/substrate/multichip module (MCM) or even communicatively interfaced with) one or more multipliers of matrices and/or graphic processors.
[0436] In one embodiment many graphic processors can be stacked in a three-dimensional arrangement for scaling the performance. It should be noted that a three-dimensional arrangement can include a vertical arrangement.
[0437] A possible method of a three-dimensional arrangement/vertical arrangement is hybrid bonding.
[0438] In hybrid bonding, copper pads can be built on the top face of each (extremely flat via chemical mechanical planarization (CMP)) chip. These copper pads can be surrounded by silicon oxide or silicon carbonitride and these copper pads themselves are slightly (nanoscaled) recessed from the surface of silicon oxide or silicon carbonitride. Two chips (extremely flat) can be pressed together face-to-face, so that the recessed copper pads on each (extremely flat) chip align. This sandwich structure is then slowly heated/annealed at a relatively high temperature (e.g., about 300 degrees centigrade), causing the copper pads to expand across the gap and fuse, connecting the two (extremely flat) chips at about 2 to 5 microns pitch.
[0439] Although, the copper pads from two (extremely flat) chips can align/press together to form an electrical connection, copper metal's grain boundaries generally may not easily cross from one side of one (extremely flat) chip to the other side of another (extremely flat) chip to merge as large single grains of copper to form across the boundary to improve electrical conductance and stability.
[0440] However, copper can be replaced by a suitable nanocomposite (e.g., consisting of (i) a polystyrene-block-polymethylmethacrylate and iron compounds or (ii) polystyrene and gold nanoparticles or (iii) polymethylmethacrylate and gold nanoparticles).
[0441] Alternatively the graphic processors can be coupled with an optical switch or an optical interface, wherein the optical interface can include light sources and photodiodes.
[0442] Alternatively, the graphic processors can be on a multichip module, wherein the multichip module includes an array of light sources, an array of photodiodes and an array of lenses.
[0443] Details of an optical switch, an optical interface and the multichip module have been described/disclosed in U.S. Non-Provisional patent application Ser. No. 17/803,388 entitled SUPER SYSTEM ON CHIP, filed on Jun. 15, 2022 and in its related U.S. non-provisional patent applications (with all benefit provisional patent applications) are incorporated in its entirety herein with this application.
[0444] Furthermore the System on Chip can include a processor-specific electronic integrated circuit, (a processor-specific electronic integrated circuit can also include one or more processing cores and one or more memory units, wherein at least one of one or more processing cores and at least one of one or more memory units can be intertwined either in a two-dimensional arrangement or a three-dimensional arrangement, wherein at least one of one or more memory units can include one or more memory elements, wherein at least one of one or more memory elements can include one or more memory circuits).
[0445] Details of the System on Chip including a multiplier of matrices and/or graphic processor have been described/disclosed in U.S. non-provisional patent application Ser. No. 18/445,647 entitled INTELLIGENT (SELF-LEARNING) SUBSYSTEM IN ACCESS NETWORKS, filed on Dec. 9, 2023 and in its related U.S. non-provisional patent applications (with all benefit provisional patent applications) are incorporated in its entirety herein with this application.
[0446] Furthermore, it should be noted that a System on Chip 400A/400B/400C/400D and/or a photonic neural learning processor may be augmented with a quantum computing system that includes a quantum processing unit (QPU) of qubits.
[0447] For example, the trapped ions are among the most promising systems for practical quantum computing systems. Benefits of trapped ions based for practical quantum computing system may include [0448] Highest Gate Fidelities [0449] Full Connectivity Between qubits [0450] Longest Coherence Time [0451] Moderate Temperature: 10K [0452] Shuttling CapabilityThis brings arbitrary combinations of qubits together for calculations. Therefore, it may constitute an important ingredient towards large-scale trapped-ion quantum processors.
[0453] A quantum processing unit of a chain of single ions in a cryogenic vacuum may also include a chip-scale electronic integrated input/output circuit (EIC-I/O) and a chip-scale photonic integrated input/output circuit (PIC-I/O).
[0454] A chain of single ions for a quantum processing unit can be created by local ionization of neutral atoms (e.g., Ca, Ba, Be or Sr). Since ions are charged, they can be controlled by electrical fields or electromagnetic fields in chip-scale ion traps for loading and trapping of ions.
[0455] Generally, a chip-scale electronic integrated input/output circuit can include monolithically integrated (i) trench capacitors for electrical filtering, (ii) through substrate vias for electrical connections to route voltage signals around the ion traps and current lines to generate magnetic fields, (iii) on-chip digital-to-analog converters (DACs), (iv) on-chip analog processing circuits, (v) on-chip digital processing circuits and (vi) on-chip avalanche photodiodes (APDs) to detect fluorescence from the ion traps.
[0456] Generally, a chip-scale photonic integrated input/output circuit can include monolithically integrated (i) different and distinct low-loss and smooth-edged optical waveguides (e.g., made of silicon nitride (SiNx) gallium nitride (GaN), aluminum nitride (AlN), lithium niobate (LiNbO.sub.3) or alumina (Al.sub.2O.sub.3)) (ii) vertical grating couplers for each distinct wavelength (color) (with inputs from a low-loss optical ring resonator(s) based optical switch and/or an array of modulators and/or an array of semiconductor lasers in UV to visible wavelength (color)) to allow a laser beam of a distinct wavelength (color) through a hole (e.g., fabricated in a metal thin-film) of a chip-scale photonic integrated input/output circuit to reach and manipulate the ion trap, located on top of the hole. The hole can be designed to reduce light diffraction for reduced cross talk. However, an array of semiconductor lasers can be optically coupled with a chip-scale photonic integrated input/output circuit via low-loss spot-size converters (e.g., inverse taper type spot-size converters with knife-edge tapers).
[0457] Furthermore, the vertical grating couplers for each distinct wavelength (color) can be located at a fraction of a micron below the ion trap.
[0458] Furthermore, an ultrafast optical switch with about nanoseconds optical switching time can be fabricated/constructed utilizing Mach-Zehnder interferometer with a phase transition material (e.g., vanadium dioxide) in UV to visible wavelength (color) range.
[0459] Details of an ultrafast optical switch have been described/disclosed in U.S. non-provisional patent applications Nos. FAST OPTICAL SWITCH AND ITS APPLICATIONS IN OPTICAL COMMUNICATION, U.S. patent application Ser. Nos. 16/501,191 and 16/501,189, filed on Mar. 5, 2019.
[0460] The coherence length of a laser is related to the linewidth of a laser. Thus, a long coherence length laser is generally a single mode laser. As to a suitable coherence length, a multi mode helium neon laser can have a coherence length of about 0.2 meters. The coherence length of a single mode laser (e.g., a distributed feedback laser in 1550 nanometers wavelength) or a diode pumped solid state laser (DPSS) can exceed 100 meters. A single mode fiber laser can have a coherence length exceeding 100 Kmeters. However, the theoretical limit of coherence length is generally set by Schawlow-Townes linewidth, based on unavoidable quantum noise.
[0461] An optical path length matching element can be an optical delay line such as (i) single-mode fiber (which is wound up to a coil and placed in a compact housing) or (ii) grating assisted contra-directional couplers integrated with an ultra compact reflector or (iii) slow light (e.g., light with a strongly reduced group velocity usually within a vicinity of narrow wavelength resonance).
[0462] A time delay can be a tunable in a wide wavelength range, utilizing photonic metamaterials. Photonic metamaterials are generally artificially engineered optical materials that may include nanostructures.
[0463] Polarization insensitive acousto optic modulators (AOMs) generally in a reference path can balance/cancel phases due to scattering of the transmitted laser beam in the viewing environment. By utilizing a pair of polarization insensitive acousto optic modulators in tandem and properly aligning them, it is possible to construct/fabricate an optical phase shifter to directly control the phase of a collimated beam of the laser beam. It should be noted that the incident laser beam is diffracted (for first order diffraction with a positive frequency shift) by a first acousto optic modulator and then first diffraction order is now the incident beam of a second acousto optic modulator in tandem (for first order diffraction with a negative frequency shift). The radio frequency driving signals to a pair of polarization insensitive acousto optic modulators in tandem can be of same frequency, but there can be a phase delay between the radio frequency driving signals.
[0464] An optical interference imaging system may include a spatial light modulator (e.g., a ferroelectric liquid crystal/liquid crystal based spatial light modulator) in the transmitted laser beam path to an object or alternatively, in the reflected/scattered beam path to a second imager/camera. A compact/faster spatial light modulator can be fabricated/constructed utilizing a two-dimensional array of Fabry Perot PiN diodes, wherein the two-dimensional array of Fabry Perot PiN diodes is electrically driven by (bump bonded) complementary metal oxide semiconductor application specific integrated circuit chip. A spatial light modulator along with an optimization algorithm (e.g., an iteration based optimization algorithm or an artificial neural network based optimization algorithm) may also enable wavefront shaping. A liquid crystal is a birefringent material. Applying a voltage to a cell of liquid crystals changes an effective refractive index seen by an incident light beam (wave). Hence, the phase retardation of the reflected light beam (wave). Usually, a spatial light modulator modulates the intensity of the light beam (wave). However, it is also possible to modulate a phase of the light beam (wave) or both the intensity and the phase simultaneously of the light beam (wave). Furthermore, a spatial light modulator can be electrically controlled (e.g., illustrated in
[0465] A continuous/quasi-continuous wave (wavelength tunable) laser based computational camera can be operable/integrated with an optical wavefront shaping system (OWSS), wherein a laser's transmitted beam is optically coupled with a spatial light modulator or a digital mirror device. The transmitted beam can be projected onto an object in any weather condition (including harsh weather/environmental conditionssuch as rain/fog/snow) and reflected/scattered light can be imaged onto a third imager/camera.
[0466] The third imager/camera can be coupled with the above spatial light modulator (or the digital mirror device) by Super System On Chip 400A/400B/400C/400D or a photonic neural learning processor (various embodiments of a photonic neural learning processor have been described/disclosed in the later paragraphs) and an optimization algorithm (e.g., a genetic algorithm and/or Poisson flow generative model++ or an evolutionary based algorithm or Vision Transformer in a low signal-to-noise environment). Details of Poisson flow generative model++ have been discussed in the later paragraphs.
[0467] A continuous/quasi-continuous wave (wavelength tunable) laser based computational camera can be operable/integrated with a digital optical phase conjugator and/or an optical coherence tomography based system (or a module in a miniature form factor)this combination may enable an unprecedented imaging performance in any weather condition (including harsh weather/environmental conditionssuch as rain/fog/snow). Such integration may be possible utilizing a superluminescent diode coupled with optical waveguides on a silicon photonics manufacturing platform.
[0468] It should be noted that a quantum imaging system can be utilized to view an object in any weather condition (including harsh weather/environmental conditions. Details of a quantum imaging system based on entangled single photons have been described/disclosed in the later paragraphs.
[0469] A continuous/quasi-continuous wave (wavelength tunable) laser based computational camera may include a parallel architecture, wherein a continuous/quasi-continuous wave (wavelength tunable) laser with triangular frequency modulation can be amplified, split and coupled into two distinct diameters based optical microresonators, a first one is acting as signal and a second one is acting as a local oscillator. The signal comb can be spatially dispersed over a target area via dispersive optics (e.g., refractive or diffractive optics). Each signal comb tooth (with an optical frequency) represents an independent channelall channels are then simultaneously superimposed with the local oscillator comb on a coherent receiver. Furthermore, the dispersive optics may include an optical component such as an optical phased array, a slow light photonic crystal waveguides based optical phased array (SL-PCW-OPA), an array of vertical couplers, an array of nanoscaled antennas, a metamaterial surface and a Rotman lens. It should be noted that the above parallel architecture can be integrated on a chip scale utilizing heterogeneous/hybrid integration of semiconductor (diode) lasers, gain chips and microresonators on a silicon photonics platform.
[0470] Furthermore continuous/quasi-continuous wave (wavelength tunable) laser based computational camera can be operable/integrated with a thermal imaging camera typically operating in a wavelength range of about 8 microns to 14 microns and/or an imaging camera in a wavelength range of about 1.3 microns to 1.55 microns.
[0471] For example, an imaging camera in a wavelength range of about 1.3 microns to 1.55 microns may utilize an infrared imager that includes an array of (i) PbSSi photo-FinFETs on Si-on-Insulator (SOI) or (ii) InGaAs PiN photodiodes. An example of a photo-FinFET fabrication/construction is as follows: an SOI substrate can be utilized to fabricate the photo-FinFET. Si channels can be defined by lithography and dry etching. Using the Si channel as a lithography reference, a drain electrode of Cr (5 nanometers)/Au (100 nanometers) and a source electrode of Cr (5 nanometers)/Au (100 nanometers) can be defined by electron beam evaporation and lift-off process. The entire backside gate of the above SOI substrate can be metallized with Cr (5 nanometers)/Au (100 nanometers). Finally, a thin-film of PbS can be grown/deposited on the top side of the above SOI substrate by a chemical bath deposition (CBD) process or an atomic layer deposition process.
[0472] For higher performance, an array of InGaAs PiN photodiodes can be coupled with an array of microlens array. An array of microlens array can be fabricated on an ultra-thin glass substrate (e.g., about 150 microns in thickness) by inkjet printing of a suitable polymer material for microlens. This substrate (of an array of microlens) can be bonded on top of an array of InGaAs PiN photodiodes (top surface an array of InGaAs PiN photodiodes can be passivated by SiNx thin-film for realizing lower dark current) utilizing cured polydimethylsiloxane.
[0473] However, it may be a cheaper solution to up-convert (e.g., utilizing a metasurface that can include SiO.sub.2 gratings on top of a thin-film of a material with high nonlinear coefficients (e.g., GaP, InGaP or LiNbO.sub.3)) a thermal image (in a wavelength range of about 1.3 microns to 1.55 microns) into a visible image and utilize an array of silicon photodiodes in visible wavelength.
[0474] An imaging camera can include a light source (e.g., a laser) and an array of imaging pixels, wherein each imaging pixel is made of a SiGe material or a quantum dot. Such integration may help in enhancing and capabilities of a continuous/quasi-continuous wave (wavelength tunable) laser based computational camera.
[0475] Furthermore, for example, a Van der Waals heterostructure of black phosphorous (BP) and molybdenum disulfide (MoS.sub.2) based photodetector stacked on top of a non-volatile and programmable floating-gate memory transistor architecture may enable a collision sensor. Such as a collision sensor can be coupled with the (i) (non-optically coupled) Super System on Chip 400A/400B/400C/400D or (ii) optically coupled Super System on Chip or (iii) one or more central processors, wherein at least one of one or more central processor includes one or more (i) processing cores and (ii) memory units, wherein at least one of one or more processing cores and at least one of one or more memory units are coupled in an intertwined pattern in a two-dimensional arrangement or a three-dimensional arrangement, wherein at least one of one or more memory units includes one or more memory elements, wherein at least one of one or more memory elements includes one or more memory circuits. Such integration may help in enhancing and capabilities of a continuous/quasi-continuous wave (wavelength tunable) laser based computational camera.
[0476] It should be noted that a central processor has electronic circuits, which can generally execute such as arithmetic, logic, controlling and input/output (110) operations. A graphic processor has electronic circuits, which can generally execute such as digital image processing, computer graphics and parallel processing.
[0477] Furthermore, a continuous/quasi-continuous wave (wavelength tunable) laser based computational camera can be operable/integrated with (i) a multi-frequency band radar sensor or (ii) an imaging radar sensor or (iii) a ground penetrating radar sensor or (iv) a sub-terahertz imaging system, wherein the imaging radar sensor includes a radio frequency complementary metal oxide semiconductor based integrated circuit and a radar processor, wherein the radar processor includes a linear algebraic radar accelerator, wherein the sub-terahertz imaging system includes a transmitter at a sub-terahertz wavelength and one or more receivers at the sub-terahertz wavelength, wherein at least one receiver includes a heterodyne detector.
[0478] Furthermore, a continuous/quasi-continuous wave (wavelength tunable) laser based computational camera can be operable/integrated with a bio-mimicking (bio-inspired) camera or a metamaterial camera or a neuromorphic camera or a quantum imaging camera to improve its performance and capability, wherein the neuromorphic camera includes camera pixels (wherein the camera pixels of the neuromorphic camera can be communicatively interfaced with the Super System on Chip or the photonic neural learning processor to improve its performance and capability).
[0479] Additionally, a continuous/quasi-continuous wave (wavelength tunable) laser based computational camera can be operable/integrated with a bio-mimicking (bio-inspired) neuromorphic event camera. An event camera can be considered as a bio-mimicking (bio-inspired) neuromorphic sensor that is distinctly different from a conventional fixed frame camera. Instead of capturing an image at a fixed frame rate, a bio-mimicking (bio-inspired) neuromorphic event camera's optoelectronic synapse based light sensors (e.g., an array of detectors) asynchronously measure/detect per-pixel brightness changes and then provide an output as a stream of events that is encoded in time, location and brightness changes. A bio-mimicking (bio-inspired) neuromorphic event camera offers attractive properties compared to a fixed frame traditional camera at least in high temporal resolution (in the order of microseconds), very high dynamic range (140 dB vs. 60 dB), low power consumption and high pixel bandwidth (on the order of kHz) resulting in reduced motion blur. Thus, a bio-mimicking (bio-inspired) neuromorphic event camera may have a significant potential for computer vision in challenging scenarios for traditional cameras, such as low-latency, high speed and high dynamic range. For example, oxide Schottky junction (e.g., graphene/ITO electrodes on Nb (about 1 wt % Nb) doped single crystal SrTiO.sub.3) based optoelectronic synapse based light sensors can enable a (bio-mimicking (bio-inspired) neuromorphic event camera via light field modulation and electric field modulation of the Schottky barrier at the graphene/ITO electrodes/Nb:SrTiO3 interface.
[0480] Furthermore, a bio-mimicking (bio-inspired) neuromorphic event camera can be communicatively interfaced with the Super System on Chip or the photonic neural learning processor to improve its performance and capability.
[0481] Generally, a hyperspectral imager system may require a digital micromirror (DMD), two relay lenses, diffraction gratings and a hyperspectral sensor (a hyperspectral sensor may include an array of photodetectors). The images obtained from a hyperspectral imager system may be compared with the images obtained from a multi-spectral imager system.
[0482] According to one embodiment, to fabricate/construct a large scale hyperspectral imager system/chip, an arrayed waveguide grating (AWG) or Echelle gratings based spectrophotometer integrated with (i) a vertical aperture with a 45-degree angle mirror for light coupling, (ii) an array of photodetectors, (iii) an array of preamplifiers with the array of photodetectors, if needed for gain and (iv) an array of readout circuits can be arranged in a two-dimensional arrangement with an array of lenses/metalenses.
[0483] Furthermore, the hyperspectral imager system/chip can be communicatively interfaced with (i) a first set of computer implementable instructions in artificial intelligence or machine learning or deep learning and/or (ii) a second set of computer implementable instructions in computer vision or Vision Transformer, wherein the first set of computer implementable instructions and the second set of computer implementable instructions may be stored in a local non-transitory storage media locally or on a cloud based non-transitory storage media.
[0484] Furthermore, a target object may be illuminated by a light source (e.g., a laser of a suitable wavelength) for imaging by the hyperspectral imager system/chip.
[0485] A quantum imaging system can generally include the following: [0486] (i) a first single photon and a second single photon (e.g., they can be produced by a laser beam incident either upon a nonlinear optical material or a nitrogen vacancy (NV) color center in a diamond thin-film) and [0487] wherein the first single photon and the second single photon may have distinctly different wavelengths and they may be separated by an optical filter/mirror, [0488] wherein the first single photon and the second single photon are quantum entangled/quantum correlated, [0489] wherein the first single photon is a transmitted signal toward an object (via an optical component (e.g., an optical phased array or a slow light based photonic crystal waveguides based optical phased array or an array of vertical couplers or an array of slow light deflectors or an array of nanoscaled antennas or a metamaterial surface or a Rotman lens)), [0490] wherein the second single photon is a non-transmitted stationary signal, [0491] (ii) one or more single photon avalanche diodes (SPADs) or photon number resolving detectors (PNRDs) or complementary metal oxide semiconductor (CMOS) based imaging pixels to detect the first single photon that is reflected from the object. But, if there is an aberration of an image, an adaptive optical component (e.g., a spatial light modulator) can be utilized to correct for the aberration. An adaptive optical component may require a bright spot (a Guide Star) for correlation and correction. But in the case of microscopy, such a bright spot may be possible utilizing a fluorescent bead (e.g., polysciences' one micron diameter Fluoresbrite YG carboxylate microspheres). Alternatively, a set of computer implementable instruction can be utilized for bright spot free (guide free) to correct for the aberration to image through turbid media with noisy signals, which may require (i) a first optimization algorithm from an initial image to a final image and (ii) a second algorithm that will ensure the convergence of very large number of (controllable) degrees of freedom. At least the first optimization algorithm and/or the second optimization algorithm can also include an evolutionary based algorithm stored in a non-transitory media (which can be located locally or in a cloud storage).
[0492] Furthermore, the nitrogen vacancy color center may be coupled with an optical out-coupler structure (e.g., a patterned semiconductor). Additionally, the nitrogen vacancy color center may be coupled with a nanoscaled optical antenna and/or a metamaterial and/or a photonic crystal.
[0493] Alternatively, a quantum imaging system can generally include the following: [0494] (a) a photonic qubit A trapped in a first photonic crystal of a nonlinear optical material of a first optical waveguide or a first whispering gallery mode (WGM) resonator of the nonlinear optical material or a first microring resonator of the nonlinear optical material, and [0495] (b) photonic qubit B trapped in a second photonic crystal of the nonlinear optical material of a second optical waveguide or a second whispering gallery mode resonator of the nonlinear optical material or a second microring resonator of the nonlinear optical material, [0496] wherein the photonic qubit A and the photonic qubit B are quantum entangled/quantum correlated, [0497] wherein the first optical waveguide and the second optical waveguide can be perpendicular to each other within a manufacturing tolerance, [0498] wherein the first photonic crystal or the second photonic crystal can be a topologically protected photonic crystal.
[0499] A thermal imaging camera typically operating in a wavelength range of 8 microns to 14 microns and/or an imaging camera typically operating in a wavelength range of about 1.3 microns to 1.55 microns and/or a metamaterial camera (including one or more metasurfaces) and/or a digital optical phase conjugator and/or an optical coherence tomography based system (or a module in a miniature form factor and/or a radar sensor can be integrated (e.g., at least on a multichip module). Generally, a multichip module includes a common platform/substrate of various connected chips.
[0500] A continuous/quasi-continuous wave (wavelength tunable) laser based computational camera can include a System on Chip 400A/400B/400C/400D and/or a photonic neural learning processor (various embodiments of a photonic neural learning processor have been described/disclosed in the later paragraphs).
[0501] A continuous/quasi-continuous wave (wavelength tunable) laser based computational camera can include a quantum imaging camera (various embodiments of a quantum imaging sensor have been described/disclosed in the later paragraphs). Furthermore, the quantum imaging camera can include an optical component such as an optical phased array, a slow light photonic crystal waveguides based optical phased array, an array of vertical couplers, an array of nanoscaled antennas, a metamaterial surface and a Rotman lens for transmitting single photons toward an object in any weather condition (including harsh weather/environmental conditionssuch as rain/fog/snow).
[0502] A continuous/quasi-continuous wave (wavelength tunable) laser based computational camera can include a first set of computer implementable instructions that includes artificial intelligence or artificial neural networks or machine learning or deep learning, wherein the first set of computer implementable instructions are stored in one or more non-transitory storage media.
[0503] A continuous/quasi-continuous wave (wavelength tunable) laser based computational camera can include a second set of computer implementable instructions to detect an object in an environment, wherein the second set of computer implementable instructions that includes signal filtering and/or of light scattering, wherein the second set of computer implementable instructions are stored in one or more non-transitory storage media.
[0504] A continuous/quasi-continuous wave (wavelength tunable) laser based computational camera can include a third set of computer implementable instructions that includes evolutionary instructions or self-learning instructions, wherein the third set of computer implementable instructions are stored in one or more non-transitory storage media.
[0505] A continuous/quasi-continuous wave (wavelength tunable) laser based computational camera can include a fourth set of computer implementable instructions that includes computer vision or Vision Transformer, wherein the fourth set of computer implementable instructions are stored in one or more non-transitory storage media.
[0506] The first set of computer implementable instructions and/or second set of computer implementable instructions and/or third set of computer implementable instructions and/or fourth set of computer implementable instructions may enable [0507] Environment Identification [0508] Merging & Analysis of Various Raw Sensor Data [0509] Classification & Segmentation of Various Raw Sensor Data [0510] Decision & Planning [0511] Execution & Actuation.
[0512] Furthermore, utilizing (i) a single wavelength tunable/frequency modulated/long coherence length distributed feedback laser/distributed Bragg reflector laser or an array of wavelength tunable/frequency modulated/long coherence length distributed feedback lasers/distributed Bragg reflector lasers, (ii) a first array/network of optical switches or a first arrayed waveguide grating router, (iii) a first beam shaping optical system, (iv) an array of balanced photodetectors, (v) a second array/network of optical switches or a second arrayed waveguide grating router, (vi) a first beam shaping optical system can be a compact (even entirely chip scaled on indium phosphide/silicon photonic based fabrication, except the first beam shaping optical system and the second beam shaping optical system) flash illumination based frequency modulated continuous/quasi-continuous wave computational camera. However, to increase the output power, a single wavelength tunable/frequency modulated/long coherence length distributed feedback laser can be integrated in a master oscillator-power amplifier arrangement or with a semiconductor optical amplifier (as generally illustrated in
[0513] Various combinations/arrangements of a modulator and a semiconductor optical amplifier are also possible to maximize the (exit) output power and reduce the back reflection from the semiconductor optical amplifier into a distributed feedback laser.
[0514] Alternatively, instead of flash illumination, an optical beam steering by a microelectromechanical system based mirror or microelectromechanical system based switchable gratings can be utilized.
[0515] A microelectromechanical system based switchable grating can generally include a grating and an optical waveguide, wherein the grating can be suspended above an optical waveguide, wherein the grating can be vertically positioned up to transmit a light beam of the continuous/quasi-continuous wave laser or vertically positioned down to couple with the light beam of the continuous/quasi-continuous wave laser with the optical waveguide.
[0516] It should be noted that a slow light Bragg (reflector based) deflector (with gratings) can be added with a continuous/quasi-continuous wave laser for laser beam steering. Similarly, an array of slow light waveguide deflectors (with an optical gain) coupled with a cylindrical lens can be added with a continuous/quasi-continuous wave laser for laser beam steering. Furthermore, a slow light photonic crystal waveguides (including lattice shifted photonic crystal waveguides in parallel on a substrate) based optical phased array can be fabricated/constructed for laser beam steeringthis arrangement may require an aberration free prism. In stead of slow light photonic crystal waveguides fabricated/constructed in parallel on a substrate, a surface normal two-dimensional slow light photonic crystal waveguides based optical phased array may be realized.
[0517] Furthermore, a microelectromechanical system based switchable grating can be replaced by an optical phased array (including slow light photonic crystal waveguides based optical phased array) or an array of vertical couplers or an array of slow light deflectors or an array of nanoscaled antennas or a metamaterial surface or a Rotman lens. Various embodiments of an optical phased array have been described/disclosed in this specification.
[0518] Furthermore, numerous variations and/or modifications are possible within the scope of a continuous/quasi-continuous wave (wavelength tunable) laser based computational camera.
[0519] As described/disclosed in this specification, a continuous/quasi-continuous wave (wavelength tunable) laser based computational camera can include (i) a transparent metal for pulsed heating or (ii) a nanostructure for defrosting or deicing a front optical surface of the imaging subsystem or (iii) an air jet agitator and/or (iv) an ultrasonic agitator for cleaning a front optical surface of the imaging subsystem.
[0520] A continuous/quasi-continuous wave (wavelength tunable) laser based computational camera can be mechanically coupled with or housed in (i) a side mirror of a vehicle system or (ii) a first head light/first taillight of the vehicle system or (iii) a second head light/second taillight of the vehicle system. A first head light/first taillight can include (i) a first micromirror and a first light emitting diode or (ii) an array of first microlight emitting diodes (First LEDs). A second head light/second taillight can include (i) a second micromirror and a second light emitting diode or (ii) an array of second microlight emitting diodes (Second LEDs).
[0521] A continuous/quasi-continuous wave (wavelength tunable) laser based computational camera can be housed in (i) a bumper or (ii) a grill or (iii) a roof or (iv) a roof shell (wherein the roof shell includes a glass enclosure) or placed in a proximity to a windshield.
[0522] The vehicle system can include (i) a body material of graphene comprising carbon-fiber reinforced epoxy resin or (ii) a body material of graphene-like material comprising carbon-fiber reinforced epoxy resin or (iii) a body material of synthetic silk comprising carbon-fiber reinforced epoxy resin. The body material further includes ultracapacitors (supercapacitors). The vehicle system can be electrically charged by electromagnetic induction.
[0523] The vehicle system can include photovoltaic modules, wherein each photovoltaic module can include (i) a first nanostructured surface or (ii) a first nanostructured material. The vehicle system further can include photosynthesis modules, wherein each photosynthesis module can include (i) a second nanostructured surface or (ii) a second nanostructured material.
[0524] The vehicle system can include a battery (the battery can include a nanotube electrode) or a hydrogen fuel cell or an electric power conversion chemical cell.
[0525] The electric power conversion chemical cell can be generally a hydrogen producing source. The vehicle system can be powered by hydrogen or metallic hydrogen.
[0526] The vehicle system further can include a viewing window, wherein light transmission through the viewing window is electro-optically controlled.
[0527] The vehicle system can include a camera or a sensor to monitor eye movements of a user in the vehicle system.
[0528] The vehicle system can recommend a service to a user by anticipating a need of the user or (ii) enable proximity based payment.
[0529] As discussed in the previous paragraphs, the vehicle system can be coupled with a network of vehicle to everything to enable road safety applications such as: [0530] Forward Collision Warning [0531] Lane Change Warning [0532] Blind Spot Warning [0533] Emergency Warning [0534] Intersection Movement Warning [0535] Emergency Vehicle Approaching [0536] Roadworks Warning
Furthermore, a network of vehicle to everything can be coupled with a Recommendation Engine (as discussed in the later paragraphs).
[0537] A vehicle to everything network can allow exchanging any location information with any vehicle system and potentially cyclists and pedestrians, as well as with the roadway infrastructure itself. Users could send and receive frequent messages to and from each other, continuously sharing information about speed, position and road conditionseven in situations with poor visibility, including around corners or in dense fog or heavy rain.
[0538] Furthermore, the vehicle system can be an autonomous vehicle system, as a part of a network of autonomous vehicle systems.
[0539] The vehicle system/continuous/quasi-continuous wave (wavelength tunable) laser based computational camera can be context-aware or sensor aware.
[0540] A coherent optical (pulse) beam combiner can be actively controlled or passively controlled. FIG. 3U5 illustrates another embodiment of a very high power (e.g., up to 300 watts) wavelength tunable pulsed laser module, utilizing an (active) coherent optical (pulse) beam combiner (COBC). In FIG. 3U5, a wavelength tunable (pulsed) laser (oscillator) is optically coupled with an optical pulse stretcher, which is optically coupled with a multiple optical beam (pulse) generator. Each optical (pulse) beam is optically coupled with an optical phase controller (which is coupled with a dynamic opto-electronic controller, which is then coupled with an optical phase detector) and an optical amplifier. Finally, multiple optical (pulse) beams are combined by an optical (pulse) beam combiner, which is then optically coupled with an optical pulse compressor. Alternatively, a master oscillator (laser) can be optically coupled with an array of phase modulators, wherein each phase modulator is then optically coupled with a semiconductor optical amplifier. The output of the array of the semiconductor optical amplifiers can be optically combined by an optical combiner and then propagated through a collimating lens. The output of the collimating lens can be coupled with an efficient diffractive optical element. The diffracted laser output from the efficient diffractive optical element is divided into two optical beams of 95% and 5% intensity by an optical beam splitter. 5% of the diffracted laser output can be measured by a single photodetector. The output of the single photodetector can be coupled with a synchronous phase processor (synchronous phase processor is then coupled with the array of phase modulators).
[0541] FIG. 3U5 is an embodiment of an (active) coherent optical (pulse) beam combiner. It should be noted that a coherent optical (pulse) beam combiner can be expanded to both wavelength and time domains. Using a well-trained convolutional neural network or an evolutionary (genetic) based algorithm (as a deep learning algorithm), a phase error in a coherent optical (pulse) beam combiner could be estimated and preliminarily compensated. Then residual phase error, if any can be compensated by a stochastic parallel gradient descent (SPGD) algorithm. In general, an (active) coherent optical (pulse) beam combiner can be coupled with a deep learning algorithm and/or a stochastic parallel gradient descent algorithm for closed-loop compensation and/or optimization. Alternatively, a (passive) coherent optical (pulse) beam combiner can include several interferometric combiners.
[0542] An evolutionary based algorithm is an evolutionary computation in artificial intelligence. An evolutionary based algorithm functions through the (similar to biological) selection process in which the least fit members of the population set are eliminated, whereas the fit members are allowed to survive and continue until better solutions are determined.
[0543] In other words, an evolutionary based algorithm is a computer application which mimics the natural (biological) evolution in order to solve a complex problem. Over time, the successful members evolve to present the optimized solution to the complex problem. An evolutionary based algorithm is a meta-algorithm, an algorithm for designing algorithmseventually, the algorithms get pretty good at the task, based on three (3) pillars of innovation: [0544] 1. Meta-learning architectures (resulting in indirect coding) [0545] 2. Meta-learn learning algorithms (resulting in open ended search) [0546] 3. Generating effective learning environments (resulting in quality diversity).
[0547] The evolutionary based algorithm is a class of stochastic search and optimization techniques obtained by natural selection and genetics. It is a population based algorithm by simulating the natural (biological) evolution. Individuals in a population compete and exchange information with one another.
[0548] There are three basic genetic operations: selection, crossover and random mutation. For example, a procedure of an evolutionary based algorithm is as follows: [0549] Step 1: Set t=0 [0550] Step 2: Randomize the initial population P(t) [0551] Step 3: Evaluate the fitness of each individual of P(t) [0552] Step 4: Select individuals as parents from P(t+1) based on the fitness [0553] Step 5: Apply search operators (crossover and mutation) to parents and generate P(t+1) [0554] Step 6: Set t=t+1 [0555] Step 7: Repeat step 3 to step 6 until the termination criterion is satisfied.
[0556] It should be noted that a conventional deep learning algorithm utilizes stochastic gradient descent (SGD), which improves an artificial neural network's over time by gradually reducing errors through an ongoing training with an existing dataset(s)generally mapping inputs to outputs in known patterns over time, but it may not work properly in reinforcement learning (which is learning how to act/decide with only infrequent feedback signals or unknown outputs for given inputs without any pattern over time).
[0557] An artificial neuroevolution algorithm utilizes an evolutionary based algorithm (similar to biological Darwinian evolution inspired by nature) with added safe/random mutations to grow/evolve/generate an artificial neural network's layers/rules/topology/parameters for better computing optimized outcomes/results.
[0558] Random mutations (may initially degrade an artificial neuroevolution algorithm, before it improves) can allow evolving and reaching a decision toward achieving greater accuracy. Thus, an artificial neuroevolution algorithm can adapt dynamically and intelligently to unknown input signals.
[0559] Furthermore, an artificial neuroevolution algorithm can be coupled/connected with a cloud based expert system, as it requires significant computing power of a supercomputer.
[0560] Alternatively, an artificial neuroevolution algorithm can be coupled/connected with a quantum computer(s), as it is illustrated in FIGS. 64A-65C of U.S. non-provisional patent application Ser. No. 16/602,404 entitled SYSTEM AND METHOD OF AMBIENT/PERVASIVE USER/HEALTHCARE EXPERIENCE, filed on Sep. 28, 2019. A quantum computer(s) has essentially an exponential computing power.
[0561] Furthermore, an evolutionary based algorithm and/or Poisson flow generative model++ (incorporated with (i) an artificial intelligence algorithm and/or artificial neural network algorithm and (ii) and fuzzy logic algorithm) can enable intelligence and scenario analysis.
[0562] However, an artificial intelligence algorithm or an artificial neural network algorithm/deep learning algorithm may include a generative artificial intelligence/physics-inspired generative artificial intelligence model. But they are generally based on transformer model or diffusion model (e.g., Poisson flow generative model++) and can be broadly classified as an artificial neural network algorithm/deep learning algorithmwhich may be augmented with an evolutionary based algorithm and/or a game theory based algorithm (a game theory based algorithm may enable consensual interactions within a transformer model or a diffusion model for accuracy and reproducibility of output data) and/or Poisson flow generative model++.
[0563] Thus, they may enable a (personal) artificial intelligence based self-learning assistant. Poisson flow generative model++ can couple a diffusion model with Poisson's equation. Poisson flow generative model++ relies on physics-inspired formulations (e.g., coupled with the laws of electromagnetism/weak nuclear force/strong nuclear force or Coulomb's law). Poisson flow generative model++ may enable smaller training data sets than diffusion models, less error-prone and requiring fewer computational steps.
[0564] An evolutionary based algorithm is a heuristic-based approach in solving problems that cannot be easily solved in polynomial time and it is a kind of Monte-Carlo method. An evolutionary based algorithm generally utilizes mechanisms inspired by biological evolution (e.g., reproduction, mutation, recombination and selection).
[0565] Generally, game theory can be classified into two categories: (a) non-cooperative game, where a decision-making unit treats the other participants as competitors and (b) a cooperative game, where a group of decision-making units decide to undertake a decision together in order to achieve their shared objectives.
[0566] In game theory, individuals/groups/units become players, when their respective decisions coupled with the decisions made by other players, produce an outcome/output. The options available to players to bring about particular outcomes are called as strategies, which are linked to outcomes/outputs by a mathematical function that specifies the consequences of the various combinations of strategy choices by the all players in a game.
[0567] A coalition refers to the formation of sub-sets of players' options under coordinated strategies. In game theory, the core is the set of feasible allocations that cannot be improved upon by a coalition. An imputation X={x.sub.1, x.sub.2 . . . x.sub.n} is in the core of an n-person game if and only if for each subset, S of N:
where V(s) is the characteristic function V of the subset S indicating the amount (reward) that the members of S can be sure of receiving, if they act together and form a coalition (or the amount of S can get without any help from players who are not in S). Above equation states that an imputation x is the core (that X is undominated), if and only if for every coalition S, the total of the received by the players in S (according to X) is at least as large a V(S). The core (C) can also be defined by the equation below as the set of stable imputations:
The imputation x is unstable through a coalition S, if the equation below is true, otherwise is stable.
The core (C) can consist of many points. The size of the core can be taken as a measure of stability or how likely a negotiated agreement is prone to be upset. To determine the maximum penalty (cost) that a coalition in the network can be sure of receiving, the linear programming problem represented by the equation below can be used, when maximize x.sub.1+x.sub.2+x.sub.3+ . . . +x.sub.n
[0568] Thus, as outlined above, a game theory based algorithm can account for any conflict and produce accurate and reproducible output data.
[0569] Generally, all transformers have the same primary components: (i) Tokenizers, which convert text into tokens, (ii) A single embedding layer-converting tokens and positions of such tokens into vector representations, (iii) Transformer layers carrying out repeated transformations on the above vector representations-extracting linguistic information. These can consist of alternating attention and feedforward layers, (Optionally) (iv) Un-embedding layer that can convert the final vector representations back into a probability distribution over the tokens. Transformer layers can be encoder type or decoder-type or in some cases even both. Transformers typically undergo self-supervised learning involving unsupervised pretraining followed by supervised fine-tuning.
[0570] An evolutionary based algorithm can be coupled with room temperature qubits (as described/disclosed later) to further enhance intelligence and scenario analysis.
[0571] A real time image reconstruction algorithm (that can include a genetic algorithm and/or Poisson flow generative model++) can generally model how harsh weather/environmental conditionsrain/fog/snow affect the scattering of a laser light in a wavelength range, then the real time image reconstruction algorithm can eliminate such scattering to create a clear picture/image of what is actually ahead in harsh weather/environmental conditions.
[0572] Furthermore, a real time image reconstruction algorithm (incorporated with a near real time map/an augmented reality (AR) enhanced near real time map) can be utilized to detect an object in harsh weather/environmental conditionsrain/fog/snow. The real time image reconstruction algorithm may include a signal processing for (i) signal filtering and/or (ii) light scattering and/or (iii) calculating the distance to an object in harsh weather/environmental conditionsrain/fog/snow.
[0573] A coherent optical (pulse) beam combiner can be fabricated/constructed utilizing flip chip bonded semiconductor optical amplifier, as an optical amplifier on a common substrate (e.g., silicon on insulator).
[0574] Alternatively, a semiconductor disk laser (e.g., utilizing 100 microns thick Yb:YAG material and active multi-pass cell consisting of five (5) reflections) can replace a coherent optical beam combiner.
[0575] The high power (wavelength) tunable pulsed laser module can be miniaturized utilizing silicon/aluminum nitride/diamond/suitable material based optical bench.
[0576] It should be noted that a wavelength based optical (pulse) beam combiner can replace a coherent optical (pulse) beam combiner. For example, a wavelength (spectral) based optical (pulse) beam combiner can include a diffraction grating within an external cavity and an active feedback loop to be used with two or more pulsed laser modules (e.g., Febry Perot broad area laser modules).
[0577] However, the emitting facet of each pulsed laser module should have 0.1% anti-reflection coating to reduce any back reflection.
[0578] A laser array (e.g., 5/10 emitters in a one-dimensional array with 0.1% anti-reflection coating at the emitting laser facet) can be optically coupled with a wavelength (spectral) based optical (pulse) beam combiner, a first laser beam shaper (to convert a rectangular laser beam to a square laser beam) and then a second laser beam shaper to convert (the square laser beam to a divergent laser beam into 140 degree angle horizontally and 140 degree angle vertically). This arrangement can achieve up to 1,000 watts of pulsed laser output (e.g., 5/10 emitters in a one-dimensional array)enabling more than 200 meters of viewing distance for an object in harsh weather/environmental conditionsrain/fog/snow by a three-dimensional time-of-flight computational camera subsystem.
[0579] The above arrangement transforms a two-dimensional time-of-flight computational camera subsystem into a three-dimensional time-of-flight computational camera subsystem.
[0580] An expanded arrangement of the above can achieve up to 10,000 watts of pulsed laser output (e.g., incorporating 50/100 emitters in a two-dimensional array)enabling more than 200 meters of viewing distance for an object in harsh weather/environmental conditionsrain/fog/snow by a three-dimensional time-of-flight computational camera subsystem. Furthermore, incorporating a two-dimensional array of single photon avalanche diodes with the expanded arrangement, a non line-of-sight (oblique) view can be achieved by a three-dimensional time-of-flight computational camera subsystem.
[0581] Furthermore, an evolutionary based algorithm (incorporated with (i) an artificial intelligence algorithm and/or artificial neural network algorithm and (ii) and fuzzy logic algorithm) can enable intelligence and scenario analysis.
[0582] An evolutionary based algorithm can be coupled with room temperature qubits (as described/disclosed later) to further enhance intelligence and scenario analysis.
[0583] Furthermore, a real time image reconstruction algorithm (incorporated with a near real time map/an augmented reality (AR) enhanced near real time map) can be utilized to detect an object in harsh weather/environmental conditionsrain/fog/snow.
[0584] It should be noted that a collimating lens/receiving lens can be a metamaterial lens. A metamaterial lens consists of an ultrathin (e.g., about 1 micron in thickness) flat surface that is covered with an array of nanoscaled pillars or holes. As incident light hits these elements, many of its properties (e.g., polarization, intensity, phase and direction of propagation) change.
[0585] Furthermore, the laser material structure and/or gallium nitride material based/gallium nitride (doped/undoped)-aluminum nitride (AlN) heterostructure material based laser driver can be bonded onto the high heat dissipating silicon carbide (SiC) by atomic diffusion bonding. The in plane laser device can be realized by an etched laser facet (mirror). The out plane laser device can be realized by an etched laser facet (mirror) and vertical gratings coupler. For example, the atomic diffusion bonding for the laser material structure on silicon carbide is described below: [0586] The top layer of the laser material on indium phosphide substrate and the top surface of a temporary silicon substrate can be coated with tungsten of about 5 nanometers thick for atomic diffusion bonding inside a bonding system at about 10 kPa pressure at room temperature [0587] Indium phosphide substrate is removed in dilute hydrochloric acid (HCl) [0588] Underside exposed layer of the laser material structure and the top surface of a silicon carbide substrate can be coated with tungsten of about 5 nanometers thick for atomic diffusion bonding inside a bonding system at about 10 kPa pressure at room temperature [0589] The temporary silicon substrate is removed in potassium hydroxide (KOH) solution [0590] Exposed tungsten is removed by plasma etching in CF.sub.4 gas [0591] These steps complete the transfer of the laser material structure onto the silicon carbide substrate for in plane laser device by an etched laser facet (mirror) or the out plane laser device by an etched laser facet (mirror) and vertical gratings coupler.
[0592] Furthermore, the gallium nitride (doped with a dopant/impurity or even undoped)-aluminum nitride (AlN) heterostructure material based circuit (e.g., power amplifier (PA)) and/or silicon material based complementary metal oxide semiconductor and/or GaAs/InP material high-electron-mobility transistor (HEMT) can be integrated on a common substrate (e.g., a silicon/silicon on insulator/silicon on diamond/silicon carbide/diamond substrate) via multiple wafer bonding process to realize a Multi-Material Super System on Chip (MM SSoC), utilizing multiple silicon handle (carrier) wafers.
[0593] In the case of the gallium nitride (doped with a dopant/impurity or even undoped)-aluminum nitride heterostructure material on silicon, both field effect transistors and heat removing microchannels can be integrated and the heat removing microchannels can be fabricated/constructed just below the active area containing gallium nitride field effect transistors.
[0594] The general steps of such fabrication/construction are outlined below: Heterostructure material epitaxial layers on a silicon substrate
[Front Side of Wafer]
[0595] Deposition and patterning of many slit openings in (compressive stress) SiNx [0596] Anisotropic corresponding slit openings in heterostructure material epitaxial layers up to the silicon substrate [0597] Anisotropic corresponding deep slit openings in the silicon substrate (through the slit opening in GaN epitaxial layers) [0598] Isotropic openings in the silicon substrate (through the slit opening in heterostructure material epitaxial layers) [0599] Removal of SiNx [0600] Metallization for device (field effect transistors) [0601] Annealing of metallization for device [0602] Deposition of seed metallization (for electroplating) [0603] Patterning for electroplating in the slit openings in GaN epitaxial layers [0604] Removal of seed metallization (for electroplating) [0605] Completion of front side device fabrication [0606] Protection of front side device with SU8 layer
[Back Side of Wafer]
[0607] Etching of microchannels from the back of the silicon substrate
[0608] Similarly, gallium nitride material can be transferred onto the silicon carbide substrate for electrical circuit fabrication. Thus, the common silicon carbide substrate can be utilized for fabricating/constructing a laser device and electrical circuit. It should be noted that a similar scheme can be utilized to bond lithium niobate thin film on a silicon on insulator substratefor a composite silicon photonic substrate.
[0609] A single photon avalanche diode is a reverse biased avalanche photodiode biased above the avalanche breakdown voltage in the Geiger mode. In this mode, a single incident photon can generate an electron-hole pair to initiate a self-sustaining avalanche, rapidly generating a readily detectable current pulse. After each detection event, the avalanche current must be quenched to restore the detector in the quiescent state to detect the next single photon. Indium-Gallium-Arsenide/Indium-Phosphide (InGaAs/InP) can enable near room temperature operation single photon avalanche diode. The single photon avalanche diode can be integrated with thin-film optical filter, if needed.
[0610] One embodiment is to combine the low-noise silicon single photon avalanche multiplication with the infrared wavelength detection/absorption by a thick (3000 nanometers) germanium (Ge) layer.
[0611] FIG. 3V1 illustrates such an embodiment. There is a layer of n+ silicon on a high resistance silicon substrate. The layer of n+ silicon has n+ metal (positive) metal contacts. There is a silicon multiplication layer on n+ silicon layer. The silicon multiplication layer has ion implanted p+ regions. There is an epitaxial seed layer (e.g., about 200 nanometers) of germanium on the silicon multiplication layer. On the epitaxial seed layer of germanium, there is a thick (e.g., about 3000 nanometers) germanium layer for infrared wavelength detection/absorption and then followed by p+ germanium layer. It should be noted that germanium-on-silicon growth is difficult to due to the lattice mismatch. However, germanium-on-silicon single photon avalanche diode can enable near room temperature operation and reduced after pulsing compared to InGaAs/InP single photon avalanche diode.
[0612] Furthermore, the layer of p+ germanium has embedded/patterned light absorbing nanostructures with p+ metal (negative) metal contacts in mesa device architecture and it includes an optical filter.
[0613] FIG. 3V2 illustrates a two dimensional array of single photon avalanche diodes in fully parallel processing.
[0614] The array of single photon avalanche diodes can be fabricated/constructed, utilizing three-dimensional stacking, wherein a read-out electronic circuitry is just below the plane of the single photon avalanche diodes and the read-out electronic circuitry is coupled with the upper single photon avalanche diodes and a lower printed electronic circuitry by via holes.
[0615] Germanium-on-silicon single photon avalanche diode can be compatible with a conventional complementary metal-oxide-semiconductor or complementary metal-oxide-semiconductor+memristors process technology. Complementary metal-oxide-semiconductor+memristors process circuit can be fabricated/constructed, wherein memristors are integrated onto a complementary metal-oxide-semiconductor+memristors process platform-enabling a neuromorphic/neural processing/computing architecture. It should be noted that memristors can be replaced by super memristors. Each super memristor can include (i) a resistor, (ii) a capacitor and (iii) a phase transition/phase change material based memristor. A phase transition material based memristor can be electrically and/or optically controlled. But a phase change material based memristor can be electrically or optically controlled. Furthermore, each super memristor can be electrically/optically controlled.
[0616] Furthermore, a neuromorphic/neural processing/computing architecture can utilize one or more super memristors or a network of super memristors, wherein each super memristor can include (i) a resistor, (ii) a capacitor and (iii) a phase transition/phase change material based memristor. Furthermore, each super memristor can be electrically/optically controlled.
[0617] It should be noted that atomically thin metal dichalcogenide/two-dimensional semiconductor material (e.g., MoS.sub.2, WS.sub.2 and WSe.sub.2) with semimetallic bismuth as a contact layer can enable a high performance processor-specific electronic integrated circuit extending Moore's law.
[0618] The processor-specific electronic integrated circuit can integrate (i) a network of memristors/super memristors and (ii) nanoscaled memory cells ((a) utilizing graphene as electrodes and atomically thin molybdenum sulfide as an active layer, a nanoscaled memory cell can be fabricated/constructed or (b) utilizing bi-layers of graphene sandwiched between slightly twisted (e.g., in about 1 degree angle) atomically thin boron nitride layers a nanoscaled (electronic) ferroelectric memory cell can be fabricated/constructed).
[0619] A three-dimensional image sensor based on the single photon avalanche diodes through silicon via and backside illuminated devices can be realized.
[0620] Furthermore, such a three-dimensional image sensor can be integrated/co packaged with complementary metal-oxide-semiconductor device/System on Chip or complementary metal-oxide-semiconductor+memristors/System on Chip or the Super System on Chip 400A/400B/400C/400D. It should be noted that memristors can be replaced by super memristors. Each super memristor can include (i) a resistor, (ii) a capacitor and (iii) a phase transition/phase change material based memristor. A phase transition material based memristor can be electrically and/or optically controlled. But a phase change material based memristor can be electrically or optically controlled. Furthermore, each super memristor can be electrically/optically controlled.
[0621] FIG. 3V3.1 illustrates integration of an image sensor (based on single photon avalanche diodes-including single photon avalanche diodes fabricated/constructed on indium phosphide or germanium-on-silicon material) with a complementary metal-oxide-semiconductor integrated circuit (of control and read-out electronics).
[0622] For example, the integration can be vertical integration utilizing low temperature direct wafer bonding/indium bump bonding.
[0623] FIG. 3V3.2 illustrates integration of an image sensor (based on single photon avalanche diodes-including single photon avalanche diodes fabricated/constructed on indium phosphide or germanium-on-silicon material) with a complementary metal-oxide-semiconductor integrated circuit (of control and read-out electronics) plus a two-dimensional/three-dimensional array of memristors/a two-dimensional/three-dimensional network of memristors. It should be noted that memristors can be replaced by super memristors. Each super memristor can include (i) a resistor, (ii) a capacitor and (iii) a phase transition/phase change material based memristor. A phase transition material based memristor can be electrically and/or optically controlled. But a phase change material based memristor can be electrically or optically controlled. Furthermore, each super memristor can be electrically/optically controlled.
[0624] FIG. 3V3.3 illustrates integration of an image sensor (based on single photon avalanche diodes-including single photon avalanche diodes fabricated/constructed on indium phosphide or germanium-on-silicon material) with a complementary metal-oxide-semiconductor integrated circuit (of control and read-out electronics) plus the Super System on Chip 400A/400B/400C/400D (as described/disclosed in the later paragraphs) for ultrafast image processing/image recognition, deep learning/meta-learning and self-learning.
[0625] It should be noted that a 90 nanometers complementary metal-oxide-semiconductor fabrication/process technology can enable about 1 million densities of a two-dimensional array of image sensors (based on single photon avalanche diodes-including single photon avalanche diodes fabricated/constructed utilizing germanium-on-silicon).
[0626] The array of pulsed lasers and single photon avalanche diodes can be coupled with the Super System on Chip 400A/400B/400C/400D (as described/disclosed in the later paragraphs) for ultrafast data processing, image processing/image recognition, deep learning/meta-learning and self-learning.
[0627] FIGS. 3W1-3W6 illustrate various embodiments of packaging of a computational camera.
[0628] FIG. 3W1 illustrates an embodiment, wherein the p-metal of a pulsed laser (P LD) is mounted on a thermally conducting metallized heat spreader (HS) (e.g., aluminum nitride/diamond). All sides of the thermally conducting metallized heat spreader can be metallized. A eutectic gold tin solder (in multilayer thin-films) can be deposited on the top surface of the thermally conducting metallized heat spreader. The thermally conducting metallized heat spreader is placed onto a carrier substrate (CS). The carrier substrate is in the front cutout section of a first printed circuit board (First PCB) for the pulsed laser. The carrier substrate has slots for mounting a fast axis collimating lens (FAC), a slow axis collimating lens (SAC), volume Bragg gratings and a diffuser (D) by UV curable epoxy.
[0629] It should be noted that a spatial light modulator may be utilized prior to the diffuser (D).
[0630] The carrier substrate can be electrically coupled with the first printed circuit board by a low inductance interconnect metal (e.g., ultrasonically welded copper metal bar of about 4 mm wide and 0.3 mm thick).
[0631] Generally, ultrasonic welding is the use of high frequency vibration to produce a solid state weld between two components held in proximity (close) contact. It has high reliability due to a low energy cold (no heating) process within a short process time, without any intermetallic phase/thermal expansion mismatch and it enables high ampacity compared to wire bond. The n-side metal of the pulsed laser is electrically coupled with the first printed circuit board by a short flexible circuit (e.g., Molex rigid flex circuit bonded onto n-side metal by epoxy) to realize a low inductance interconnect.
[0632] The first printed circuit board has gallium nitride field effect transistors based integrated circuit, which is driven by a driver integrated circuit (e.g., LMG1020 manufactured by Texas Instrument). However, monolithically integrating the gallium nitride field effect transistors based integrated circuit and driver integrated circuit higher performance can be achieved.
[0633] It is possible to control the thermal stress in gallium nitride layer on a silicon substrate by inserting an aluminum nitride and an aluminum gallium nitride (AlGaN), as intermediate layers. Furthermore, use of a silicon nitride interlayer can reduce the density of threading dislocations, by encouraging threading dislocations to bend into the (0001)-plane and move laterally where they annihilate with dislocations of opposite Burger's vector.
[0634] Furthermore, the silicon substrate can be replaced by a composite substrate including a bulk substrate of silicon, followed by a diamond thin/thick film of 1-50 microns in thickness and then followed by a silicon thin-film of 0.5-2 microns in thickness. The above substrate can be identified as diamond-on-silicon.
[0635] Thus, gallium nitride field effect transistors can be fabricated/constructed, utilizing a substrate like silicon, silicon on insulator, silicon on diamond, silicon carbide or diamond.
[0636] In the case of gallium nitride on silicon, both field effect transistors and heat removing microchannels can be integrated and the heat removing microchannels can be fabricated/constructed just below the active area containing gallium nitride field effect transistors.
[0637] The general steps of such fabrication/construction of GaN epitaxial layers on a silicon substrate are outlined below:
[Front Side of Wafer]
[0638] Deposition and patterning of many slit openings in (compressive stress) SiNx [0639] Anisotropic corresponding slit openings in GaN epitaxial layers up to the silicon substrate [0640] Anisotropic corresponding deep slit openings in the silicon substrate (through the slit opening in GaN epitaxial layers) [0641] Isotropic openings in the silicon substrate (through the slit opening in GaN epitaxial layers). [0642] Removal of SiNx [0643] Metallization for device (field effect transistors) [0644] Annealing of metallization for device [0645] Deposition of seed metallization (for electroplating) [0646] Patterning for electroplating in the slit openings in GaN epitaxial layers [0647] Removal of seed metallization (for electroplating) [0648] Completion of front side device fabrication [0649] Protection of front side device with SU8 layer
[Back Side of Wafer]
[0650] Etching of microchannels from the back of the silicon substrate
[0651] It should be noted that the diamond substrate can (i) reduce thermal impedance ( C./W) by as much as 60% and (ii) increase power density (of gallium nitride field effect transistors) by 3-fold compared to the silicon carbide substrate. The gallium nitride field effect transistors based integrated circuit can provide current at about 250 amp with a full width at half maximum rise time/fall time of an electrical pulse current between 1 ns and 10 ns.
[0652] Alternatively, the carrier substrate can have a first metallized stepped vertical structure eliminating the heat spreader completely and a second metallized stepped vertical structure. The first metallized stepped vertical structure and the second metallized stepped vertical structure are separated in dimension and electrically isolated. However, the first metallized stepped vertical structure is electrically connected to the first contact at bottom of the carrier substrate by a metallized via hole(s) and the second metallized stepped vertical structure is electrically connected to the second contact at bottom of the carrier substrate by a metallized via hole(s).
[0653] The first metallized stepped vertical structure is for p-metal down bonding/mounting of the pulsed laser/array of lasers. The second metallized stepped vertical structure is for an extremely short and very wide wedge/ribbon bond to n-metal of the pulsed laser/array of pulsed lasers. There may be more than one extremely short and very wide wedge/ribbon bond to minimize inductance.
[0654] Generally, a laser driver is much bigger in size than an array of pulsed lasers. It would be convenient to fabricate/construct a first printed circuit board and a second printed circuit board, wherein the first printed circuit board can generally include all components excluding all necessary components related to a laser driver, wherein the second printed circuit board can generally include all necessary components related to the laser driver.
[0655] The second printed circuit board can be electrically coupled to the first printed circuit board at the metallized edge (on the second printed circuit board) in a vertical configuration/arrangement with first metallized electrical traces (on the first printed circuit board) and second metallized electrical traces on the first printed circuit board.
[0656] The common n-metal (of an array of pulsed lasers) can be wire bonded (e.g., a wedge/ribbon/flex circuit/metal bar) to the first metallized electrical traces on the first printed circuit board. The electrically isolated p-metals (of an array of pulsed lasers) can be electrically coupled/routed to the first printed circuit board via metallized vias.
[0657] Then the metallized vias (on the first printed circuit board) can be electrically coupled/routed to the second metallized electrical traces on the first printed circuit board.
[0658] The second metallized electrical traces on the first printed circuit board can be coupled at the metallized edge on the second printed circuit board.
[0659] The carrier substrate can be further electrically coupled to a printed circuit board by an interposer. An interposer is an electrical interface routing device, which can spread or reroute a connection from one electrical interface to another electrical interface.
[0660] It should be noted that simultaneously operating all (pulsed) lasers of a monolithic (pulsed) laser array can be problematic due to the need of large pulsed peak current from a (pulsed) laser driver. However, selectively operating one (pulsed) laser at a time with a fixed delay time with respect to operating the next (pulsed) laser of a monolithic (pulsed) laser array is an option (at the cost of high average pulsed output power (brightness)).
[0661] In above particular case, images of an object can be obtained sequentially within a field of view and then an algorithm (a set of computer-aided instructions) can stitch all images obtained sequentially to render a composite three-dimensional image of the said object within the field of view.
[0662] Furthermore, each (pulsed) laser can be a separate known good die/chip and a non-monolithic (pulsed) laser array can be fabricated/constructed utilizing an aluminum nitride/diamond/suitable electrically insulating type material based optical bench to die attach multiple (pulsed) lasers, wherein each (pulsed) laser die/chip can be electrically isolated and operated without a common cathode (common substrate) condition of a monolithic (pulsed) laser array.
[0663] Alternatively, a monolithic (pulsed) laser array can be fabricated/constructed on a low-defect density insulating/semi-insulting substrate (with an etched trenched isolation between (pulsed) lasers), as opposed to a monolithic (pulsed) laser array fabricated/constructed on a low-defect density semi-conducting substrate.
[0664] Similarly, FIG. 3W1 contains a second printed circuit board for an array of the single photon avalanche diodes and an imaging lens. However, the array of the single photon avalanche diodes and the imaging lens can be placed onto a separate carrier substrate.
[0665] The array of the single photon avalanche diodes can be bonded onto a complementary metal oxide semiconductor-electronic integrated circuit via indium bumps, wherein the above stack can be temperature controlled/cooled by a thermoelectric cooler for higher performance, especially if the single photon avalanche diode is based on indium phosphide material.
[0666] The first printed circuit board and the second printed circuit board are electrically coupled with the Super System on Chip 400A/400B/400C/400D.
[0667] The carrier substrate, the first printed circuit board, the second printed circuit board and the Super System on Chip 400A/400B/400C/400D (for ultrafast data processing, image processing/image recognition, deep learning/meta-learning and self-learning) can be housed in a hermetically sealed enclosure.
[0668] The hermetically sealed enclosure can be thermally coupled with a finned heat sink/finned heat sink with a fan. The hermetically sealed enclosure has two (2) transparent metal coated glass windows for pulsed heating to defrost or deice. Furthermore, the hermetically sealed enclosure's front optical surface can be cleaned by an air jet agitator and/or an ultrasonic agitator.
[0669] Alternatively, or additionally the glass windows can include nanostructures (typically based on an insect) to defrost or deice. Such nanostructures can be fabricated/constructed utilizing self-assembled nanospheres or colloidal lithography.
[0670] FIG. 3W2 is similar to FIG. 3W1, except the short flexible circuit interconnect is replaced by a mechanical clamp between the first printed circuit board and a metal (e.g., copper) holder, placed on top of the n-metal to realize a low inductance metal interconnect. Furthermore, many wide (e.g., each 2 mm wide) and thick (e.g., each 0.2 mm thick) gold heavy wedge/ribbon bonds may also be suitable to realize a low inductance metal interconnect.
[0671] FIG. 3W3 is similar to FIG. 3W1, except it has an array of pulsed lasers, followed by an array of collimating lenses (CLA) and a beam shaper optics (BSO) to shape the laser beam to a composite square profile from a rectangular profile from the array of pulsed lasers.
[0672] FIG. 3W4 is similar to FIG. 3W3, except the short flexible circuit interconnect is replaced by a mechanical clamp between the first printed circuit board and a metal (e.g., copper) holder, placed on top of the n-metal of the array of pulsed laser to realize a low metal inductance interconnect.
[0673] With an advanced fabrication/construction technology of an etched facet/mirror, far away from the p-metal, on a semiconductor surface, an edge step of a suitable dimension can be fabricated/constructed all the way to the n+ substrate. The edge step can be passivated and planarized by a spin on glass (SOG). A large diameter via hole(s) to the n+ substrate can be fabricated/constructed and completely filled with eutectic n-metal (AuGeNi)Au. In this configuration both p-metal and n-metal contacts can be bonded by flip chip technology eliminating wire bonds completely, enabling faster optical signal (less than 5 ns optical pulse width) at 10-20 KHz repetition rate.
[0674] FIG. 3W5 illustrates an embodiment of flip chip mounting a pulsed laser of a computational camera directly bonded (utilizing eutectic/epoxy bond) on a complementary metallized pattern of the printed circuit board, wherein n-metal contact is fabricated/constructed by metallized via hole(s), as described/disclosed in the above paragraph. Furthermore, optical components can be bonded (utilizing epoxy) onto the precise cutout holes of the printed circuit board.
[0675] FIG. 3W6 is similar to FIG. 3W5, except it has an array of pulsed lasers, instead of a pulsed laser.
[0676] FIGS. 3X1-3X10 illustrate ten (10) embodiments of an integrated detection and ranging subsystem on multi-layer of polymer/spin-on-glass on a substrate (e.g., silicon on insulator), utilizing a three-dimensional photonic integrated circuit based optical phased array.
[0677] A (electro optic) phase modulator utilizes a metal electrode/optical element, placed along an optical waveguide. By applying electric voltage on the electrode or the optical signals on the optical element (e.g., a ring resonator), the refractive index in the optical waveguide can be changed in order to control the phase of the light.
[0678] For example, an electrically induced phase modulator of a phase transition material-vanadium dioxide is about 375 nanometers375 nanometers in area and about 50 nanometers in thickness. Similarly, an optically induced phase modulator of a phase transition material-vanadium dioxide is about 250 nanometers250 nanometers in area and about 50 nanometers in thickness.
[0679] The unwanted side lobes can be suppressed when phase modulators are spaced less than /2 (1550 nanometers) distance. A non-uniform spacing of the phase modulators may be used to suppress unwanted side lobes.
[0680] FIG. 3X1 illustrates an integrated embodiment of a light detection and ranging subsystem 5 (based on a three-dimensional photonic integrated circuit based optical phased array), utilizing a narrow linewidth laser, which is coupled with a lN multimode interference coupler, an array of (electrically controlled) phase modulators, an array of semiconductor amplifiers/variable optical attenuators and an array of vertical couplers (for laser beam steering). The return optical path is coupled with an array of balanced photodetectors (e.g., based germanium material based photodiodes), which are also coupled with the reference narrow linewidth laser via a multimode interference coupler. Furthermore, a grating coupler, Rotman lens and an array of actively controlled (even passive) optical phase shifters can also be utilized for laser beam steering.
[0681] The narrow linewidth laser can be fabricated/constructed by butt coupling a reflective semiconductor amplifier (RSOA) with a spot size converted optical waveguide, an array of ring resonators (with a heating element on each ring resonator) and a loop mirror.
[0682] The array of balanced photodetectors can be coupled with the Light-to-Distance/Velocity System on Chip System on Chip. The Light-Distance/Velocity System on Chip is then coupled with a machine learning (including artificial neural networks/deep learning/meta-learning and self-learning) algorithm based intention system.
[0683] Furthermore, the Light-Distance/Velocity System on Chip can include/couple with a Lorentzian Least Squares Fitting Processor (LLSF Processor) to improve precision and sensitivity beyond the coherence length of the narrow linewidth laser. A Lorentzian Least Squares Fitting Processor can include an integrated electronic circuit that performs the calculations to improve precision and sensitivity beyond the coherence length of the narrow linewidth laser.
[0684] A processor performs arithmetical, logical, input/output (I/O) and other basic instructions that can be passed from an operating system (OS). Many other processes are dependent on the core operations of a processor. The terms processor Central Processing Unit (CPU) and microprocessor are commonly linked as synonyms. But one CPU may be just one of the processors.
[0685] Furthermore, a Graphics Processing Unit (GPU) is another processor and even some hard drives are technically capable of performing some processing.
[0686] FIG. 3X2 illustrates another integrated embodiment of a light detection and ranging subsystem 6 (based on a three-dimensional photonic integrated circuit based optical phased array). This embodiment is similar to the embodiment in FIG. 3X1, except an array of phase modulators are controlled optically (e.g., a phase transition material-vanadium dioxide under optical excitation), instead of being controlled electrically.
[0687] FIG. 3X3 illustrates another integrated embodiment of a light detection and ranging subsystem 7 (based on a three-dimensional photonic integrated circuit based optical phased array). This embodiment is similar to the embodiment in FIG. 3X1, except the narrow linewidth laser is fabricated/constructed differently, by utilizing an array of multiwavelength/multicolor distributed feedback lasers, coupled with a multimode interference coupler, wherein the multimode interference coupler is coupled with a curved semiconductor optical amplifier. The output of the curved semiconductor optical amplifier is (free-space) coupled with a planar lightwave circuit (PLC). The planar lightwave circuit includes a directional coupler (DC) and high reflectivity coated optical waveguide for feedback to the array of multiwavelength/multicolor distributed feedback lasers.
[0688] FIG. 3X4 illustrates another integrated embodiment of a light detection and ranging subsystem 8 (based on a three-dimensional photonic integrated circuit based optical phased array). This embodiment is similar to the embodiment in FIG. 3X3, except an array of phase modulators are controlled optically, instead of being controlled electrically.
[0689] FIG. 3X5 illustrates another integrated embodiment of a light detection and ranging subsystem 9 (based on a three-dimensional photonic integrated circuit based optical phased array). This embodiment is similar to the embodiment in FIG. 3X1, except the narrow linewidth laser is based on a distributed feedback laser, which is optically coupled with a whispering gallery microresonator/high Q microresonator via a half pitch graded index lens.
[0690] FIG. 3X6 illustrates another integrated embodiment of a light detection and ranging subsystem 10 (based on a three-dimensional photonic integrated circuit based optical phased array). This embodiment is similar to the embodiment in FIG. 3X5, except an array of phase modulators are controlled optically, instead of being controlled electrically.
[0691] It should be noted that a distributed feedback laser in FIG. 3X5 and FIG. 3X6 can be replaced by an optically pumped erbium doped waveguide laser (e.g., utilizing an erbium-ion-implanted ultralow-loss waveguide with an intracavity microring-based Vernier filter).
[0692] FIG. 3X7 illustrates another integrated embodiment of a light detection and ranging subsystem 11 (based on a three-dimensional photonic integrated circuit based optical phased array). This embodiment is similar to the embodiment in FIG. 3X1, except the narrow linewidth laser is based on an external cavity laser.
[0693] An external cavity laser can provide narrow linewidth. Generally, the external cavity laser can consist of an external cavity, a semiconductor gain chip (with an anti-reflection coating on both facets of the semiconductor gain chip) and volume holographic Bragg gratings (VHBG). This is similar to a conventional extended cavity diode laser but with the external cavity replacing one of the mirrors. Here, the external cavity acts as a mirror and the resonant feedback is re-injected into the gain chip if the frequency of the extended cavity diode laser matches the resonance frequency of the external cavity. As the light travels back and forth inside the external cavity before feeding back to the gain chip, this configuration effectively enables a very long cavity to ensure an ultra-narrow linewidth (less than 50 Hz) laser.
[0694] FIG. 3X8 illustrates another integrated embodiment of a light detection and ranging subsystem 12 (based on a three-dimensional photonic integrated circuit based optical phased array). This embodiment is similar to the embodiment in FIG. 3X7, except an array of phase modulators are controlled optically, instead of being controlled electrically.
[0695] FIG. 3X9 illustrates another integrated embodiment of a light detection and ranging subsystem 13 (based on a three-dimensional photonic integrated circuit based optical phased array). This embodiment is similar to the embodiment in FIG. 3X8, except it utilizes electrically controlled nanoscaled antennas (for both phase control and laser beam steering) of phase transition/phase change material. It is desirable to have the maximum dimension of the nanoscaled antenna between 2 nanometers to 1000 nanometers.
[0696] FIG. 3X10 illustrates another integrated embodiment of a light detection and ranging subsystem 14 (based on a three-dimensional photonic integrated circuit based optical phased array). This embodiment is similar to the embodiment in FIG. 3X9, except it utilizes optically controlled nanoscaled antennas (for both phase control and laser beam steering) of phase transition/phase change material. It is desirable to have the maximum dimension of the nanoscaled antenna between 2 nanometers to 1000 nanometers.
[0697] Generally, the array of antennas can be either one-dimensional or two-dimensional. The array of antennas actively can be actively controlled by an external stimulus (e.g., an electrical (voltage/current) or optical or terahertz signal).
[0698] For example, a nanoscaled slot antenna element can consist of 30 nanometers wide etched slot into a metal (e.g., gold) thin-film of about 40 nanometers thickness. The metal thin-film can be deposited on a phase transition (e.g., vanadium dioxide) thin-film of about 25 nanometers thickness. The length of the slots can be about 300 nanometers. The spacing between adjacent nano-slot centers is about 100 nanometers. The phase transition thin-film can be deposited on a suitable base substrate (e.g., alumina, diamond, lithium niobate, silicon, silicon on insulator).
[0699] The larger laser beam steering angle may be possible by optimizing the geometric parameters of the antenna elements and utilizing non-identical antenna elements.
[0700] The angular steering of laser beam range can be extended by decreasing the period between the emitting elements to sub-wavelength dimensions at the cost of individual control of each single emitter.
[0701] Generally, a phase transition material is a solid material (e.g., vanadium dioxide), wherein its lattice structure can change from one particular form to another form, still remaining crystal-graphically solid. But a phase change material is a material (e.g., Ge.sub.2Sb.sub.2Te.sub.5 (GST), Ge.sub.2Sb.sub.2Se.sub.4Te.sub.1 (GSST) or Ag.sub.4In.sub.3Sb.sub.67Te.sub.26 (AIST)), wherein its phase can change from a solid to liquid or its phase can change from an amorphous to crystalline or crystalline to amorphous.
[0702] Furthermore, a phase transition material (e.g., vanadium dioxide) may generate an optical loss; an alternative phase change material (e.g., Ge.sub.2Sb.sub.2Te.sub.5 (GST), Ge.sub.2Sb.sub.2Se.sub.4Te.sub.1 (GSST) or Ag.sub.4In.sub.3Sb.sub.67Te.sub.26 (AIST)) can be utilized.
[0703] It should be noted that the multiple optical components of the LiDAR 1 in
[0704] Alternative to embodiment in FIG. 3X10, an external cavity laser and a balanced photodetectors can be coupled with a multi-mode coupler/3-port optical circulator, wherein the multi-mode coupler/3-port optical circulator can be coupled with a two-dimensional array of optical switches. Each element of the two-dimensional array of optical switches can be coupled with an antennathen a two-dimensional array of antennas can be coupled with a lens. Each antenna can be utilized to transmit the laser beam (from the external cavity laser) and receive the reflected laser beam (to the balanced photodetector) from the object.
[0705] Photonic wire bonding is a technique in which photonic waveguides are written with an ultrafast laser into a photoresist material via two-photon lithography, producing free-space photonic wires that can optically connect disparate optical components on a common platform, just as electronics can be connected via conventional metal wire bonding on a printed circuit board. Photonic integrated circuits and optical waveguides can be placed on a common platform substrate using a standard pick-and-place machine. The optical coupling between the photonic integrated circuits and optical waveguides can be embedded into a photosensitive resist. The positions of the optical coupling structure within the photosensitive resist are detected using three-dimension machine vision techniques with sub-100 nanometers accuracy. The shape of the photonic wire bond optical waveguides is designed according to the recorded imaged positions of optical structures and defined by two-photon lithography. Unexposed photoresist can be removed and the photonic wire bond optical waveguides are embedded in a low-index cladding material.
[0706] For example, a master platform can be copper of about 0.125 mm thickness, followed by aluminum nitride of about 0.25 mm to 0.4 mm thickness, followed by about 0.125 mm thickness of copper. The master platform can consist of a stepped pad, slots for optical mounting and metallized via holes for electrical connections. The master platform can also be a heat spreader.
[0707] The light detection and ranging subsystems, as described/disclosed in the previous paragraphs can enable LiDAR-on-Chip, on a silicon on insulator substrate/silicon on silicon nitride substrate. Ultimately, the light detection and ranging subsystem(s), as described/disclosed in the previous paragraphs shall be hermetically sealed to protect from the environment.
[0708] FIG. 3Y1 illustrates a diagram for ultrafast laser beam steering utilizing a metamaterial surface of a phase transition material (e.g., vanadium dioxide) or a phase change material (e.g., Ge.sub.2Sb.sub.2Te.sub.5 (GST), Ge.sub.2Sb.sub.2Se.sub.4Te.sub.1 (GSST)) and a laser (e.g., a mode locked laser). This metamaterial can be tunable (electrically or optically) and/or time-varying and/or space-varying.
[0709] FIG. 3Y2 illustrates another diagram for ultrafast laser beam steering utilizing a metamaterial surface and a photonic crystal (broad area) semiconductor laser. The vertical stack configuration of the photonic crystal (broad area) semiconductor laser includes an active layer and photonic crystal layer sandwiched by an upper cladding layer and a lower cladding layer. The light emission from the photonic crystal (broad area) semiconductor laser can be steered by a metamaterial surface. However, the photonic crystal (broad area) semiconductor laser can be replaced by a vertical cavity surface emitting laser.
[0710] A metamaterial surface in FIG. 3Y1 and FIG. 3Y2 can consist of a two-dimensional array of resonant metasurface unit cells (fabricated/constructed on a material with electrically tunable dielectric constant). By controlling the electrical stimulus (voltage or current) to each individual metasurface unit cell, the resonance frequency can be adjusted. Also, the phase of the transmitted electromagnetic wave through the unit cell can also be controlled-enabling the manipulation of the phase front of the transmitted electromagnetic wave through the metasurface for laser beam steering. Alternatively, a metamaterial surface in FIG. 3Y1 and FIG. 3Y2 can consist of nanoscaled antennas, wherein each nanoscaled antenna can be electrically or optically controlled. Such a metamaterial surface that includes nanoscaled antenna nanoscaled antennas can be capable of reflecting an incoming light beam into many wavelength (or frequency) channels in many geometric directions in a free space.
[0711] The material with electrically tunable dielectric constant can be a phase transition material/phase change material/liquid crystal/graphene.
[0712] It should be noted that ultrafast beam steering can be obtained, utilizing (a) an electric field for triggering insulator-to-metal phase transition in a particular phase transition material-vanadium dioxide or (b) terahertz for triggering a phase change in a particular phase change material-Ag.sub.4In.sub.3Sb.sub.67Te.sub.2 (AIST).
[0713] The optical phase conjugation can operate like a dynamic holography. In optical phase conjugation, light is always reflected straight back the way it came from, no matter what the angle of incidence is. This reflected conjugate wave therefore propagates backwards through a distorting mediumsuch as rain/fog/snow and essentially un-does any distortion and returns to a coherent beam of parallel rays traveling in the exact opposite direction. This along with Huygen's principle of wave propagation can explain the time-reversed reconstruction principles in optical phase conjugation.
[0714] A digital optical phase conjugation based system (or a module in a miniature form factor) (or a digital optical phase conjugator) can generally include a laser, a photodiode, a spatial light modulator, a scientific CMOS camera (e.g., Kinetix scientific CMOS camera manufactured by Teledyne) and optical beam splitters for time reversal of optical wavefronts in any weather condition (including harsh weather/environmental conditionssuch as rain/fog/snow). A spatial light modulator may be replaced by a deformable mirror.
[0715]
[0716] Furthermore, the digital optical phase conjugation system (or a module in a miniature form factor) can be integrated with the computational camera, as described/disclosed in the previous paragraphs.
[0717] Any weather condition (including harsh weather/environmental conditionssuch as rain/fog/snow) can be dynamically changing. In such situations an optical coherence tomography based system (or a module in a miniature form factor) in a time domain can be useful, which can generally include a broadband light source (e.g., a superluminescent diode in a suitable wavelength range of low absorption such as rain/fog/snow) and an optical beam splitter, wherein the optical beam splitter is optically coupled with a reference optical waveguide/arm and a transmitting optical waveguide/arm. It should be noted that the viewing distance/imaging distance may depend on the output power of a broadband light source.
[0718] Since the weather condition is dynamically changing, a fast microprocessor (e.g., based on field programmable gate array) can be integrated with an optical coherence tomography based system (or a module in a miniature form factor) in a time domain.
[0719] An optical coherence tomography based system (or a module in a miniature form factor) in frequency domain can generally include a broadband light source, an optical beam splitter, gratings and an array of photodetectors (coupled with a lens), wherein the optical beam splitter is optically coupled with a reference optical waveguide/arm and a transmitting optical waveguide/arm.
[0720] It should be noted that a combination of gratings and an array of photodetectors is essentially a spectrophotometer. A chip scaled spectrophotometer can be fabricated/constructed utilizing an arrayed waveguide grating router and an array of photodiodes. An optical coherence tomography based system (or a module in a miniature form factor) in frequency domain may offer advantages in sensitivity and imaging speed.
[0721] In general (embodiments described herein can be modified in any arrangement and detail), but not limited to the intelligent vehicle system (including a robotic/self-driving vehicle system) for self-intelligence, sensor-awareness, context-awareness and autonomous actions, remembering the patterns and movements can include: [0722] (a) a Super System on Chip 400A/400B/400C/400D for ultrafast data processing, image processing/image recognition, deep learning/meta-learning and self-learning, wherein the Super System on Chip 400A/400B/400C/400D includes: [0723] (i) a processor-specific electronic integrated circuit, [0724] (ii) an array or a network of memristors/super memristors for neural processing (a super memristor can include (i) a resistor, (ii) a capacitor and (iii) a phase transition/phase change material based memristors. It should be noted that memristors can be replaced by super memristors. Furthermore, each super memristor can be electrically/optically controlled. A phase transition material based memristor can be electrically and/or optically controlled. But a phase change material based memristor can be electrically or optically controlled) and [0725] (iii) a photonic component or a photonic integrated circuit, wherein the photonic component includes an optical waveguide, wherein the processor-specific electronic integrated circuit in said (i), the array or the network of memristors/super memristors in said (ii), and the photonic component or the photonic integrated circuit in said (iii) of the Super System on Chip 400A/400B/400C/400D are interconnected or coupled in two-dimension or three-dimension electrically and/or optically (e.g., by optical wavelength division multiplexing and/or optical time division multiplexing), [0726] wherein the Super System on Chip 400A/400B/400C/400D is coupled with a digital signal processor and/or an artificial eye, wherein the artificial eye includes light activated and/or electrically activated switches, wherein the Super System on Chip 400A/400B/400C/400D is coupled with a photonic neural learning processor for neural processing, wherein the photonic neural learning processor includes (i) an interferometer and a laser or (ii) one or more vanadium dioxide switches, wherein the vanadium dioxide switch is electrically or optically controlled.
Furthermore, for example, the machine learning (including artificial neural networks/deep learning/meta-learning and self-learning) algorithm based near real time/real time intention system of the Super System on Chip 400A/400B/400C/400D can be sensor-aware and/or context-aware and it can alert the user (driver) of the intelligent vehicle about the intention of other users (drivers of other intelligent vehicles) in proximity.
Alternatively, an optically controlled Super System on Chip can include an input or an output, wherein the optically controlled Super System on Chip's input or output can include one or more lasers and/or photodiodes and/or first memristors and/or super memristors (e.g., a super memristor can include a resistor, a capacitor and a second memristor) for neural processing, wherein the optically controlled Super System on Chip's input or output can include a first single photon (a first single photon and a second single photon can be induced by a laser incident on a nonlinear crystal, while a second single photon can be separated by an optical beam splitter and directed to a photodetector. Details of a first single photon and a second single photon induced by a laser incident on a nonlinear crystal have been described/disclosed in the later paragraphs), wherein the first memristor can be electrically and/or optically controlled, wherein the first memristor can include a phase transition material/phase change material, (wherein the phase transition material based memristor is electrically and/or optically controlled, wherein the phase change material based memristor is electrically or optically controlled) wherein the super memristor can include a capacitor, a second memristor and a resistor, wherein the super memristor can be electrically/optically controlled. Furthermore, the input or the output of the optically controlled Super System on Chip can be coupled by a Mach-Zehnder interferometer, wherein the Mach-Zehnder interferometer can include a phase transition material (e.g., VO.sub.2) or a phase change material (e.g., Ge.sub.2Sb.sub.2Te.sub.5 (GST), Ge.sub.2Sb.sub.2Se.sub.4Te.sub.1 (GSST), Ag.sub.4In.sub.3Sb.sub.67Te.sub.26 (AIST), Sb.sub.2S.sub.3 (antimony trisulfide) or Sb.sub.2Se.sub.3 (antimony triselenide)) or a lithium niobate material or a polymeric material on a suitable substrate (including lithium niobate material on insulator), (wherein the phase transition material is electrically and/or optically controlled, but the phase change material is electrically or optically controlled, wherein the lithium niobate material or the polymeric material is electrically controlled) wherein the Mach-Zehnder interferometer can be coupled by a first optical waveguide (e.g., a low-loss SiNx optical waveguide) in a two-dimensional arrangement or a three-dimensional arrangement, wherein the first optical waveguide can be coupled with (i) a semiconductor optical amplifier and/or (ii) a second optical waveguide in a two-dimensional arrangement or a three-dimensional arrangement, wherein the three-dimensional arrangement can generally include a vertical arrangement (the vertical arrangement may require evanescent (optical) coupling and/or vertical wafer bonding (a vertical bonding can be direct bondingwhich may include surface cleaning, surface plasma activation, pre-bonding at room temperature, then followed by elevated temperature (e.g., 250 C.) annealing under pressure to strengthen the Van Der Waals bonds) with critical alignment of a first SOI substrate with a second InP substrate or a hybrid SOI on InP substrate/hybrid InP on SOI substrate), wherein the second optical waveguide can include a nonlinear optical material (e.g., chalcogenide As.sub.2S.sub.3) or a nonlinear optical resonator/photonic crystal based nonlinear optical resonator made of a nonlinear optical material (e.g., chalcogenide As.sub.2S.sub.3) or a III-V material. Various combinations are also possible within the context of the optically controlled Super System on Chip. It is also possible to construct/fabricate a vertical three-dimensional arrangement utilizing a Mach-Zehnder interferometer of a phase transition material/phase change material/lithium niobate material/polymeric material on a SOI substrate, wherein a section of the SOI substrate can include the first optical waveguide of a low-loss optical material and the second optical waveguide, wherein the second optical waveguide can include a nonlinear optical material (e.g., chalcogenide As.sub.2S.sub.3) or a nonlinear optical resonator/photonic crystal based nonlinear optical resonator made of a nonlinear optical material (e.g., chalcogenide As.sub.2S.sub.3) or a III-V material, wherein the first optical waveguide and the second optical waveguide are evanescently (optically) coupled. Furthermore, the semiconductor optical amplifier can be replaced by photonic crystals based nonlinear resonators. Various combinations and arrangements are also possible within the context of the optically controlled Super System on Chip. An optically controlled Super System on Chip is generally similar to a photonic neural learning processor for photonic neural processing. Furthermore, this arrangement can include an electrically programmable/tunable (connected) optical waveguide lattice/mesh. For example, a programmable/tunable (connected) optical waveguide lattice/mesh can be fabricated/constructed by utilizing Mach-Zehnder interferometers, wherein each Mach-Zehnder interferometer can include a phase transition material/phase change material/lithium niobate material/polymeric material (wherein a phase transition material is electrically and/or optically controlled, but a phase change material is electrically or optically controlled, wherein the lithium niobate material or the polymeric material is electrically controlled). Alternatively, a programmable/tunable (connected) optical waveguide lattice/mesh can be fabricated/constructed by utilizing a nonlinear material for nonlinear processing. Such a programmable/tunable (connected) optical waveguide lattice/mesh can be coupled with Super System on Chip's input/output. An optically controlled Super System on Chip can also include a first electronic component such as a processor-specific electronic integrated circuit (which may include a two-dimensional material) or an application specific integrated circuits/field programmable gate array/Bose-Einstein condensate based optical switch, wherein the Bose-Einstein condensate based optical switch includes polaritons. It should be noted that the application specific integrated circuits/field programmable gate array/Bose-Einstein condensate based optical switch can be coupled with the input or the output of the optically controlled Super System on Chip in two-dimensional/three-dimensional arrangement (three-dimensional arrangement can be realized by wafer-to-wafer bonding or wafer-on-wafer stacking. However, wafer-to-wafer bonding/wafer-on-wafer based three-dimensional stacking may require (i) chip/device yield on each wafer to be high and (ii) integrated (on-wafer) microchannel/microjet cooling for heat dissipation). Such an optically controlled Super System on Chip may enable to create a synthetic voice or voice-to-voice translation in near real time. An optically controlled Super System on Chip can also include a second electronic component that is reconfigurable into a capacitor/resistor/neuron/synapse, when the second electronic component can include a thin-film (generally less than 200 nanometers in thickness) of a proton doped perovskite nickelate material. An optically controlled Super System on Chip has one or more inputs and one or more outputs. At least, one or more inputs and outputs can be coupled by one or more third optical waveguides by feedback (or even feed forward) loop, wherein at least one or more third optical waveguides can include either a phase transition material or a phase change material-enabling as a reconfigurable metametrial surface. An optically controlled Super System on Chip can be a part of a multichip module, wherein the multichip module can include one or more fourth optical waveguides. The multichip module can be thermally coupled with an array of microchannels and/or microjets for cooling. An optically controlled Super System on Chip can be operable/integrated with a first artificial eye/second artificial eye/neuromorphic visual system/hyperspectral imager system (as discussed in the previous paragraph), wherein the first artificial eye includes electrically activated switches, wherein the second artificial eye includes light activated switches, wherein the neuromorphic visual system includes (i) an array of optically coupled capacitors or (ii) an array of optically coupled field effect transistors. An optically controlled Super System on Chip can include a first set of computer implementable instructions, stored in one or more non-transitory storage media, wherein the first set of instructions includes an artificial neural network algorithm or a machine learning algorithm or a deep learning algorithm. An optically controlled Super System on Chip can also include a second set of computer implementable instructions stored in one or more non-transitory storage media, wherein the second set of instructions can include an evolutionary based algorithm or a self-learning algorithm and/or Poisson flow generative model++. An optically controlled Super System on Chip can also include a third set of computer implementable instructions stored in one or more non-transitory storage media, wherein the third set of instructions includes a computer vision algorithm or an image processing algorithm or a Vision Transformer. (A Vision Transformer is a model for image classification that utilizes a transformer like architecture over patches of an image. An image is split into fixed-size patches, each of patches is then linearly embedded, position embeddings are also addedthe resulting sequence of vectors is fed into a standard Transformer encoder. It may require higher computing power and may be useful for processing data, (natural) language, raw images and video). Furthermore, the above hyperspectral imager system can be communicatively interfaced with (i) a first set of computer implementable instructions in artificial intelligence or machine learning or deep learning and/or (ii) a second set of computer implementable instructions in computer vision or Vision Transformer, wherein the first set of computer implementable instructions and the second set of computer implementable instructions may be stored in a local non-transitory storage media locally or on a cloud based non-transitory storage media. [0727] (b) a detection system, wherein the detection system can include (i) or (ii) or (iii), as listed below, [0728] (i) a radar or a radar comprising metamaterials or a ground penetrating radar or a multi-frequency (multi-band) radar sensor or an imaging radar sensor (e.g., utilizing about 75 to 110 GHz range radio frequency complementary metal oxide semiconductor integrated circuit and a radar processor with a linear algebraic radar accelerator). It should be noted the above radar sensor(s) can include a first set of computer implementable instructions in artificial intelligence or artificial neural networks or machine learning or deep learning to improve radar performances, wherein the first set of computer implementable instructions are generally stored in one or more non-transitory storage media. Also, the above radar sensor(s) can include a second set of computer implementable instructions to detect an object in an environment, utilizing signal filtering to improve radar performances, wherein the second set of computer implementable instructions are generally stored in one or more non-transitory storage media. Also, above radar sensor(s) can include a third set of computer implementable instructions in evolutionary instructions or self-learning instructions to improve radar performances, wherein the third set of computer implementable instructions are generally stored in one or more non-transitory storage media. Above radar sensor(s) can include a third set of computer implementable instructions that can include a fourth set of computer implementable instructions in computer vision or Vision Transformer, wherein the fourth set of computer implementable instructions are generally stored in one or more non-transitory storage media. A first set of computer implementable instructions and/or a second set of computer implementable instructions and/or a third set of computer implementable instructions and/or a fourth set of computer implementable instructions may require a Super System on Chip 400A/400B/400C/400D and/or a photonic neural learning processor (various embodiments of a photonic neural learning processor have been described/disclosed in the later paragraphs). [0729] (ii) a four-dimensional (4-D) light detection and ranging subsystem to measure distance and/or velocity, wherein the four-dimensional light detection and ranging subsystem is hermetically sealed. The four-dimensional light detection and ranging subsystem can include one or more narrow linewidth (less than 200 Hz) lasers and one or more photodetectors/balanced photodetectors. However, it should be noted that one laser can be a semiconductor diode laser or a master oscillator-power amplifier or a fiber laser (one or more lasers can be fabricated/constructed on a low-defect density conducting/semi-insulating/insulating substrate), [0730] (iii) a computational camera or one or more cameras, wherein the computational camera includes one or more pulsed lasers, wherein one pulsed laser can be a semiconductor diode laser or a master oscillator-power amplifier or an oscillator-thyristor device or a fiber laser, wherein one pulsed laser is mounted (either p-metal up or p-metal down) on a heat spreader substrate (which can have one or more microchannels and/or microjects for fluid based cooling), which consists of either (a) diamond material and copper-tin alloy material or (b) diamond material and copper material or (c) diamond material and copper composite material or (d) copper-diamond composite material, wherein one pulsed laser may be optically coupled with a spatial light modulator wherein one pulsed laser has a full width at half maximum rise time of an optical (laser) pulse or a full width at half maximum fall time of an optical (laser) pulse from 0.01 nanoseconds to 10 nanoseconds, (wherein one pulsed laser can consist of one or more P/N junctions in a vertically stacked arrangement, if one pulsed laser is a semiconductor diode laser), wherein the computational camera further includes one or more single photon avalanche diodes (or avalanche photodiodes), wherein one pulsed laser is electrically coupled with an integrated circuit including gallium nitride transistors, wherein a full width at half maximum rise time of an electrical pulse current or wherein a full width at half maximum fall time of the electrical pulse current of the integrated circuit including gallium nitride transistors is between 1 nanosecond and 10 nanoseconds, wherein the detection system can be coupled with a sub-terahertz imaging system. The detection system can couple with or include a real time image reconstruction algorithm to detect an object in a harsh weather or around a corner. The detection system can couple with a sub-terahertz imaging system. A sub-terahertz imaging system can transmit a signal at a sub-terahertz wavelength and measure the absorption and reflection of the scattered signal (from an object) at the sub-terahertz wavelength by a two-dimensional array of receivers, wherein each receiver consists of a heterodyne detector. The signal from the two-dimensional array of receivers can be coupled with a processor to recreate an image of the object. The output signals of the two-dimensional array of receivers can be used to calculate the distance of the object and combining/steering the output signals of the two-dimensional array of receivers can be used to image of the object. The Super System on Chip 400A/400B/400C/400D and/or qubits can be coupled with the detection system. The qubits should be operable at room temperature.
[0731] Furthermore, a pulsed optical signal of a pulsed wave laser can include a unique (short) modulated or a unique (short) coded pulse sequence (generally as an electrical waveform input to a pulsed laser) to reduce any interference.
[0732] Alternatively, a continuous/quasi-continuous wave laser may be utilized in lieu of a pulsed optical signal. When utilizing a continuous/quasi-continuous wave laser, the coherence length of the continuous/quasi-continuous wave laser should be long and reflected laser can be detected by one or more balanced photodetectors.
[0733] For transmitting continuous/quasi-continuous wave laser toward an object, a first array/network of optical switches (e.g., a Mach-Zehnder based optical switch) can be utilized.
[0734] For receiving reflected light from an object to one or more balanced photodetectors, a second array/network of optical switches can be utilized.
[0735] Both the first array/network of optical switches and the second array/network of optical switches can be coupled with an array of 3-port optical circulators and an array of lenses.
[0736] The detection system can be coupled with or includes an artificial intelligence/artificial neural networks/machine learning/deep learning (e.g., neural networks based deep learning)/fuzzy logic (including neuro-fuzzy logic) algorithm.
[0737] A real time image reconstruction algorithm can generally model how harsh weather/environmental conditionsrain/fog/snow affect the scattering of a laser light in a wavelength range, then the real time image reconstruction algorithm can eliminate such scattering to create a clear picture/image of what is actually ahead in harsh weather/environmental conditions.
[0738] Furthermore, a real time image reconstruction algorithm (incorporated with a near real time map/an augmented reality enhanced near real time map) can be utilized to detect an object in harsh weather/environmental conditionsrain/fog/snow. The real time image reconstruction algorithm may include a signal processing for (i) signal filtering and/or (ii) light scattering and/or (iii) calculating the distance to an object in harsh weather/environmental conditionsrain/fog/snow. The detection system can be further coupled with or includes such a real time image reconstruction algorithm.
[0739] Furthermore, for example, a Van der Waals heterostructure of black phosphorous and molybdenum disulfide based photodetector stacked on top of a non-volatile and programmable floating-gate memory transistor architecture may enable a collision sensor. Such as a collision sensor can be coupled with the (i) Super System on Chip 400A/400B/400C/400D or (ii) optically controlled Super System on Chip or (iii) one or more central processors, wherein at least one of one or more central processor includes one or more (i) processing cores and (ii) memory units, wherein at least one of one or more processing cores and at least one of one or more memory units are coupled in an intertwined pattern in a two-dimensional arrangement or a three-dimensional arrangement, wherein at least one of one or more memory units includes one or more memory elements, wherein at least one of one or more memory elements includes one or more memory circuits. Such integration may help in enhancing and capabilities of the detection system.
[0740] The detection system can be further coupled with or includes a self-learning (including relearning) algorithm. It should be noted that the self-learning (including relearning) algorithm can include an evolutionary based algorithm and/or Poisson flow generative model++.
[0741] An evolutionary based algorithm is an evolutionary computation in artificial intelligence. An evolutionary based algorithm functions through the (similar to biological) selection process in which the least fit members of the population set are eliminated, whereas the fit members are allowed to survive and continue until better solutions are determined.
[0742] In other words, an evolutionary based algorithm is a computer application which mimics the natural (biological) evolution in order to solve a complex problem. Over time, the successful members evolve to present the optimized solution to the complex problem. An evolutionary based algorithm is a meta-algorithm, an algorithm for designing algorithmseventually, the algorithms get pretty good at the task, based on three (3) pillars of innovation: [0743] 1. Meta-learning architectures (resulting in indirect coding) [0744] 2. Meta-learn learning algorithms (resulting in open ended search) [0745] 3. Generating effective learning environments (resulting in quality diversity)
[0746] The evolutionary based algorithm is a class of stochastic search and optimization techniques obtained by natural selection and genetics. It is a population based algorithm by simulating the natural (biological) evolution. Individuals in a population compete and exchange information with one another.
[0747] There are three basic genetic operations: selection, crossover and random mutation.
[0748] For example, a procedure of an evolutionary based algorithm is as follows: [0749] Step 1: Set t=0 [0750] Step 2: Randomize the initial population P(t) [0751] Step 3: Evaluate the fitness of each individual of P(t) [0752] Step 4: Select individuals as parents from P(t+1) based on the fitness [0753] Step 5: Apply search operators (crossover and mutation) to parents and generate P(t+1) [0754] Step 6: Set t=t+1 [0755] Step 7: Repeat step 3 to step 6 until the termination criterion is satisfied
[0756] It should be noted that a conventional deep learning algorithm utilizes stochastic gradient descent (SGD), which improves an artificial neural network's over time by gradually reducing errors through an ongoing training with an existing dataset(s)generally mapping inputs to outputs in known patterns over time, but it may not work properly in reinforcement learning (which is learning how to act/decide with only infrequent feedback signals or unknown outputs for given inputs without any pattern over time).
[0757] An artificial neuroevolution algorithm utilizes an evolutionary based algorithm (similar to biological Darwinian evolution inspired by nature) with added safe/random mutations to grow/evolve/generate an artificial neural network's layers/rules/topology/parameters for better computing optimized outcomes/results.
[0758] Random mutations (may initially degrade an artificial neuroevolution algorithm, before it improves) can allow evolving and reaching a decision toward achieving greater accuracy. Thus, an artificial neuroevolution algorithm can adapt dynamically and intelligently to unknown input signals.
[0759] The detection system can be also coupled with or includes a near real time map or an augmented reality enhanced near real time map projected on a display/head-up display/augmented reality based apparatus. The augmented reality based apparatus is generally illustrated in
[0760] The four-dimensional light detection and ranging subsystem or the computational camera can be coupled with a gyro sensor or a global positioning system or an augmented reality enhanced global positioning system.
[0761] The four-dimensional light detection and ranging subsystem or the computational camera can be in a hermetically sealed housing. They can be mechanically coupled with or housed in a bumper/grill/head light (similarly back light)/roof/roof shell/side mirror (or placed in a proximity to a windshield) of the intelligent vehicle system. The intelligent vehicle system can enable proximity based payment. Proximity based payment is illustrated in
[0762] The hermetic sealed housing with a front cover glass surface (placed at the exterior of the hermetic sealed housing) may require cleaning (from just) and defrosting/deicing. The defrosting/deicing can be realized efficiently and quickly by very rapid pulsed current based heating (of heat flux of 10 to 100 watts/cm.sup.2) on a transparent metal coating (e.g., indium tin oxide or index matched indium tin oxide) on the front cover glass surface (placed at the exterior of the hermetic sealed housing). Furthermore, air jet agitator and/or ultrasonic agitator can clean the hermetically sealed enclosure's front optical surface.
[0763] Alternatively, the diverging lens and the imaging lens can be coated with a transparent metal coating on the outer front surface for very rapid pulsed heating in order to quickly defrost/deice. Alternatively, or additionally the glass windows can include nanostructures (typically based on an insect) to defrost or deice.
[0764] The four-dimensional light detection and ranging subsystem can be a coherent/Synthetic Aperture based coherent subsystem.
[0765] The four-dimensional light detection and ranging subsystem can include a stabilized chirped pulsed laser or an optical phase-locked loop.
[0766] The four-dimensional light detection and ranging subsystem can be either frequency modulation or amplitude modulation.
[0767] The four-dimensional light detection and ranging subsystem can include a two-dimensional/three-dimensional optical phased array for laser beam steering.
[0768] The optical phased array for laser beam steering can include one or more semiconductor optical amplifiers or variable optical attenuators.
[0769] The four-dimensional light detection and ranging subsystem can include an array of nanoscaled antennas, wherein each nanoscaled antenna is passively uncontrolled or actively controlled for laser beam steering.
[0770] As described/disclosed in the previous paragraphs, to achieve coherent emitters, a 10-element array of vanadium dioxide slot nanoantennas should be fed by a single narrow linewidth laser via a multimode interference coupler (or by an array of phase locked/injection locked narrow linewidth lasers). A 10-element array of vanadium dioxide slot nanoantennas can enable about 20 angle. Vertical stacked layers (separated by a silicon dioxide/polymer layer) of a 10-element array of vanadium dioxide slot nanoantennas can be coupled with a narrow linewidth laser and this configuration can enable about 20 angle in horizontal axis and vertical axis to enable three-dimensional optical phased array.
[0771] Furthermore, an individual vanadium dioxide slot nanoantenna can be electrically controlled (e.g., about 10 nanoseconds switching time) by via metal electrodes/transparent graphene nanoheaters, coupled through metallized via holes. Alternatively, an individual vanadium dioxide slot nanoantenna can be optically controlled (e.g., about 1 nanosecond switching time) by via optical waveguides and a laser (e.g., a 1550 nanometers laser).
[0772] The three-dimensional optical phased array for laser beam steering can include a first (optical) layer of a first optical material and a second (optical layer) of a second optical material, wherein the first (optical) layer includes an array of (nanoscaled) antennas of a phase transition/phase change/transition metal dichalcogenide (TMDC) material (the transition metal dichalcogenide material is a high second harmonic (SH) generation material) on the first optical material, wherein the second (optical) layer includes an array of (nanoscaled) antennas of a phase transition/phase change/second harmonic generation material on the second optical material, wherein the first (optical) layer of the first optical material and the (second) optical layer of the second optical material are isolated by an electrically insulating layer, wherein the first optical material and the second optical material can be similar or dissimilar in optical properties. It is desirable to have the maximum dimension of the nanoscaled antenna between 2 to 1000 nanometers.
[0773] It may be necessary to utilize some chemical mechanical polishing to ensure sufficiently flat/planar surfaces and to accurately align the first (optical) layer with the second (optical) layer via a self-aligned vertical stacking process.
[0774] For example, a first silicon nanomembrane can be transfer printed onto a suitable substrate (e.g., silicon on insulator substrate for many vertical stacks). A dielectric layer for optical waveguide, a phase transition/phase change layer for (nanoscaled) antennas (e.g., dipole/slot) and metallization on the phase transition/phase change layer and edge metal bond pads can be deposited and fabricated/constructed. A spin-on dielectric, such as spin-on-glass (SOG) or polyimide can be coated as a separation layer. It may be necessary to utilize some chemical mechanical polishing of the separation layer to ensure sufficiently flat/planar surface. A second silicon nanomembrane can be transfer printed.
[0775] Via holes (dry etching through the separation layer) can be used to contact the metallization (for electrical coupling) on the phase transition/phase change layer. Alternatively, slanted etched optical waveguides, surface gratings and mirrors can be fabricated/constructed (for optical coupling) on the phase transition/phase change layer.
[0776] The above fabrication steps can be repeated to realize multiple vertical layers, wherein each vertical layer is coupled by a single narrow linewidth laser via a multimode interference coupler (or by an array of phase locked/injection locked narrow linewidth lasers) to realize a three-dimensional optical phased array.
[0777] Because a phase transition material (e.g., vanadium dioxide) may generate an optical loss, an alternative phase change material (e.g., Ge.sub.2Sb.sub.2Te.sub.5 (GST), Ge.sub.2Sb.sub.2Se.sub.4Te.sub.1 (GSST) or Ag.sub.4In.sub.3Sb.sub.67Te.sub.26 (AIST)) can be utilized. Alternatively, a transition metal dichalcogenide material (e.g., MoS.sub.2) of monolayer/nanoscaled thickness on top of about 50 nanometers thick metal (e.g., gold) rod with dimensions of about 20 nanometers by 30 nanometers can be arrayed (in one-dimension/two-dimension) to form an optical phased arrayed antenna. A transition metal dichalcogenide material can exhibit high second harmonic generation in monolayer/nanoscaled thickness. In practice, a transition metal dichalcogenide material is a second harmonic generation material.
[0778] The four-dimensional light detection and ranging subsystem can include a metamaterial surface for laser beam steering.
[0779] The four-dimensional light detection and ranging subsystem can include an array of optomechanical antennas or an array of optoacoustical antennas for laser beam steering.
[0780] The four-dimensional light detection and ranging subsystem can include an optical switch or an array of holographic optical elements or an array of collimating lenses or a 3-port optical circulator.
[0781] The four-dimensional light detection and ranging subsystem can include a laser of a distinct wavelength/tunable wavelength/narrow linewidth. The narrow linewidth laser can be coupled with a processor for Lorentzian least squares fitting to enhance a coherence length of the narrow linewidth laser.
[0782] The computation camera can include a germanium-on-silicon single photon avalanche diode, which may be optically coupled with a light absorbing nanostructure. The single photon avalanche diode can be coupled with a lens. Furthermore, the single photon avalanche diode can be replaced by an avalanche photodiode (which each avalanche photodiode can be include integrated a vertical cavity semiconductor optical amplifier). The single photon avalanche diode can be electrically coupled with the Super System on Chip 400A/400B/400C/400D.
[0783] The single photon avalanche diode can be electrically coupled with a complementary metal-oxide-semiconductor circuitry. The complementary metal-oxide-semiconductor circuitry can be coupled with an array or a network of memristors/super memristors. Each super memristor can include (i) a resistor, (ii) a capacitor and (iii) a phase transition/phase change material based memristor. A phase transition material based memristor can be electrically and/or optically controlled. But a phase change material based memristor can be electrically or optically controlled. Furthermore, each super memristor can be electrically/optically controlled.
[0784] The single photon avalanche diode can be electrically coupled with an electronic circuitry in a vertically stacked arrangement.
[0785] One or more pulsed lasers (one or more lasers can be fabricated/constructed on a low-defect density conducting/semi-insulating/insulating substrate) of the computational camera can be intimately coupled (with reduced inductance or an inductance reduction/cancellation circuit) with a laser driver consisting of gallium nitride transistors to realize a current pulse of 1-10 ns full width at half maxima pulse width. In practice, the trailing edge should not have a long tail. The trailing edge should be no more than full width at half maxima pulse width. An inductance reduction/cancellation circuit brings together equal but opposite magnetic fields in physical alignment with each other to cancel out the two independent magnetic fields. If there is no realized magnetic field, there is no energy stored and hence there is no inductance. Hence, it is desired to keep the two conductors on the same axis in parallel with each other over the entire current loop path. In a printed circuit board design, the physical parallel axis alignment of the two copper traces on the outside layer and the layer below over the entire current loop path can determine inductance reduction/cancellation and the total layer thickness of the printed circuit board can also determine the inductance reduction/cancellation.
[0786] The single photon avalanche diode of the computational camera can be electrically coupled with an electronic circuitry in a vertically stacked arrangement.
[0787] The pulsed laser of the computational camera can be intermediately coupled with a laser driver consisting of gallium nitride transistors.
[0788] The computational camera can include a three-dimensional dynamic real time image reconstruction algorithm to detect an object in a harsh weather or around a corner.
[0789] The three-dimensional image reconstruction algorithm can iterate (via parallel computational processing) between depth, reflectivity and background updates, by applying a gradient step followed by a denoiser.
[0790] For example, the depth update can include a gradient step and a point cloud denoising. The reflectivity update can include a reflectivity step and a point cloud denoising. The background update can include an imaging step and a point cloud denoising.
[0791] The computational camera can include a digital optical phase conjugation based system (or a module in a miniature form factor), wherein the digital optical phase conjugation based system (or a module in a miniature form factor) generally can consist of a spatial light modulator, an imaging device and a laser.
[0792] The four-dimensional light detection and ranging subsystem and/or the computational camera can be operable/integrated with a bio-mimicking (bio-inspired) neuromorphic event camera. An event camera can be considered as a bio-mimicking (bio-inspired) neuromorphic sensor that is distinctly different from a conventional fixed frame camera. Instead of capturing an image at a fixed frame rate, a bio-mimicking (bio-inspired) neuromorphic event camera's optoelectronic synapse based light sensors (e.g., an array of detectors) asynchronously measure/detect per-pixel brightness changes and then provide an output as a stream of events that is encoded in time, location and brightness changes. A bio-mimicking (bio-inspired) neuromorphic event camera offers attractive properties compared to a fixed frame traditional camera at least in high temporal resolution (in the order of microseconds), very high dynamic range (140 dB vs. 60 dB), low power consumption and high pixel bandwidth (on the order of kHz) resulting in reduced motion blur. Thus, a bio-mimicking (bio-inspired) neuromorphic event camera may have a significant potential for computer vision in challenging scenarios for traditional cameras, such as low-latency, high speed and high dynamic range. For example, oxide Schottky junction (e.g., graphene/ITO electrodes on Nb (about 1 wt % Nb) doped single crystal SrTiO3) based optoelectronic synapse based light sensors can enable a bio-mimicking (bio-inspired) neuromorphic event camera via light field modulation and electric field modulation of the Schottky barrier at the graphene/ITO electrodes/Nb:SrTiO3 interface.
[0793] Furthermore, a bio-mimicking (bio-inspired) neuromorphic event camera can be communicatively interfaced with the Super System on Chip or the photonic neural learning processor to improve its performance and capability.
[0794] The four-dimensional light detection and ranging subsystem and/or the computational camera and/or the sub-terahertz imaging system and/or the bio-mimicking (bio-inspired) camera and/or a bio-mimicking (bio-inspired) neuromorphic event camera can be monolithically integrated or co-packaged on a common substrate. The bio-mimicking (bio-inspired) camera can also include a neuromorphic visual system/hyperspectral imager system, wherein the neuromorphic visual system can include an array of optically coupled capacitors or an array of optically coupled field effect transistors.
[0795] Furthermore, the hyperspectral imager system can be communicatively interfaced with (i) a first set of computer implementable instructions in artificial intelligence or machine learning or deep learning and/or (ii) a second set of computer implementable instructions in computer vision or Vision Transformer, wherein the first set of computer implementable instructions and the second set of computer implementable instructions may be stored in a local non-transitory storage media locally or on a cloud based non-transitory storage media.
[0796] A sub-terahertz imaging system includes a transmitter at a sub-terahertz wavelength and one or more receivers at the sub-terahertz wavelength.
[0797] The Super System on Chip 400A/400B/400C/400D can be coupled with a hardware security component, wherein the hardware security component includes an array of memristors/super memristors. Each super memristor can include (i) a resistor, (ii) a capacitor and (iii) a phase transition/phase change material based memristor. A phase transition material based memristor can be electrically and/or optically controlled. But a phase change material based memristor can be electrically or optically controlled. Furthermore, each super memristor can be electrically/optically controlled.
[0798] The Super System on Chip 400A/400B/400C/400D can be coupled with one or more qubits or a photonic neural learning processor, wherein the photonic neural learning processor includes an interferometer or a laser, wherein the photonic neural learning processor can be also coupled with one or more qubits.
[0799] The Super System on Chip 400A/400B/400C/400D can be coupled with a set of computer implementable instructions in an artificial intelligence algorithm/artificial neural network algorithm/machine learning algorithm, stored in a non-transitory memory component.
[0800] The Super System on Chip 400A/400B/400C/400D can be coupled with a set of computer implementable instructions in computer vision algorithm/image processing algorithm, stored in a non-transitory memory component.
[0801] The Super System on Chip 400A/400B/400C/400D can be coupled with a set of computer implementable instructions in natural language processing, stored in a non-transitory memory component.
[0802] The detection system can be coupled with a sub-terahertz imaging system, wherein the sub-terahertz imaging system includes a transmitter at a sub-terahertz wavelength and one or more receivers at the sub-terahertz wavelength, wherein one receiver consists of a heterodyne detector.
[0803] The intelligent vehicle system can include a camera, wherein the camera is a video camera/three-dimensional orientation video camera/high speed video camera/ultrafast video camera/bio-mimicking (bio-inspired) neuromorphic event camera/bio-mimicking (bio-inspired) camera/metamaterials (metasurfaces) based camera/quantum imaging camera. Details of a quantum imaging camera/system have been described/disclosed in the later paragraphs.
[0804] A high speed video camera at about 150 frames per second may generate gigabytes of raw video data in real time. Utilizing a built-in processing circuit at each individual pixel (of a high-speed video camera) gigabytes of video data can be analyzed in real time. Thus, a high speed video camera includes a built-in processing circuit (e.g., as illustrated in
[0805] However, an ultrafast video camera includes a laser that emits femtosecond laser pulses and an optical subsystem. The optical subsystem breaks up each femtosecond laser pulses into a train of shorter laser pulses, which are utilized in producing an image by an ultrafast video camera.
[0806] Generally, a bio-mimicking (bio-inspired) camera includes one or more photodetectors to detect an intensity of light in a wide dynamic range of light intensities.
[0807] A metamaterials (metasurfaces) based camera includes one or more metamaterials (metasurfaces), which can capture all image information in one snapshot. A metamaterial (metasurfaces) based camera can collect multiple (incident) wavelengths (in one snapshot) for example, utilizing an array of silver/aluminum nanostructures/nano optical antennas on an ultrathin (e.g., about 5 nanometers) insulating (spacer) layer of silicon dioxide/aluminum oxide. The above ultrathin insulating (spacer) layer of silicon dioxide/aluminum oxide is deposited on an ultrathin-film (e.g., about 50 to 200 nanometers) of aluminum/gold metal (under layer metal). It is desirable to eliminate any intermediate metal adhesion layer such as titanium (Ti)/chromium (Cr) between insulating (spacer) layer and the under layer metal.
[0808] The (center-to-center) spacing of an array of silver/aluminum nanostructures/nano optical antennas (e.g., as illustrated in
[0809] Furthermore, a metamaterial (metasurfaces) based camera can be coupled with (i) a microprocessor or (ii) a Super System on Chip for fast data processing, image processing/image recognition, deep learning/meta-learning or self-learning,
[0810] The intelligent vehicle system can include a body material of graphene integrated (included) with carbon-fiber reinforced epoxy resin or a body material of graphene-like material integrated (included) with carbon-fiber reinforced epoxy resin or a body material of synthetic silk integrated (included) with carbon-fiber reinforced epoxy resin, wherein the body material can be integrated (included) with one or more ultracapacitors or supercapacitors, wherein one ultracapacitor/supercapacitor can be charged by electromagnetic induction (including electromagnetic induction on the road).
[0811] Furthermore, any body material can be integrated (included) with one or more ultracapacitors or supercapacitors, wherein one ultracapacitor/supercapacitor can be charged by electromagnetic induction (including electromagnetic induction on the road).
[0812] The intelligent vehicle system can include a photovoltaic module and/or a photosynthesis module, wherein the photovoltaic module can include a nanostructured surface/nanostructured material.
[0813] The intelligent vehicle system can be hydrogen fuel cell powered or battery powered, the battery includes a nanotube electrode (e.g., an anode).
[0814] The intelligent vehicle system can include a Long-Term Evolution-Direct communication subsystem or a vehicle-to-vehicle communication subsystem.
[0815] The intelligent vehicle system can include a viewing window, wherein light transmission through the viewing window is electrically tunable.
[0816] The intelligent vehicle system can include a first head light and a second head light, wherein the first head light includes a first micromirror and a first light emitting diode, wherein the second head light includes a second micromirror and a second light emitting diode.
[0817] The intelligent vehicle system can include a proximity payment subsystem, wherein the proximity payment subsystem includes a near-field communication device.
[0818] The intelligent vehicle system can be sensor-aware and/or context-aware. The intelligent vehicle system can be coupled with multi-frequency (multiple bands) radar sensor. At each frequency band, a radar sensor can estimate a target in line of sight. But, when the target is not within the line of sight (rather in an oblique angle), then the radar sensor may just infer the target by distinguishing the line of sight signals, weaker multipath signals and weaker through the stationary object signals. However, integrating data collected from each band of the radar sensor, a statistical (Bayesian) probability based algorithm may infer the target, when the target is not within the line of sight (rather in an oblique angle). Furthermore, the intelligent vehicle system can be coupled with qubits.
[0819] It should be noted that thermal load of the pulsed laser depends on the pulse duration and the pulse repetition rate. The pulsed laser can be bonded p-metal side down onto a metallized heat spreader (e.g., metallized boron arsenide (B.sub.12As.sub.2) semiconductor/aluminum nitride ceramic/copper diamond composite (DMCH) ceramic).
[0820] The heat spreader can then be bonded in near proximity to a pulsed laser driver circuitry (consisting of transistors based on gallium nitride material).
[0821] The heat spreader can be a multilayer stack of two or more electrically insulating ceramics (e.g., aluminum nitride and copper diamond composite) with suitable thicknesses, thermal expansion coefficients and thermal conductivities to reduce effective thermal stress and effective thermal resistance.
[0822] The wafer of two or more electrically insulating ceramics can be bonded (wafer bonding) to create the multilayer stack of two or more electrically insulating ceramics. For example, chemical vapor deposited/wafer bonded aluminum nitride film (e.g., about 10 microns thickness) on a diamond substrate can be utilized with gold tin solder and this integrated ceramic can have a suitable thermal expansion coefficient with very high heat conductivity. Alternatively, following layers can be utilized
TABLE-US-00003 1-3 Microns Thick Au-Sn Solder Ti/Pt/Au Metal Layer Copper/Copper Composite (20 Microns Thick) Diamond Layer (400 Microns Thick) Copper (500 Microns Thick)
Alternatively, a diamond substrate with following layers can be utilized
TABLE-US-00004 1-3 Microns Thick Au-Sn Solder Ti/Pt/Au Metal Layer Copper-Tin Alloy Layer (1-3 Microns Thick) Diamond Substrate
[0823] The heat spreader can be a multilayer stack of one or more electrically insulating ceramic (e.g., aluminum nitride and copper diamond composite) and a metal (e.g., copper) with suitable thicknesses, thermal expansion coefficients and thermal conductivities to reduce effective thermal stress and effective thermal resistance. For example, a heat spreader can be copper of about 0.125 mm thickness, followed by about 0.25 mm to 0.4 mm thickness of aluminum nitride, followed by about 0.125 mm thickness of copper.
[0824] Alternatively, one or more ceramic layers can be deposited by microwave plasma-assisted chemical vapor deposition (plasma-CVD) and/or molecular beam epitaxy (MBE) onto another ceramic base substrate. For example, aluminum nitride can be deposited by microwave plasma-assisted chemical vapor deposition (Plasma-CVD) from hexakis(dimethylamido)dialuminum-Al.sub.2(N(CH.sub.3).sub.2)6.
[0825] Alternatively, one or more ceramic layers can be printed from a suitable liquid slurry consisting of a ceramic powder(s) and a polymer(s), utilizing ultraviolet (UV) light based stereolithography/three-dimensional printing and subsequent post three-dimensional printing high temperature annealing in a suitable gas mixture.
[0826] For example, in the case of an indium phosphide (InP) material based pulsed laser, the top layer for the pulsed laser bonding (e.g., p-metal contact down) can be about 400 microns thick semiconductor boron arsenide, followed by about 1600 microns thick AlSiC pyrolytic graphite composite.
[0827] Alternatively, in the case of an indium phosphide material based pulsed laser, the top ceramic for the pulsed laser bonding (e.g., p-metal contact down) can be a combination of about 20 microns thick aluminum nitride and about 1000 microns thick copper diamond composite, followed by about 1600 microns thick AlSiC pyrolytic graphite composite.
[0828] Alternatively, in the case of an indium phosphide material based pulsed laser, the top layer for the pulsed laser bonding (e.g., p-metal contact down) can be about 400 microns thick semiconductor boron arsenide, followed by about 1600 microns thick CuMoCu/AlSiC metal, wherein the 1600 microns thick CuMoCu/AlSiC metal (as a base) can include a folded fin or an array of microchannels. However, isolation layers are required to separate the microchannels from the electrical contact to the pulsed laser diode and reduce the CTE value of the cooler to 5-6.5 ppm/K.
[0829] Alternatively, in the case of an indium phosphide material based pulsed laser, the top ceramic for the pulsed laser bonding (e.g., p-metal contact down) can be a combination of about 20 microns thick aluminum nitride and about 1000 microns thick copper diamond composite, then followed by about 1600 microns thick CuMoCu/AlSiC metal, wherein the 1600 microns thick CuMoCu/AlSiC metal (as a base) can include a folded fin or an array of microchannels.
[0830] Alternatively, in the case of an indium phosphide material based pulsed laser, the top layer for the pulsed laser bonding (e.g., p-metal contact down) can be about 400 microns thick semiconductor boron arsenide, followed by about 400 microns thick CuMoCu/AlSiC metal, followed by a folded fin, followed by a structure encapsulating a thermally sensitive phase change material, then followed by about 1600 microns thick CuMoCu/AlSiC metal, wherein the 1600 microns thick CuMoCu/AlSiC metal (as a base) can include an array of microchannels.
[0831] Alternatively, in the case of an indium phosphide material based pulsed laser, the top ceramic for the pulsed laser bonding (e.g., p-metal contact down) can be a combination of about 20 microns thick aluminum nitride and about 1000 microns thick copper diamond composite, followed by about 400 microns thick CuMoCu/AlSiC metal, followed by a folded fin, followed by a structure encapsulating a thermally sensitive phase change material, then followed by about 1600 microns thick CuMoCu/AlSiC metal, wherein the 1600 microns thick CuMoCu/AlSiC metal (as a base) can include an array of microchannels.
[0832] Alternatively, in the case of an indium phosphide material based pulsed laser, the top layer for the pulsed laser bonding (e.g., p-metal contact down) can be about 400 microns thick semiconductor boron arsenide, followed by about 400 microns thick CuMoCu/AlSiC metal, followed by a folded fin, followed by a structure encapsulating a thermally sensitive phase change material, then followed by about 1600 microns thick CuMoCu/AlSiC metal/AlSiC pyrolytic graphite composite (as a base).
[0833] Alternatively, in the case of an indium phosphide material based pulsed laser, the top layer for the pulsed laser bonding (e.g., p-metal contact down) can be about 400 microns thick semiconductor boron arsenide, followed by about 400 microns thick CuMoCu/AlSiC metal, followed by a folded fin, then followed by about 1600 microns thick CuMoCu/AlSiC metal/AlSiC pyrolytic graphite composite (as a base).
[0834] Alternatively, in the case of an indium phosphide material based pulsed laser, the top ceramic for the pulsed laser bonding (e.g., p-metal contact down) can be a combination of about 20 microns thick aluminum nitride and about 1000 microns thick copper diamond composite, followed by about 400 microns thick CuMoCu/AlSiC metal, followed by a folded fin, followed by a structure encapsulating a thermally sensitive phase change material, then followed by about 1600 microns thick CuMoCu/AlSiC metal/AlSiC pyrolytic graphite composite (as a base).
[0835] Alternatively, in the case of an indium phosphide material based pulsed laser, the top ceramic for the pulsed laser bonding (e.g., p-metal contact down) can be a combination of about 20 microns thick aluminum nitride and about 1000 microns thick copper diamond composite, followed by about 400 microns thick CuMoCu/AlSiC metal, followed by a folded fin, then followed by about 1600 microns thick CuMoCu/AlSiC metal/AlSiC pyrolytic graphite composite (as a base).
[0836] Alternatively, in the case of an indium phosphide material based pulsed laser, the top ceramic for the pulsed laser bonding (e.g., p-metal contact down) can be a 1000 microns thick aluminum nitride, followed by about 400 microns thick CuMoCu/AlSiC metal, followed by a folded fin, then followed by about 1600 microns thick CuMoCu/AlSiC metal/AlSiC pyrolytic graphite composite (as a base).
[0837] Furthermore, 1000 microns thick aluminum nitride can act as an optical bench for mounting a beam shaping optical subsystem, volume holographic Bragg gratings and a laser driver.
[0838] Various permutations and combinations of the above thermal configurations are possible to reduce thermal stress, thermal resistance and to increase heat transfer efficiently.
[0839] Furthermore, instead of boron arsenide semiconductor, a metal matrix composite (MMC) material with tailored coefficient of expansion (4-8 ppm/K) and thermal conductivity (>450 W/m K), specifically those based on diamond particles (with thermal conductivity between 1000 and 2000 W/mK) can be utilized.
[0840] CuMoCu has tunable thermal properties and its properties are illustrated below:
TABLE-US-00005 CuMoCu Density CTE Thermal Conductivity W/mK Composition (g/cm3) (ppm/K) On Plane Thru Plane 14:72:14 9.88 5.6 200 170 1:4:1 9.75 6.0 220 180 1:3:1 9.66 6.8 244 190 1:2:1 9.54 7.8 260 210 1:1:1 9.32 8.8 305 250
[0841] Furthermore, CuMoCu may be replaced by WCu and its properties are illustrated below:
TABLE-US-00006 Physical Properties W90-Cu10 W85-Cu15 W80-Cu20 W75-Cu25 Composition 90% 85% 80% 75% (Wt % W) Density at 20 C. 17.0 16.3 15.6 14.9 (g/cm3) CTE at 20 C. 6.5 7.0 8.3 9.0 (ppm/K) Thermal 180 190 200 220 Conductivity (W/mK)
[0842] Furthermore, the ceramic heat spreader can consist of an array of vertical thermal vias to enhance vertical thermal conduction.
[0843] The array of microchannels can utilize an electrically insulated liquid coolant (e.g., HFE-7100) that boils as it flows through the array of microchannels. Hoverer, it should be noted that narrower diameter microchannels are useful for efficient heat transfer.
[0844] A phase change material (PCM) can store thermal energy by the phase change from solid to liquid.
[0845] Additionally, an array of microchannels can be spatially coupled with an array of microjets, which (a microjet) utilizes small jets of high velocity fluid for cooling. The microjet impinges directly on the surface to be cooled. The momentum of the jet suppresses the thermal boundary layer at the surface, producing very high heat transfer coefficients in the impingement zone. The combination of the array of microchannels and the array of microjets is a hybrid microcooling system.
[0846] Generally, the above thermal design configurations can be applied to any high heat dissipating device/chip.
[0847] Additionally, the array of microchannels can be carefully fabricated/constructed (or even embedded with the heat spreader) within the Super System on Chip 400A/400B/400C/400D or an optics to chip multichip module for efficient thermal management.
[0848] Additionally, thermal management can be performed by an application specific microcontroller/processor with a thermistor chip and an algorithm consisting of a feedback control/feed forward control/a combination of feedback and feed forward/predictive control.
[0849] The predictive control is generally designed by the minimization of a cost function in which the change of the manipulated variable and the next values of the controlled variable are evaluated. The prediction of the controlled variable at the present time k over a horizon p is based on a nonparameterized (e.g. impulse response) or a parameterized system model.
[0850] In
[0851] In
[0852] In
[0853] In
[0854] In
[0855] In
[0856] In step 2740, the user gives a service grade to the gasoline station for the service rendered. In step 2760, 100C receives a notification from an array of eye-facing cameras that the user is nodding off.
[0857] In
[0858] In
[0859] The intelligent algorithm 100 includes an application specific algorithm submodule 100C. There are other applications of the intelligent algorithm 100, for example (a) by converting detailed photo images of real properties using a computer vision/image processing based application specific algorithm submodule 100C, the value of the real property may be estimated and (b) by converting Monte Carlo enhanced discounted free cash flow (MC-DCF) to an application specific algorithm submodule 100C, the intrinsic value of a stock may be estimated.
[0860]
[0861]
[0862]
[0863] Additionally, a tandem 3-junction solar cell can include silicon quantum dots and/or germanium quantum dots for carrier multiplication in order to enable a higher efficiency solar cell. Alternatively, perovskite-copper indium gallium diselenide (CIGS) tandem or perovskite-multicrystalline silicon (Si) tandem can be utilized instead of tandem 3-junction solar cells. Solar cells for both blue spectrum and green spectrum can be coated with pentacene organic thin-film to increase the conversion efficiency by about 5%.
[0864]
[0865]
[0866] A photoanode can be based on InGaN material. A photocathode for water splitting can be based on platinum-multiwall carbon nanotube/N.sub.2P-multiwall carbon nanotube/multiwall carbon nanotube coated with Laccase enzyme. The artificial photosynthesis module is the tandem 3-junction solar cells (plus an amorphous silicon solar cell at the bottom).
[0867]
[0868]
[0869] The point of sale payment system can be provisioned or enabled by a second biometric sensor, in case of any malfunction of the first biometric sensor. The instant variable code for the user varies at each point of sale transaction.
[0870] Similar to
[0871]
[0872]
[0873]
[0874] The point of sale payment system can be provisioned or enabled by a second biometric sensor, in case of any malfunction of the first biometric sensor. The instant variable code for the user varies at each point of sale transaction.
[0875] Similar to
[0876]
[0877]
[0878] A fingerprint sensor can be fabricated/constructed by combining colloidal crystals with a rubbery material, wherein colloidal crystals can be dissolved in a suitable chemical leaving air voids in the rubbery material, thus creating an elastic photonic crystal. The fingerprint sensor emits an intrinsic color, displaying three-dimensional ridges, valleys and pores of the user's fingerprint, when pressed. The cash card specific System on Chip with a specific algorithm and camera can be utilized to compare the user's previously captured/stored fingerprint. A non-matching fingerprint would render the cash card instantly unusable.
[0879] Details of the optical fingerprint sensor have been described/disclosed in U.S. non-provisional patent application Ser. No. 12/931,384 entitled DYNAMIC INTELLIGENT BIDIRECTIONAL OPTICAL ACCESS COMMUNICATION SYSTEM WITH OBJECT/INTELLIGENT APPLIANCE-TO-OBJECT/INTELLIGENT APPLIANCE INTERACTION, filed on Jan. 31, 2011 and in its related U.S. non-provisional patent applications (with all benefit provisional patent applications) are incorporated in its entirety herein with this application.
[0880]
[0881]
[0882]
[0883] It should be noted that any code number (e.g., a card verification value number) on the cash card A or cash card B or cash card C can be dynamically reconfigured/changed, as the cash card A or cash card B or cash card C contains a cash card specific System on Chip (integrated with a processor, a memory component, a secure element and a storage component).
[0884] Thus, the cash card A or cash card B or cash card C with any dynamically reconfigured/changed code number can reduce fraud related to any transaction.
[0885]
[0886] The cash card can have electromagnetic coils in its interior for receiving electrical power wirelessly at a close proximity to the intelligent portable internet appliance 160 or the intelligent wearable augmented reality personal assistant device 180.
[0887] The cash card can be integrated with the intelligent portable internet appliance 160 or the intelligent wearable augmented reality personal assistant device 180 or the social wallet.
[0888] Utilizing the cash card, the user can securely purchase/rent a product/service.
[0889] The user can register for a secure short text message payment service by sending/verifying a short text message with a web portal of the cash card (wherein the web portal is configured with intelligent algorithms) in order to create a virtual cash card account. Upon verification of the (a) user's unique pin number, (b) user's unique biometric identification (e.g., finger vain sensor/voice), (c) user required reply within a specified timeout period for a one time random key provided (from the web portal of the cash card) and (d) a digital security protection algorithm submodule 100A (within Fazila as described/illustrated in
[0890] The social wallet (e.g., 100N2/natural language activated/voice activated Fazila as described/illustrated in
[0891] Patterns of various applications or functions of a single user can be incorporated in the personal web. The personal web can make life easier in automating routine actions/decisions for the user. The personal web can relate to (a) social (people, the user interacts with and the content the user exchanges in the social networks), (b) location (the user checks into), (c) product (the things the user buys on Amazon or eBay, the movies the user watches on Snapchat/Netflix/YouTube or the hotels the user books online) and (d) interest (the sort of things the user searches for on Google/You Tube or the things the user like on Facebook)-thus the personal web can reveal a lot about the user. Building a statistical history, learning and relearning about the user data of social, location, product and interest, the usefulness of a personal web can be enhanced. For example, the personal web can be configured to know what time the user wants/anticipates waking up at, even before the user sets an alarm. It knows the user's route to work and monitors traffic along the way, guiding the user through the most efficient route. Before the user's lunch break, the user can get food recommendations based on his/her past eating habits and current health conditions. When the user gets home, a smart thermostat has heated the home to the user's preferred temperature and a smart TV has remembered that the user loves to watch the evening news with CBS Dan Rather after work.
[0892] Furthermore, the usefulness of the personal web can be enhanced by connecting with sensors, wherein the sensors are also connected with the distributed internet/distributed semantic internet (coupled with a public/consortium/private blockchain) and/or intelligent portable internet appliance 160 and/or the intelligent wearable augmented reality personal assistant device 180.
[0893] The user has multiple passwords, identifications, services and devices. But security across them is fragmented. The digital security protection algorithm submodule 100A can sort through contextual, situational and historical data to verify the user's identity on different devices including the user's identity with biometric data in near real time/real time. The digital security protection algorithm submodule 100A can learn about the user's social graph and make an inference about the user behavior that is out of the norm or may be due to someone stealing that user's identity. Based on the user's social graph, the digital security protection algorithm submodule 100A will know the user intimately, for example if a particular user is a vegetarian, but someone is buying a non-vegetarian food with the user's credit card, the digital security protection algorithm submodule 100A will automatically close the credit card in question. Thus, online security is based on intimacy with the user's social graph, rather than a collection of various fragmented passwords.
[0894] Furthermore, the one integrated user identification can be embedded with the digital security protection algorithm 100A.
[0895] A social graph of a user, enabled by (a) sensors (e.g., a location determination module-indoor positioning system/global positioning system), (b) individual data patterns of the user, (c) an algorithm for generating the user's social graph with machine transformations, wherein the algorithm for generating the composite social graph with machine transformations can be stored in a local data storage unit of the intelligent portable internet appliance 160 and/or the intelligent wearable augmented reality personal assistant device 180 and/or a cloud based data storage unit of the social wallet.
[0896] The near real time/real time snapshots/holographic snapshots (e.g., images/videos) of the contextual world around the user can be color enhanced/edited/geotagged/personalized (e.g., personalized with emoji/emoticon) by utilizing an algorithm(s). The user's (or the user's one integrated user identification) social graph and/or social geotag can be linked with a virtual avatar.
[0897] The near real time/real time snapshots/holographic snapshots (e.g., images/videos) by a camera (e.g., camera of the intelligent portable internet appliance 160/intelligent wearable augmented reality personal assistant device 180) can be instantly recognized (with or without much information about the snapshots/holographic snapshots) or color enhanced or edited/geotagaged/personalized by utilizing an algorithm(s). Furthermore, near real time/real time snapshots/holographic snapshots can be integrated with the virtual avatar (and the virtual avatar can be coupled with a public/consortium/private blockchain) and shared via the internet or a cloud based data storage unit of the social wallet via the intelligent portable internet appliance 160 or the intelligent wearable augmented reality personal assistant device 180.
[0898] Alternatively, the user can store his/her social graph and/or social geotag in his/her personal cloud via a microcomputer (e.g., Raspberry Pi) with properly implemented cryptography (e.g., lattice based encryption, which can hide data inside complex algebraic structures) and personal authentication (e.g., face/voice recognition).
[0899] The user can auction/monetize his/her social graph with or without social geotag by utilizing an auction algorithm(s) or opt out. The price of the user's social graph with or without social geotag can be based on the utility function of his/her social graph and/or social geotag to an advertiser-thus enabling user centric distributed personal web and democratizing the distributed internet.
[0900] Details of the personal web and auctioning/monetizing the user's social graph have been described/disclosed in U.S. non-provisional patent application Ser. No. 15/731,577 entitled OPTICAL BIOMODULE FOR DETECTION OF DISEASES AT AN EARLY ONSET, filed on Jul. 3, 2017 and in its related U.S. non-provisional patent applications (with all benefit provisional patent applications) are incorporated in its entirety herein with this application.
[0901] Furthermore, the user can securely host/store his/her own files and data (which can be used at any place, any time and any device) in his/her personal cloud via a microcomputer. Such a microcomputer can enable secure communication (e.g., Bitmail) and connect with other systems/subsystems/objects/biological objects via a personal network (e.g., Wi-Fi). Instead of talking to a centralized e-mail mail server at Google, Bitmail can distribute messages across networks of peer users, encrypting Bitmail's address and content automatically. Furthermore, peer users can help store and only deliver Bitmail to the intended recipient user. Bitmail can obscure the sender's identity and an alternate Bitmail address can send Bitmail on the user's behalf. Additionally, this can enable online payment, protecting privacy of the user via the user's virtual avatar (which can be coupled with a public/consortium/private blockchain). Through the user's virtual avatar, the user just would need to supply/apply a fragment of information necessary to receive a service (e.g., purchasing an item). Furthermore, intelligence from the user's social graph and/or social geotag can be realized by an intelligent learning set of instructions, which can include: a computer vision algorithm and/or an artificial intelligence algorithm and/or an artificial neural network algorithm and/or a machine learning (including artificial neural networks/deep learning/meta-learning and self-learning) algorithm for ultrafast data processing, image processing/image recognition, deep learning/meta-learning and self-learning.
[0902] The intelligent learning set of instructions (e.g., as described/illustrated in
[0903] The remote browser can be coupled with an array of memristors, as described/disclosed in pervious paragraphs. Furthermore, the intelligent learning set of instructions (described/illustrated in
[0904] It should be noted that the intelligent learning set of instructions can include a quantum computer enhanced machine learning (including artificial neural networks/deep learning/meta-learning and self-learning) algorithm and such realized intelligence can enable targeted advertisement to the user/user's virtual avatar.
[0905] A composite social graph of many users, enabled by (a) sensors (e.g., a location determination module-indoor positioning system/global positioning system), (b) collective data patterns, (c) the intelligent learning set of instructions for generating the composite social graph with machine transformations, wherein the composite social graph can be stored in a local data storage unit of the intelligent portable internet appliance 160 and/or the intelligent wearable augmented reality personal assistant device 180 and/or a cloud based data storage unit of the social wallet.
[0906] The composite social graph may include location, web tracking, message/e-mail, social media/message, near real time/real time bidding/auction, online purchase and online/digital banking.
[0907] A method of extracting intelligence and prediction from the composite social graph can utilize a topological data analysis algorithm submodule, a computer vision algorithm submodule, a pattern recognition algorithm submodule, a data mining algorithm submodule, Big Data analysis algorithm submodule, a statistical analysis algorithm submodule, a fuzzy logic (including neuro-fuzzy) algorithm submodule, an artificial neural network/artificial intelligence algorithm submodule, a machine learning (including artificial neural networks/deep learning/meta-learning and self-learning) algorithm submodule, a predictive analysis algorithm submodule, a software agent algorithm submodule and a natural language processing algorithm submodule.
[0908] This one-time random key is sent to the user via a short text message (from the web portal of the cash card) and it will be received only by the user.
[0909] Loss of the short text message will lead to a transaction failure, while a delayed short text message may increase the time required for the transaction to complete. However, this may affect only a small number of transactions.
[0910] Fazila is described/illustrated in
[0911] The connections between various algorithm submodules of the intelligent algorithm 100X can be similar to synaptic networks to enable deep learning/meta-learning and self-learning of the intelligent algorithm 100X. Furthermore, Fazila, as described/illustrated in
[0912] An application of Fazila, as described/illustrated in
[0913] Furthermore, Fazila, as described/illustrated in
[0914] Furthermore, the user can anonymously purchase products/services/pay online without revealing the user's true identity.
[0915] For example, the user could ask for a one-time password (OTP) for his/her Amazon account by clicking the Amazon icon on the user's intelligent portable internet appliance (e.g., as illustrated in
[0916] Details of the social wallet enabling online payment, online real money transfer between users and online virtual money transfer between users have been described/disclosed in U.S. non-provisional patent application Ser. No. 13/448,378 entitled SYSTEM AND METHOD FOR INTELLIGENT SOCIAL COMMERCE, filed on Apr. 16, 2012 (U.S. Pat. No. 9,697,556, issued on Jul. 4, 2017) and in its related U.S. non-provisional patent applications (with all benefit provisional patent applications) are incorporated in its entirety herein with this application.
[0917] Furthermore, intelligence from the user's social graph and/or social geotag can be realized by an intelligent learning set of instructions, which can include: a computer vision algorithm and/or an artificial intelligence algorithm and/or an artificial neural network algorithm and/or a machine learning (including artificial neural networks/deep learning/meta-learning and self-learning) algorithm for ultrafast data processing, image processing/image recognition, deep learning/meta-learning and self-learning.
[0918] Instead of the verification of the user's unique biometric identification, the user can utilize a near field communication enabled cash card to authenticate himself/herself with the near field communication enabled intelligent portable internet appliance 160 or the near. field communication enabled intelligent wearable augmented reality personal assistant device 180.
[0919]
[0920]
[0921] It should be noted that other forms of text message can be utilized instead of the short text message.
[0922]
[0923]
[0924]
[0925]
[0926]
[0927] In another embodiment the bioobject 120B can be only gold nanoparticles containing/coupling with a specific ligand to bind with a (disease) biomarker binder or a protein/biomolecule in blood. A specific ligand can be a specific receptor.
[0928] These gold nanoparticles (containing/coupling with a specific ligand to bind with a (disease) biomarker binder or a protein/biomolecule in blood) can be encapsulated or sandwiched within a porous biocompatible material (e.g., (i) hydrogel or (ii) a porous membrane (e.g., porous carbon membrane) and poly(dimethylsiloxane) or (iii) a porous metallic glass material). The bioobject 120B can be implanted under human skin.
[0929] An optical spectrum (e.g., a near infrared optical spectrum due to binding of a specific ligand to bind with a (disease) biomarker binder or a protein/biomolecule in blood with a specific ligand) can be continuously detected/monitored by a spectrophotometer, when the gold nanoparticles can be excited by a light source.
[0930] Furthermore, a pair of gold nanoparticles (containing/coupling with a specific ligand to bind with a specific protein/biomolecule) can be chemically coupled with a single strand of DNAsuch an arrangement can act as a plasmonic nanoantenna to enhance the signal of the optical spectrum.
[0931] Details of the plasmonic nanoantenna have been described/disclosed in U.S. non-provisional patent application Ser. No. 15/731,577 entitled BIOMODULE TO DETECT A DISEASE AT AN EARLY ONSET, filed on Jul. 3, 2017 and in its related U.S. non-provisional patent applications (with all benefit provisional patent applications) are incorporated in its entirety herein with this application.
[0932] For in-vivo diagnostics, the light source can be coupled with an optical fiber. The end of the optical fiber can be fabricated/constructed with a protruded metal/non-metal nano optical antenna (
[0933] Additionally, Mn.sup.2+ ions can be encapsulated within the pH-sensitive biodegradable calcium phosphate nanoshell or any suitable nanoshell to release Mn.sup.2+ in cancer cells. Mn.sup.2+ in cancer cells can be utilized as an enhanced MRI contrast agent.
[0934] For a cancer therapeutic application, a functionalized (e.g., one/two ligands to chemically bind/couple with one type/two types of cell receptors) smart nanoshell encapsulating a light sensitive compound can be injected into the bloodstream and absorbed selectively by cancer cells. When the treated cancer cells are exposed to laser (coupled with an optical fiber), highly reactive oxygen molecules can be produced to destroy cancer cells.
[0935] The end of the optical fiber can be fabricated/constructed with a protruded metal/non-metal nano optical antenna (
[0936] Similarly, for a cancer therapeutic application, a functionalized (e.g., one/two ligands to chemically bind/couple with one type/two types of cell receptors) smart nanoshell encapsulating cerium fluoride (CeF.sub.3) nanoparticles can be injected into the bloodstream and absorbed selectively by cancer cells. When the treated cancer cells are exposed to X-ray/pulsed terahertz radiation, highly reactive oxygen molecules can be produced to destroy cancer cells.
[0937]
[0938] For example, the bioobject 120B can measure and transmit the user's heart rhythm periodically. If the user's heart rhythm is perceived to be abnormal (compared with the user's normal heart rhythm) then the intelligent portable internet appliance 160/intelligent wearable augmented reality personal assistant device 180 can communicate automatically for emergency 911 (indicating the user's location by a global/indoor positioning system) help without any human input.
[0939]
TABLE-US-00007 TABLE 1 Component Description 100 Algorithm 340 Three-Dimensional/Holographic Display 380 Communication Radio* (WiMax/LTE/4G/5G/ Higher Than 5G) 400A/400B/ Super System On Chip (Can Be Coupled With 400C/400D An Artificial Eye/LiDAR/Computational Camera) 420 Operating System Algorithm 440 Security & Authentication Algorithm 460 Time Shift & Place Shift Device 480 Surround Sound Microphone 500 Front Facing High Resolution Camera(s) @ Low Light Level Front Facing High Resolution Camera(s) @ Low Light Level Can Be Coupled With An Artificial Eye(s) Front Facing High Resolution Camera(s) @ Low Light Level May Consist Of Complementary Metal Oxide Semiconductor Camera Based Sensor(s) With Integrated Metasurface Built-On Top Of Complementary Metal Oxide Semiconductor Camera Based Sensor(s) 520 Back Facing High Resolution Camera(s) @ Low Light Level Back Facing High Resolution Camera(s) @ Low Light Level Can Be Coupled With An Artificial Eye(s) Back Facing High Resolution Camera(s) @ Low Light Level May Consist Of Complementary Metal Oxide Semiconductor Based Camera Sensor(s) With Integrated Metasurface Built-On Top Of Complementary Metal Oxide Semiconductor Based Camera Sensor(s) 540 High Resolution Camcorder @ Low Light Level (Can Be Coupled With An Artificial Eye) 560 Microprojector 580 Proximity Radio * (Near Field Communication/ Bluetooth LE) TxRx 600 Personal Area Networking Radio 1* (Bluetooth/Wi-Fi) TxRx 620 Personal Area Networking Radio 2* (Ultrawide Band/Millimeter-Wave) TxRx 640 Positioning System (Global Positioning System* & Indoor Positioning System) 660 Universal Communication Interface (UCI) 680 Electronic Personal Assistant 700 Electrical Powering Device (Solar Cell + Battery + Ultracapacitor) With Wireless Charging Option 720 Stylus [*With Radio Specific Antenna] [TxRx Means Transceiver]
[0940] The intelligent portable internet appliance 160 can enable wireless electrical charging or over the air electrical charging (electromagnetically charging through air). A power base station can be plugged into the electrical wall plug/socket. The power base station can emit low-frequency (4 MHz to 10 MHz) electromagnetic radiation. A power harvesting circuitry on an electrical contact area of the intelligent portable internet appliance 160 can resonate at the same frequency emitted by the power base station. When the electrical contact area of the intelligent portable internet appliance 160 comes in close proximity to the power base station, the electrical contact area of the intelligent portable internet appliance 160 can absorb the energy via electromagnetic coupling-thus enabling electromagnetically charging through air.
[0941] Similarly, the intelligent portable internet appliance 160 can enable wireless electrical charging or over the air electrical charging (electromagnetically charging through air) with another intelligent portable internet appliance 160.
[0942] The intelligent portable internet appliance 160 can project light beam(s) through a permeable front panel to simulate a dial pad
[0943] Details of the electronic personal assistant and stylus to write on a display have described/disclosed in U.S. non-provisional patent application Ser. No. 13/448,378 entitled SYSTEM AND METHOD FOR INTELLIGENT SOCIAL COMMERCE, filed on Apr. 16, 2012 and its related U.S. non-provisional patent applications (with all benefit provisional patent applications) are incorporated in its entirety herein with this application.
[0944] A universal communication interface can integrate animation, animated GIF, drawings, emotions, gestures (hand/eye), location data, text, voices, voice snippets and videos.
[0945] The universal communication interface can be further enhanced by Fazila as described/illustrated in
[0946] Solar cells can be fabricated/constructed on top of the battery, integrated with an ultracapacitor.
[0947] The intelligent portable internet appliance 160 is sensor-aware and context-aware, as it is wirelessly connected/sensor connected with objects 120As, object nodes 120s, bioobjects 120Bs and bioobject nodes 140s.
[0948]
[0949] The stretchable display 360 can be reconfigured into two viewing windows, denoted as 360A and 360B. The two viewing windows can display different images. The stretchable display can be fabricated/constructed utilizing a light emitting (stretchable) polymer.
[0950] Alternatively, a display or a holographic display can be foldable, which can be constructed from a graphene sheet and/or an organic light-emitting diode connecting/coupling/interacting with a printed organic transistor and a rubbery conductor (e.g., a mixture of carbon nanotube/gold conductor and rubbery polymer) with a touch/multi-touch sensor.
[0951] A foldable display can replace the stretchable display 360.
[0952] Details of the foldable display have been described/disclosed in U.S. non-provisional patent application Ser. No. 12/931,384 entitled DYNAMIC INTELLIGENT BIDIRECTIONAL OPTICAL ACCESS COMMUNICATION SYSTEM WITH OBJECT/INTELLIGENT APPLIANCE-TO-OBJECT/INTELLIGENT APPLIANCE INTERACTION, filed on Jan. 31, 2011 and in its related U.S. non-provisional patent applications (with all benefit provisional patent applications) are incorporated in its entirety herein with this application.
[0953] It should be noted that the stretchable display 360 can be a wraparound display that continues over the edge of the intelligent portable internet appliance 160/160A onto the rear of the intelligent portable internet appliance 160/160A.
[0954]
[0955]
[0956]
[0957] Gradually tapered silicon optical waveguides (on silicon) connecting with polymer optical waveguides (on silicon) can enable large-scale integration of photonic integrated circuits and electronic integrated circuits. Various photonic components can be integrated utilizing an asymmetric twin-waveguide (ATG) structure.
[0958] Details of the large-scale integration of photonic integrated circuits and electronic integrated circuits have been described/disclosed in U.S. non-provisional patent application Ser. No. 13/448,378 entitled SYSTEM AND METHOD FOR INTELLIGENT SOCIAL COMMERCE, filed on Apr. 16, 2012 and in its related U.S. non-provisional patent applications (with all benefit provisional patent applications) are incorporated in its entirety herein with this application.
[0959]
[0960]
[0961]
[0962]
[0963] A topological insulator is an insulator in the bulk interior, but conducting at the edges without any heat dissipation. A special normal insulator can be switched (e.g., either electrically or optically by a laser) to a topological insulator (material state) at a room temperature. Such switchable topological insulator can electrically connect a source metal and a drain metal of a transistor. For example, an electrically switchable (room temperature) topological insulator is a two-dimensional (atomically thin) Na.sub.3Bi or Bi.sub.xSe(1x) or Bi.sub.2Se.sub.3 or an atomically thin layer of bismuth atoms on insulating silicon carbide substrate (bismuthene).
[0964] Alternatively, attracted pairs of electron and holes in two (2) atomically thin semiconductors (a first semiconductor is carrying electrons and a second semiconductor is carrying holes) can enable (room temperature) exciton superfluid of an energy efficient exciton transistor without any heat dissipation.
[0965]
[0966] A memristor is a non-linear resistive and switching device with an inherent memory similar to a synapse. Both are two-terminal devices whose conductance can be modulated by an external stimulus with the ability to store (memorize) new information. Memristor can bring data closer to a processor, without a lot of electrical power consumption, as a biological neural system does. Also, memristors/super memristors can create neuron-like voltage spikes to enable realistic neuromorphic circuits. Each super memristors can include (i) a resistor, (ii) a capacitor and (iii) a phase transition/phase change material based memristor. A phase transition material based memristor can be electrically and/or optically controlled. But a phase change material based memristor can be electrically or optically controlled. Furthermore, each super memristor can be electrically/optically controlled.
[0967] Alternatively, photonic synapse mimicking the biological neural synapse can be based on a tapered optical waveguide (e.g., a silicon nitride material based optical waveguide) with discrete phase change/phase transition material islands on top of the tapered optical waveguide and a 3-port optical circulator-optically coupling the photonic synapse (in one port), the post-neuron (in another port) and the weighing pulses and pre-neuron (in another port).
[0968] A photonic integrated circuit of many (e.g., 100) photonic synapses can include both input diffraction (optical) couplers and output diffraction (optical) couplers-thus enabling a photonic neural learning processor.
[0969] Additionally, a photonic neural learning processor (can be useful for machine learning (including artificial neural networks/deep learning/meta-learning and self-learning) and/or image/pattern recognition and/or Big Data analysis) can be fabricated/constructed for example, utilizing a cascaded configuration of interferometers (e.g., Mach-Zehnder type interferometers), 3-db (optical) couplers and optical waveguide based phase shifters. Heat applied to the optical waveguide base phase shifter(s) can direct light beams to change its shape. It should be noted that interferometer(s) and/or optical waveguide based phase shifter(s) can be fabricated/constructed, utilizing a phase change/phase transition material for faster response to an external stimulus (e.g., heat or voltage) and/or integrated with saturable absorbers (e.g., graphene integrated saturable absorber). To reduce thermal cross-talk between the heating elements, thermal isolation trenches can be fabricated/constructed between the heating elements. Alternatively, the photonic neural learning processor can be fabricated/constructed for example as a network(s) of wavelength tunable/selective laser-integrated with an external modulator, when the external modulators are activated by an action of weighted electrical signals (from an array of memristors/super memristors (Each super memristor can include (i) a resistor, (ii) a capacitor and (iii) a phase transition/phase change material based memristor. A phase transition material based memristor can be electrically and/or optically controlled. But a phase change material based memristor can be electrically or optically controlled. Furthermore, each super memristor can be electrically/optically controlled) or by converting optical signals of distinct wavelengths from ring resonators/fast tunable ring resonators (e.g., fast tunable ring resonators incorporating vanadium dioxide thin-film/quantum dot) based add/drop filters). The above network(s) can also utilize a network(s) of optical switches/fast optical switches. It should be noted that the photonic neural learning processor can be a standalone subsystem. Such a system on chip or an artificial neural network based system on chip can enable cognitive/artificial neural like computing. Furthermore, a system on chip or an artificial neural network system based on chip can include ultrafast graphene transistors of modified band structure: silicon carbide (substrate)preciously positioned/intercalated magnetic metal ions (e.g., rare-earth metal ions) below graphenegraphene.
[0970] In digital electronics, memory and processors are spatially separated. But, in a biological neural network, each neuron can process and store data with minimum latency. Similarly, a photonic matrix tensor unit (PMTU) can process and store data with minimum latency.
[0971] A photonic matrix tensor unit can be fabricated/constructed, wherein multiple wavelengths with weighted signals such as 1 wavelength with a first wavelength weighting factor 1 . . . n wavelength with nth wavelength weighting factor an are combined/multiplexed by a wavelength division combiner/multiplexer (WDM)the combined/multiplexed signals on the first output optical waveguide are separated/filtered by a first series of ring resonators. The outputs of the first series of ring resonators are optically coupled in intimate proximity with a series of Mach-Zehnder interferometers (wherein one arm of each Mach-Zehnder interferometer includes either a phase transition material or a phase change material. The phase transition material or the phase change material can be electrically controlled or optically controlled. However, optical control may enable ultrafast (e.g., femtoseconds' time domain) speed advantage) to perform a second wavelength weighting factor 1 . . . n (due to pre-set phase changes in the series of Mach-Zehnder interferometers) in an optical domain. The weighted outputs of the series of Mach-Zehnder interferometers are then optically coupled in intimate proximity with a second set of ring resonators. The outputs of second set of ring resonators are matrix multiplication via light-matter interaction such as 1 1+2 2 . . . +n nwhich can be summed on a second optical waveguide and detected by a photodetector, coupled with the second optical waveguide.
[0972] Furthermore, each Mach-Zehnder interferometers can be replaced by an optical waveguide containing a phase transition or a phase change material, wherein the refractive index of the optical waveguide containing a phase transition or a phase change material can be tuned by an electrical (e.g., current/voltage) or an optical stimulus.
[0973] An array of photonic matrix tensor units can be utilized as a photonic neural learning processor.
[0974] The advantages of a large array of photonic matrix tensor units to perform intelligent tasks are substantial, wherein the data is in optical form (e.g., 5G networks).
[0975] Furthermore, a large array of photonic matrix tensor units can be coupled with a supercomputer and/or qubits.
[0976] Furthermore, a system on chip or an artificial neural network based system on chip can integrate the photonic neural learning processor via a network(s) of optical waveguides (including an optical waveguide(s) of nonlinear chalcogenide glass material), thus enabling a hybrid electrical-photonic neural learning processor.
[0977] Alternatively, the photonic neural learning processor can be fabricated/constructed utilizing an array of optically induced phase transition material (e.g., vanadium dioxide) based memristors/super memristors. Each super memristor can include (i) a resistor, (ii) a capacitor and (iii) a phase transition/phase change material based memristor. A phase transition material based memristor can be electrically and/or optically controlled. But a phase change material based memristor can be electrically or optically controlled. Furthermore, each super memristor can be electrically/optically controlled.
[0978] Details of the memristor have been described/disclosed in U.S. non-provisional patent application Ser. No. 13/448,378 entitled SYSTEM AND METHOD FOR INTELLIGENT SOCIAL COMMERCE, filed on Apr. 16, 2012 and in its related U.S. non-provisional patent applications (with all benefit provisional patent applications) are incorporated in its entirety herein with this application.
[0979] Alternatively, a circularly/elliptically polarized optical pulse(s) from a first pulsed laser of a first optical intensity (e.g., 0.1 mV/cm strength) at a first wavelength (e.g., infrared) on an atomically thin layer/monolayer/thin-film of a two-dimensional material (e.g., tungsten diselenide) can put electrons of the two-dimensional material into a first pseudospin state (e.g., computing Von Neumann state 1) and then a linearly polarized optical pulse(s) from a second pulsed laser of a second optical intensity (e.g., 10 mV/cm strength) at a second wavelength (e.g., terahertzfor example coupling a femotosecond laser device with a non-linear material) can put electrons of the two-dimensional material into a second pseudospin state (e.g., computing Von Neumann state 2) in femtoseconds. The first optical intensity is different from the second optical intensity and the first wavelength is different from the second wavelength.
[0980] Such ultrafast switching from the first pseudospin state/computing Von Neumann state 1 (e.g., emitting detectable light of clockwise circular polarization) to the second pseudospin state/computing Von Neumann state 2 (e.g., emitting detectable light of counterclockwise circular polarization) can enable a unique building block of an ultrafast (clock speed) digital optical processing element.
[0981] Furthermore, the two-dimensional material can be epitaxially (e.g., atomic layer epitaxy/molecular beam epitaxy) grown/deposited (e.g., chemical/ion beam/physical vapor deposition)/three-dimensionally printed on a first substrate (e.g., boron nitride), where the first substrate is transparent to the incident wavelength.
[0982] For example, the first substrate can be a silicon/silicon on insulator/silicon on sapphire, which is transparent to an infrared wavelength. The first substrate can be utilized for epitaxially growing/depositing/three-dimensional printing the two-dimensional material (also etching an array of microscaled/nanoscaled spots of the two-dimensional material).
[0983] An array of the microscaled/nanoscaled spots can be arrayed into a two-dimensional configuration. Additionally, a vertical heterostructure stack of the two-dimensional material and an array of the microscaled/nanoscaled spots can be arrayed into a three-dimensional configuration.
[0984] Alternatively, an ultrafast photonic neural learning processor can be fabricated/constructed when a network(s) of the first pulsed lasers and second pulsed lasers are activated by an action of weighted electrical signals (from an array of memristors/super memristors or by converting optical signals of distinct wavelengths from ring resonators/fast tunable ring resonators (e.g., fast tunable ring resonators incorporating vanadium dioxide thin-film/quantum dot) based add/drop filters). Alternatively, a photonic neural learning processor can be fabricated/constructed utilizing an array of optically induced phase transition material (e.g., vanadium dioxide) based memristors/super memristors. Each super memristors can include (i) a resistor, (ii) a capacitor and (iii) a phase transition/phase change material based memristor. A phase transition material based memristor can be electrically and/or optically controlled. But a phase change material based memristor can be electrically or optically controlled. Furthermore, each super memristor can be electrically/optically controlled.
[0985] Furthermore, the photonic neural learning processor can integrate network(s) of optical waveguides (including an optical waveguide(s) of nonlinear chalcogenide glass), thus enabling a hybrid electrical-photonic neural learning processor.
[0986] A qubit has the odd property that it can be in superposition, meaning it's in two different states at the same time: The bits in a Von Neumann computer can represent either zero or one, but a qubit can represent both zero and one at the same time. For this reason, a string of only 16 qubits can represent 64,000 different numbers simultaneously. It is because a quantum computer can in principle evaluate all possible solutions to the same problem in parallel that increases computational speed exponentially.
[0987] But one of the difficulties in building a quantum computer is that superposition of states can be very fragile. Any interaction (e.g., a material defect/vibration/fluctuating electric fields/noise) with its environment can cause a subatomic particle to snap into just one of its possible states. Photons are much more resistant to outside influences than subatomic particles, but that also makes them harder to control over the course of a computation, a quantum computer needs to repeatedly alter the states of qubits.
[0988] Additionally, there may be superposition of the first pseudospin state and second pseudospin state-enabling an ultrafast qubit at a normal temperature. An array of such qubits at microscaled/nanoscaled spacing (only limited by diffraction/near-field diffraction) can enable an optical quantum computer at a normal temperature.
[0989] Furthermore, a compact optical configuration can be realized by fabricating/constructing a network of silicon nitride optical waveguides on top of a second substrate. The network of silicon nitride optical waveguides can route light. Above the silicon nitride optical waveguides, a layer (e.g., about 1 micron in thickness) of silicon dioxide thin-film or an electrically activated optically tunable material based thin-film can be fabricated/constructed. On top of the silicon dioxide thin-film or electrically activated optically tunable material based thin-film on the second substrate, there are transparent/indium tin oxide/niobium electrodes, integrated with tiny openings in the electrodes to allow light (which is guided via silicon nitride optical waveguides) to pass through to activate/configure a qubit on the first substrate. Beneath the tiny openings in the transparent/indium tin oxide/niobium electrodes, the optical waveguides in silicon nitride break into a series of sequential ridges to act as diffraction gratings in order to direct light down through the holes and concentrate the light into a beam narrow enough to activate/configure a qubit on the first substrate, as described/disclosed in the previous paragraph. Furthermore, integration of a surface normal light modulator (e.g., a graphene based surface normal spatial light modulator) with the diffraction gratings can also be realized.
[0990] A single microscaled/nanoscaled spot (only limited by diffraction/near-field diffraction) of the two-dimensional material can be formed on an optical waveguide (on the second substrate), wherein the optical waveguide can be utilized to propagate both circularly/elliptically polarized optical pulse(s) of the first wavelength at time t=0 and linearly polarized optical pulse(s) of the second wavelength at time t=t.sub.1, which can be sequenced in time domain.
[0991] Furthermore, in some configurations the first substrate can be integrated/co-packaged with the second substrate. In some configurations the first substrate can be the same as the second substrate.
[0992] Alternatively, qubits on the first substrate can be realized by entangled impurity ions, implanted (at a precise depth) into a nanoscaled (e.g., about 50 nanometers in diameter single crystal) phase transition material. The phase transition material can be grown or fabricated/constructed on yttria-stabilized zirconia (YSZ) with refractive index of 2.110 at 1550 nanometers. Photoluminescence (which can be enhanced by a pair of nanoscaled optical antennas (as illustrated in
[0993] Alternatively, qubits on the first substrate can be realized by entangled nitrogen vacancy color centers. The first substrate can include an array (or a network) of optical waveguides (e.g., single mode/multi-mode optical waveguides) of a diamond single-crystal by optical/electron-beam lithography and ion-beam milling/reactive-ion/wet etching. The above array (or the network) of optical waveguides can be coupled to an array of optical fibers.
[0994] A nitrogen vacancy color center is a nitrogen (contamination) impurity molecule in the diamond (carbon) lattice located adjacent to an empty lattice site or a vacancy. A nitrogen vacancy color center can be created utilizing a single-crystal diamond, which is inherently contaminated with about 2 PPM (parts per million) nitrogen impurity molecules and a first laser pulse (e.g., from a femtosecond laser).
[0995] The first pulse can be activated to create an empty lattice site or a vacancy. Then a second laser pulse can be activated to move/push the newly created empty lattice site or the vacancy toward the nitrogen molecule (contamination) impurity molecule until a fluorescence signal from the newly formed nitrogen vacancy color center is detected. The intensity of the first laser pulse can be higher than the intensity of the second laser pulse.
[0996] Each optical waveguide can include one or more such nitrogen vacancy color centers at specific locations. Each nitrogen vacancy color center can be located within the gap defined by at least a bowtie nanoantenna to enhance the fluorescence signal from the nitrogen vacancy color center. Furthermore, each nitrogen vacancy color center can be optically coupled with photonic crystals to enhance the fluorescence signal from the nitrogen vacancy color center. Additionally, each specific location can include a curved lens or a metamaterial lens (e.g., including an array of nanoscaled pillars) for efficient collection of light from each nitrogen vacancy color center. However, the curved lens or the metamaterial surface may be fabricated/constructed after or before each nitrogen vacancy color center is formed.
[0997] The first substrate can include microwave strip lines to control nitrogen vacancy color center and electrodes to tune the emission wavelength of the fluorescence signal from each nitrogen vacancy color center upon excitation from a third laser pulse from the second substrate (the second substrate is described/disclosed in the previous paragraphs). A 532 nanometers laser (for spatial imaging and stabilizing the local charge environment), a 637 nanometers laser (for resonant readout) and a microwave signal (for ground-state spin manipulation) can address a single nitrogen vacancy color center. Thus, spins of the nitrogen vacancy color center are entangled and can enable a qubit (for quantum computer and/or quantum memory and/or quantum internet). For example, a first microwave signal can put the electronic spins of the nitrogen vacancy color center into superposition. Then, a radio-frequency signal can put the nitrogen nucleus into a specified spin state. A second lower power microwave signal can entangle the spins of the nitrogen vacancy color center and they are suitable to perform quantum computation. After the quantum computation is performed, a third microwave signal (with polarization rotated relative to that of the second microwave signal) can disentangle the nucleus and the nitrogen vacancy color center. Additionally, utilizing a feedback control system, a nitrogen vacancy color center qubit can stay in superposition over a long period of time. Additionally, a thin-film of a piezoelectric material coupled with two electrodes can be fabricated/constructed on the first substrate. Consequently, both laser and surface acoustic wave (SAW) can be used to control its quantum state.
[0998] It is possible that these qubits can operate at room temperature. But the first substrate may be cooled at a lower temperature (e.g., 4K) so that qubits are not fragile.
[0999] The nitrogen vacancy color center based qubit can be integrated with an input (excitation) laser. The input (excitation) laser is only configured to generate light pulses mimicking a neuron to communicate with many neurons. The input (excitation) laser is only configured to generate light pulses mimicking a neuron to communicate with many neurons.
[1000] The input (excitation) laser for the nitrogen vacancy color center based qubits can be excited only when a network(s) of the first pulsed lasers and second pulsed lasers are activated by an action of weighted electrical signals (from an array of memristors/super memristors or by converting optical signals of distinct wavelengths from ring resonators/fast tunable ring resonators (e.g., fast tunable ring resonators incorporating vanadium dioxide thin-film/quantum dot) based add/drop filters)thus coupling nitrogen vacancy color center based qubits with the Super System on Chip 400A/400B/400C/400D (including the neural learning processor of the Super System on Chip 400A/400B/400C/400D, wherein the neural learning processor consists of an array or a network of memristors/super memristors, arranged in either in two-dimension or in three-dimension) and/or the photonic neural learning processor. Each super memristor can include (i) a resistor, (ii) a capacitor and (iii) a phase transition/phase change material based memristor. A phase transition material based memristor can be electrically and/or optically controlled. But a phase change material based memristor can be electrically or optically controlled. Furthermore, each super memristor can be electrically/optically controlled.
[1001] Furthermore, nitrogen vacancy color center based qubit can be replaced by a defect center in a two-dimensional material (e.g., hexagonal boron nitride (h-BN)).
[1002] For some of the defects in a two-dimensional material, the intensity of the emitted light may change with a magnetic field, which controls the spin and the spin controls the number of photons emitted from the defects in a two-dimensional material. This change in number of photons can be utilized as a qubit (potentially) at room temperature. This configuration can enable a portable nuclear magnetic resonance (NMR) imaging device (like a stethoscope). Quantum mechanical spins due to defects in a two-dimensional material can create a faint radio frequency signal. This faint radio frequency signal can be converted into an electrical signal utilizing an electrical circuit, consisting of a capacitor (C), an inductance (L) and a resistor (R). The electrical circuit can be coupled with an ultrathin/nanoscaled (e.g., about 10 to 20 nanometers thick) membrane. The ultrathin/nanoscaled membrane can form an external cavity. The resonance frequency (by laser excitation) of the external cavity may change minutely due to nanoscaled deformation of the ultrathin/nanoscaled membrane and the minute change (the original frequency of the laser and frequency change due to signals quantum mechanical spins). However, the quantum mechanical spins due to defects in a two-dimensional material may change in the presence of hydrogen molecules in a biological material and thus the quantum mechanical spins can be detected for in vivo and ex vivo diagnostic applications.
[1003] These defects in a two-dimensional material can be systematically organized/created by a first laser pulse and second laser pulse. The first laser can be activated to create a defect center in a two-dimensional material. Then a second laser pulse can be activated to move/push the newly created defect center until a fluorescence signal from the newly formed defect center is detected under a suitable magnetic field. The intensity of the first laser pulse can be higher than the intensity of the second laser pulse.
[1004] Furthermore, a compact optical configuration can be realized by fabricating/constructing a network of silicon nitride optical waveguides on top of a second substrate. The network of silicon nitride optical waveguides can route light. Above the silicon nitride optical waveguides, a layer (e.g., about 1 micron in thickness) of silicon dioxide thin-film or an electrically activated optically tunable material based thin-film can be fabricated/constructed. On top of the silicon dioxide thin-film or electrically activated optically tunable material based thin-film on the second substrate, there are transparent/indium tin oxide/niobium electrodes, integrated with tiny openings in the electrodes to allow light (which is guided via silicon nitride optical waveguides) to pass through to activate/configure a qubit on the first substrate. Beneath the tiny openings in the transparent/indium tin oxide/niobium electrodes, the optical waveguides in silicon nitride break into a series of sequential ridges to act as diffraction gratings in order to direct light down through the holes and concentrate the light into a beam narrow enough to activate/configure a qubit on the first substrate, as described/disclosed in the previous paragraph. Furthermore, integration of a surface normal light modulator (e.g., a graphene based surface normal spatial light modulator) with the diffraction gratings can also be realized.
[1005] Many (e.g., 100) qubits may be controlled by a commercially available multi-channel activation and readout control system (e.g., Zurich Instruments' Quantum Computing Control System (QCCS)). The readout of such qubits is performed by a photodetector and then digitized by a pulse counter.
[1006]
[1007]
[1008] Additionally, the above 400A6 in
[1009]
[1010] Additionally, the above 400A7 in
[1011] Furthermore, the digital processor can also be based on ferroelectric or carbon nanotube material. A carbon nanotube can be utilized as an electrode in 400A4/400A5/400A6/400A7 and as an interconnecting material in 400A5/400A6/400A7.
[1012] Details of the three-dimensional interconnecting material, as carbon nanotube have been described/disclosed in U.S. non-provisional patent application Ser. No. 14/120,835 entitled CHEMICAL COMPOSITION & ITS DELIVERY FOR LOWERING THE RISKS OF ALZHEIMER'S, CARDIOVASCULAR AND TYPE-2 DIABETES DISEASES, filed on Jul. 1, 2014 and in its related U.S. non-provisional patent applications (with all benefit provisional patent applications) are incorporated in its entirety herein with this application.
[1013]
[1014]
[1015]
[1016]
[1017]
[1018] In a von Neumann computer, computation occurs in orders of magnitude faster than accessing memory. Applications on a computer can spend over 50% of all computing cycles waiting for data to arrive from memory. This problem is the memory bottleneck. To mitigate this memory bottleneck, generally a microprocessor uses a hierarchical memory system with small and fast memory close to the microprocessor (i.e., caches) and large yet slower memory farther away from the microprocessor. A predictive memory prefetcher algorithm (enabled by an artificial intelligence algorithm and/or an artificial neural network based learning algorithm and/or a machine learning (including artificial neural networks/deep learning/meta-learning and self-learning) algorithm) can predict when to fetch what data into cache to reduce the memory bottleneck and enable predicting memory access patterns efficiently.
[1019]
[1020]
[1021]
[1022] Alternatively, a gate oxide coupling a source and a drain (for a field effect transistor) can be utilized. The gate oxide can consist of zirconium oxide and hafnium oxide. Furthermore, the gate oxide can consist of atomic layers of zirconium oxide, wherein the atomic layers of zirconium oxide are sandwiched between single atomic layers of hafnium oxide.
[1023] Alternatively, stacked dual layers of ultra-thin film (about 10 nanometers to 50 nanometers) of hexagonal boron nitride (sandwiched with a monolayer graphene layer as a middle core) can be utilized in a processor-specific electronic integrated circuit.
[1024] But there are other memory types such asthe ferroelectric FET (FeFET), Nanotube RAM, Phase Change Memory, ReRAM and Spin-Orbit Torque MRAM (SOT-MRAM) can be utilized. For the ferroelectric FET, lead-zirconium-titanate (PZT) or lead-zirconium-titanate integrated with an ultra-thin film (about 25 nanometers) of zinc oxide or hafnium dioxide (HfO.sub.2) or hafnium zirconium dioxide (HfZrO.sub.2) or stacked dual layers of ultra-thin film of hexagonal boron nitride (sandwiched with a monolayer graphene layer as a middle core) can be utilized. For example, TiN/HfZrO.sub.2/IGZO capacitor can be fabricated/constructed.
[1025] It should be noted that the ferroelectric FET can be utilized as a memristor.
[1026]
[1027]
[1028]
[1029]
[1030] The Super System on Chip 400A/400B can enable the storage and processing of information simultaneously and it is capable of learning/relearning for self-intelligence, sensor-awareness, context-awareness and autonomous actions, remembering the patterns and movements.
[1031]
[1032] Details of the vertical cavity surface emitting laser integrated with an electro-optic modulator have been described/disclosed in U.S. non-provisional patent application Ser. No. 13/448,378 entitled SYSTEM AND METHOD FOR INTELLIGENT SOCIAL COMMERCE, filed on Apr. 16, 2012 and in its related U.S. non-provisional patent applications (with all benefit provisional patent applications) are incorporated in its entirety herein with this application.
[1033]
[1034]
[1035]
[1036]
[1037]
[1038]
[1039]
[1040]
[1041]
[1042] An all-optical random-access memory utilizes optical cavities in an indium-gallium arsenide strip buried in gallium arsenide that represent a 1 or 0 by either passing or blocking light. It acts as an optical memory for about a microsecond because the indium-gallium arsenide strip changes its refractive index when exposed to a laser. The optical signal that all-optical random-access memory is trying to remember, will be blocked or passed, depending on the state of the strip. A second pulse of laser on a control section of the indium-gallium arsenide strip reverses its state.
[1043]
[1044]
[1045] Electronics scale in capacities with space division multiplexing, by adding parallel wires to a bus, while optical signal scale in capacities with wavelength division multiplexing, by adding parallel wavelengths to a single optical waveguide. Therefore, an array of microring resonator modulators (as translators) can be utilized to convert space division multiplexed electronic signals to wavelength division multiplexed optical signals.
[1046] Electrical signals of the Super System on Chip 400A/400B are then transferred to an array of ultralow threshold multi-wavelength lasers (e.g., a heater on a microscaled whispering gallery mode laser or a heater on a nanoscaled active area (
[1047]
[1048] The high bit-rate modulator can be an electro-absorption or Mach-Zehnder type modulator. Additionally, the high-bit rate modulator can be based on barium titanate material. The photodiodes can be based on photonic crystals. To reduce size, multi-mode interference Mach-Zehnder (MMI-MZ) wavelength multiplexers/demultiplexers can be utilized.
[1049] Optical components can be adhesively bonded onto silicon on insulator substrate (with polymer waveguides) by DVS-bis-benzocyclybutene. Then the above silicon on insulator substrate can be flip chip bonded onto an array of solder bumps forming connections between the optical components and an electronic circuit.
[1050]
[1051]
[1052] Vanadium dioxide is an insulator/Mott insulator until it hits about 150 degrees Fahrenheit, then it turns electrically conducting.
[1053] The vanadium dioxide thin-film can be placed just on the optical waveguide itself or in the close proximity to the optical waveguide via optical coupling. The vanadium dioxide thin-film can be doped with a trace amount of a dopant (e.g., germanium/graphene/tungsten) to modulate the phase transition temperature and/or thermal conductivity in the metallic phase. The vanadium dioxide thin-film can be deposited on a seed layer (e.g., ruthenium dioxide (RuO.sub.2) or aluminum oxide (Al.sub.2O.sub.3). Alternatively, it can be deposited as multi-layers of vanadium dioxide ultrathin-films and titanium dioxide (TiO.sub.2) ultrathin-films-as quantum wells. Furthermore, the vanadium dioxide thin-film can be replaced by a thin-film of another phase transition material or a phase change material (PCM) (e.g., germanium-antimony-tellurium/GeSbTe/GST).
[1054] Furthermore, the gap between two straight (optical) coupler sections can be as low as 15 nanometers, instead of 200 nanometers and the gap can be filled with a material (e.g., germanium/silicon nitride/titanium dioxide/metamaterial).
[1055] A method of fabrication/construction of the directional (optical) coupler vanadium dioxide thin-film optical switch is summarized: RF magnetron deposition of vanadium dioxide thin-film on the silicon on insulator substrate, lithographic pattern of the directional (optical) coupler, reactive ion etching of the vanadium dioxide thin-film in CF4 and Ar gases, reactive ion etching of silicon ridge of about 220 nanometers in depth and lift off of Cr/Au metallization on vanadium dioxide thin-film without any misalignment.
[1056] A symmetrical on-off switching time can be obtained by planarization (e.g., utilizing aluminum oxide/hafnium silicate/zirconium silicate/hafnium dioxide/zirconium dioxide thin-film) on the area of the electrode 1 and electrode 2, to reduce resistance-capacitive electrical effects of metallization.
[1057] As with the directional (optical) coupler optical switch, the two-photonic crystal (two-dimensional) optical waveguides can be placed sufficiently close so that the optical modes in each photonic crystal optical waveguide overlap and interact with each other. The coupling length of a photonic crystal optical switch can be reduced. Hence, the switching time can be reduced.
[1058]
[1059] The bandwidth of the two-dimensional photonic crystal directional (optical) coupler optical switch can be narrow. However, a two-dimensional photonic crystal Mach-Zehnder optical switch can enable larger bandwidth. In this case, the pitch of the hexagonal photonic crystal lattice can be about 400 nanometers (a) and the normalized air hole diameter can be about 0.53 (d/a).
[1060] Metamaterials and/or nanoplasmonic structures endowed with special negative refractive index properties, surrounded by normal materials with positive refractive index properties, as a light (or optical signal(s)) slowing/light (or optical signal(s)) buffering component can slow (even stop) light/optical signal(s) at either input or output of the directional (optical) coupler optical switch or two-dimensional photonic crystal directional (optical) coupler optical switch or two-dimensional photonic crystal Mach-Zehnder optical switch (based the vanadium dioxide ultrathin-film activated by an electrical pulse or a light pulse) for optical processing without any optical-electrical-optical (O-E-O) conversion to read header information of an optical (internet) packet optically. Thus, this can enable an all-optical network. Furthermore, the wavelength or frequency or color of a composite light (or composite optical signal(s)) can slow (even stop) at different spatial points (of metamaterials and/or nanoplasmonic structures endowed with special negative refractive index properties, surrounded by normal materials with positive refractive index properties) to have a trapped effect. The trapped effect can be used for localized intense heating for magnetic storage (which requires a tiny magnetic field by heating), biological imaging and biological (molecular) interaction.
[1061] Furthermore, a nanowire of a nonlinear material (e.g., cadmium sulfide) wrapped by a dielectric material, then wrapped by a silver shell at either input or output of the directional (optical) coupler optical switch or two-dimensional photonic crystal directional (optical) coupler optical switch or two-dimensional photonic crystal Mach-Zehnder optical switch (based the vanadium dioxide ultrathin-film activated by an electrical pulse or a light pulse) can change the wavelength or frequency or color of light that passes through it. By confining light within the nonlinear material rather than at the interface between the nonlinear material and the silver shell, light intensity can be maximized, while changing the wavelength or frequency or color of light that passes through it.
[1062] Additionally, by applying an electric field across a nanosccaled ring of a nonlinear material (e.g., cadmium sulfide), mixing of optical signals at high on or off ratio can be obtained. Such mixing of optical signals at high on or off ratio can act as an optical transistor.
[1063]
[1064] The slow thermal recovery time can be reduced, if the active area of vanadium dioxide thin-film is nanoscaled and/or current through the material is limited and/or the heat dissipation is rapid (e.g., utilizing diamond thin-film).
[1065]
[1066] By fabricating/constructing a heat dissipation layer utilizing an ultrathin-film of synthetic diamond/boron arsenide/single walled carbon nanotube/graphene onto electrode 1 and electrode 2 (
[1067] Alternatively, rapid thermal dissipation can be realized by fabricating/constructing a heat dissipation layer utilizing an ultrathin-film of synthetic diamond/boron arsenide/single walled carbon nanotube/graphene below the vanadium dioxide thin-film.
[1068]
[1069] A microscaled ion cloud cooling device/superlattice thermoelectric cooler can be utilized in conjunction with or without the heat dissipation layer and/or nanoscaled heat spreader.
[1070] Details of the microscaled ion cloud cooling device and superlattice thermoelectric cooler have been described/disclosed in U.S. non-provisional patent application Ser. No. 12/931,384 entitled DYNAMIC INTELLIGENT BIDIRECTIONAL OPTICAL ACCESS COMMUNICATION SYSTEM WITH OBJECT/INTELLIGENT APPLIANCE-TO-OBJECT/INTELLIGENT APPLIANCE INTERACTION, filed on Jan. 31, 2011 and in its related U.S. non-provisional patent applications (with all benefit provisional patent applications) are incorporated in its entirety herein with this application.
[1071] Faster optical switching time can be obtained by scaling/segmenting vanadium dioxide thin-film to a smaller area and/or optical activation (e.g., ultrashort pulsed laser activation) rather than electrical activation.
[1072] Other chemical compositions of vanadium oxide (e.g., vanadium(III) oxide (V.sub.2O.sub.3)) and doped compositions of vanadium oxide can be utilized to enable a higher performance optical switch.
[1073] Following various permutations and combinations of graphene/graphene quantum dots with vanadium oxide/vanadium oxide quantum dots in Table 2 can be utilized to enable higher performance optical switch.
TABLE-US-00008 TABLE 2 On Silicon (Bottom Layer) Middle Layer Top Layer ~25 nanometers Vanadium None Graphene/Graphene QDs Dioxide Graphene/Graphene QDs None ~25 nanometers Vanadium Dioxide ~10 nanometers Graphene/ ~10 nanometers Vanadium Dioxide Graphene QDs Vanadium Dioxide Vanadium Dioxide QDs None Graphene/Graphene QDs Graphene/Graphene QDs None Vanadium Dioxide QDs Vanadium Dioxide QDs Graphene/ Vanadium Dioxide QDs Graphene QDs
[1074] The process of fabricating/constructing a graphene layer consists of dispersing a graphene oxide (GO) solution in a micropipette, depositing the solution locally and then reducing the graphene oxide to graphene by thermal or chemical treatment.
[1075] The optical switch can be integrated with a log.sub.2N demultiplexer, which generally consists of rectangular shaped periodic frequency filters in series, wherein the rectangular shaped periodic frequency filters can be formed in a one-dimensional photonic crystal on a ridge optical waveguide.
[1076] In general (embodiments described herein can be modified in any arrangement and detail), but not limited to the Super System on Chip 400A/400B/400C/400D can enable ultrafast data processing, image processing/image recognition, deep learning/meta-learning and self-learning, wherein the Super System on Chip 400A/400B/400C/400D can include embedded microchannels within Super System on Chip 400A/400B/400C/400D for efficient thermal management. These embedded microchannels can utilize an electrically insulated liquid coolant that boils as it flows through the embedded microchannels: [1077] (a) a processor-specific electronic integrated circuit, made of silicon material or silicon-germanium material, [1078] or [1079] a processor-specific electronic integrated circuit, made of a two-dimensional material and a transition metal oxide or a two-dimensional material and a phase change material or a two-dimensional material and a phase transition material, [1080] or [1081] a processor-specific electronic integrated circuit, made of a topological insulator, [1082] or [1083] a processor-specific electronic integrated circuit, made of an exciton (superfluid), [1084] (b) a memory component, made of a nano-scaled phase change material or a nano-scaled phase transition material and/or, [1085] (c) an array of memristors/super memristors (each super memristor can include (i) a resistor, (ii) a capacitor and (iii) a phase transition/phase change material based memristor. Furthermore, each super memristor can be electrically/optically controlled. A phase transition material based memristor can be electrically and/or optically controlled. But a phase change material based memristor can be electrically or optically controlled. Furthermore, each super memristor can be reconfigurable into a capacitor or a resistor or a neuron or a synapse by an electrical (e.g., voltage/current) pulse, wherein each super memristor can include a proton/hydrogen doped perovskite nickelate thin-film (e.g., less than 200 nanometers in thickness) material (e.g., rear earth (e.g., Nd) NiO.sub.3) on a crystal/silicon substrate) for neural processing and [1086] (d) a photonic component or a photonic integrated circuit, wherein the photonic component includes an optical waveguide (a photonic crystal based optical waveguide), wherein the processor-specific electronic integrated circuit in said (a), the memory component in said (b), the array of memristors/super memristors in said (c), and the photonic component or the photonic integrated circuit in said (d) of the Super System on Chip 400A/400B/400C/400D can be interconnected or coupled in two-dimension or three-dimension, electrically or optically (e.g., optically-utilizing either optical wavelength division multiplexing or optical time division multiplexing). The Super System on Chip 400A/400B/400C/400D can be coupled with an artificial eye, if needed for a particular application. For example, as described/disclosed in the previous paragraphs, the artificial eye can be fabricated/constructed utilizing a very large scale integration of the atomic scaled switches. Photocurrent is induced in a photoconductive layer (which is coupled between a metal electrode and a solid-electrolyte electrode) by light irradiation. The photocurrent reduces metal ions with positive charges in the solid-electrolyte electrode and this precipitates as metal atoms to form an atomic scaled metal connection between the metal electrode and the solid-electrolyte electrode-operating as an atomic scaled switch, turned on by light irradiation and/or an applied electrical activation (e.g., voltage). It should be noted that the Super System on Chip 400A/400B/400C/400D can be wafer-scale.
[1087] Alternatively, the Super System on Chip 400A/400B/400C/400D can enable ultrafast data processing, image processing/image recognition, deep learning/meta-learning and self-learning, wherein the Super System on Chip 400A/400B/400C/400D can include (embedded microchannels within Super System on Chip 400A/400B/400C/400D for efficient thermal management. These embedded microchannels can utilize an electrically insulated liquid coolant that boils as it flows through the embedded microchannels): [1088] (a) a processor-specific electronic integrated circuit, made of silicon material or silicon-germanium material, [1089] or [1090] a processor-specific electronic integrated circuit, made of a two-dimensional material and a transition metal oxide or a two-dimensional material and a phase change material or a two-dimensional material and a phase transition material, [1091] or [1092] a processor-specific electronic integrated circuit, made of a topological insulator, [1093] or [1094] a processor-specific electronic integrated circuit, made of an exciton (superfluid), [1095] (b) a memory component, made of a nano-scaled phase change material or a nano-scaled phase transition material and/or, [1096] (c) an array of memristors/super memristors for neural processing and [1097] (d) a photonic component or a photonic integrated circuit, wherein the photonic component includes an optical waveguide (a photonic crystal based optical waveguide), [1098] wherein the processor-specific electronic integrated circuit in said (a), the memory component in said (b), the array of memristors/super memristors in said (c) and the photonic component or the photonic integrated circuit in said (d) of the Super System on Chip 400A/400B/400C/400D can be interconnected or coupled in two-dimension or three-dimension, electrically or optically (e.g., optically-utilizing either optical wavelength division multiplexing or optical time division multiplexing), wherein the Super System on Chip 400A/400B/400C/400D can include/couple with a photonic neural learning processor for neural processing, wherein the photonic neural learning processor can include an interferometer or a laser. The Super System on Chip 400A/400B/400C/400D can be coupled with the artificial eye, if needed for a particular application.
[1099] Alternatively, the Super System on Chip 400A/400B/400C/400D can enable ultrafast data processing, image processing/image recognition, deep learning/meta-learning and self-learning, wherein the Super System on Chip 400A/400B/400C/400D can include (embedded microchannels within Super System on Chip 400A/400B/400C/400D for efficient thermal management. These embedded microchannels can utilize an electrically insulated liquid coolant that boils as it flows through the embedded microchannels): [1100] (a) a processor-specific electronic integrated circuit, made of silicon material or silicon-germanium material, [1101] or [1102] a processor-specific electronic integrated circuit, made of a two-dimensional material and a transition metal oxide or a two-dimensional material and a phase change material or a two-dimensional material and a phase transition material, [1103] or [1104] a processor-specific electronic integrated circuit, made of a topological insulator, [1105] or [1106] a processor-specific electronic integrated circuit, made of an exciton (superfluid), [1107] (b) a memory component, made of a nano-scaled phase change material or a nano-scaled phase transition material and/or, [1108] (c) an array of memristors/super memristors for neural processing and [1109] (d) a photonic component or a photonic integrated circuit, wherein the photonic component includes an optical waveguide (or a photonic crystal based optical waveguide), [1110] wherein the processor-specific electronic integrated circuit in said (a), the memory component in said (b), the array of memristors/super memristors in said (c) and the photonic component or the photonic integrated circuit in said (d) of the Super System on Chip 400A/400B/400C/400D can be interconnected or coupled in two-dimension or three-dimension, electrically or optically (e.g., optically-utilizing either optical wavelength division multiplexing or optical time division multiplexing), wherein the Super System on Chip 400A/400B/400C/400D can be coupled with a hardware security component, wherein the hardware security component includes an array of memristors/super memristors, wherein the Super System on Chip 400A/400B/400C/400D can be coupled with a photonic neural learning processor for neural processing, wherein the photonic neural learning processor can include an interferometer or a laser. The Super System on Chip 400A/400B/400C/400D can be coupled with artificial eye, if needed for a particular application.
[1111] Alternatively, the Super System on Chip 400A/400B/400C/400D can enable ultrafast data processing, image processing/image recognition, deep learning/meta-learning and self-learning, wherein the Super System on Chip 400A/400B/400C/400D can include (embedded microchannels within Super System on Chip 400A/400B/400C/400D for efficient thermal management. These embedded microchannels can utilize an electrically insulated liquid coolant that boils as it flows through the embedded microchannels): [1112] (a) a processor-specific electronic integrated circuit, made of silicon material or silicon-germanium material, [1113] or [1114] a processor-specific electronic integrated circuit, made of a two-dimensional material and a transition metal oxide or a two-dimensional material and a phase change material or a two-dimensional material and a phase transition material, [1115] or [1116] a processor-specific electronic integrated circuit, made of a topological insulator, [1117] or [1118] a processor-specific electronic integrated circuit, made of an exciton (superfluid), [1119] (b) a memory component, made of a nanoscaled phase change material or a nanoscaled phase transition material and/or, [1120] (c) an array of memristors/super memristors for neural processing and [1121] (d) a photonic component or a photonic integrated circuit, wherein the photonic component includes an optical waveguide (or a photonic crystal based optical waveguide), [1122] wherein the processor-specific electronic integrated circuit in said (a), the memory component in said (b), the array of memristors/super memristors in said (c) and the photonic component or the photonic integrated circuit in said (d) of the Super System on Chip 400A/400B/400C/400D can be interconnected or coupled in two-dimension or three-dimension, electrically or optically (e.g., optically-utilizing either optical wavelength division multiplexing or optical time division multiplexing), wherein the Super System on Chip 400A/400B/400C/400D can be coupled with a hardware security component, wherein the hardware security component includes an array of memristors/super memristors, wherein the Super System on Chip 400A/400B/400C/400D can be coupled with a photonic neural learning processor for neural processing, wherein the photonic neural learning processor can include an interferometer or a laser. The Super System on Chip 400A/400B/400C/400D can be coupled with an algorithm, stored in a non-transitory memory component for predictive memory prefetching. The Super System on Chip 400A/400B/400C/400D can be coupled with artificial eye, if needed for a particular application.
[1123] Alternatively, an optically controlled Super System on Chip can include an input or an output, wherein the optically controlled Super System on Chip's input/output can include one or more first memristors (each first memristor may include a phase transition material or a phase change material) or super memristors for (e.g., weighted signals based) neural processing, wherein first memristor is electrically and/or optically controlled, wherein at least the super memristor can include a capacitor, a second memristor (each second memristor can include a phase transition material or a phase change material, wherein a phase transition material based memristor is electrically and/or optically controlled, but a phase change material based memristor is electrically or optically controlled) and a resistor, wherein the super memristor is electrically/optically controlled, wherein the input or the output of the optically controlled Super System on Chip can be coupled by a Mach-Zehnder interferometer, wherein the Mach-Zehnder interferometer can include a phase transition material or a phase change material or a lithium niobate material or a polymeric material (wherein a phase transition material is electrically and/or optically controlled, but a phase change material is electrically or optically controlled, wherein the lithium niobate material or the polymeric material is electrically controlled), wherein the Mach-Zehnder interferometer can be coupled by a low-loss first optical (routing) waveguide in two-dimensions, wherein the low-loss first optical waveguide can be coupled by a semiconductor optical amplifier (for nonlinear optical processing) in two-dimensions. It should be noted that the semiconductor optical amplifier can be replaced by a second optical waveguide containing a nonlinear optical material (e.g., a chalcogenide phase change nonlinear optical material) for nonlinear optical processing. Furthermore, the semiconductor optical amplifier can also include a second optical waveguide containing a nonlinear optical material for nonlinear optical processing. Furthermore, the semiconductor optical amplifier can also include a second optical waveguide containing a nonlinear optical material for advanced nonlinear optical processing (e.g., wavelength conversion).
[1124] Alternatively, an optically controlled Super System on Chip can include an input or an output, wherein the optically controlled Super System on Chip's input/output can include one or more first memristors (each first memristor may include a phase transition material or a phase change material) or super memristors for (e.g., weighted signals based) neural processing, wherein first memristor is electrically and/or optically controlled, wherein at least the super memristor can include a capacitor, a second memristor (each second memristor can include a phase transition material or a phase change material, wherein a phase transition material based memristor is electrically and/or optically controlled, but a phase change material based memristor is electrically or optically controlled) and a resistor, wherein the super memristor is electrically/optically controlled, wherein the input or the output of the optically controlled Super System on Chip can be coupled by a Mach-Zehnder interferometer, wherein the Mach-Zehnder interferometer can include a phase transition material or a phase change material or a lithium niobate material or a polymeric material, wherein the Mach-Zehnder interferometer can be coupled by a low-loss first optical (routing) waveguide in three-dimensions, wherein the low-loss first optical waveguide can be coupled by a semiconductor optical amplifier (for nonlinear optical processing) in three-dimensions. This arrangement can enable three-dimensionally connected artificial neurons. It should be noted that the semiconductor optical amplifier can be replaced by a second optical waveguide containing a nonlinear optical material for nonlinear optical processing. Furthermore, the semiconductor optical amplifier can also include a second optical waveguide containing a nonlinear optical material for advanced nonlinear optical processing (e.g., wavelength conversion).
[1125] Alternatively, an optically controlled Super System on Chip can include an input or an output, wherein the optically controlled Super System on Chip's input/output can include one or more first memristors (each first memristor may include a phase transition material or a phase change material) and/or super memristors for (e.g., weighted signals based) neural processing, wherein first memristor is electrically and/or optically controlled, wherein at least the super memristor can include a capacitor, a second memristor (each second memristor can include a phase transition material or a phase change material, wherein a phase transition material based memristor is electrically and/or optically controlled, but a phase change material based memristor is electrically or optically controlled) and a resistor, wherein the super memristor is electrically/optically controlled, wherein the input or the output of the optically controlled Super System on Chip can be coupled by a Mach-Zehnder interferometer, wherein the Mach-Zehnder interferometer can include a phase transition material or a phase change material or a lithium niobate material or a polymeric material (wherein a phase transition material is electrically and/or optically controlled, but a phase change material is electrically or optically controlled, wherein the lithium niobate material or the polymeric material is electrically controlled), wherein the Mach-Zehnder interferometer can be vertically coupled (via vertical evanescent coupling) with a low-loss first optical (routing) waveguide, wherein the low-loss first optical waveguide can be vertically coupled (via vertical evanescent coupling) with a semiconductor optical amplifier (for nonlinear optical processing). This arrangement can enable three-dimensionally connected artificial neurons.
[1126] Furthermore, this arrangement can include an electrically programmable/tunable (connected) optical waveguide lattice/mesh.
[1127] For example, a programmable/tunable (connected) optical waveguide lattice/mesh can be fabricated/constructed by utilizing Mach-Zehnder interferometers, wherein each Mach-Zehnder interferometer can include a phase transition material or a phase change material a lithium niobate material or a polymeric material (wherein a phase transition material is electrically and/or optically controlled, but a phase change material is electrically or optically controlled, wherein the lithium niobate material or the polymeric material is electrically controlled).
[1128] Alternatively, a programmable/tunable (connected) optical waveguide lattice/mesh can be fabricated/constructed by utilizing a nonlinear material for nonlinear processing. Such a programmable/tunable (connected) optical waveguide lattice/mesh can be coupled with Super System on Chip's input/output.
[1129] It should be noted that the semiconductor optical amplifier can be replaced by a second optical waveguide containing a nonlinear optical material for nonlinear optical processing.
[1130] Furthermore, the semiconductor optical amplifier can also include a second optical waveguide containing a nonlinear optical material for advanced nonlinear optical processing (e.g., wavelength conversion).
[1131] Specifically, the optically controlled Super System on Chip's input/output can be coupled by a Mach-Zehnder interferometer, wherein the Mach-Zehnder interferometer can include a phase transition material or a phase change material or a lithium niobate material or a polymeric material (wherein a phase transition material is electrically and/or optically controlled, but a phase change material is electrically or optically controlled, wherein the lithium niobate or the polymeric material is electrically controlled), wherein the Mach-Zehnder interferometer can be coupled by a low-loss first optical (routing) waveguide in either two-dimensions/three-dimensions, wherein the low-loss first optical waveguide can be coupled by a semiconductor optical amplifier (for nonlinear optical processing) in either two-dimensions/three-dimensions. This is generally illustrated in
[1132] It should be noted that the semiconductor optical amplifier can be replaced by a second optical waveguide containing a nonlinear optical material for nonlinear optical processing. This is generally illustrated in
[1133] Furthermore, the semiconductor optical amplifier can also include a second optical waveguide containing a nonlinear optical material for advanced nonlinear optical processing. This is generally illustrated in
[1134]
[1135] Furthermore, the first optical waveguide can be coupled optically with a second optical waveguide in the two-dimensional arrangement, wherein the second optical waveguide may include a nonlinear optical material. The (optically enabled) Super System on Chip can be coupled optically with a laser (LD) and one or more photodiodes (PDs), denoted as PD1 and PD2 in
[1136] It should be noted that a semiconductor optical amplifier can be replaced by an optical resonator in two-dimensional/three-dimensional arrangement.
[1137] It should be noted that the above two-dimensional representation of the (optically enabled) Super System on Chip (in
[1138]
[1139] Thus, the (personal) artificial intelligence based self-learning assistant may be able to recommend useful information without asking/searching for such information explicitly (via a Recommendation Engine). The Recommendation Engine may also include inputs from swarm (collective) intelligence (SI), which is at least based on (i) individual awareness, (ii) self-coordination, (iii) self-expandability and (v) self-healing (self-resiliency) properties. Furthermore, a diffusion model may include blackout diffusion model, which can generate an image from an empty picture, as it does not require a random seed to get started.
[1140] An evolutionary based algorithm is a heuristic-based approach in solving problems that cannot be easily solved in polynomial time and it is a kind of Monte-Carlo method. An evolutionary based algorithm generally utilizes mechanisms inspired by biological evolution (e.g., reproduction, mutation, recombination and selection).
[1141] Generally, game theory can be classified into two categories: (a) non-cooperative game, where a decision-making unit treats the other participants as competitors and (b) a cooperative game, where a group of decision-making units decide to undertake a decision together in order to achieve their shared objectives.
[1142] In game theory, individuals/groups/units become players, when their respective decisions coupled with the decisions made by other players, produce an outcome/output. The options available to players to bring about particular outcomes are called as strategies, which are linked to outcomes/outputs by a mathematical function that specifies the consequences of the various combinations of strategy choices by the all players in a game.
[1143] A coalition refers to the formation of sub-sets of players' options under coordinated strategies. In game theory, the core is the set of feasible allocations that cannot be improved upon by a coalition. An imputation X={x.sub.1, x.sub.2 . . . x.sub.n} is in the core of an n-person game if and only if for each subset, S of N:
where V(s) is the characteristic function V of the subset S indicating the amount (reward) that the members of S can be sure of receiving, if they act together and form a coalition (or the amount of S can get without any help from players who are not in S). Above equation states that an imputation x is the core (that X is undominated), if and only if for every coalition S, the total of the received by the players in S (according to X) is at least as large a V(S). The core (C) can also be defined by the equation below as the set of stable imputations:
The imputation x is unstable through a coalition S, if the equation below is true, otherwise is stable.
The core (C) can consist of many points. The size of the core can be taken as a measure of stability or how likely a negotiated agreement is prone to be upset. To determine the maximum penalty (cost) that a coalition in the network can be sure of receiving, the linear programming problem represented by the equation below can be used, when maximize x.sub.1+x.sub.2+x.sub.3+ . . . +x.sub.n
[1144] Thus, as outlined above, a game theory based algorithm can account for any conflict and produce accurate and reproducible output data.
[1145] For example, the (personal) artificial intelligence based self-learning assistant can book the user on a next flight, when the (personal) artificial intelligence based self-learning assistant finds out from the internet and other resources that the previous flight is canceled. The (personal) artificial intelligence based self-learning assistant can communicate with the user's family about the delay in arrival, newly booked flight and then notify/reorder the airport shuttle/taxicab accordingly to pick up the user from the airport. Besides the internet, the (personal) artificial intelligence based self-learning assistant can search/scan other resources such as various search engines (e.g., Bing, Google, Yahoo and Yelp), expert databases, data from existing Question & Answer forums (e.g., ChaCha) and answers drawn from real time applications that will ask relevant people if they know they answer. What makes the Question & Answer forums powerful is that it keeps track of each and every question and answer pairing ever asked and every answer ever given. For example, as noted before an elderly user living alone in a home, suddenly experiencing a heart attack, a sensor/biosensor on the elderly user can detect such health problem and call 911 automatically with the location coordinates of the elderly user, without any intervention of the elderly user. Furthermore, combining both
[1146] The Super System on Chip 400A/400B/400C/400D (including the optically controlled Super System on Chip as described/disclosed in the previous paragraphs) can include a processor-specific electronic integrated circuit (which may include silicon or germanium or a silicon-germanium composition or a silicon-germanium superlattice or an indium gallium zinc oxide composition or a III-V material or a one-dimensional material (e.g., a carbon nanotube) or a two-dimensional material (e.g., metal dichalcogenide tungsten disulfide) or dual layers of a two-dimensional material (e.g., hexagonal boron nitride) or a superatomic material (e.g., Re.sub.6Se.sub.8Cl.sub.2)) or a one-dimensional/two-dimensional material on a silicon substrate or an application specific integrated circuits or a field programmable gate array or a Bose-Einstein condensate based optical switch. A processor-specific electronic integrated circuit including a superatomic material can utilize excitons for processing. The processor-specific electronic integrated circuit can also include a gate oxide consisting of zirconium oxide and hafnium oxide. Furthermore, the processor-specific electronic integrated circuit can include a gate oxide consisting of atomic layers of zirconium oxide, wherein the atomic layers of zirconium oxide are sandwiched between a single atomic layer of hafnium oxide. It should be noted that the Super System on Chip 400A/400B/400C/400D (including the optically controlled Super System on Chip) can be integrated on a wafer scale.
[1147] The processor-specific electronic integrated circuit may include multiple processing cores and memory units (e.g., each memory unit can include one or more memory elements. Each memory element can include one or more memory circuits). Also, the multiple processing cores and memory units can be coupled generally in an intertwined geometrical architecture either in a two-dimensional arrangement or a three-dimensional arrangement, wherein at least one of one or more memory units can include one or more memory elements, wherein at least one of one or more memory elements can include one or more memory circuits.
[1148] Additionally, the processor-specific electronic integrated circuit may include a three-dimensional stacked structure of a field effect transistor electronic integrated circuit, utilizing a self-aligned complementary metal oxide semiconductor process technology.
[1149] Furthermore, a modified three-dimensional stacked structure of a field effect transistor may include a multi-part gate (as opposed to a single-part gate) and a memory element (e.g., a memory element may include a ferroelectric material, which can enable switchable polarization). Ferroelectrics are material choice for nonvolatile memories with low write power. Based on the readout procedure, three different ferroelectric memory elements such as FeRAM, FeFET and FTJ memory elements may be realized.
[1150] The modified three-dimensional stacked structure of a field effect transistor may be coupled with a cross-bar array (e.g., acting as neural synapses) that can include a ferroelectric semiconductor (e.g., alpha indium selenide (-In.sub.2Se.sub.3)) sandwiched between two electrodes. Such a two-dimensional cross-bar array was described/disclosed in the embodiment(s) illustrated in
[1151] The multi-part gate may utilize one or more voltage pulses-enabling lower electrical power consumption (hence generation). It should be noted that heat generation is a critical issue. This device's transistor channel region may be silicon or transition metal dichalcogenides.
[1152] The Super System on Chip 400A/400B/400C/400D (including the optically controlled Super System on Chip as described/disclosed in the previous paragraphs) can also include a first artificial eye, wherein the first artificial eye can consist of light activated and/or electrically activated switches. It should be noted that a first artificial eye including electrically activated switches may be interconnected compactly utilizing silicon interconnected fabric wafer at about 2-10 microns pitch interconnects of metallized copper pillars.
[1153] The Super System on Chip 400A/400B/400C/400D (including the optically controlled Super System on Chip as described/disclosed in the previous paragraphs) can also include a second artificial eye, wherein the second artificial eye consists of an array of photodiodes.
[1154] The Super System on Chip 400A/400B/400C/400D (including the optically controlled Super System on Chip as described/disclosed in the previous paragraphs) can be coupled with one or more optical switches to enable a connected subsystem/system of many Super System on Chips 400As/400Bs/400Cs/400Ds (including the optically controlled Super System on Chips). The Super System on Chip 400A/400B/400C/400D (including the optically controlled Super System on Chip as described/disclosed in the previous paragraphs) may be interconnected (e.g., chip-to-chip) on a multichip module, utilizing an array of light sources (e.g. micro light emitting diodes), an array of photodiodes, a first array of lenses (on the array of light sources), a second array of lenses (on the array of photodiodes) and a multicore optical-fiber cable. This optical interface arrangement requires a precise packaging alignment technology of the first array of lenses onto the array of light sources, the second array of lenses onto the array of photodiodes and then subsequently both the first array of lenses and the second array of lenses onto the multicore optical-fiber cable. For example, it is possible to detect short optical pulses from blue micro light emitting diodes by a silicon PIN photodiode. Alternatively, an optical interface including an array of light sources (e.g., low threshold infrared wavelength lasers), an array of infrared wavelength photodiodes, a first array of lenses (on the array of light sources), a second array of lenses (on the array of photodiodes) and a multicore optical-fiber cable can be utilized. Furthermore, such an optical interface can be included in a multi-chip module.
[1155] The Super System on Chip 400A/400B/400C/400D (including the optically controlled Super System on Chip as described/disclosed in the previous paragraphs) can also include an artificial neural network algorithm or a machine learning algorithm, stored in one or more non-transitory storage media.
[1156] The Super System on Chip 400A/400B/400C/400D (including the optically controlled Super System on Chip as described/disclosed in the previous paragraphs) can also include a computer vision algorithm or an image processing algorithm or a Vision Transformer, stored in one or more non-transitory storage media.
[1157] When incorporated/integrated with an artificial intelligence/artificial neural network/machine learning algorithm, a digital signal processor and a miniature electrocardiogram (ECG), the Super System on Chip 400A/400B/400C/400D (including the optically controlled Super System on Chip as described/disclosed in the previous paragraphs) can detect can many heart diseases such as atrial fibrillation (AF) in real time/near real timecan alter 911 emergency via an intelligent device, as described/disclosed in U.S. Non-Provisional patent application Ser. No. 14/014,239 entitled DYNAMIC INTELLIGENT BIDIRECTIONAL OPTICAL ACCESS COMMUNICATION SYSTEM WITH OBJECT/INTELLIGENT APPLIANCE-TO-OBJECT/INTELLIGENT APPLIANCE INTERACTION, filed on Aug. 29, 2013 and in their related U.S. non-provisional patent applications (with all benefit provisional patent applications) are incorporated in its entirety herein with this application.
[1158] It should be noted that the first memristor including a phase transition material or a phase change material can be switched either electrically (e.g., voltage/current) or optically (e.g., a laser pulse generally in femtoseconds rise/fall time scale). A phase transition material or a phase change material switched electrically can be slower due to thermal/joule heating, when compared a phase transition material or a phase change material switched optically. Furthermore, effects of slower switching time (especially OFF time compared to ON time) can be mitigated by utilizing an ultrathin-film (e.g., about 5 to 100 nanometers) of diamond film.
[1159] The above Super System on Chip 400A/400B/400C/400D described/disclosed in the previous paragraphs can include/couple with a digital signal processor. The above Super System on Chip 400A/400B/400C/400D described/disclosed in the previous paragraphs can include/couple with a wireless chipset (e.g., a Wi-Fi/Wi-Fi(N) chipset) or other chipsets utilizing silicon interconnected fabric wafer at about 10 microns pitch. It should be noted that higher bandwidth wireless chipset (including higher than 5G) coupled with above the Super System on Chip 400A/400B/400C/400D can enable more immersive communication using holograms.
[1160] The Super System on Chip 400A/400B/400C/400D or optically controlled Super System on Chip can include multiple electronic circuits (including electronic components) and/or multiple optical circuits (including optical components) in a vertically stacked configuration. Discrete electronic circuits and/or discrete optical circuits in a vertically stacked configuration may enable a Super System on Package (SSoP).
[1161] Thus, the distinction between the Super System on Chip 400A/400B/400C/400D (or the optically controlled Super System on Chip) and the Super System on Package is practically minor and both are generally termed as a Super System.
[1162] However, the manufacturing yield of the Super System on Package may be higher than that of the Super System on Chip 400A/400B/400C/400D or optically controlled Super System on Chip.
[1163] Furthermore, the Super System on Chip 400A/400B/400C/400D (or the optically controlled Super System on Chip) or equivalently the Super System on Package can include (via integration, co-integration on a same platform/substrate/multichip module or even communicatively interfaced with) one or more multipliers of matrices and/or graphic processors.
[1164] In one embodiment many graphic processors can be stacked in a three-dimensional arrangement for scaling the performance. It should be noted that a three-dimensional arrangement can include a vertical arrangement.
[1165] Alternatively the graphic processors can be coupled with an optical switch or an optical interface, wherein the optical interface can include light sources and photodiodes.
[1166] Alternatively, the graphic processors can be on a multichip module wherein the multichip module includes an array of light sources, an array of photodiodes and an array of lenses.
[1167] Details of an optical switch, an optical interface and the multichip module have been described/disclosed in U.S. Non-Provisional patent application Ser. No. 17/803,388 entitled SUPER SYSTEM ON CHIP, filed on Jun. 15, 2022 and in its related U.S. non-provisional patent applications (with all benefit provisional patent applications) are incorporated in its entirety herein with this application.
[1168] Additionally, the Super System on Chip 400A/400B/400C/400D (or the optically controlled Super System on Chip) or equivalently the Super System on Package can be coupled with a System on Chip, wherein the System on Chip can include a multiplier of matrices and/or graphic processors.
[1169] In one embodiment many graphic processors can be stacked in a three-dimensional arrangement for scaling the performance. It should be noted that a three-dimensional arrangement can include a vertical arrangement.
[1170] Alternatively the graphic processors can be coupled with an optical switch or an optical interface, wherein the optical interface can include light sources and photodiodes.
[1171] Alternatively, the graphic processors can be on a multichip module wherein the multichip module includes an array of light sources, an array of photodiodes and an array of lenses.
[1172] Such as a super system can be operable with a wireless network or Zigbee and either sensor-aware and/or context-aware. Such as a super system can integrate a radio transceiver, a microphone, an audio processing module (which include one or more electronic circuits/components to process an audio signal), a display (a photonic crystal display or a holographic display or a foldable display, wherein a photonic crystal display can include one or more nanoscaled structures), a touch sensor (which can include a microfluidic channel) and an intelligent camera (wherein the intelligent camera can include a digital signal processor (DSP)). Furthermore, a display with pixels, wherein each pixel can include a camera sensor. Moreover, such as a super system can be coupled with an audio processing module, a first set of computer implementable instructions to process the audio signal, a second set of computer implementable instructions to interpret or analyze contextual data, depending on a context of data and a third set of computer implementable instructions in artificial neural networks, wherein the artificial neural networks can include (i) a transformer model or a diffusion model and (ii) also an evolutionary based algorithm and/or a game theory based algorithm. The first set of computer implementable instructions, the second of computer implementable instructions and the third set of computer implementable instructions can be stored in one or more non-transitory media locally or on one or more cloud servers. The second of computer implementable instructions and/or the third set of computer implementable instructions can enable self-learning.
[1173] On the machine learning, correlations in the data can be replaced by pattern matching to understand why/how that data was generated initially. Furthermore, using both semantic technologies and machine (deep) learning it may be possible to infer the missing data based on context clues of the data, without reconstructing on a bit-by-bit level.
[1174] Alternatively, the above Super System on Chip 400A/400B/400C/400D described/disclosed in the previous paragraphs can include/couple with an ultrahigh speed wireless chipset (e.g., an ultrahigh speed millimeter wave chipset (made of InP based epitaxial material on InP substrate) for peak data rates up to 100 Gbps). The millimeter wave is the frequency bands between 30 GHz to 300 GHz and it has a range of 2 meters (indoor) to 300 meters (outdoor) and it has a latency of about 1 ms.
[1175] A System on integrated Super System on Chip 400A/400B/400C/400D can be realized by three-dimensional packaging such as a chip-on-wafer (CoW) stacking which may allow mix-and-match integration of many different known good dies (e.g., a Wi-Fi/ultrahigh speed millimeter wave chipset (e.g., for 5G) and the Super System on Chip 400A/400B/400C/400D) or even stacks of known good dies. The chip-on-wafer stacking is both a face-to-face and face-to-back technology, which can reach up to 1 million bonds per mm.sup.2.
[1176] Alternatively, bare unprocessed metal-organic chemical vapor deposited (MOCVD) or molecular beam epitaxy (MBE) deposited indium phosphide based materials/layers on indium phosphide substrate can be bonded onto a silicon wafer. Then InP substrate can be removed and then millimeter wave chipset on indium phosphide based materials/layers can be fabricated/constructed.
[1177] Alternatively, a System on integrated Super System on Chip 400A/400B/400C/400D can be realized by direct wafer bonding of the metal-organic chemical vapor deposited (MOCVD) or molecular beam epitaxy (MBE) deposited indium phosphide based materials/layers (less than 200 nanometers) on silicon/silicon on insulator/lithium niobate on insulator-silicon substrate via an interface layer for monolithic integration of millimeter wave chipset and the Super System on Chip 400A/400B/400C/400D). It should be noted that base indium phosphide is removed in the direct wafer bonding.
[1178] Alternatively, a System on integrated Super System on Chip 400A/400B/400C/400D can be realized by direct metal-organic chemical vapor deposition or molecular beam deposition of indium phosphide based materials on silicon/silicon on insulator/lithium niobate on insulator-silicon substrate for monolithic integration of millimeter wave chipset and the Super System on Chip 400A/400B/400C/400D) via various interface layers to minimize the defect density in indium phosphide based materials/layers.
[1179] Furthermore, an antenna-in-package (AiP) solution in LTCC technology can be utilized for an antenna or an array of antennas for a compact standard surface mounted device.
[1180] Conventional gold metal based contact on indium phosphide based materials/layers can be replaced by nickel based alloyed contact compatible with complementary metal-oxide-semiconductor fabrication on silicon.
[1181] Furthermore, a System on integrated Super System on Chip 400A/400B/400C/400D can integrate lithium niobate photonics technology and/or silicon photonics at the back end of line (BEOL) portion of fabrication.
[1182] The silicon photonics can include a tapered optical waveguide, in which light can enter a tapered optical waveguide and then it is directed by an adiabatic taper into an underneath optical waveguide(s) (e.g., a polymer/chalcogenide glass based optical waveguide) for further electro-optical/optical processing (e.g., optical amplification by a semiconductor optical amplifier)/non-linear optical processing/wave propagation.
[1183] Additionally, if needed underneath polymer optical waveguide(s) can be coupled with an ultrafast (electrically stimulated) nanoseconds optical switch-fabricated/constructed of a phase transition material (e.g., vanadium dioxide) or epitaxially grown barium titanate material. Pockels effect can be strong even in nanoscaled devices of barium titanate material.
[1184] The optical switch can include a tapered optical waveguide, in which light can enter a tapered optical waveguide and then it is directed by an adiabatic taper into an underneath optical waveguide(s) (e.g., a polymer/chalcogenide glass based optical waveguide) for further electro-optical/optical processing (e.g., optical amplification by a semiconductor optical amplifier)/non-linear optical processing/wave propagation.
[1185] The above Super System on Chip 400A/400B/400C/400D described/disclosed in the previous paragraphs can include/couple with a vertical cavity surface emitting laser or a photonic crystal based vertical cavity surface emitting laser or a light emitting diode or a waveguide photodiode or an optical switch.
[1186] The above Super System on Chip 400A/400B/400C/400D described/disclosed in the previous paragraphs can include/couple with an all-optical random access memory component.
[1187] Additionally, the above Super System on Chip 400A/400B/400C/400D described/disclosed in the previous paragraphs can include/couple with an artificial neural network algorithm and/or a machine learning algorithm, stored in non-transitory memory component.
[1188] Additionally, the above Super System on Chip 400A/400B/400C/400D described/disclosed in the previous paragraphs can include/couple with a computer vision algorithm and/or an image processing algorithm, stored in non-transitory memory component.
[1189] The above Super System on Chip 400A/400B/400C/400D (including the neural learning processor of the Super System on Chip 400A/400B/400C/400D, wherein the neural learning processor consists of an array or a network of memristors/super memristors arranged in either in two-dimension or in three-dimension) and/or the photonic neural learning processor, as described/disclosed in the previous paragraphs can be coupled with one or more qubits (for quantum processing and/or a quantum memory and/or quantum internet). Each super memristor can include (i) a resistor, (ii) a capacitor and (iii) a phase transition/phase change material based memristor. A phase transition material based memristor can be electrically and/or optically controlled. But a phase change material based memristor can be electrically or optically controlled. Furthermore, each super memristor can be electrically/optically controlled.
[1190] Integrating U.S. non-provisional patent application Ser. No. 14/014,239 entitled DYNAMIC INTELLIGENT BIDIRECTIONAL OPTICAL ACCESS COMMUNICATION SYSTEM WITH OBJECT/INTELLIGENT APPLIANCE-TO-OBJECT/INTELLIGENT APPLIANCE INTERACTION, filed on Aug. 29, 2013 (along with its priority provisional patent applications in 2006), with this current patent application, an application of the Super System on Chip 400A/400B/400C/400D can be as follows:\
[1191] An intelligent subsystem can be coupled by a wireless network or a sensor network, wherein the intelligent subsystem can include: [1192] (a) the Super System on Chip 400A/400B/400C/400D to enable ultrafast data processing, image processing/image recognition, deep learning/meta-learning and self-learning, [1193] (b) a foldable/stretchable/photonic crystals/holographic display, Furthermore, the photonic crystals display can include nanoscaled optical antennas (e.g., denoted by , as in
[1204] The intelligent subsystem can be coupled with the social wallet, wherein the social wallet is coupled with a blockchain.
[1205] Additionally, the social wallet can enable online payment, online real money transfer between users and online virtual money transfer between users, protecting privacy of the user via the user's virtual avatar. Through the user's virtual avatar, the user just would need to supply/apply a fragment of information necessary to receive a service (e.g., purchasing an item).
[1206] The blockchain enabled social wallet can enhance increased security in mobile payment/peer-to-peer lending/peer-to-peer social commerce, preventing scams like fraud, double-spending and price gouging. Transactions can be accounted for on a tamper-proof ledger. Furthermore, the blockchain can be coupled with a virtual avatar to hide the user identity for anonymity.
[1207] The intelligent subsystem described/disclosed in the previous paragraph can further include a universal communication interface integrating (i) animation, (ii) animated GIF, (iii) drawings, (iv) emotions, (v) gestures (hand/eye), (vi) location data, (vii) text and (viii) voices/voice snippets/videos. The universal communication interface can be further enhanced by Fazila as described/illustrated in
[1208]
[1209] The modulator can be either ring resonator or Mach-Zehnder interferometer based. The active material of the modulator can be a phase transition/phase change material, which can be stimulated by an electrical/optical/terahertz signal.
[1210] The phase transition/phase change switching speed (thereby change in refractive index) can be in the order of picoseconds-even in the order of femtoseconds.
[1211] For optical stimulation, the stimulation wavelength 2 can be different than the propagation wavelength 1. In the case of the ring resonator based modulator the nanoscaled (e.g., about 200 nanometers200 nanometers in area) patch of a phase transition material (e.g., vanadium dioxide) or a phase change material (e.g., Ge.sub.2Sb.sub.2Te.sub.5 (GST), Ge.sub.2Sb.sub.2Se.sub.4Te.sub.1 (GSST) or Ag.sub.4In.sub.3Sb.sub.67Te.sub.26 (AIST)) can be stimulated via an optical waveguide based transformation optical coupler. Furthermore, the optical waveguide based transformation optical coupler can include nanoscaled holes (of about 100 nanometers diameter) or photonic crystals (of about 100 nanometers in diameter). The nanoscaled holes or photonic crystals can be air or dielectric filled.
[1212] It is expected that there will be optical loss in a phase transition or a phase change material. Such optical loss can be compensated in which light can enter a tapered optical waveguide and then it is directed by an adiabatic taper into an underneath polymer optical waveguide(s) (e.g., a polymer/chalcogenide glass based optical waveguide) on a photonic substrate for further electro-optical/optical processing (e.g., optical amplification by a semiconductor optical amplifier)/non-linear optical processing/wave propagation. Alternatively, the adiabatic taper can be replaced by a photonic wire bond waveguide, enabled by direct-write three-dimensional laser lithography based on two-photon polymerization.
[1213] The ultrahigh speed modulator, the receiver and the electrical chip can be electrically coupled to a first packaged substrate by a first array of ball grids. It should be noted that the first packaged substrate can be connected with a second packaged substrate by a second array of ball grids.
[1214] Utilizing 128 optical waveguides, wherein each waveguide is at 500G per second modulation bandwidth with cumulative throughput of about 51.2 terabit per second and each optical waveguide can be coupled with a common laser source. Furthermore, wavelength division multiplexing via arrayed waveguide grating router (AWGR) can be utilized in order to reduce the number of optical waveguides.
[1215]
[1216] To reduce any joule heating the nanoscaled patch can be coated with about 500 nanometers of polycrystalline diamond.
[1217] The photonic substrate is the coupled with a first packaged substrate by a first array of ball grids. Furthermore, the photonic substrate and the first packaged substrate can be integrated into one substrate. It should be noted that the first packaged substrate can be connected with a second packaged substrate by a second array of ball grids.
[1218] In general (embodiments described herein can be modified in any arrangement and detail), but not limited to an input/output of an electrical chip/electrical component (a processor/application specific integrated circuits/field programmable gate array/electrical switch) or the Super System on Chip 400A/400B/400C/400D, wherein the input/output of the electrical chip/component or the Super System on Chip 400A/400B/400C/400D can be coupled electrically and/or optically by a modulator, a receiver and a semiconductor optical amplifier, wherein the modulator is either a Mach-Zehnder modulator or a ring resonator modulator, wherein the modulator includes a phase transition material/phase change material, wherein the modulator is activated by an electrical stimulus/optical stimulus/terahertz stimulus, wherein the optical stimulus is provided by a transformation optical waveguide coupler, wherein the transformation optical waveguide coupler includes one or more holes (having each hole of about 100 nanometers in diameter) or a photonic crystal. In a Hyperscaler Data Center (HDC), placing optics next to a switch chip in a (optics to chip) multichip module can simplify high speed serialiser/deserialiserthe circuit that gets data on and off the chip. Thus, there is no need to drive very high speed electrical signals all the way to the front panel's pluggables. This simplifies the printed circuit board design, but significantly constrains the multichip module's overall power consumption/heat dissipation given hundreds of serialiser/deserialiser are used on a reduced area and thus, it will require an array of microchannels and/or microjets for fluid based cooling of the multichip module.
[1219]
[1220] Specifically, (an optically enabled) Super System on Chip's input/output can be coupled by a Mach-Zehnder interferometer, wherein the Mach-Zehnder interferometer can include a phase transition material or a phase change material (wherein a phase transition material is electrically and/or optically controlled, but a phase change material is electrically or optically controlled), wherein the Mach-Zehnder interferometer can be coupled by a low-loss first optical (routing) waveguide in either two-dimensions/three-dimensions, wherein the low-loss first optical waveguide can be coupled by a semiconductor optical amplifier (for nonlinear optical processing) in either two-dimensions/three-dimensions. It should be noted that a three-dimensional arrangement can include a vertical coupling.
[1221] It should be noted that the semiconductor optical amplifier can be replaced by a second optical waveguide containing a nonlinear optical material for nonlinear optical processing. This is generally illustrated in
[1222] Furthermore, the semiconductor optical amplifier can also include a second optical waveguide containing a nonlinear optical material for advanced nonlinear optical processing. This is generally illustrated in
[1223]
[1224]
[1225]
[1226]
[1227]
[1228] Alternatively, instead of scanning with a single (continuous wave/pulsed/ultrashort pulsed) laser, two lasers can be utilized simultaneously. In the first instant a typical laser is using an appropriate wavelength to excite a material. In the second instant is a key second laser, which is focused so that it produces a donut of light overlapping the focal point of the first laser. This configuration can enable the laser to focus below the Abbey's diffraction limit for ultrahigh density storage.
[1229] Quantum dots are tiny light sources with nanoscaled dimensions. They rely on internal electronic transitions which emit a stream of photons, with the color defined by the material, shape and size.
[1230] Graphene quantum dots can fluoresce brighter than conventional quantum dots. Graphene quantum dots or quantum dots of a two-dimensional material can be utilized instead of conventional quantum dots. Ultrasound can be utilized to chop up a graphene sheet into atom scale dots. Then, potassium hydroxide can be utilized to enhance the surface area of these atom scale dots.
[1231]
[1232] Numerous variations and/or modifications in geometrical shapes, tip curvature, dimensions and separation gaps of the protruded metal/non-metal nano optical antenna and nanoscaled box (open or closed) are also possible within the scope of the present invention.
[1233] Furthermore, the protruded metal/non-metal nano optical antenna (including its surface and/or tip) can be coated with a two-dimensional material (e.g., graphene).
[1234]
[1235]
[1236] Photonic crystals are wavelength scale periodic dielectric microstructures, which create photonic band gaps. Photonic crystals insulate photons similar to the way electrons are insulated in a semiconductor crystal.
[1237]
[1238] An original silicon wafer master of a desired photonic crystal design can be fabricated/constructed by laser interference lithography and reactive ion etching. From the original silicon wafer master, many working stamps of a tri-layer material (thin polydimethylsiloxane with Young's modulus of 80 MPa+soft polydimethylsiloxane+thin glass substrate) can be created utilizing ultraviolet enhanced substrate conformal imprint lithography and inorganic silica sol-gel imprint photoresist. The working stamp of the tri-layer material with silica sol-gel is a suitable transfer mask for printing the desired photonic crystal onto a transparent substrate (to an incident light).
[1239] Inkjet printing can be utilized to print quantum dots (in a solution) onto the desired photonic crystal.
[1240] Similarly, a working stamp of the tri-layer material with silica sol-gel is a suitable transfer mask for printing the desired photonic crystal with the embedded protruded metal/non-metal nano optical antenna onto a substrate transparent (to an incident light). Two-dimensional and/or three-dimensional colloidal photonic crystals can be fabricated/constructed on a large area transparent polymer/semi-interconnected interpenetrating polymer networks (SIPN) substrate by a roll-to-roll Langmuir-Blodgett method, utilizing silica nanospheres (250 to 550 nanometers in diameter).
[1241] Inkjet printing can be utilized to print quantum dots (from a solution) onto the desired photonic crystal with the embedded protruded metal/non-metal nano optical antenna.
[1242]
[1243]
[1244] Alternatively, a hyperbolic metamaterial of alternating titanium nitride metal and aluminum scandium nitride insulator, each is about 5 to 20 nanometers in thickness can be utilized. Alternatively, a hyperbolic metamaterial including only insulators can be also utilized.
[1245] In
[1246]
[1247]
[1248]
[1249]
[1250] Details of the microelectromechanical system based light valve have been described/disclosed in U.S. non-provisional patent application Ser. No. 13/448,378 entitled SYSTEM AND METHOD FOR INTELLIGENT SOCIAL COMMERCE, filed on Apr. 16, 2012 and in its related U.S. non-provisional patent applications (with all benefit provisional patent applications) are incorporated in its entirety herein with this application.
[1251] A phase change material switches rapidly between two distinct phases/states with the application of an electric field. However, an electrically switchable light valve based on a phase transition material (sandwiched between two transparent electrodes) can be faster than that of a phase change material. The transparent electrode can be indium tin oxide (ITO)/fluorine doped tin oxide (FTO)/graphene.
[1252]
[1253] However, a multi-layer thin-film transmission optical color filter can be utilized instead of a plasmonic transmission optical color filter.
[1254]
[1255] The light emitting diode backlighting is usually composed of light emitting diodes, coated with a phosphor to give off a white light. In
[1256]
[1257]
[1258]
[1259]
[1260]
[1261]
[1262]
[1263]
[1264] Details of the quantum dots (nanocrystals) and light emitting diode backlighting enabled display have been described/disclosed in U.S. non-provisional patent application Ser. No. 13/448,378 entitled SYSTEM AND METHOD FOR INTELLIGENT SOCIAL COMMERCE, filed on Apr. 16, 2012 and in its related U.S. non-provisional patent applications (with all benefit provisional patent applications) are incorporated in its entirety herein with this application.
[1265]
[1266]
[1267]
[1268]
[1269]
[1270]
[1271]
[1272]
[1273]
[1274]
[1275]
[1276]
[1277]
[1278]
[1279] It should be noted that ultraviolet/blue microlight emitting diodes (with photonic crystals light collection optics) can be utilized in
[1280]
[1281]
[1282]
[1283]
[1284]
[1285]
[1286] The above integration is the Super System on Chip 400C, which can enable the camera to see, store and process information simultaneously and it is capable of learning/relearning for self-intelligence, sensor-awareness, context-awareness and autonomous actions, remembering the patterns and movements.
[1287]
[1288] Details of such integration of camera pixels with the Super System on Chip 400A/400B have been described/disclosed in U.S. non-provisional patent application Ser. No. 14/120,835 entitled CHEMICAL COMPOSITION & ITS DELIVERY FOR LOWERING THE RISKS OF ALZHEIMER'S, CARDIOVASCULAR AND TYPE-2 DIABETES DISEASES, filed on Jul. 1, 2014 and in its related U.S. non-provisional patent applications (with all benefit provisional patent applications) are incorporated in its entirety herein with this application.
[1289]
[1290]
[1291]
[1292]
[1293]
[1294]
[1295]
[1296]
[1297]
[1298]
[1299]
[1300]
[1301]
[1302]
[1303]
[1304]
[1305]
[1306] A UV/blue nanolight emitting diode can be realized by fabricating/constructing (e.g., utilizing electron beam lithography and reactive ion etching) a nanoscaled (e.g., 40 nanometers in diameter) pillar of a UV/blue light emitting material near or in the gap of the protruded metal/non-metal nano optical antenna. The nanoscaled UV/blue light emitting material can be based on quantum wells or quantum dots.
[1307] An ammonium hydroxide dip, followed by (NH.sub.4).sub.2S.sub.x and KrF pulsed laser (at a low intensity) treatments or alternatively, argon/nitrogen ion beam treatment on the walls of a nanoscaled disc, then deposition of about 2 nanometers of silicon/amorphous silicon/hydrogenated amorphous silicon/zinc selenide and 20 nanometers of aluminum oxide under vacuum can reduce surface defects. The ion beam energy, the ion beam density, the ion beam exposure time and the composition of the background gas mixture are critical in argon/nitrogen ion beam treatment. Typically, the entire passivation process can be performed under an ultrahigh vacuum to reduce any possibility of surface oxidation prior to passivation. Alternatively, regrowth of passivation material (e.g., semi-insulating indium phosphide) around the nanoscaled disc can reduce surface defects. Similarly, this process step/regrowth step can be applied to mirrors (facets)at least to the exit mirror (facet) of any high power edge emitting laser to reduce catastrophic optical mirror (facet) damage (COMD).
[1308] Furthermore, photonic crystals light collection optics can be fabricated/constructed on the exit output surface of the nanoscaled disc for high (light output) extraction efficiency.
[1309] Fabrication/construction of the nanolight-emitting diode can be realized as follows: (1) growth of material, (2) electron beam lithography and reactive ion etching of an array of nanoscaled discs, (3) removal of surface oxides on the walls of the nanoscaled discs, (4) selective regrowth of passivation material around the nanoscaled discs, utilizing a dielectric mask, (5) removal of the dielectric mask and (6) precision electron beam lithography and reactive ion etching of protruded metal/non-metal nano optical antenna.
[1310]
[1311]
[1312]
[1313] The above integration of the Super System on Chip is 400D, which can enable the camera to store and process information simultaneously and it is capable of learning/relearning for self-intelligence, sensor-awareness, context-awareness and autonomous actions, remembering the patterns and movements.
[1314]
[1315]
[1316] The array of microlenses can be an array of ultrathin flat microlenses (e.g., graphene on glass). The ultrathin flat microlens can be distortion free.
[1317]
[1318] The photonic crystals light collection optics vertical cavity surface emitting lasers are rapidly switched to mix a color spectrum by a phase change/phase transition material based light valve. The outputs of the light valve are multiplexed by a focusing slab optical waveguide and then focused to a micro (nano) mechanical system based scanning mirror by a (e.g., about 45-degree angle) deflecting mirror to enable a microprojector.
[1319] Any light valve can be utilized instead of the phase change/phase transition material based light valve.
[1320]
[1321] In general (embodiments described herein can be modified in any arrangement and detail), but not limited to a first display device can include the following, as listed below [1322] (a) a first layer that can include a light source of emitting a color in a visible wavelength, [1323] (b) a second layer that can include one or more three-dimensional nanoscaled optical elements, wherein the second layer absorbs a portion of the color in the visible wavelength from the light source, [1324] wherein at least one three-dimensional nanoscaled optical element includes a dielectric material/metal material/tunable material, [1325] wherein the tunable material is a phase transition material/phase change material, [1326] wherein at least one three-dimensional nanoscaled optical element has a maximum dimension less than 400 nanometers, [1327] (c) an electrically controlled first transparent electrode and [1328] (d) an electrically controlled second electrode.
[1329] It should be noted that an ordered two-dimensional array of three-dimensional nanoscaled optical elements can create a metasurface. Furthermore, an (ordered) two-dimensional array of three-dimensional nanoscaled optical elements made of a tunable (optically reversible) material (e.g., a phase transition/phase change material) can create a tunable (reconfigurable) metasurface.
[1330] The light source of the first display device can be (i) an organic light emitting diode or (ii) an organic light emitting diode including quantum dots or (iii) a microlight emitting diode or (iv) a vertical cavity surface emitting laser. Furthermore, an array of microlight emitting diodes in this configuration can enable a holographic display device. The microlight emitting diode can also include a light collection layer, wherein the light collection layer can include photonic crystals.
[1331] The vertical cavity surface emitting laser can include a first metallized Bragg mirror and a second metallized Bragg mirror, wherein the first metallized Bragg mirror can include a first hole, wherein second first metallized Bragg mirror can include a second hole.
[1332] Following FIG. 12Z1 of U.S. non-provisional patent application Ser. No. 16/602,966 entitled OPTICAL BIOMODULE FOR DETECTION OF DISEASES AT AN EARLY ONSET, filed on Jan. 6, 2020, an ultrathin light source in the visible wavelength spectrum can include a two-dimensional material electrically coupled with (electrically controlled) gratings of a two-dimensional material (e.g., boron nitride).
[1333] Thus, the light source of the first display device can include a first two-dimensional material coupled with (i) metal electrodes and/or (ii) gratings of a second two-dimensional material, wherein the gratings are optimized (fabricated/constructed) for the visible wavelength.
[1334] The first display device can include an optical filter and/or a microlens and/or a solar cell.
[1335] The first display device consists of display pixelseach display pixel can include a camera sensor in its proximity/close proximity.
[1336] Furthermore, the first display device consisting of display pixels may include imaging pixels of an imaging camera, operating in a wavelength range of 1.3 microns to 1.55 microns, wherein the imaging pixel is made of a SiGe materialsuch as polycrystalline SiGe material deposited on a glass substrate.
[1337] A polycrystalline SiGe may utilize an isothermal annealing process at temperatures between 500 C. and 540 C. of co-sputtered Si+Ge on a glass substrate.
[1338] Various permutations and combinations of the above display components of the first display device are possible within the scope of this invention.
[1339] Furthermore, the first display device can be replaced by a second display device.
[1340] In general (embodiments described herein can be modified in any arrangement and detail), but not limited to a second display device can include the following, as listed below [1341] (a) a first layer that can include a light source of emitting a color in a visible wavelength, [1342] (b) a second layer that can include one or more three-dimensional nanoscaled optical elements, wherein the second layer absorbs a portion of the color in the visible wavelength from the light source, [1343] wherein at least one three-dimensional nanoscaled optical element can include a dielectric material/metal material/tunable material, [1344] wherein the tunable material is a phase transition material/phase change material, [1345] wherein at least one three-dimensional nanoscaled optical element has a maximum dimension less than 400 nanometers, [1346] (c) an electrically switchable light valve or an electrically switchable light shutter.
[1347] Furthermore, the second display device consisting of display pixels may include imaging pixels of an imaging camera, operating in a wavelength range of 1.3 microns to 1.55 microns, wherein the imaging pixel is made of a SiGe materialsuch as polycrystalline SiGe material deposited on a glass substrate.
[1348] A polycrystalline SiGe may utilize an isothermal annealing process at temperatures between 500 C. and 540 C. of co-sputtered Si+Ge on a glass substrate.
[1349]
[1350]
[1351]
[1352]
[1353]
[1354] The grey area indicates optical waveguide material (e.g., glass) and the white circles are about 2 to 5 microns diameter air holes in the two-dimensional photonic crystal.
[1355] A spatial light modulator is a device that enables spatially varying modulation on a beam of light.
[1356]
[1357]
[1358] Each electrode is about 5 microns in width. The gap between the two electrodes is about 15 microns.
[1359] Another suitable electro-optic polymer can be utilized instead of poly(vinylidene fluoride-trifluoroethylenechlorofluoroethylene)ter polymer.
[1360]
[1361]
[1362] Augmented reality refers to what a user can perceive through his/her biological senses (e.g., viewing) and the user's perception can be enhanced with device/computer generated input data (e.g., images, sound and video). Augmented reality makes more information available to the user by combining device/computer generated input data to what the user experiences (or views). For example, the user can find a nearby caf with the menu of the caf translated from a local language to the user's own native language by augmented reality enabled enhancement.
[1363]
[1364] The eye tracking sensor includes an infrared light source and two cameras. The infrared light reflects off the pupil and cornea and the reflections are captured by the two cameras and then processed by an image processing algorithm.
[1365] The key components of the multichip module system 740 (in block diagram) are listed below in Table 3.
TABLE-US-00009 TABLE 3 Component Description 380 Communication Radio* (WiMax/LTE) 400A/400B/ Super System On Chip (Can Be Coupled With 400C/400D An Artificial Eye/LiDAR/Computational Camera/Hyperspectral Imager System) 420 Operating System Algorithm 440 Security & Authentication Algorithm 480 Surround Sound Microphone 500 Front Facing High Resolution Camera @ Low Light Level (Can Be Coupled With An Artificial Eye) 520 Back Facing High Resolution Camera @ Low Light Level (Can Be Coupled With An Artificial Eye) 540 High Resolution Camcorder @ Low Light Level (Can Be Coupled With An Artificial Eye) 580 Proximity Radio * (Near Field Communication/ Bluetooth LE) TxRx 600 Personal Area Networking Radio 1* (Bluetooth/ Wi-Fi) TxRx 620 Personal Area Networking Radio 2* (Ultrawide Band/Millimeter-Wave) TxRx 640 Positioning System (Global Positioning System* & Indoor Positioning System) 660 Universal Communication Interface 700 Electrical Powering Device (Solar Cell + Battery + Ultracapacitor) With Wireless Charging Option. For Example, Lithium-Ion Battery's Cobalt Oxide Cathode Can Be Coated With Graphene Nanoparticles Or The Cathode Can Be Replaced By Vanadium Disulfide (VS2) Flakes-Which Are Nanoscaled Coated With Titanium Disulfide (TiS2) [* With Radio Specific Antenna] [TxRx Means Transceiver]
[1366] A universal communication interface can integrate animation, animated GIF, drawings, emotions, gestures (hand/eye), location data, text, voices, voice snippets and videos.
[1367] The universal communication interface can be further enhanced by Fazila as described/illustrated in
[1368] The intelligent wearable augmented reality personal assistant device 180 can include a wearable electrical power providing patch.
[1369] Details of the wearable electrical power providing patch have been described/disclosed in U.S. non-provisional patent application Ser. No. 14/120,835 entitled CHEMICAL COMPOSITION & ITS DELIVERY FOR LOWERING THE RISKS OF ALZHEIMER'S, CARDIOVASCULAR AND TYPE-2 DIABETES DISEASES, filed on Jul. 1, 2014 and in its related U.S. non-provisional patent applications (with all benefit provisional patent applications) are incorporated in its entirety herein with this application.
[1370] The front facing high resolution camera-500 and/or the back facing high resolution camera-520 can be coupled with the Super System on Chip 400A/400B/400C/400D and/or the artificial eye.
[1371] The Super System on Chip 400A/400B/400C/400D and/or the artificial eye can be coupled with a computer vision algorithm and/or an artificial intelligence algorithm and/or an artificial neural network algorithm and/or a machine learning (including artificial neural networks/deep learning/meta-learning and self-learning) algorithm and/or a fuzzy logic (including neuro-fuzzy) algorithm for ultrafast data processing, image processing/recognition, deep learning/meta-learning and self-learning.
[1372] Thus, enabling a four-dimensional effect on an image captured by image captured by the front facing high resolution camera-500 and/or the back facing high resolution camera-520 of the intelligent wearable augmented reality personal assistant device 180. Thus, enabling a four-dimensional effect (e.g., not only what the front facing high resolution camera-500 and/or the back facing high resolution camera-520 can see, but also how a character/player/event can experience) on an image captured by the front facing high resolution camera-500 and/or the back facing high resolution camera-520 of the intelligent wearable augmented reality personal assistant device 180.
[1373] The intelligent wearable augmented reality personal assistant device 180 is sensor-aware and/or context-aware; as it is wirelessly connected/sensor connected with objects 120A, object nodes 120, bioobjects 120Bs and bioobject nodes 140s.
[1374]
[1375]
[1376]
[1377]
[1378] Alternatively, gold nanoparticles decorated with disease specific oligonucleotides (or microRNA specific locked nucleic acids (LNAs)) can be embedded in the disposable diagnostic chip 1. When the disease specific oligonucleotides (or microRNA specific locked nucleic acids) recognize complementary disease specific deoxyribonucleic acid/ribonucleic acid strands (including microRNAs) and upon hybridization, color (by chemiluminescence) of the disposable chip 1 can change (which can be detected by a naked eye/spectrophotometer).
[1379] Metal (e.g., gold) nanoparticles can also bind with cancer deoxyribonucleic acids-enabling a new blood based test for circulating cancers by detecting a change of color. Furthermore, a substrate including metal nanoparticles of a particular (suitable) shape and particular (suitable) thickness in an ordered array with a particular (suitable) periodicity can emit light of lower wavelength, when excited by light of higher wavelength. If biomolecules bind to the surface of said metal nanoparticles, then intensity of the emitted light of lower wavelength and/or the particular wavelength of the emitted light can change-enabling detection of biomolecules (e.g., cancer deoxyribonucleic acids).
[1380] The Recombinase Polymerase Amplification can operate over a convenient temperature range (e.g., about 37 C.-42 C.) and it is rapid (10-20 min) and insensitive to temperature variations of about 1 C. The Recombinase Polymerase Amplification (RPA) (integrating a joule heating element/micro Peltier element on the disposable diagnostic chip 1) can be utilized to amplify of the disease specific deoxyribonucleic acid/ribonucleic acid strands (including microRNAs).
[1381] Additionally, a reporter probe (that releases a fluorescent signal when physically separated) can be integrated/chemically coupled with the disease specific deoxyribonucleic acid/ribonucleic acid strands (including microRNAs). In presence of CRISPR-Cas12 (for a single-stranded deoxyribonucleic acid) and CRISPR-Cas13 (for ribonucleic acid), CRISPR-Cas12/CRISPR-Cas13 goes beyond cutting the original deoxyribonucleic acid/ribonucleic acid target respectively and releases enhanced non-specific chemiluminescence signal by cutting other deoxyribonucleic acid/ribonucleic acid respectively. Thus, it can enable rapid diagnostics of a disease (e.g., malaria).
[1382] As an alternative or addition to enzyme based amplification, fluorescence amplification can be regarded as an effective strategy in bioassay. The integration of plasmonic nanoparticles (e.g., ZnSeCOOH or lanthanide (Ln3.sup.+) nanoparticles) in proximity to the gold nanoparticles can also significantly enhance photoluminescence.
[1383] In case of ZnSeCOOH nanoparticles, the localized surface plasmon resonance (SPR) of gold nanoparticles, the ultraviolet-visible absorption spectrum of gold nanoparticles overlapped with the emission spectrum of ZnSeCOOH nanoparticles-thus generating resonant energy transfer (RET) between gold nanoparticles and ZnSeCOOH nanoparticles.
[1384]
[1385] The disposable diagnostic chip 1/disposable diagnostic chip 2 can be fabricated/constructed on a graphene/polymer/paper substrate.
[1386] Generally, a three-dimensional protruded structure may be augmented/replaced by an amplifying chemical structure/sequence such as two or more linear hybridizations chain reaction (L-HCR) based oligonucleotide probes for linear amplification or two or more nonlinear hybridization chain reaction (N-HCR) based oligonucleotide probes for nonlinear (e.g., exponential) amplification. It should be noted that an amplifying chemical sequence can be coupled with a capturing chemical structure or include a capturing chemical structure. For example, an amplifying sequence can include a DNA/RNA sequence.
[1387] The linear hybridization chain reaction is an enzyme-free isothermal amplification technique with high sensitivity and good selectivity. In the linear hybridization chain reaction, a single stranded DNA (ssDNA) can trigger two metastable complementary DNA hairpin structures, thus-generating a linearly amplified signal (e.g., fluorescence) and achieving the detection of a target molecule. It should be noted that this scheme may be applicable utilizing Frster/Fluorescence Resonance Energy Transfer.
[1388] Alternative to the linear hybridization chain reaction or nonlinear hybridization chain reaction, a molecular beacon (with (i) a fluorophore (a non-quantum dot based fluorophore (e.g., an organic fluorophore Cy3/Cy5) or a quantum dot based fluorophore) and (ii) a quencher in a suitable wavelength range can be designed with its loop sequence complementary to a target molecule. However, a molecular beacon (with (i) a fluorophore (a non-quantum dot based fluorophore (e.g., an organic fluorophore Cy3/Cy5) or a quantum dot based fluorophore) and (ii) a quencher in a suitable wavelength range can be integrated with the linear hybridization chain reaction or nonlinear hybridization chain reaction by carefully positioning a fluorophore and a quencher (in suitable wavelength range with respect to a fluorophore) in distance.
[1389] However, an enzyme recognition sequence (e.g., a nicking enzyme recognition sequence) may be embedded into the loop portion of the above molecular beacon for linear amplification of fluorescence signal which generally may include three major stepshybridization, cleavage and dissociation, if a target molecule has a built-in easily accessible recognition site (e.g., sequence of N.BstNB I on a target molecule), which may be recognized by an enzyme recognition sequence of a molecular beacon. When a target molecule hybridizes with a molecular beacon (e.g., at about room temperature or 90 degree C. temperature), a full recognition site may form with an enzyme to cleave the molecular beacon strand. The net result of one reaction cycle is a cleaved molecular beacon. After many cycles, one target molecule may give rise to many molecular beacon related fluorescence signals, thus achieving linear signal amplification. If the target molecule is a microRNA/messenger RNA, then RNAse inhibitor may be added to preserve a microRNA/messenger RNA, when the target molecule and its corresponding molecular beacon is heated at about 90 degree C. temperature.
[1390] Alternatively, it may be possible to convert the above molecular beacon into a metastable probe, upon placement of the above molecular beacon on a substrate made of a two-dimensional material (e.g., graphene) and then linear hybridizations chain reaction based oligonucleotide probes for linear amplification or nonlinear hybridization chain reaction based oligonucleotide probes for nonlinear amplification may be added for amplification of fluorescence signal.
[1391] A quantum dot based fluorophore (about 15 to 20 nanometers in diameter) is a semiconductor material (e.g., cadmium mixed with selenium or tellurium) which is then encapsulated within an additional semiconductor shell (e.g., zinc sulfide).
[1392] Furthermore, the enhanced signal amplification may be obtained utilizing a quantum dot based fluorophore-further conjugated with a metal nanoparticle (e.g., a silver/gold nanoparticle of about 40 to 50 nanometers in diameter). But it may be necessary to functionalize the exterior surface of a quantum dot based fluorophore with silica (SiO.sub.2) or micron sized glass beads or magnetic beads, depending on the specific application.
[1393] Generally, a micron sized particle loaded with many fluorophores can be very bright. But to reduce any quenching of a signal (e.g., fluorescence), anti-fluorescence quenching molecules (suitably electrically charged) may be added with fluorophores, which are caged in a micron sized particle (e.g., made of a polymer material).
[1394] Many quantum dot based fluorophores or even non-quantum dot based fluorophores (added with other anti-fluorescence quenching suitably electrically charged molecules) may be either encapsulated within a micron sized particle (e.g., made of a polymer material) or arranged in a two-dimensional or a three-dimensional lattice cavities (e.g., each cavity can be made of a polymer material). This particular arrangement can be considered as a Sirius assembly. Such a Sirius assembly can include one or more metal (e.g., aluminium/gold/silver) nanoparticles. It should be noted that this scheme with a Sirius assembly may be applicable utilizing Frster/Fluorescence Resonance Energy Transfer.
[1395] Alternatively, an amplifying chemical structure/sequence or a fluorophore (which generally includes both a quantum dot based fluorophores or a non-quantum dot based fluorophore) or a Sirius assembly may be placed within a gap defined by at least a three-dimensional protruded structure (e.g., a metal/non-metal nano optical antenna) fabricated either by self-organizing DNA/RNA origami or electron beam lithography/liftoff based semiconductor process.
[1396] Alternatively, a Sirius assembly may include metallic nanoparticles (e.g., silver nanoparticles or gold nanoparticles).
[1397] For example, two nanoparticles (each nanoparticle is about 50 to 100 nanometers in diameter) attached to a pillar shaped self-organizing DNA/RNA origami (about 100 to 200 nanometers in height) can act as a three-dimensional protruded structure of a nano optical antenna. The three-dimensional protruded structure of a nano optical antenna has suitable resonance wavelength and enhanced electric field intensity within a geometrical area including a gap defined by at least a nano optical antenna. The above nanoparticle can be a colloidal gold nanoparticle or a colloidal silver nanoparticle.
[1398] However, in some cases a center region is approximately a middle region of a three-dimensional protruded structure (for example within a dogbone/dumbbell type three-dimensional protruded structure).
[1399] If a gap of the three-dimensional protruded structure (of a suitable material) is generally less than 25 nanometers, then the electric field enhancement at a height of about 1-5 nanometers can be significant to enable even a single molecule detection in about 20 microliters of a biological fluid (e.g., serum/plasma). For example, there may be about 10-20 circulating tumor DNAs in a volume of 10 microliters of serum.
[1400] Furthermore, the above placement of an amplifying chemical structure/sequence (coupled with a fluorophore) or a fluorophore or a Sirius assembly within a geometrical area including a gap defined by at least one three-dimensional protruded structure may be realized, by surface functionalization (e.g., utilizing a precision inkjet printer) or click chemistry (including copper free based a click reagent (e.g., dibenzo-cyclooctyne (DBCO) structure)) based functionalization within a nanoscaled hole on a substrate (e.g., made of quartz or a semiconductor) or a nanopatterned flow cell (with nanowells)).
[1401] When two metal nanoparticles (e.g., surface-anchored by a pillar-shaped DNA origami structure) come close together, their overlapping plasmonic fields may create a region that can act as a nanoantenna to enhance the fluorescent emission.
[1402] But it should be noted that choice of a fluorophore with proper quantum yield may be important in realizing significant fluorescence enhancement within a geometrical area (as discussed in the later paragraphs) that includes a center region or a middle region. For a fluorophore with high quantum yield, a suitable quencher may be considered.
[1403] In some applications, the nanohole on a substrate can be replaced/augmented by a (one/two-dimensional) photonic crystal or an optical resonator (e.g., a microring resonator or a whispering gallery mode resonator) on a substrate. A scheme of surface functionalization utilizing a molecule , as shown below
##STR00001##
and its linking molecule (which is complementary to a molecule ), as shown below
##STR00002##
has been described/disclosed in U.S. Non-Provisional patent application Ser. No. 17/803,387 entitled OPTICAL BIOMODULE FOR DETECTION OF DISEASES AT AN EARLY ONSET, filed on Jun. 15, 2022 and in its related U.S. non-provisional patent applications (with all benefit provisional patent applications) are incorporated in its entirety herein with this application.
[1404] A nanopattered flow cell (with a large number of nanoscaled wells) can be fabricated/constructed using semiconductor process technology such as electron beam lithography and dry/wet etching of a substrate. Typically, a nanoscaled well can be a recessed nanoscaled well with a dimension (e.g., diameter and/or depth) less than 1000 nanometers.
[1405] Alternatively, direct-write dip pin lithography may be used to (bio) functionalize the nanoscaled wells.
[1406] Alternatively, the nanoscaled wells can have electron beam photoresist openings by electron beam lithography, utilizing proper tone (e.g., a PMMA positive tone) electron beam photoresist. A monolayer (about 0.5 nanometers in thickness) of (3-aminopropyl)trimethoxysilane (APTMS) or (3-Aminopropyl)triethoxysilane (APTES) can be deposited by chemical vapor deposition. Then all unnecessary electron beam photoresist can be removed by sonicating the substrate (including nanoscaled wells) in N-Methyl-2-pyrrolidone (NMP) at about 50 degree C. temperature.
[1407] (3-aminopropyl)trimethoxysilane (APTMS) or (3-Aminopropyl)triethoxysilane (APTES) functionalized nanoscaled wells can be coupled with a pillar shaped self-organizing DNA/RNA origami (about 100-200 nanometers in height), which may be attached with two nanoparticles (each nanoparticle is about 50-100 nanometers in diameter).
[1408] Furthermore, the tip of the pillar shaped self-organizing DNA/RNA origami can be click conjugated with a linker at the fluorophore end (e.g., 5) of a molecular beacon. It should be noted that the non-quantum dot based fluorophore/quantum dot based fluorophore/Sirius assembly should be within a geometrical area (that includes the gap) defined by at least the two nanoparticles.
[1409] For example, a sequence can be 5-K-L-X-3, wherein K is DBCO-serinol phosphoramidite, L is dithiol serinol phosphoramidite, X is oligo sequence (which can be complementary to a target molecule and X can include a fluorophore/Sirius assembly) and a quencher. L can be coupled with a metal nanoparticle (e.g., gold nanoparticle of about 40 to 50 nanometers in diameter or a silver nanoparticle of about of 80 nanometers in diameter)
[1410] A click chemistry (e.g., copper free click chemistry) can be conjugated to K, wherein the nanoscaled wells should be functionalized with complementary azide (N3) group on the monolayer (about 0.5 nanometers in thickness) of (3-aminopropyl)trimethoxysilane (APTMS) or (3-Aminopropyl)triethoxysilane (APTES) can be deposited by chemical vapor deposition. If a three-dimensional protruded structure is a nano optical antenna with a gap (which can be a nanoscaled well), then L may not be needed.
K is represented by the following chemical structure
##STR00003##
L is represented by the following chemical structure
##STR00004##
[1411] Furthermore, a fluorophore, which may be directly coupled with click chemistry based regent. For example, 5-norbornene-2-nonanoic acid ligand may be added to CdSe/CdS quantum dot syntheses and generate a direct clickable quantum dot.
[1412] Furthermore, CRISPR-Cas12a system may be combined with the linear hybridization a chain reaction or the non-linear hybridization chain reaction. The linear hybridization chain reaction or the non-linear hybridization chain reaction may convert each target molecule (e.g., a microRNA) into multiple DNA duplexes, as activators to activate the transcleavage activity of Cas12a for further signal amplification.
[1413] The nonlinear hybridization chain reaction may also include branched hybridization chain reaction based amplification and catalytic hairpin assembly (CHA) amplification. Catalytic hairpin assembly amplification can involve two metastable DNA hairpin probes and a target molecule. At the presence of the target molecule, two metastable DNA hairpins may autonomously cycle through a cascade reaction, producing exponentially amplified signal (e.g., fluorescence or electrochemical).
[1414] The linear hybridizations chain reaction based oligonucleotide probes or the nonlinear hybridization chain reaction based oligonucleotide probes can be conjugated with one or more functional materials (e.g., an electrochemical reagent or an electrochemical sensor molecule or a nanozyme or a fluorophore).
[1415] Furthermore, the linear hybridizations chain reaction based oligonucleotide probes or the nonlinear hybridization chain reaction based oligonucleotide probes can be coupled/conjugated with one or more (i) fluorophores, (ii) metal nanoparticles (e.g., gold/silver nanoparticles, each nanoparticle of a suitable size (e.g., about 30 to 50 nanometers in diameter)) or (iii) Sirius assemblies.
[1416] Additionally, to obtain much higher sensitivity, the nonlinear hybridization chain reaction based oligonucleotide probes may rapidly self-assemble into a network/branched nanostructure, enabling exponential amplificationforming avalanche signal (e.g., fluorescence) amplification with a faster response and higher detection sensitivity. It should be noted that this scheme may be applicable utilizing Frster/Fluorescence Resonance Energy Transfer.
[1417] However, several disadvantages may limit the application of the nonlinear hybridization chain reaction based oligonucleotide probes due to (i) the existence of steric hindrance limiting the amplified signal (e.g., fluorescence) signal and (ii) the background (e.g., the background fluorescence) related to such probes' undesired spontaneous opening.
[1418] DNAzyme is a synthetic DNA/RNA sequence with catalytic function with a special method of recognition and it may be combined with nonlinear hybridization chain reaction (DNAzyme-N-HCR) based oligonucleotide probes to solve the above problems due to (i) the existence of steric hindrance limiting the amplified signal (e.g., fluorescence) and (ii) the background signal (e.g., the background fluorescence) related to such probes' spontaneous undesired opening.
[1419] Additionally, (i) the linear hybridization chain reaction based oligonucleotide probes or (ii) the nonlinear hybridization chain reaction based oligonucleotide probes or (iii) the nonlinear hybridization chain reaction based oligonucleotide probes combined with DNAzyme can be placed on DNA/RNA origami structures or DNA/RNA origami networks (e.g., by assembling hybridization chain reaction based oligonucleotide probes at the vertexes of tetrahedral DNA nanostructures)which may result into a three-dimensional hyperbranched tree-like structure enabling lower detection limit of a test molecule. Furthermore, the DNA/RNA origami structures or DNA/RNA origami networks may also be self-replicating. It should be noted that this scheme may be applicable utilizing Frster/Fluorescence Resonance Energy Transfer.
[1420] Additionally, CRISPR-Cas9 system or a suitable CRISPR system or a DNA/RNA logic gate may also be utilized to detect a target molecule at a lower concentration.
[1421] Additionally, Raman signal such as surface enhanced Raman scattering (SERS) signal can suffer from poor signal-to-noise ratio, due to the complexity of overlapping of Raman bands from complex biological tissues and Raman reporters (a molecular beacon with a fluorophore (e.g., FAM, Cy3, Cy5 or ROX) and a quencher can be considered as a Raman Reporter, which is complimentary to a target molecule). The Raman reporters can scatter light in the biological silent window (Raman silent) between 1750 cm1 and 2750 cm1a spectral window, where Raman bands from biological molecules and tissues are minimized, however Raman bands from a triple bond (e.g., alkyne, cyanide or nitrile) vibrational modes may appear. Since, the Raman shift is relative to the energy of the excitation source, the Raman silent window corresponds to a first wavelength range of about 720 to 775 nanometers, when the excitation wavelength is 638 nanometers and to a second wavelength range of 910 to 1000 nanometers, when the excitation wavelength is 785 nanometers.
[1422] In another embodiment, a substrate containing nano optical antennas or nanoscaled patterns (e.g., made of a metal/semiconductor) may be functionalized with multiple molecular beacons, wherein each molecular beacon may include a fluorophore and a quencher in a suitable wavelength range, wherein each molecular beacon may be complementary to a specific target molecule. In the absence of any specific target molecule, surface enhanced Raman scattering signal from the substrate containing nano optical antennas or nanoscaled patterns may be high, upon excited by a laser of a suitable wavelength. But, in the presence of one or more specific target molecules, surface enhanced Raman scattering signal from the substrate containing nano optical antennas or nanoscaled patterns may be low, upon excited by a laser, when each molecular beacon binds with its complementary specific target moleculethis arrangement may be useful for multiplexed detection of various target molecules in a biological silent (Raman silent) window.
[1423] Additionally, each molecular beacon acting as a Raman Reporter may include an amplifying chemical structure/sequence, if the corresponding target molecule has a built-in recognition site. When a target molecule hybridizes with a specific molecular beacon, a full recognition site may form with an enzyme to cleave the molecular beacon strand. The net result of one reaction cycle is a cleaved molecular beacon. After many cycles, one target molecule may give rise to many molecular beacon related fluorescence signals, thus achieving linear signal amplification.
[1424] Alternatively, a disease specific biomarker binder (generally, a disease specific biomarker binder can bind/couple/hybridize with its complementary disease biomarker) and its complementary disease biomarker can be coupled/hybridized in a solution.
[1425] The disease specific biomarker binder can include an amplifying chemical structure/sequence such as two or more linear hybridizations chain reaction based oligonucleotide probes for linear amplification or two or more nonlinear hybridization chain reaction based oligonucleotide probes.
[1426] Then the coupled/hybridized assembly (of the above disease specific biomarker binder and its complementary disease biomarker) can be placed (e.g., utilizing a click chemistry reagent and a surface functionalized monolayer to capture the click chemistry reagent) within a geometrical area (in a horizontal plane) of a gap defined by at least one three-dimensional protruded structure (e.g., a metal/non-metal nano optical antenna) fabricated either by self-organizing DNA/RNA origami or electron beam lithography/liftoff based semiconductor process. It should be noted that generally two three-dimensional protruded structures define a gap, having a geometric area of the gap.
[1427] It should be noted that the above geometrical area (in a horizontal plane) is defined by at least one three-dimensional protruded structure includes a center region or a middle region (in a horizontal plane). Generally, the above geometrical area may enable any undesired quenching of an optical signal (e.g., fluorescence).
[1428] A Raman signal of the above coupled/hybridized assembly can be excited by a suitable laser and collected by a spectrophotometer for detecting the Raman signal. Such a spectrophotometer can be coupled with a refractive optical element and/or a reflective optical element and/or a light concentrator.
[1429] Furthermore, the spectrophotometer can be communicatively interfaced with computer implemented instructions in artificial intelligence or an artificial neural network (stored in non-transitory storage media). Computer implementable instructions in machine learning/artificial neural networks may aid in analysis of Raman signal such as surface enhanced Raman scattering signal. Furthermore, the above computer implementable instructions may also include a transformer model or a diffusion model (e.g., as generally described/illustrated in
[1430] Furthermore, combining both
[1431] An aptamer is a short sequence of an artificial DNA/RNA/XNA or a peptide that binds a target molecule. Furthermore, a molecular beacon can be replaced by a peptide beacon (e.g., a coiled-coil peptide beacon architecture based peptide beacon) or an aptamer beacon to bind with a receptor binding domain (RBD) of a virus such as a Corona Virus and such binding may enable to detect a virus or a protein. However, a virus generally has an RNA molecule inside and a molecular beacon can directly bind with the RNA molecule within a virus.
[1432] A three-dimensional structure of the spike protein of the Corona Virus can bind about 10/20 times tighter with angiotensin-converting enzyme 2 (ACE2) receptor's alpha helix area and the spike protein has a coating of glycans to evade a human body's immune system.
[1433] Thus, a peptide beacon binding with a receptor binding domain of a virus can be utilized to detect any virus.
[1434] A peptide beacon can be coupled with a metal nanoparticle (e.g., a gold nanoparticle/silver nanoparticle). The above metal nanoparticle can then be coupled with a three-dimensional structure (e.g., a nano optical antenna) fabricated/constructed on top of a photonic crystal or an optical resonator or a metamaterial surface, which is fabricated/constructed on a substrate. However, precious positioning of the above peptide beacon within the gap of the above three-dimensional structure can be achieved via click chemistry conjugation, as described in the previous paragraphs. It should be noted that a molecular beacon or a peptide beacon can be generally considered as a biomarker binder.
[1435] For example, certain fluorescent dyes (e.g., 2-(N-(7-nitrobenz-2-oxa-1,3-diazol-4-yl)amino)-2-deoxy-D-glucose with excitation and emission wavelengths at 465 nanometers and 540 nanometers respectively) can bind specifically to glucose molecules in saliva. Therefore, strength of a fluorescence signal can be proportional to the concentration of glucose in salivaenabling a non-invasive glucose test.
[1436] For example, a specific oligonucleotide probe (that can couple with a biomarker in saliva (e.g., glucose/adenosine monophosphate (AMP) or a glucose sensing protein) can be further coupled with two linear hybridrization chain reaction based oligonucleotide probes or two nonlinear hybridrization chain reaction based oligonucleotide probes, wherein at least one linear hybridrization chain reaction based oligonucleotide probe or (at least) one nonlinear hybridrization chain reaction based oligonucleotide probe can be conjugated with a fluorophore/fluorescent dye (e.g., 2-(N-(7-nitrobenz-2-oxa-1,3-diazol-4-yl)amino)-2-deoxy-D-glucose. Therefore, strength of a fluorescence signal can be proportional to the concentration of glucose in salivaenabling a non-invasive glucose test. Additionally, the nonlinear hybridization chain reaction based oligonucleotide probes combined with DNAzyme can be utilized. It should be noted that this scheme may be applicable utilizing Frster/Fluorescence Resonance Energy Transfer.
[1437] The linear hybridrization chain reaction based oligonucleotide probes or the nonlinear hybridization chain reaction based oligonucleotide probes or the nonlinear hybridization chain reaction based oligonucleotide probes combined with DNAzyme can be placed on DNA/RNA origami structures or DNA/RNA origami networks (e.g., by assembling hybridization chain reaction based oligonucleotide probes at the vertexes of tetrahedral DNA nanostructures)which may result in a three-dimensional hyperbranched tree-like structure enabling lower detection limit of glucose. Furthermore, the DNA/RNA origami structures or DNA/RNA origami networks can be also self-replicating. It should be noted that this scheme may be applicable utilizing Frster/Fluorescence Resonance Energy Transfer.
[1438] For example, to detect a protein: [1439] Capture of a target protein by a binding antibody on a substrate (e.g., a ceramic substrate/graphene coated quartz/semiconductor/quartz, a magnetic bead or an electrode). [1440] Initiation of the linear hybridization chain reaction or the nonlinear linear hybridization chain reaction on an oligonucleotide probe that may be specifically linked/coupled with the above binding antibody coupled with the above target protein. [1441] Quantitative measurement of signal via an optical or an electrochemical technique. [1442] Alternatively, a protein sequencing method can be utilized.
[1443] To improve, the stability, lower sensitivity and accuracy of detection of a target molecule, the linear hybridrization chain reaction based oligonucleotide probes or the nonlinear hybridization chain reaction based oligonucleotide probes or the nonlinear hybridization chain reaction based oligonucleotide probes combined with DNAzyme can be coupled/conjugated with one or more (i) fluorophores, (ii) metal nanoparticles (e.g., gold/silver nanoparticles, each nanoparticle of a suitable size (e.g., of about 30 to 50 nanometers in diameter)) or (iii) Sirius assemblies.
[1444] Furthermore, such a non-invasive glucose test can be calibrated utilizing a non-invasive glucose test (or even utilizing an invasive blood based glucose test).
[1445] For example, a glucose sensing protein can be sandwiched between AcGFP1 (as a donor) (can be excited by a laser at 475 nanometers wavelength) at its N-terminus and mCherry (as an acceptor) (emission wavelength at 610 nanometers) at its C terminus. The glucose sensing protein can expand/open in the presence of glucose in saliva and similarly contract/close in the absence of glucose in saliva, leading to a change in the relative distance between AcGFP1 (as a donor) and mCherry (as an acceptor) and thus, altering Frster/Fluorescence Resonance Energy Transfer efficiency due to distance variation between AcGFP1 (as a donor) and mCherry (as an acceptor).
[1446] Furthermore, AcGFP1 (as a donor) and mCherry (as an acceptor) may be replaced by one or more DNA probes, which can then be coupled with two or more (i) linear hybridrization chain reaction based oligonucleotide probes or (ii) nonlinear hybridization chain reaction based oligonucleotide probes with a donor-specific fluorophore and as well as an acceptor-specific fluorophore, wherein measured Frster/Fluorescence Resonance Energy Transfer efficiency can be directly proportional to glucose concentration in salivaenabling a non-invasive glucose test.
[1447] Additionally, the nonlinear hybridization chain reaction based oligonucleotide probes combined with DNAzyme can be utilized.
[1448] The linear hybridrization chain reaction based oligonucleotide probes or the nonlinear hybridization chain reaction based oligonucleotide probes or the nonlinear hybridization chain reaction based oligonucleotide probes-combined with DNAzyme can be placed on DNA/RNA origami structures or DNA/RNA origami networks (e.g., by assembling hybridization chain reaction based oligonucleotide probes at the vertexes of tetrahedral DNA nanostructures)which may result in a three-dimensional hyperbranched tree-like structure enabling lower detection limit of glucose. The DNA/RNA origami structures or DNA/RNA origami networks can also be self-replicating.
[1449] To improve, the stability, lower sensitivity and accuracy of detection of a target protein, hybridrization chain reaction based oligonucleotide probes can be coupled/conjugated with one or more (i) fluorophores, (ii) metal nanoparticles (e.g., gold/silver nanoparticles, each nanoparticle of a suitable size (e.g., about 30 to 50 nanometers in diameter)) or (iii) Sirius assemblies. But, in the context of Frster/Fluorescence Resonance Energy Transfer, metal nanoparticles may need to be caged within a nanoshell or oligonucleotides based nanostructure.
[1450] In stead of either fluorescence or Frster/Fluorescence Resonance Energy Transfer efficiency, a shift in absorption spectrum due to binding of hybridrization chain reaction based oligonucleotide probes onto a specific oligonucleotide probe-coupled with glucose/adenosine monophosphate/glucose sensing protein biomarker in saliva on (i) an optical resonator or (ii) gold nanoparticles/silver nanoparticles may be realized.
[1451] The gold nanoparticles/silver nanoparticles may also be placed either on a substrate (e.g., made of a semiconductor/graphene/polymer/paper/quartz) or on an optical resonator.
[1452] It should be noted that glucose level in saliva is typically 10 to 100 times lower than that in blood. Thus, it may require a highly sensitive, specific and accurate detection method. Furthermore, glucose level in saliva may be influenced by oral hygiene, diet and medication.
[1453] Furthermore, computer implementable instructions in artificial intelligence (artificial intelligence can be machine learning or artificial neural networks or deep learning) and/or evolutionary based algorithm, wherein the artificial neural networks may include a transformer model or a diffusion model (e.g., as generally described/illustrated in
[1454] Additionally, the Super System on Chip 400A/400B/400C/400D or optically controlled Super System on Chip (the Super System on Chip 400A/400B/400C/400D or optically controlled Super System on Chip may include an intelligent algorithm 100Y) can be communicatively interfaced to improve the speed of multiplexing detection technique of many disease biomarkers. The optically controlled Super System on Chip includes Mach-Zehnder interferometers.
[1455] It should be noted that a System on Chip (such a System on Chip can be an artificial intelligence hardware accelerator and/or a multiplier of matrices) may be an alternative to the Super System on Chip 400A/400B/400C/400D or optically controlled Super System on Chip.
[1456] Furthermore, an artificial intelligence hardware accelerator may include one or more processing cores and memory units, wherein at least one of the processing cores and at least one of the memory units can be coupled in an intertwined geometrical architecture either in a two-dimensional arrangement or a three-dimensional arrangement, wherein at least one of one or more memory units can include one or more memory elements, wherein at least one of one or more memory elements can include one or more memory circuits.
[1457] In summary, a LifeMicrochipa system to detect many disease biomarkers in parallel (multiplexing) can be fabricated/constructed as follows: (i) a substrate (e.g., made of a semiconductor/graphene/polymer/paper/quartz) or (ii) a fluidic container, that can include: a Mach-Zehnder interferometer and/or an optical resonator and/or photonic crystals and/or a metamaterial surface (e.g., a hyperbolic metamaterial surface) and/or a nanoscaled hole (of about of about 10-15 nanometers in diameter, but less than 20 nanometers in diameter made of a two-dimensional material (e.g., a single atomic layer of graphene or bi-atomic layers of MoS.sub.2) or synthetic DNA/RNA material (e.g., synthetic DNA/RNA material based DNA/RNA origami structure) and/or one or more three-dimensional protruded structures (e.g., made of a metal/semiconductor/dielectric or synthetic DNA/RNA/designer protein or a combination of a metal/semiconductor/dielectric and synthetic DNA/RNA/designer protein).
[1458] Furthermore, three-dimensional protruded structures can be fabricated/constructed at specific locations on the Mach-Zehnder interferometer and/or the optical resonator and/or photonic crystals and/or a metamaterial surface and/or a photonic hypercrystal.
[1459] It should be noted that a photonic hypercrystal is a photonic crystal fabricated/constructed of a hyperbolic metamaterial (Type I or Type II). The structuring of the above hyperbolic metamaterial (Type I or Type II) can have features smaller than an incident light's wavelength and the photonic hypercrystal's periodicity. Photonic crystals and hyperbolic metamaterials have different optical attributes, when it comes to supporting surface waves, but their optical attributes can be combined in the photonic hypercrystal.
[1460] Additionally, a DNA/RNA origami structure may be optimized/designed to incorporate a synthetic sensor molecule to detect a specific disease biomarker.
[1461] Each specific location of the LifeMicrochip can include a disease specific biomarker binder. However, depending on the final surface presented to the disease specific biomarker binder, a particular surface treatment (e.g., phosphonic acid based surface treatment or chlorobutyldimethyl silane based surface treatment) may be required for proper biografting of a disease specific biomarker binder.
[1462] Click chemistry can enable two molecules to meet up only and join together in an environment of many other molecules. In this context, a click chemistry terminated disease specific biomarker binder (as a molecular probe) and its complimentary click chemistry terminated surface treatment on the final surface may be useful.
[1463] A disease specific biomarker binder can be an aptamer, a molecular beacon, a peptide beacon or a protein, which can be coupled with linear hybridization chain reaction based oligonucleotide probes or nonlinear hybridization chain reaction based oligonucleotide probes. This may enable Fluoro-sequencing or FRET-sequencing for massively parallel identification/quantification of disease biomarkers via amplified signal (e.g., fluorescence or Frster/Fluorescence Resonance Energy Transfer) in dynamic (high and low) concentrations. Furthermore, Frster/Fluorescence Resonance Energy Transfer efficiency may be enhanced by selecting suitable a donor (e.g., Cy3 organic dye) and an acceptor (e.g., Cy5 organic dye) and further coupling a donor and an acceptor with a metamaterial surface and/or a nanostructured surface, wherein the resonance wavelength and/or maximum Purcell enhancement of a metamaterial surface and/or a nanostructured surface is at the overlap region in the emission spectrum of the donor and the absorption spectrum of the acceptor.
[1464] It should be noted that more than 95% of the proteins in the human proteome may be identified by labeling only three amino acids (lysine, cysteine and methionine) and threading them linearly through the above nanoscaled hole.
[1465] Furthermore, a disease specific biomarker binder can include an amplifying chemical structure/sequence. The amplifying chemical structure/sequence can be coupled/conjugated with a functional material (e.g., an electrochemical reagent or an electrochemical sensor molecule or a nanozyme). Also, the amplifying chemical structure/sequence can be coupled/conjugated with a fluorophore or a metal nanoparticle or a Sirius assembly.
[1466] Generally, a viral vector (like AAV, retrovirus or lentivirus) or a non-viral vector can be used to insert a beneficial genetic material (e.g., DNA/RNA/mRNA/plasmid DNA) into a cell. But, using an electrical current, one or more bioactive molecules can also be inserted into a cell by creating temporary pores in the cell membrane. After insertion of a beneficial genetic material, cell pores can be closed by switching off the current. The process may take about a few microseconds or milliseconds and depend on electrical pulse length and electrical field strength. But, under high electric field live cells may die. Thus, apoptosis rate may be very high for live cells.
[1467] The LifeMicrochip can be coupled with a microfluidic device, which can include one or more microfluidic channels. Furthermore, one or more microfluidic channels may be adiabatically constricted/narrowed at a dimension less than that of a target cell (e.g., a T cell) at certain locations to inject a beneficial genetic material from microfluidic channels into the target cell, when the target cell is propagating at adiabatically constricted/narrowed dimensions of the microfluidic channel. Furthermore, the microfluidic channels with adiabatically constricted/narrowed dimensions may be vibrated at a specified frequency to improve injection of a beneficial genetic material from the microfluidic channels into the target cell.
[1468] Additionally, one or more microfluidic channels containing a beneficial genetic material may be included in the nanoscaled electrodes (each nanoscaled electrode is about 1000 nanometers high and 1000 nanometers in diameter) made of a biocompatible polymeric material or a biocompatible noble (e.g., titanium or gold) material. Target cells placed on top of the nanoscaled electrodes may have temporary nanoscaled openings for a beneficial genetic material to be injected into the target cells, when electrodes are electrically activated by suitable electrical pulses. The choice of material of the nanoscaled electrodes is extremely critical to reduce contamination of the material into the beneficial genetic material to be injected into the target cells.
[1469] Alternatively, one or more microfluidic channels containing a beneficial genetic material may be guided (by a first laser) into a temporary pore in a cell, wherein the temporary pore (in a cell) can be created by an ultra short laser pulse (femtoseconds) from a second laser of suitable wavelength. Optical tweezers may be used to fix the position of the cell in a microfluidic channel.
[1470] The inserted genetic material may include an additional gene that codes for a green fluorescent protein. Once inside a live cell, the gene may become active and the live cell's machinery may produce the green fluorescent protein to be viewed under a fluorescence microscope/confocal microscope on an array of zero-mode optical waveguides (ZMW).
[1471] But, as a result of this type of force feeding of the beneficial genetic material into the target cells, the target cells may spit out exosomes. These exosomes (including their internal biological components such as DNAs/RNAs) acting as Molecular Twitter for cell to cell communication have the potential to enable in predicting an early onset of a disease or a therapeutic action.
[1472] Such a disease may be managed by (i) changing lifestyle/environment or (ii) editing genes or removing epigenetic errors. Artificial intelligence (artificial intelligence can be machine learning or artificial neural networks or deep learning) and/or evolutionary based algorithm and/or Poisson flow generative model++ coupled with a DNA/RNA sequencing device may be useful to locate such errors in gene or epigenome.
[1473] Details of a biosensing sequencing device have been described/disclosed in U.S. Non-Provisional patent application Ser. No. 17/803,387 entitled OPTICAL BIOMODULE FOR DETECTION OF DISEASES AT AN EARLY ONSET, filed on Jun. 15, 2022 and in its related U.S. non-provisional patent applications (with all benefit provisional patent applications) are incorporated in its entirety herein with this application.
[1474] Furthermore, above biosensing sequencing device can be extended to protein/peptide sequencing by utilizing the following five (5) strategies: [1475] (i) Tandem and coupled sequencing devices, [1476] (ii) A protein/peptide may be cut into small pieces, [1477] (iii) A protein/peptide can be tagged with positively charged amino acids (e.g., Lysine), [1478] (iv) The movement of the protein/peptide may be slowed through a smaller diameter (e.g., about 1.5 nanometers in diameter) and a bit thicker (e.g., about 0.5 nanometers in thickness) nanoscaled hole. The nanoscaled hole can be integrated/coupled with a three-dimensional protruded structure (e.g., a nano optical antenna), [1479] (v) The ionic current associated with the movement/passage of the protein/peptide through the nanoscaled hole may be computed by a mathematical time series with permutation entropy (PE) analysis to the ionic current measurement. Permutation entropy may be calculated as
wherein pj represents the relative frequencies of possible permutation patterns (n!). Permutation entropy can enable an appropriation due to any complexity in time series in presence of dynamical and/or observational noise, wherein the above computer implementable instructions are stored in a non-transitory storage media.
[1480] The LifeMicrochip can be coupled/communicatively interfaced with a complementary metal-oxide-semiconductor integrated circuit or a microprocessor or the Super System on Chip 400A/400B/400C/400D or optically controlled Super System on Chip (the Super System on Chip 400A/400B/400C/400D or optically controlled Super System on Chip may include an intelligent algorithm 100Y). The optically controlled Super System on Chip includes Mach-Zehnder interferometers.
[1481] Additionally, the LifeMicrochip can be coupled/communicatively interfaced with an electronic integrated circuit, which may include one or more processing cores and memory units, wherein at least one of the processing cores and at least one of the memory units can be coupled in an intertwined geometrical architecture either in a two-dimensional arrangement or a three-dimensional arrangement, wherein at least one of one or more memory units can include one or more memory elements, wherein at least one of one or more memory elements can include one or more memory circuits.
[1482] Details of a Super System on Chip or an optically controlled Super System on Chip (which includes Mach-Zehnder interferometers have been described/disclosed in U.S. Non-Provisional patent application Ser. No. 17/803,388 entitled SUPER SYSTEM ON CHIP, filed on Jun. 15, 2022 and in its related U.S. non-provisional patent applications (with all benefit provisional patent applications) are incorporated in its entirety herein with this application.
[1483] The above LifeMicrochip may be communicatively interfaced with computer implementable instructions in artificial intelligence (artificial intelligence can be machine learning or artificial neural networks or deep learning) and/or evolutionary based algorithm, wherein the artificial neural networks may include a transformer model or a diffusion model (e.g., as generally described/illustrated in
[1484] Furthermore, combining both
[1485] In another embodiment, the above LifeMicrochip can be fabricated/constructed as follows: a light beam from a light source (e.g., a laser) in a suitable wavelength range can be reflected by a mirror, then transmitted downward through a photo mask onto a substrate (e.g., a quartz substrate), which can include a disease specific biomarker binder (may include a fluorophore) and its corresponding disease biomarker. Biografting of a disease specific biomarker binder and its corresponding disease biomarker onto a substrate (or even at specific locations of the substrate) may require click chemistry conjugation. However, the substrate may be a disposable (one-time use only) substrate.
[1486] The substrate may include a three-dimensional protruded structure and/or a Mach-Zehnder interferometer and/or an optical resonator and/or a photonic crystal and/or a metamaterial surface and/or a photonic hypercrystal. A three-dimensional protruded structure can at least define a gap and the gap has a geometric area. A fluorophore and/or a disease specific biomarker binder and/or its corresponding disease biomarker may be positioned within a geometrical area surrounding a gap (defined by at least one three-dimensional protruded structure) by click chemistry conjugation. In case of protein/peptide sequencing a fluorophore labeled amino acid recognizer and an amino acid cleaver (e.g., aminopeptidase) can be added. Alternative to the above substrate, at least one three-dimensional protruded structure may be within a well or within a waveguide (including a zero-mode waveguide).
[1487] A Mach-Zehnder interferometer generally includes a multimode interference (optical) or a Y coupler or an equivalent coupler at an input and an output. It should be noted that one arm of a Mach-Zehnder interferometer can include an optical phase shifter and/or a variable optical attenuator (VOA) and another arm of the Mach-Zehnder interferometer can (i) include a continuous metal (e.g., gold metal) stripe or a segmented metal stripe or a nanoscaled segmented (e.g., about 50 to 100 nanometers in each nanoscaled segment) metal stripe or (ii) couple with an optical ring resonator in close proximity. Furthermore, improvement in disease biomarker detection sensitivities can be improved utilizing cascaded Mach-Zehnder interferometers and optical ring resonators.
[1488] Such a Mach-Zehnder interferometer can be fabricated/constructed utilizing a low loss (optical) material (e.g., SiNx). For example, Si.sub.3N.sub.4 optical waveguide (about 400 nanometers thick and 1000 nanometers long) can be fabricated/constructed on thermally grown SiO.sub.2 on silicon wafer. Low temperature PECVD SiO.sub.2 (about 500 nanometers thick) can be deposited as a cladding layer. A cavity slot (at a depth of about 1200 nanometers from the top surface and various lengths (e.g., 10,000 nanometers long)) for a metal stripe (e.g., silver) can be fabricated/constructed. Furthermore, such a metal stripe may be nanoscaled segmented (each nanoscaled segment can be about 50 to 100 nanometers long).
[1489] A laser (generally an electrically activated distributed feedback (DFB) laser or a micro distributed feedback laser based on whispering gallery modes (WGMs) of emitting wavelength ) and a detector (of detecting wavelength ) can be coupled with a Mach-Zehnder interferometer for sensing a change in refractive index due to binding of a disease specific biomarker binder onto its corresponding disease biomarker via optical fiber coupling or waveguide coupling. However, optical fiber coupling or waveguide coupling could be an expensive alignment problem. Thus, an input of a Mach-Zehnder interferometer can include diffraction gratings or curved mirrors or prisms for less expensive vertical alignment. An optically pumped distributed feedback laser such as organic dye molecules embedded into a host polymer matrix (e.g., poly(methyl methacrylate) (PMMA) and applied onto Bragg gratings based optical cavity may replace electrically activated distributed feedback laser. Furthermore, Bragg grating may include a /4 phase shift at the center.
[1490] When voltage is applied in one arm, which can change the refractive index of that arm and thus it can produce a phase shift between the two arms of a Mach-Zehnder interferometer in a propagating light wave of a laser of wavelength k. A disease specific biomarker detection (via disease specific biomarker binder-disease biomarker binding/coupling) can be realized at the sensing arm, while reference arm may contain a liquid (e.g., PBS solution) with similar refractive index of the sensing arm (the sensing arm may be immersed in a flow cell) in order to reduce the common mode noise generally caused by mechanical and temperature fluctuation. The sensing arm may include three-dimensionally printed arrays of synthetic DNAs/RNAs. These three-dimensionally printed arrays of synthetic DNAs/RNAs may also include fluorophores.
[1491] The binding of a disease biomarker on the sensor arm may form an adhesion layer with a refractive index and thickness that can be directly proportional to the concentration of a disease biomarker. It should be noted that a proper surface functionalization of the sensing arm may be required.
[1492] The light coming out of both the arms will interfere at an output junction of the multimode interference (optical) or a Y coupler showing a sinusoidal variation related to change in refractive index of surrounding medium in a waveguide. Guided mode at the sensing arm can experience a phase shift (). Thus, an effective refractive index change (Neff) relative to reference arm due to the cladding index change-caused by disease specific biomarker binder-disease biomarker binding/coupling is shown by the following equation, wherein L.sub.int=an effective length of a Mach-Zehnder interferometer and wavelength=
=(2*(Lint/))*(Neff)
[1493] At the output a Mach-Zehnder interferometer, guided modes from the sensing arm and reference arm can re-combine and interfere to produce a fringe pattern (linked with input optical power) response with time as shown in the following equation, where V is the fringe visibility factor. P (Output Optical Power)=0.5*P (Input Optical Power)*(1+Vcos())
[1494] Fringe counting algorithm may be utilized to calculate the total phase shift which can be correlated with the concentration of a disease biomarker.
[1495] Furthermore, such a disease specific biomarker binder can also include an amplifying chemical structure/sequence to enable a higher signal.
[1496] It should be noted that cascaded mirroring resonators (made of low temperature dependence material) can replace a Mach-Zehnder interferometer for sensing a change in refractive index/resonance wavelength shift due to binding of a disease specific biomarker binder onto its corresponding disease biomarker. Generally, a Mach-Zehnder interferometer based biosensor has a larger footprint than that of cascaded mirroring resonators based biosensor.
[1497] The above substrate may also include a hyperspectral imager system/chip (as discussed in the previous paragraphs) to obtain a signature optical spectrum of a disease specific biomarker binder and/or its corresponding disease biomarker.
[1498] It may be necessary to mechanically hold/manipulate a disease specific biomarker binder and/or its corresponding disease biomarker with a magnetic tweezer (or magnetic nano-tweezer) or a nano-optical tweezer. For manipulation of a disease specific biomarker binder and/or its corresponding disease biomarker by a magnetic tweezer (or magnetic nano-tweezer) may require coupling with a magnetic nanoparticle with a disease specific biomarker binder and/or its corresponding disease biomarker.
[1499] Just below the substrate, there can be an optical bandpass filter to exclude any unnecessary incident light beam from the above light source. Below the optical bandpass filter, there can be an optical to electrical conversion (OE) printed circuit board (which can include an array of photodiodes/photodetectors/phototransistors, a light signal amplification circuit, a (light to current) read-out electronic circuit, an analog to digital conversion electronic circuit and a signal processing electronic circuit) to detect a fluorescence signal due to binding of a disease specific biomarker binder (with a fluorophore) and its corresponding disease biomarker. It should be noted that a two-dimensional array of single photon avalanche diodes or a two-dimensional array of multi-pixel photon counters may be appropriate for low level light detection.
[1500] Alternatively, a Raman signal is possible due to binding of a disease specific biomarker binder (generally without needing a fluorophore) and its corresponding disease biomarker. Thus, it is applicable to any light signal (e.g., a fluorescence signal or a Frster/Fluorescence Resonance Energy Transfer signal or a Raman signal).
[1501] Below the optical to electrical conversion printed circuit board, there can be a complementary metal-oxide-semiconductor integrated circuit/microprocessor or the Super System on Chip 400A/400B/400C/400D or optically controlled Super System on Chip (the Super System on Chip 400A/400B/400C/400D or optically controlled Super System on Chip may include an intelligent algorithm 100Y) and a signal processing circuit. The optically controlled Super System on Chip includes Mach-Zehnder interferometers.
[1502] Furthermore, the above photo mask and the substrate can be combined with a zero-mode optical waveguide substrate. However, to image through a zero-mode optical waveguide substrate, a thinner substrate thickness (e.g., 0.175 mm in thickness) may be needed.
[1503] It is also possible to fabricate/construct a mechanical slot on top of the optical to electrical conversion printed circuit board to insert/remove the substrate. Various combinations and arrangement of the substrate, the light source, the photo mask, the optical bandpass filter, the optical to electrical conversion printed circuit board and the complementary metal-oxide-semiconductor integrated circuit/microprocessor or the Super System on Chip 400A/400B/400C/400D or optically controlled Super System on Chip are possible within the spirit of this embodiment.
[1504] The above Super System on Chip 400A/400B/400C/400D or optically controlled Super System on Chip may be communicatively interfaced with computer implementable instructions in artificial intelligence (artificial intelligence can be machine learning or artificial neural networks or deep learning) and/or evolutionary based algorithm, wherein the artificial neural networks may include a transformer model or a diffusion model (e.g., as generally described/illustrated in
[1505] In general (embodiments described herein can be modified in any arrangement and detail), a LifeMicrochip can include (but not limited to) [1506] (a) [1507] (i) a substrate/fluidic container, which may include (i) a synthetic Cas13/Cas12 protein coupled with a CRISPR RNA (crRNA)generally identified as a synthetic CRISPR-Cas system and/or (ii) a DNA/RNA logic gate. [1508] (ii) a nanoscaled tube (e.g.,
[1515] The above LifeMicrochip can be coupled with: [1516] (i) a complementary metal-oxide-semiconductor integrated circuit or a microprocessor or the Super System on Chip 400A/400B/400C/400D or optically controlled Super System on Chip (the Super System on Chip 400A/400B/400C/400D or optically controlled Super System on Chip may include an intelligent algorithm 100Y) and a signal processing circuit. The optically controlled Super System on Chip includes Mach-Zehnder interferometers. Furthermore, Alternatively or additionally a processor-specific electronic integrated circuit, wherein the processor specific electronic integrated circuit includes one or more processing cores and one or more memory units, wherein at least one of one or more processing cores and at least one of one or more memory units are coupled in an intertwined geometrical architecture either in a two-dimensional arrangement or a three-dimensional arrangement, wherein at least one of one or more memory units can include one or more memory elements, wherein at least one of one or more memory elements can include one or more memory circuits. [1517] (ii) a light source, a photodetector (or a light sensor) and an optical filter. The light sensor can be based on a low-light level detection camera (e.g., a charge coupled device based camera/electron-multiplying charged coupled device based camera) or an array of single photon avalanche diodes of a suitable wavelength range. [1518] (iii) an electrochemical sensing readout circuit. [1519] (iv) a first microfluidic device. [1520] (v) a second microfluidic device, which can include one or more vibrating microfluidic channels/constricted microfluidic channels and/or nanoscaled electrodes to inject a beneficial genetic material (e.g., a messenger RNA/DNA/circular DNA) into a target cell (e.g., a T cell). [1521] (vi) one or more electrodes/inter-digited electrodes, wherein each electrode/inter-digited electrode may include organoids to communicate with organoids. [1522] (vii) a wearable personal health assistant device. Such a wearable personal health assistant device may include a patch on the skin, one or more mie-like electromagnetic resonators (which are coupled with one or more electromagnetic detectors and one or more amplifiers), a laser and a spectrophotomer (e.g., a harmless low power laser and an arrayed waveguide grating router based chip spectrophotomer with (i) a vertical aperture with a 45-degree mirror for light coupling, (ii) an array of photodetectors, (iii) an array of preamplifiers with the array of photodetectors, if needed for gain and (iv) an array of readout circuits can be arranged in a two-dimensional arrangement) can act as a wearable chemical sensor. Furthermore, a spectrophotometer can be replaced by a hyperspectral imager system/chip. It may be useful to fabricate/construct a skin wearable patch which can include silk embedded with biocompatible material (e.g., gold nanowires) or metal cubes (e.g., silver cubes) to detect a biomarker under the skin, utilizing Raman signal. Alternatively, a skin wearable patch may include Raman reporters especially designed for biomarkers in sweat. [1523] An application of a wearable personal health assistant device can be to detect in-situ disease biomarkers by utilizing light sources (e.g., lasers/light emitting diodes) of multiple wavelengths/colors (e.g., red/blue/green), an array of detectors (e.g., an array of avalanche photodiodes (APDs)/single photon avalanche diode (SPADs)/multi-pixel photon counters (MIPPCs) or a hyperspectral imager system/chip, which can then be coupled with a signal processing circuit (e.g., an analog-to-digital processing circuit) and then to a complementary metal-oxide-semiconductor integrated circuit or a microprocessor or the Super System on Chip 400A/400B/400C/400D or optically controlled Super System on Chip (the Super System on Chip 400A/400B/400C/400D or optically controlled Super System on Chip may include an intelligent algorithm 100Y). The optically controlled Super System on Chip includes Mach-Zehnder interferometers. Additionally or alternatively, this can be coupled/communicatively interfaced with an electronic integrated circuit, which may include one or more processing cores and memory units, wherein at least one of the processing cores and at least one of the memory units can be coupled in an intertwined geometrical architecture either in a two-dimensional arrangement or a three-dimensional arrangement, wherein at least one of one or more memory units can include one or more memory elements, wherein at least one of one or more memory elements can include one or more memory circuits. Further computation for accurate detection in-situ disease biomarkers can be realized in a cloud server by utilizing computer implementable instructions in artificial intelligence (artificial intelligence can be machine learning or artificial neural networks or deep learning) and/or evolutionary based algorithm, wherein the artificial neural networks may include a transformer model or a diffusion model (e.g., as generally described/illustrated in
[1530]
[1531]
[1532] The wearable personal health assistant device can also include a first active/passive patch with spiropyran to detect/treat blood sugar. The first active/passive patch can include polymeric nanoshells encapsulating insulin or long-acting insulin, wherein polymeric nanoshells disintegrate under light activation, after the read-out notification of blood sugar utilizing the first active/passive patch with spiropyran. The wearable personal health assistant device can also include a second patch (e.g., of silicone/hydrogel) with flexible metal wiresproducing ultrasound waves to detect blood pressure and other biological/health parameters in a noninvasive manner. The second patch second patch with flexible metal wiresproducing ultrasound waves to detect blood pressure can be replaced by capacitive micromachined ultrasonic transducers.
[1533] The wearable personal health assistant device can be coupled with an implanted device (e.g., in FIGS. 3B and 3C of U.S. non-provisional patent application Ser. No. 13/448,378 entitled SYSTEM AND METHOD FOR INTELLIGENT SOCIAL COMMERCE, filed on Apr. 16, 2012 (U.S. Pat. No. 9,697,556, issued on Jul. 4, 2017) and/or a bio-implanted/bio-indigested energy-efficient microscaled computer.
[1534] The bio-implanted/bio-indigested energy-efficient microscaled computer can include a photovoltaic cell, which can be electrically charged/powered by an external infrared illumining beam.
[1535] The bio-implanted/bio-indigested energy-efficient microscaled computer can also include a microscaled neural processor consisting of memristors/super memristors. Each super memristor can include (i) a resistor, (ii) a capacitor and (iii) a phase transition/phase change material based memristor.
[1536] A phase transition material based memristor can be electrically and/or optically controlled. But a phase change material based memristor can be electrically or optically controlled. Furthermore, each super memristor can be electrically/optically controlled.
[1537] The bio-implanted/bio-indigested energy-efficient microscaled computer can also include a bidirectional long-range antenna (for example a near field communication antenna) transmitting through flesh and skin.
[1538] The wearable personal health assistant device can be integrated with a pulse oximeter, an insertion socket (for the disposable diagnostic chip 1/disposable diagnostic chip 2), an ultrasensitive light detector (for fluorescence measurement), a wearable diagnostic device A and a wearable diagnostic device B.
[1539] The wearable personal health assistant device can be electrically coupled with a patch with spiropyran, passive patch, active patch, sensor and LifeSoC. An alarm can remind the user about potential mistakes/conflicts.
[1540] Furthermore, the wearable personal health assistant device can be electromagnetically coupled with a patch containing liposomes. Each liposome can encapsulate bioactive molecules/drugs (e.g., insulin/metformin) and magnetic nanoparticles. Upon heating by a high frequency and low intensity magnetic field, the liposome can undergo a phase change from solid to liquidthus releasing the bioactive molecules/drugs at a time t=0. But, when the high frequency and low intensity magnetic field is turned off, the lipids re-solidify due to reverse phase change, preventing any release of the bioactive molecules/drugs at a time t=t.
[1541] Furthermore, the high frequency and low intensity magnetic field can be turned on/off by a signal from a sensor to detect a particular disease (e.g., blood sugar measurement by the diagnostic device in
[1542] The wearable personal health assistant device can be integrated with a disposable surface acoustic wave chip, which can be decorated/functionalized with disease specific biomarker binders for biomarker. Upon biomarker-disease biomarker binder coupling on the surface acoustic wave chip, change in shear horizontal-surface acoustic wave (SH-SAW) can be measured to detect a disease.
[1543] The wearable personal health assistant device can be integrated with disposable field effect (nanowire) transistors to monitor binding in a completely label free bioassay. For example, peptide nucleic acid (PNA) functionalized silicon nanowires can be incubated with complementary microRNAs (targets) and changes in the resistivity of the silicon nanowires are monitored before and after the binding events. Peptide nucleic acid is deoxyribonucleic acid analogue in which the deoxyribose and phosphate backbone is replaced by a peptide bonding motif.
[1544] Details of the field effect (nanowire) transistor have been described/disclosed in U.S. non-provisional patent application Ser. No. 15/731,577 entitled BIOMODULE TO DETECT A DISEASE AT AN EARLY ONSET, filed on Jul. 3, 2017 and in its related U.S. non-provisional patent applications (with all benefit provisional patent applications) are incorporated in its entirety herein with this application.
[1545] The wearable personal health assistant device can be integrated with disposable indium oxide (In.sub.2O.sub.3) nanoribbon field effect transistors with gold side gate and electrodes decorated/functionalized with (a) an enzyme glucose oxidase, (b) a natural chitosan film and (c) single-walled carbon nanotubes. When glucose is present in sweat, it interacts with enzyme glucose oxidase-thus setting off a short chain of reactions and generating an electrical signal.
[1546] Alternatively, the wearable personal health assistant device can be integrated with disposable organic transistors containing a biomarker disease biomarker binder (e.g., glutathione (GSH)). When the organic transistors coupled/integrated with the disease biomarker binder is exposed to a biomarker (e.g., glutathione S-transferase (GST) associated with Alzheimer's, breast cancer and Parkinson's) creating a chemical reaction detected by the organic transistors.
[1547] Furthermore, the wearable personal health assistant device can be integrated with a disposable organic electrochemical transistors (OECTs) based biosensor decorated with an enzyme, wherein the enzyme is selectively sensitive to either cholesterol or glucose or uric acid.
[1548] Alternatively, the high density solid state storage device of the wearable personal health assistant device can be electrically coupled/integrated with a disposable complementary metal oxide semiconductor-electronic integrated circuit (CMOS-EIC), wherein aluminum (Al) metallization layers of the complementary metal oxide semiconductor-electronic integrated circuit wafer are encapsulated by silicon dioxide (SiO.sub.2)-planarized and then passivated by a layer of silicon nitride (SiNx) to reduce moisture/humidity related corrosion on aluminum metallization layers. Via holes are etched down to aluminum metallization layers. The complementary metal oxide semiconductor-electronic integrated circuit is coated with titanium/titanium nitride (Ti/TiN) barrier layer. Then via holes are filled with CVD tungsten (W). Tungsten is reactive ion etched up to the tungsten barrier layer. Then tungsten barrier layer is removed by reactive ion etching. A metal layer (e.g., titanium/platinum/gold (Ti/Pt/Au) with gold metallization on top) is lifted off only on tungsten.
[1549] The top metal layer provides a surface for immobilization/functionalization of disease biomarker binders (e.g., single stranded deoxyribonucleic acid and/or deoxyribonucleic acid origami based probe molecules (integrated with an antibody) or locked nucleic acid based probes). Furthermore, the top metal layer can be nanostructured (e.g., about 5 to 25 nanometers surface roughness) to enhance coupling of the disease biomarker binders-biomarkers.
[1550] It should be noted that microRNAs have a high degree of similarity between the sequences. Some microRNAs vary by a single nucleotide. Locked nucleic acid can be used to enhance the discriminatory power (of the primers and/or probes) to enable excellent discrimination of closely related microRNAs sequences. Locked nucleic acid offers significant improvement in sensitivity and specificity. MicroRNAs are pivotal regulators of cellular processes and cancer biomarkers. Among many methods, electrochemical biosensors have advantages, such as low-cost, small-size, simplicity of construction, ease of use, high sensitivity and selectivity of microRNAs. Their rapid detection at about 1 fM concentration detection limit is possible by Electrochemical Impedance Spectroscopy (EIS) at the electrode/electrolyte interface, (using positively charged gold nanoparticles coupled with disease specific microRNAs/deoxyribonucleic acids) or redox marker(s) or coupling base stacking technology with enzymatic amplification.
[1551] The structure of locked nucleic acid is given below. The ribose ring is connected by a methylene bridge between the 2-O and 4-C atoms thus, locking the ribose ring in the ideal conformation for Watson-Crick binding. When incorporated into deoxyribonucleic acid/ribonucleic acid oligonucleotide, locked nucleic acids make the pairing with a complementary nucleotide strand with speed and stability of the resulting duplex.
##STR00005##
[1552] The top metal layer can be integrated/included with an electrochemical sensor probe (e.g., [Ru(NH.sub.3).sub.6]3.sup.+).
[1553] Furthermore, the top metal layer can be integrated/included with (a) a joule heating element/micro Peltier element for the Recombinase Polymerase Amplification and (b) an agent for the Recombinase Polymerase Amplification.
[1554] Additionally, the Recombinase Polymerase Amplification can be modified by using electroactive/electrochemical active sequence-specific probes to increase the sensitivity electrical signals from the electrochemical sensor probe, upon the disease biomarker binder-biomarker (a biomarker(s) in plasma/serum/saliva) binding. By altering the Recombinase Polymerase Amplification reagent (e.g., a different primer to target a different nucleotide sequence) various applications are possible.
[1555] Furthermore, the addition of a lysis agent (e.g., guanidinium thiocyanate) on the metal layer can enable use of a biomarker(s) in whole blood, without the need of plasma or serum.
[1556] Upon the disease biomarker binder-biomarker binding and amplification, the amplified electrical signals from the electrochemical sensor probe can be detected by the complementary metal oxide semiconductor-electronic integrated circuit. Furthermore, the disposable complementary metal oxide semiconductor-electronic integrated circuit wafer can be replaced by a disposable wafer of silicon-germanium, if a cost is not an issue.
[1557] Furthermore, the disposable complementary metal oxide semiconductor-electronic integrated circuit based diagnostic device can be a standalone diagnostic device.
[1558] Alternatively, a biocompatible substrate (e.g., quartz) with an array of avidin molecules, wherein each avidin molecule is chemically coupled with a biotin molecule, wherein each biotin molecule is chemically coupled with a particularly suitable length poly(ethylene glycol) (PEG) strand, wherein each poly(ethylene glycol) is chemically coupled with a hairpin shaped molecular beacon (MB) or a hairpin shaped locked molecular beacon (LMB) (incorporating locked nucleic acids, a fluorophore and a quencher). Alternatively, the biocompatible substrate can include an array of deoxyribonucleic acid origami based binding sites, utilizing a diamond-like carbon/trimethylsilyl manolayer as a foundation monolayer. The foundation monolayer can be processed into suitable binding sites by (a) electron beam lithography, (b) reactive ion etching, (c) oxygen plasma or ultraviolet-ozone exposure and (d) 100 mM MgCl.sub.2 treatment.
[1559] Furthermore, binding sites can be preciously positioned utilizing the artificial zinc-finger proteins (ZFPs). Generally, the artificial zinc-finger proteins can bind to a wide variety of deoxyribonucleic acid sequences. SNAP-tag is a self-labeling protein tag available in various expression vectors. The deoxyribonucleic acid-binding artificial zinc finger adaptor with SNAP-tag can enable site-selective and efficient assembly of target protein of interest.
[1560] Upon binding with a complementary biomarker target, the fluorophore and the quencher of the hairpin shaped molecular beacon or hairpin shaped locked molecular beacon are physically separatedcreating an ON (fluorescence) state from a generally OFF (non-fluorescence) state.
[1561] Furthermore, to enhance the fluorescence signal, each avidin-biotin-poly(ethylene glycol)-hairpin shaped molecular beacon/hairpin shaped locked molecular beacon based molecular system (within a biosensing pixel) can be positioned horizontally relative to an open space of a three-dimensional protruded structure.
[1562] Additionally, the three-dimensional protruded structure can be integrated with a whispering gallery mode microscaled/nanoscaled resonator(s) with a pass-through optical waveguide for significantly higher detection sensitivity due to change in transmission wavelength (through the optical waveguide) when (a) the whispering gallery mode microscaled/nanoscaled resonator (e.g., circular shaped/disk shaped/toroidal shaped resonator) is functionalized with disease specific biomarker binders with respect to (b) upon disease specific biomarker binders-biomarkers binding. Furthermore, the whispering gallery mode microscaled/nanoscaled resonator(s) with a pass-through optical waveguide can be fabricated/constructed on a hyperbolic metamaterial surface (as illustrated for example, in
[1563] Details of a three-dimensional protruded structure have been described/disclosed in U.S. non-provisional patent application Ser. No. 15/731,577 entitled BIOMODULE TO DETECT A DISEASE AT AN EARLY ONSET, filed on Jul. 3, 2017 and in its related U.S. non-provisional patent applications (with all benefit provisional patent applications) are incorporated in its entirety herein with this application.
[1564] Additionally, each biosensing pixel can include one or more molecular systems.
[1565] Each biosensing pixel can be electro-optically coupled with a complementary metal oxide semiconductor image read-out pixel of a complementary metal oxide semiconductor imaging-electronic integrated circuit wafer.
[1566] As an example, co-packaged system (of biopixels and complementary metal oxide semiconductor imaging-electronic integrated circuits) can include the following stepsSeparating/dicing of a single (complementary metal oxide semiconductor imaging-electronic integrated) die from a complementary metal oxide semiconductor imaging-electronic integrated circuit wafer (e.g., about 6 to 12 inches in diameter wafer). Mounting the above single die on another substrate. Passivating the active surface of the above single die. Patterning the active surface of the above single die into an array of optically transparent spots. Functionalizing each optically transparent spots with disease specific biomarker binders (e.g., hairpin shaped locked molecular beacons or molecular beacons). Washing/preparing surface, if needed. Attaching a removable optical excitation subsystem. Attaching a biofluidic container and/or a separate device to provide isolated specific microRNAs and/or attaching a nanohole based deoxyribonucleic acid sequencing device. It should be noted that the above following steps can be modified, if needed.
[1567] Details of a biofluidic container (to provide a biomarker fluid), a separate device (to provide isolated specific microRNAs from exosomes) and a nanohole based deoxyribonucleic acid sequencing device have been described/disclosed in U.S. non-provisional patent application Ser. No. 15/731,577 entitled BIOMODULE TO DETECT A DISEASE AT AN EARLY ONSET, filed on Jul. 3, 2017 and in its related U.S. non-provisional patent applications (with all benefit provisional patent applications) are incorporated in its entirety herein with this application.
[1568] Alternatively, an electrical power can be wirelessly transmitted to a LED pixel and a glucose sensor (e.g., a graphene based glucose sensor) on the wearable personal health assistant device through an antenna on the wearable personal health assistant device. This electrical power can activate the LED pixel and the glucose sensor. The LED glows in the normal range of glucose condition. The LED turns off in the high level of glucose condition.
[1569] A hydrogel containing pluronic acid with genetically programmed living cells (e.g., genetically programmed bacteria), responding to respond to certain stimuli (molecules) can be utilized as three-dimensional printing ink for a disposable three-dimensional structure (e.g., a tattoo). The wearable personal health assistant device can be integrated with a disposable three-dimensional structure to sense variety of stimuli (molecules) on sweat on skin.
[1570] The key components of the wearable personal health assistant device are listed below:
TABLE-US-00010 Low Power Processor Digital Memory Operating System Algorithm Wrap-around Display High Density Solid State Data Storage Microphone Proximity Radio * (Near Field Communication/Bluetooth LE) TxRx Universal Communication Interface Electrical Powering Device (Solar Cell + Battery + Ultracapacitor) Ultrasensitive Light Detector
[1571] A universal communication interface can integrate animation, animated GIF, drawings, emotions, gestures (hand/eye), location data, text, voices, voice snippets and videos.
[1572] The universal communication interface can be further enhanced by Fazila as described/illustrated in
[1573] The micro-USB port can enable transfer of encrypted and public/consortium/private blockchain coupled personal health records, stored in the high density solid state storage device. The disposable diagnostic chip 1/disposable diagnostic chip 2 can be inserted into the insert socket for detection and analysis of fluorescence.
[1574]
[1575] With wiring, a small electrical current can be applied to the skin, along with pilocarpine (drug) to induce the skin to sweat for analysis by a wearable diagnostic device A.
[1576] Details of a wearable diagnostic device A, wearable diagnostic device B, patch with spiropyran, passive patch and active patch will be described later.
[1577] An array of sensors can be fabricated/constructed at the edge of the flexible substrate.
[1578] The bioobject(s) 120B can be integrated with a LifeSoC, multichip module electronics to collect reliable signals from the bioobject(s) 120B. Details of LifeSoC are illustrated in
[1579]
[1580] Details of LifeSoC have been described/disclosed in non-provisional patent application Ser. No. 14/120,835 entitled CHEMICAL COMPOSITION & ITS DELIVERY FOR LOWERING THE RISKS OF ALZHEIMER'S, CARDIOVASCULAR AND TYPE-2 DIABETES DISEASES, filed on Jul. 1, 2014 and in its related U.S. non-provisional patent applications (with all benefit provisional patent applications) are incorporated in its entirety herein with this application.
[1581] Biomarkers contained in sweat can give indications about the physical state of the body. They include electrolytes (e.g., calcium, chloride, potassium and sodium), metabolites (creatinine, glucose, lactate and uric acid), proteins (interleukins, neuropeptides and tumor necrosis factor) and small molecules (amino acids, cortisol and DHEA).
[1582]
[1583]
[1584]
[1585]
[1586]
[1587] Details of the body patch have been described/disclosed in U.S. non-provisional patent application Ser. No. 14/120,835 entitled CHEMICAL COMPOSITION & ITS DELIVERY FOR LOWERING THE RISKS OF ALZHEIMER'S, CARDIOVASCULAR AND TYPE-2 DIABETES DISEASES, filed on Jul. 1, 2014 and in its related U.S. non-provisional patent applications (with all benefit provisional patent applications) are incorporated in its entirety herein with this application.
[1588] The input of the microfluidic channels in
[1589]
[1590] If UV light is beamed through spiropyran, the chemical structure of spiropyran is charged (polar) and open structureenabling more glucose molecules to diffuse through the first layer from skin. If irradiated with visible light, the chemical structure of spiropyran reverts back to normal/closed structureenabling fewer glucose molecules to diffuse to the first layer from skin. By comparing the optical spectrum taken under UV light against the optical spectrum taken under visible light, glucose in blood can be quantified. By embedding other molecular sensors in the second layer, other biomarkers/analytes (e.g., creatinine and electrolytes) in blood can also be quantified. This method to measure blood sugar in-situ can be integrated with the wearable diagnostic device A.
[1591]
[1592] Hydrogels embedded with glucose sensors (e.g., boronic acid) are a second layer. The second layer is attached onto the first layer.
[1593] If UV light is beamed through spiropyran, the chemical structure of spiropyran is charged (polar)/open structureenabling more glucose to diffuse to the first layer from the outer most layer of skin/skin. If visible light is beamed through spiropyran, the chemical structure of spiropyran reverts back to normal/closed structureenabling less glucose to diffuse to the first layer from the outer most layer of skin/skin. By comparing optical spectra taken under UV and visible light, glucose in blood can be quantified. Additionally, by embedding suitable molecular sensors in the second layer, other analytes (e.g., creatinine and electrolytes) in blood can be quantified.
[1594] Alternatively, only the porous membrane spiropyran (the first layer) can be utilized. If UV light is beamed through spiropyran, the chemical structure of spiropyran is charged (polar)/open structureenabling more glucose to diffuse to the first layer from the outer most layer of skin/skin and glucose can then be quantified by a Raman spectrophotometer. Raman spectra is induced by a laser and propagated through an optical beam splitter, collimating lens, hyperbolic metal concentrator, an optical filter and focusing lens to the Raman spectrophotometer. The hyperbolic metal concentrator can be utilized to collect scattered photons. Raman measurements can be calibrated with other direct blood sugar measurements. An algorithm can be utilized with the Raman spectrophotometer to correct for any concentration and time lag effects. Thus, a look up table and/or algorithm can enable continuous/quasi-continuous in-situ blood sugar measurement.
[1595] Furthermore, the two-layer patch can include nanoshells (e.g., polymeric nanoshells) encapsulating insulin molecules/long acting insulin molecules, wherein the nanoshells can disintegrate upon light activation. Thus, this will enable to deliver insulin molecules/long acting insulin molecules from the two-layer patch.
[1596] Additionally, the two-layer patch (including nanoshells encapsulating insulin molecules/long acting insulin molecules) in
[1597]
[1598]
[1599] Alternatively, a porous membrane with a biocompatible needle can be utilized to create a microscopic pore at the outermost layer (e.g., about 20 microns in depth) of skin for interstitial fluid to cross the outer skin barrier. Glucose in interstitial fluid can be converted into hydrogen peroxide by glucose oxidase. Hydrogen peroxide can chemically react with horseradish peroxidase to generate colored liquid resorufin, which absorbs/emits red light. The optical signature of resorufin is a measure of glucose in human blood and it can be quantified by Raman spectrophotometer/optical coherence tomography/plasmonic interferometer/spectrophotometer/(organic light emitting diode or ultrasensitive detector of the wearable personal health assistant device).
[1600] Alternatively, hydrogels (integrated with embedded photonic crystals), a pre-shrink chemical compound (e.g., polyvinyl alcohol) and a glucose binding chemical compound (e.g., boronic acid) with a biocompatible needle can be utilized to create a microscopic pore at the outermost layer (e.g., about 20 microns in depth) of skin for interstitial fluid to cross the outer skin barrier. Glucose in interstitial fluid can bind with the glucose binding chemical compound-thus changing arrangement of the photonic crystals and shifting the spectrum of the reflected light from the organic light emitting diode. Such a configuration can be incorporated with the wearable personal health assistant device.
[1601]
[1602] The smart nanoshell can be of any shape and built by deoxyribonucleic acid origami method.
[1603] The bioactive compound can also mean RNA-i, engineered riboswitch and synthetic notch molecule.
[1604] Smart nanoshells can be stored in a biocompatible reservoir (e.g., a microelectromechanical system biocompatible reservoir) and their movement from the biocompatible reservoir can be controlled by a micropump. Smart nanoshells have to meet a suitable external condition(s) and/or couple with a specific receptor(s) to release a bioactive compound.
[1605] For example, the smart nanoshell can be made of water-fearing molecules (pointing inward) and water-loving molecules (pointing outward). The smart nanoshell can encapsulate insulin molecules/long acting insulin molecules. The external surface of the smart nanoshell can be coupled with an enzyme to convert glucose into gluconic acid. In the presence of excess glucose, the enzyme (converting glucose into gluconic acid) creates a lack of oxygen and causes water-loving molecules (pointing outward) to collapseenabling the delivery of insulin/long acting insulin/smart insulin at a suitable external condition.
[1606] In another example, a smart nanoshell (fabricated/constructed by deoxyribonucleic acid origami) can be decorated with an aptamer/engineered riboswitch based (excess) glucose sensor. In the presence of excess glucose, the smart nanoshells can collapseenabling the delivery of insulin/long acting insulin/smart insulin at a suitable external condition.
[1607] Smart insulin can be Ins-PBA-F, which can consist of a long-acting insulin derivative that has a chemical moiety with phenylboronic acid added at one end. Under normal conditions, smart insulin can bind with serum proteins (circulating in blood). In the presence of excess glucose, it can bind with phenylboronic acid to release Ins-PBA-F.
[1608] In another example, a smart nanoshell (fabricated/constructed by deoxyribonucleic acid based origami) can be decorated with an aptamer/engineered riboswitch to detect cancer cells. In the presence of cancer cells, the smart nanoshell can collapseenabling the delivery of a synthetic notch molecule/engineered riboswitch to activate a T cell.
[1609] In another example, resembling a biological cell, a synthetic cell (e.g., a lipid-based synthetic cell) can sense, when integrated with a synthetic deoxyribonucleic acid template within the natural membrane of a biological tissue (e.g., a cancer tissue) to activate/produce a therapeutic/diagnostic proteindictated by the integrated synthetic deoxyribonucleic acid template and/or activate a gene, when integrated with a gene enhancer switch molecule (a short segment of deoxyribonucleic acid chemically coupled by a specialized protein (e.g., a transcription factor)).
[1610] Furthermore, the synthetic cell can integrate an anticancer bioactive compound and/or a smart molecule, wherein the smart molecule can chemically bind with one or more binding centers on a cell within the biological tissue. A binding center may represent either a disease specific binding center or a disease stage specific binding center.
[1611]
[1612] Details of the smart nanoshells and the wearable diagnostic device B have been described/disclosed in U.S. non-provisional patent application Ser. No. 13/663,376 entitled CHEMICAL COMPOSITION & ITS DELIVERY FOR LOWERING THE RISKS OF ALZHEIMER'S, CARDIOVASCULAR AND TYPE-2 DIABETES DISEASES, filed on Oct. 29, 2012 and in its related U.S. non-provisional patent applications (with all benefit provisional patent applications) are incorporated in its entirety herein with this application.
[1613]
[1614]
[1615]
[1616]
[1617]
[1618]
[1619]
[1620] For example, the bioactive compound 2-(4-morpholinoanilino)-6-cyclohexylaminopurine or phenanthriplatin can induce death of a cancer cell selectively.
[1621] Similarly, the bioactive compound Lomaiviticin A can induce cell death of a cancer cell selectively, by cleaving a cancer cell's deoxyribonucleic acid structure. Furthermore, a structural/chemical analogue of Lomaiviticin A can also be utilized. The structure of Lomaiviticin A is given below.
##STR00006##
[1622] Additionally, the smart nanoshell/benign plant virus can be functionalized to evade the immune system.
[1623] Green tea-derived nanocomplex micelles, self-assembled from epigallocatechin-3-O-gallate (EGCG) derivatives can be utilized as a safer smart nanoshell.
[1624] Details of the functionalized nanoshell have been described/disclosed in U.S. non-provisional patent application Ser. No. 13/663,376 entitled CHEMICAL COMPOSITION & ITS DELIVERY FOR LOWERING THE RISKS OF ALZHEIMER'S, CARDIOVASCULAR AND TYPE-2 DIABETES DISEASES, filed on Oct. 29, 2012 and in its related U.S. non-provisional patent applications (with all benefit provisional patent applications) are incorporated in its entirety herein with this application.
[1625] A glutathione-capped water-soluble biocompatible quantum dot (e.g., including silica-coated nanocomposites) can be utilized as a fluorophore (chemically coupled with the smart nanoshell/benign plant virus) for vivo and bioimaging applications.
[1626] Additionally, selenohydantoins or a structural/chemical analogue of selenohydantoins encapsulated in a smart nanoshell can be utilized as an anticancer bioactive compound. The structure of selenohydantoins is given below.
##STR00007##
[1627] The structure of selenohydantoins is given above. Additionally, selenohydantoins or a structural/chemical analogue of selenohydantoins encapsulated in a smart nanoshell can be utilized as an anticancer bioactive compound.
[1628]
[1629] In the case of the engineered riboswitch, the gene can be turned on and off with a small inducer molecule. Thus, human cells can be programmed/reprogrammed with the engineered riboswitch to manufacture a specific protein only when a person takes a pill (containing the small inducer molecule), otherwise it is neutral or non-programmed.
[1630] In the case of the synthetic notch signaling molecule, the genome can be turned on and off. However, a gene can mean either natural or edited gene.
[1631]
[1632] The segment A has a donor fluorophore and the segment B has an acceptor fluorophore. The donor fluorophore can be about 2 nanometers to 10 nanometers apart from the acceptor fluorophore. The segment A of the disease biomarker binder (e.g., first molecular beacon/first deoxyribonucleic acid based origami probe coupled with a donor fluorophore) couples (e.g., chemically couples/binds) with a section of the biomarker. Similarly, the segment B of the disease biomarker binder (e.g., second molecular beacon/second deoxyribonucleic acid based origami probe coupled with a receptor fluorophore) couples (e.g., chemically couples/binds) with another section of the biomarker. Alternatively, the segment B of the disease biomarker binder can couple with segment A of the disease biomarker binder and this strategy may work better for the biomarker of small molecular size (e.g., in the case of exosomes/microRNAs).
[1633] For example, segment A can be
TABLE-US-00011 (SEQ.IDNO.1) GCTGTTGCTGGGAGCTGTTCTACTG/3ATTO565N.
[1634] For example, segment B can be
TABLE-US-00012 (SEQ.IDNO.2) 5ATTO647N/TAGCTCTGCCCGGTCATGA.
[1635] For example, DNA template to which both segment A and segment B to couple can be
TABLE-US-00013 (SEQ.IDNO.3) GGCCCTTGAGTCGTGGTTTCCTGGTCATGACCGGGC AGAGCTAATAGCAGTAGAACAGCTCCCAGCAACAGC ATCCTGAGCCCTGATGTCAGGAGTTTCA.
[1636] Furthermore, segment A can include a metallic (e.g., gold/silver) nanoparticle and segment B can also include a metallic (e.g., gold/silver) nanoparticle.
[1637] The donor fluorophore/acceptor fluorophore can consist of inner spherical metal (e.g., silver), followed by spherical dielectric (e.g., silica) spacer and then followed by dye doped dielectric (e.g., silica).
[1638] In close proximity between the donor fluorophore and acceptor fluorophore, there is detectable Frster/Fluorescence Resonance Energy Transfer. The emitted fluorescence wavelength from the acceptor fluorophore is distinct from the excitation laser wavelength. The emitted fluorescence wavelength from the acceptor fluorophore can be utilized to identify the presence of the biomarker (e.g., microRNA of a particular cancer cell) at a very early stage of disease progression.
[1639] Furthermore, the donor fluorophore and/or acceptor fluorophore can be very long-lived fluorophores (e.g., europium ions)
[1640] For example, the segment A of the disease biomarker binder can be the first half of a molecular beacon. The segment B of the disease biomarker binder can be a second half of a molecular beacon. The segment A and the segment B can be separated by a spacer molecule. The segment A can bind only onto a certain fragment of a biomarker (e.g., a miRNA). The segment B can bind only onto a certain fragment of the above biomarker.
[1641] Additionally, a semiconductor quantum dot (SQD), an upconversion nanoparticle, (UCNP), a graphene quantum dot (GQD) and a suitable material can act as an efficient donor and/or acceptor replacing a fluorescent organic dye molecule. Furthermore, p19 protein-conjugated donor/acceptor may be utilized.
[1642] Additionally, a microresonator-barium titanate/polystyrene divinylbenzene (PS-DVB) microsphere filled with a fluorescent protein (e.g., a green fluorescent protein) can be coupled with the donor as an in-situ biological laser (when excited by an external light source (optical pump)).
[1643] Furthermore, the microresonator can include or couple with one or more nano optical element/antennas (represented by ) to enhance light matter interaction.
[1644] A special case of the disease biomarker binder can be a nanoscaled molecularly imprinted synthetic polymer with a three-dimensional structure to bind only onto a certain fragment of a biomarker. The nanoscaled molecularly imprinted synthetic polymer can be loaded with one or more bioactive compounds.
[1645]
[1646] The gap defined by at least a nano optical element/antenna (represented by ) can be fabricated/constructed with a metamaterial of a special property (e.g., epsilon-near-zero (ENZ) at a particular wavelength range).
[1647] For example, a metamaterial with epsilon-near-zero in the visible wavelength range can be realized by 4 pairs of 18 nanometers Au layer and 81 nanometers Al.sub.2O.sub.3 layer or alternatively, 13 pairs of 20 nanometers Au layer and 80 nanometers SiO.sub.2 layer.
[1648] However, instead of the entire substrate coated with antibodies against a particular type of diseased cells, a relevant section of the substrate (e.g., within a gap defined by at least a nano optical element/antenna (represented by )) or the metamaterial of a special property can be coated with antibodies against a particular type of diseased cells to capture the particular type of diseased cells efficiently.
[1649] However, instead of the entire substrate coated with antibodies against a particular type of diseased cells, a relevant section of the substrate (e.g., within a gap defined by at least a nano optical element/antenna (represented by )) or the metamaterial of a special property can be fabricated/constructed with one or more dielectric (e.g., silica/polymer) nanowires, wherein each dielectric nanowire can be coated with antibodies against a particular type of diseased cells to capture the particular type of diseased cells efficiently.
[1650] Furthermore, the nano optical element/antenna (represented by ) can be caged within a bounded (semi-closed/closed) nanostructure (of dielectric/metal/refractory metal) to reduce the background signal. For example, such a bounded (semi-closed/closed) nanostructure is illustrated in
[1651] The nano optical element/antenna (represented by ) can be fabricated/constructed of single crystalline/polycrystalline material. The nano optical element/antenna (represented by ) can include a fractal geometrical design or optically couple with an index matching liquid. The nano optical element/antenna (represented by ) can be fabricated/constructed of a metal/refractory material or a two-dimensional material (e.g., argentine/graphene) or a combination of a metal and a refractory material (e.g., titanium nitride-gold). Furthermore, Langmuir-Blodgett deposited (one/two-dimensional) array of nanoparticles or a nano optical element/antenna (represented by ) can be coupled with a (colloidal) photonic crystal(s).
[1652] The nano optical element/antenna (represented by ) can be fabricated/constructed on a substrate of the biological wafer, wherein the substrate of the biological wafer can include one or more materials.
[1653] The substrate can be entirely coated with antibodies against a particular type of diseased cells to capture the particular type of diseased cells. For example, glycoprotein is present on the surfaces of cancer cells.
[1654] The substrate can be selectively coated in the proximity of the nano optical element/antenna (represented by ) with antibodies against a particular type of diseased cells to capture the particular type of diseased cells.
[1655] For example, one or more materials can be an ultrathin-film (e.g., about 50 to 200 nanometers in thickness) of an insulator, wherein the ultrathin-film insulator is then deposited on an ultrathin-film (e.g., about 50 to 200 nanometers in thickness) of a metal, wherein the ultrathin-film metal is then deposited on the substrate of the biological wafer (which can include one or more materials). For example, one or more materials can be a metamaterial. Additionally, one or more materials can be a metamaterial of epsilon-near-zero (ENZ) (with respect to the range of the excitation and emission wavelength in Frster/Fluorescence Resonance Energy Transfer).
[1656] For example, but not limited to, a metamaterial of epsilon-near-zero is fabricated/constructed utilizing a multilayer (e.g., about 5 layers) of an ultrathin-film (e.g., about 40 to 150 nanometers in thickness) of metal-silver and an ultrathin-film (e.g., about 35 to 135 nanometers in thickness) of insulator-silicon nitride.
[1657] For example, but not limited to, a metamaterial of epsilon-near-zero is fabricated/constructed utilizing a multilayer (e.g., about 5 layers) of an ultrathin-film (e.g., about 20 to 30 nanometers in thickness) of metal-silver and an ultrathin-film (e.g., about 45 to 75 nanometers in thickness) of insulator-titanium dioxide.
[1658] Furthermore, an ultrathin-film of metal silver can be replaced by graphene.
[1659] It should be noted that, the substrate of the biological wafer can be a membrane substrate (e.g., an ultrathin-film insulator on an etched back silicon membrane) to reduce proximity effect of electron beam lithography in order to define a dimension of less than 10 nanometers.
[1660] It should be noted that (a) sub-10 nanometers gap between the nano optical element/antenna, (b) orthogonal coupling, (c) a substrate of a metamaterial/metamaterial of epsilon-near-zero and (d) a substrate of a high ratio of real-to-imaginary refractive index/permittivity individually or collectively in combination can affect Frster/Fluorescence Resonance Energy Transfer-resulting in stronger fluorescence intensity of the acceptor. Such stronger fluorescence intensity of the acceptor can be detected by an electron-multiplying charged coupled device camera or an equivalent detector.
[1661] Details of the nano optical element/antenna, compositions of the nano optical element/antenna, sub-10 nanometers lithography and substrate of one or more materials have been described/disclosed in U.S. non-provisional patent application Ser. No. 15/731,577 entitled OPTICAL BIOMODULE FOR DETECTION OF DISEASES AT AN EARLY ONSET, filed on Jul. 3, 2017 and in its related U.S. non-provisional patent applications (with all benefit provisional patent applications) are incorporated in its entirety herein with this application.
[1662]
[1663] The gap around the metal nanoparticle can be fabricated/constructed with a metamaterial of a special property (e.g., epsilon-near-zero (ENZ) at a particular wavelength range).
[1664] For example, a metamaterial with epsilon-near-zero in the visible wavelength range can be realized by 4 pairs of 18 nanometers Au layer and 81 nanometers Al.sub.2O.sub.3 layer or alternatively, 13 pairs of 20 nanometers Au layer and 80 nanometers SiO.sub.2 layer.
[1665] However, instead of the entire substrate coated with antibodies against a particular type of diseased cells, the metamaterial (of a special property) can be coated with antibodies against a particular type of diseased cells to capture the particular type of diseased cells.
[1666]
[1667] An application of the device illustrated in
[1668]
[1669]
[1670]
[1671]
[1672]
[1673] The sensing arm of the asymmetric Mach-Zehnder interferometer can include disease biomarker binders (for coupling with biomarkers via a microfluidic device, wherein the microfluidic device can deliver whole blood/plasma/serum/saliva).
[1674] The phase difference A(D between two arms =(2*L/)*(N.sub.SensN.sub.Ref). is the operating wavelength. L is the length of sensing length. N.sub.sen is the refractive index of the sensing arm. N.sub.Ref is the refractive index of the reference arm.
[1675] There may be false positive reading due to (i) signal ambiguity, (ii) intensity variation and (iii) sensitivity fading. Wavelength modulation can solve problems due to the periodic nature of signal from the asymmetric Mach-Zehnder interferometer. The intensity variation can be monitored by extracting the reference optical signal of the asymmetric Mach-Zehnder interferometer. The disease biomarker binder-biomarker coupling can be unambiguously determined label free by Fast Fourier Transform (FFT) of the normalized output signal (utilizing raw output signal and reference output signal), for example, inverse tangent of the ratio between a third harmonic and second harmonic.
[1676] It should be noted that integrating a first variable attenuator on the sensing arm and/or a second variable attenuator on the reference arm of the asymmetric Mach-Zehnder interferometer can enhance the extinction ratio of the asymmetric Mach-Zehnder interferometer.
[1677] It should be noted that one or more ring resonators, optically coupled with the sensing arm of the asymmetric Mach-Zehnder interferometer can enhance sensitivity.
[1678] Alternatively, a trench-based asymmetric Mach-Zehnder interferometer can enhance sensitivity.
[1679] Furthermore, a slow light one-dimensional/two-dimensional photonic crystal (e.g., air holes of period of about 350 nanometers, wherein each air hole can be either circular or rectangular in shape. The circular air hole can be about 125 nanometers in diameter or rectangle of 200 nanometers by 300 nanometers in dimension) based Mach-Zehnder interferometer can enhance sensitivity. A two-dimensional photonic crystal is illustrated in
[1680] The asymmetric Mach-Zehnder interferometer can be arrayed (in one-dimension or two-dimension) on a planar surface to enable a multiplexed device for biological sensing of multiple biomarkers.
[1681] Alternatively, one or more whispering gallery mode based resonators (wherein each whispering gallery mode resonators has a quality factor of about 10.sup.8 can be utilized as a standalone device, instead of the asymmetric Mach-Zehnder interferometer.
[1682] Alternatively, a photonic crystal nanolaser (for example as illustrated in
[1683] Alternatively, a field effect (nanowire) transistor can be utilized as a standalone device, instead of the asymmetric Mach-Zehnder interferometer. This embodiment has been described/disclosed in FIGS. 13C, 13D and 13E of U.S. non-provisional patent application Ser. No. 14/120,835 entitled CHEMICAL COMPOSITION & ITS DELIVERY FOR LOWERING THE RISKS OF ALZHEIMER'S, CARDIOVASCULAR AND TYPE-2 DIABETES DISEASES, filed on Jul. 1, 2014 and in its related U.S. non-provisional patent applications (with all benefit provisional patent applications).
[1684] Furthermore, the surface of nanowire of the field effect (nanowire) transistor can be nanostructured (e.g., about 5 to 25 nanometers surface roughness) to enhance coupling of the disease biomarker binders-biomarkers.
[1685]
[1686]
[1687]
[1688] The microfluidic based microRNA capture system can be integrated with embodiments described in 57I/57J/57K.
[1689]
[1690] The two-dimensional array of nanowaveguides is within a flow cell. At least one protruded metal/non-metal nano optical antenna (
[1691] Incident light from only one laser of an array of lasers (e.g., emitting in a visible wavelength rangetypically at 470/530/640 nanometers) via an optical column can excite a fluorophore (fluorescence can be due to chemical coupling/interaction between a disease biomarker binder and a biomarker, wherein the biomarker is chemically coupled with the fluorophore).
[1692] The optical column with an objective lens can be positioned by a precision positioning system from one nanowaveguide to the next, as the center to center distance between nanowaveguides can be larger than the diameter of the nanowaveguide. A dichroic mirror can separate the optical paths of the incident light and fluorescence light. Fluorescence light can be demultiplexed by a color splitter and then focused by a lens onto an ultrasensitive optical detector (e.g., an electron multiplying charged coupled detector/single photon avalanche diode).
[1693] Instead of scanning with a single (continuous wave/pulsed/ultrashort pulsed) laser, two lasers can be utilized simultaneously. In the first instant a typical laser is using an appropriate wavelength to excite a material. In the second instant is a key second laser, which is focused so that it produces a donut of light overlapping the focal point of the first laser. This configuration can enable the laser to focus below the Abbey's diffraction limit for high resolution fluorescence.
[1694] The nanowaveguide with an integrated protruded metal/non-metal nano optical antenna can allow a single molecule to be isolated for enhanced fluorescence detection at a high concentration. Surface adsorption and appropriate concentration can enable just one molecule in one nanowaveguide. The advantages of the early diagnostic system A are (a) ultimate sensitivity down to the single molecule level, (b) no amplification induced false positive data and (c) small sample volume.
[1695] Key fabrication/construction steps of the nanowaveguide with integrated protruded metal/non-metal nano optical antenna on a transparent substrate (e.g., 100 millimeters in diameter and 175 microns in thickness glass) are: (1) deposition and removal of silicon nitride or silicon oxynitride in the selected places, (2) electron beam lithography and lift off of protruded metal (e.g., aluminum/copper/gold/silver) or non-metal nano optical antenna on silicon nitride or silicon oxynitride, (3) electron beam lithography and protection of protruded metal/non-metal nano optical antenna, (4) electron beam lithography of nanowaveguide (utilizing a negative tone process) and lift-off of metal (e.g., aluminum/copper/gold/silver or a combination of aluminum, copper, gold and silver) nanowaveguide, (5) removal of all photoresists, (6) passivation on the walls of nanowaveguide by a biological material (e.g., polyethylene glycol) to increase single molecule occupancy level within the nanowaveguide and (7) dicing of the wafer into chip A.
[1696] Furthermore, the nanowaveguide can be fabricated/constructed as a zero-mode optical waveguide.
[1697]
[1698] Deoxyribonucleic acid based origami chemically coupled with a fluorophore can be positioned at a precise location within the gap of protruded metal/non-metal nano optical antennas utilizing electron-beam lithography to etch a sticky binding site that has a complementary shape of origami chemically coupled with a fluorophore.
[1699]
[1700]
[1701] Alternatively, a hyperbolic metamaterial of alternating titanium nitride metal and aluminum scandium nitride insulator, each is about 5 to 20 nanometers in thickness can be utilized. Alternatively, a hyperbolic metamaterial that includes only insulator can also be utilized.
[1702]
[1703] Additionally, any protruded metal/non-metal nano optical antenna (designated as ) can be placed on the hyperbolic metamaterial (designated as .sub.1). This configuration can enable enhanced fluorescence, when the fluorophore is within or near the gap of the protruded metal (e.g., aluminum/copper/gold/silver) or non-metal nano optical antenna (as illustrated in
[1704] In one embodiment, a transparent glass/silicon dioxide (SiO.sub.2) substrate can be selectively deposited with silicon nitride (SiNx) or silicon oxynitride (SiONx) except in the gap of the protruded metal/non-metal nano optical antenna (as illustrated in
##STR00008##
[1705] Additionally, the antibody/aptamer/molecular beacon/leave-out protein can be chemically coupled with a molecule (e.g., biotin), which can then chemically bind with a biomolecule of interest.
[1706] In another embodiment, a transparent glass/silicon dioxide (SiO2) substrate can be selectively deposited with gold in the gap of the protruded metal (e.g., aluminum/copper/gold/silver) nano optical antenna (as generally illustrated as metal/non-metal nano optical antenna in
[1707] Additionally, the amino group of the protein can be chemically coupled with a molecule (e.g., biotin), which can then chemically bind with a biomolecule of interest.
[1708]
[1709]
[1710]
[1711]
[1712]
[1713]
[1714] The protruded metal/non-metal nano optical antennas 1, 2, 3, 4 and 5 can be enclosed within an open nanoscaled box (
[1715] The protruded metal/non-metal nano optical antennas 1, 2, 3, 4 and 5 can be enclosed within a closed nanoscaled box (
[1716]
[1717] Alternatively, to the molecular beacon, a fluorescent protein/deoxyribonucleic acid origami based structure with a fluorophore (e.g., quantum dot/polymeric fluorophore) is split into two fragments-A & B. A is attached to a set of nanoparticles (e.g., gold) to bind on a first set of specific biomarkers at a cell surface. B is attached to a set of nanoparticles (e.g., gold) to bind on a second set of specific biomarkers at a cell surface. As two fragments-A & B collide on a specific disease cell (e.g., a cancer cell), they naturally reassemble into the whole fluorescent protein or the integrated deoxyribonucleic acid origami based structure with a fluorophore for detection by a fluorescence spectrophotometer or a Raman spectrophotometer.
[1718] As an example, the early diagnostic system A or early diagnostic system B can detect Ciz1 protein or its variants (e.g., b-variant), which are prevalent in the blood of people with early stage lung cancer. Inhibiting Ciz1 protein or its variants by a targeted delivery of a specific small interfering RNA or synthetic notch molecule by the smart nanoshell (decorated with one or more receptor binding ligands) can limit the growth of lung cancer. The smart nanoshell can be coupled with a near-infrared fluorophore (e.g., quantum dot/polymeric fluorophore) for fluorescence detection-enabling visualization of accumulation of smart nanoshells at lung cancer cells.
[1719]
[1720] At a zone of Raman measurement, a protruded metal/non-metal nano optical antenna can be fabricated/constructed to enhance the Raman signal. The top metal of a protruded metal/non-metal nano optical antenna can be coated with 1.5 nanometers thick aluminum oxide (utilizing atomic layer deposition) prior to transferring graphene onto aluminum oxide, utilizing poly(methyl methacrylate) (PMMA).
[1721] Details of the nanohole based deoxyribonucleic acid sequencing system have been described/disclosed in U.S. non-provisional patent application Ser. No. 13/663,376 entitled CHEMICAL COMPOSITION & ITS DELIVERY FOR LOWERING THE RISKS OF ALZHEIMER'S, CARDIOVASCULAR AND TYPE-2 DIABETES DISEASES, filed on Oct. 29, 2012 and in its related U.S. non-provisional patent applications (with all benefit provisional patent applications) are incorporated in its entirety herein with this application.
[1722]
[1723]
[1724]
[1725] Exosomes contain ribonucleic acids. Cells communicate with each other by sending and receiving exosomes. Thus, an exosome can be viewed as cellular Twitter for cell-to-cell biological communication directly by surface expressed ligands or transferring molecules from the originating cells. For example, exosomes can carry material from an originating cancer cell to suppress the immune system and stimulate angiogenesis for the growth of cancer cells. Recipient cells act utilizing ribonucleic acids for protein manufacturing. Thus, exosomes can be utilized as a universal nanoshell to deliver ribonucleic acid (e.g., a specific small interfering ribonucleic acid (siRNA)) for therapeutic purposes.
[1726]
[1727]
[1728] Superparamagnetic nanoparticles iron oxide (Fe.sub.3O.sub.4) can be synthesized with positive electrical charges to bond onto the membrane surface of exosomes' negative electrical charge due to electrostatic interactions. The biochemical chamber can be integrated with a magnet. Exposure to a magnetic field can separate superparamagnetic nanoparticles iron oxide (once attached with exosomes) from exosomes. Capture of exosomes by superparamagnetic nanoparticles iron oxide is realized in Capture+Wash Microchamber.
[1729] Alternatively, a nanosieve/nanomembrane/nanofilter of about 100 nanometers pore diameter can filter exosomes. For example, a nanosieve/nanomembrane/nanofilter can be graphene based. Nanoholes in graphene (a hexagonal array of carbon atoms) can be fabricated/constructed in a two-stage process. First, a graphene sheet is bombarded with gallium/helium ions, which disrupt the carbon bonds. Second, the graphene sheet is wet etched in an oxidizing solution that reacts strongly with the disrupted carbon bonds, producing a nanohole at each spot, where the gallium/helium ions once bombarded/struck. By controlling how long the graphene sheet is left in the oxidizing solution, the average size of the nanoholes can be controlled.
[1730]
[1731] The protruded metal/non-metal nano optical antenna can be integrated with the fluorophore to enhance fluorescence. Alternatively, the removable Lysis+Probe Microchamber can be configured with the protruded metal/non-metal nano optical antennas on the floor of the Removable Lysis+Probe Microchamber to enhance fluorescence.
[1732]
[1733] Details of exosome diagnostic system have been described/disclosed in U.S. non-provisional patent application Ser. No. 14/120,835 entitled CHEMICAL COMPOSITION & ITS DELIVERY FOR LOWERING THE RISKS OF ALZHEIMER'S, CARDIOVASCULAR AND TYPE-2 DIABETES DISEASES, filed on Jul. 1, 2014 and in its related U.S. non-provisional patent applications (with all benefit provisional patent applications) are incorporated in its entirety herein with this application.
[1734]
[1735] An optical waveguide device (
[1736]
[1737] Additionally, two-photon polymerization can be utilized to fabricate/construct microstructures in biocompatible ormocers material. A printed micro/nano component can be attached to live/bioprinted biological materials.
[1738] Alternatively, instead of scanning with a single (continuous wave/pulse/ultrashort pulse) laser, two lasers can be utilized simultaneously. The first instant is a typical laser using an appropriate wavelength to excite a material. The second instant is a key second laser, which is focused so that it produces a donut of light overlapping the focal point of the first laser. This configuration can enable the laser to focus below the Abbey's diffraction limit for nanoprinting.
[1739]
[1740] The application specific algorithm submodule 100C3 (Human OS) and the knowledge database 100N4 (e.g., Bioinformatics Database) can be coupled with a public/consortium/private blockchain.
[1741] The connections between various algorithm submodules of the intelligent algorithm 100Y can be similar to synaptic networks to enable deep learning/meta-learning and self-learning of the intelligent algorithm 100Y.
[1742]
[1743]
[1744]
[1745] The states of a classical bit can be represented by the scalars 0 and 1. The states of a quantum bit (qubit) are represented by quantum mechanical wave functions |0> and |1> as well as any linear combination a|0>+b|1>. The fact that the qubit can be in a superposition of states means that it can be on and off (or 0 and 1) at the same time and this is the main difference between the qubit and the bit.
[1746] The Josephson Effect is observed in a Josephson junction (e.g., Al/AlO.sub.x/Al or Nb/AlOx/Nb), when the flow of a supercurrent between two superconducting electrodes across a non-superconducting gap. The Josephson junction is a nonlinear inductor.
[1747] In
[1748]
[1749] Furthermore, the photonic neural learning processor (fabricated/constructed utilizing an array of optically induced phase transition material (e.g., vanadium dioxide) based memristors/super memristors) can be coupled with a qubit based on Josephson junction. Each super memristor can include (i) a resistor, (ii) a capacitor and (iii) a phase transition/phase change material based memristor. A phase transition material based memristor can be electrically and/or optically controlled. But a phase change material based memristor can be electrically or optically controlled. Furthermore, each super memristor can be electrically/optically controlled.
[1750] The photoconductor/atomic scaled switch is coupled with an input excitation laser. The photocurrent in an atomic scaled switch is induced in a photoconductive layer (which is coupled between a metal electrode and a solid-electrolyte electrode) by an input excitation laser. The photocurrent reduces metal ions with positive charges in the solid-electrolyte electrode and this precipitates as metal atoms to form an atomic scaled metal connection between the metal electrode and the solid-electrolyte electrode-operating as an atomic scaled switch, turned on by an input excitation laser and/or an applied electrical activation (e.g., voltage) by an action of weighted electrical signals (from an array of memristors/super memristors). Each super memristor can include (i) a resistor, (ii) a capacitor and (iii) a phase transition/phase change material based memristor. A phase transition material based memristor can be electrically and/or optically controlled. But a phase change material based memristor can be electrically or optically controlled. Furthermore, each super memristor can be electrically/optically controlled.
[1751] The input (excitation) laser is only configured to generate light pulses mimicking a neuron to communicate with many neurons. The input (excitation) laser can be excited only when a network(s) of the first pulsed lasers and second pulsed lasers are activated by an action of weighted electrical signals (from an array of memristors/super memristors or by converting optical signals of distinct wavelengths from ring resonators/fast tunable ring resonators.
[1752]
[1753] In
[1754] Alternatively, propagating first single photons in a first high quality optical waveguide (fabricated/constructed of a nonlinear optical crystal (e.g., LiNbO.sub.3)) can be trapped inside an array of first high quality photonic crystal cavities (made of the nonlinear optical crystal) embedded in the first high quality optical waveguide at least temporarily. Similarly, propagating second single photons in a second high quality optical waveguide (fabricated/constructed of a nonlinear optical crystal can be trapped inside an array of second high quality photonic crystal cavities (made of the nonlinear optical crystal) embedded in the second high quality optical waveguide at least temporarily.
[1755] The photonic crystal cavities can be placed such that both single photons are trapped in one single high quality photonic crystal cavity (of the nonlinear optical crystal), wherein the first high quality optical waveguide and the second high quality optical waveguide are geometrically perpendicular to each other. The first single photons and the second single photons interacting in one single high quality photonic crystal cavity (of the nonlinear optical crystal) may enable a room temperature photonic qubit.
[1756] Alternatively, a high quality photonic crystal cavity can be replaced by a high Q-factor microring of a suitable nonlinear optical material (e.g., barium titanate or lithium niobate) or a high Q-factor whispering gallery mode resonator of a suitable nonlinear optical material.
[1757] The photonic crystal cavities can be two-dimensional photonic crystal cavities and they may also include/integrate with two slightly different hole patternsthe topology.
[1758] This topological property allows light propagation at the boundary-similar to electrons in topological insulators. Because the topology of both hole patterns is locked and light propagation cannot be revokedit is topologically protected.
[1759] The room temperature photonic qubits can form quantum logic gates. The logic gates acting on two photonic qubits together can create quantum entanglement between them, wherein two different particles can share a relationship with one another. By studying one particle, one can learn things about the other particle-which could be even miles away. Then, these two particles are said to be quantum entangled.
[1760] Furthermore, (i) an optical phased array or (ii) an array of vertical couplers or (iii) an array of nanoscaled antennas or (iv) a metamaterial surface or (v) a Rotman lens can be utilized transmitting the first single photons toward an object.
[1761] Additionally, the first high quality optical waveguide and the second high quality optical waveguide can be arrayed (perpendicular to each other like in a matrix) and coupled with an optical switch/Mach-Zhender interferometers in two-dimensions.
[1762] Alternatively, an array of room temperature photonic qubits can form by selectively depositing an atomically thin material (e.g., hexagonal boron nitride) on nanopillars, wherein the nanopillars can be optically coupled with optical waveguides (e.g., made of aluminum nitride), optical delay lines, Mach-Zhender interferometers and optical inputs/outputs.
[1763] Alternatively, an array of room temperature photonic qubits (based on defect centers in diamond or silicon carbide) can form by optically coupling/aligning (utilizing nano-positioning manipulator under a microscope) with optical waveguides (e.g., made of aluminum nitride), optical delay lines, Mach-Zhender interferometers and optical inputs/outputs.
[1764] Furthermore, entangled photons (in the visible or near infrared wavelength regime) at room temperature can enable a long-range, ultra-sensitive and higher resolution quantum light detection and ranging (QuLiDAR) subsystem or a quantum imaging system. The entangled single photons that are strongly correlated and have the same inseparable identity and experiences and work as one quantum system, even when separated miles away. However, a quantum light detection and ranging subsystem can be extremely fragile and it can be immediately or completely destroyed by the slightest bit of noise or atmosphere disturbance, which is known as decoherence (or loss of coherence). Using the principles of quantum light detection and ranging subsystem, a quantum imaging system can be fabricated/constructed as followsgenerating entangled photons by shining a laser beam onto a suitable nonlinear crystal that can split each photon into a single photon pair of .sub.1 and .sub.2. Single photons of .sub.1 can be utilized to illuminate an object, while its stationary/idle entangled partner single photons of .sub.2 can be detected by a detector (e.g., a complementary metal oxide semiconductor based camera or a single photon avalanche diode) for imaging. Alternatively, both the single photons of .sub.1 and single photons of .sub.1 can be detected (by (i) a single photon avalanche diode or (ii) a photon number resolving detector (PNRD) or (iii) a complementary metal oxide semiconductor based imaging pixel) and coupled with a coincidence circuit.
[1765] Furthermore, the nonlinear crystal can be coupled with a metamaterial surface/substrate and/or a nano optical antenna, wherein the nano optical antenna can enhance excitation of the laser beam incident on the nonlinear optical material,
[1766] Furthermore, entangled photons can utilize a set of computer implementable instructions in machine learning that can preferentially utilize less noisy qubits/photonic qubits in computation/imaging using the fewest computational resources and fewest logic gates in an optimized (shortest) period of time without the inherent effect of (noisy)/error-prone quantum computing/imaging.
[1767] Furthermore, each ultra-sensitive single photon avalanche diode can be coupled with an optical waveguide. The ultra-sensitive single photon avalanche diode of a suitable material (e.g., germanium-tin (GeSn) can operate at room temperature. The ultra-sensitive single photon avalanche diode of a suitable material (e.g., germanium-tin (GeSn) can be fabricated/constructed on silicon on insulator substrate.
[1768] Alternatively, a (waveguide) photon number resolving detector (W-PNRD) (e.g., NbN superconducting nanowires on a GaAs/Al.sub.0.75 Ga.sub.0.25 As ridge waveguide) can replace a single photon avalanche diode.
[1769] An optical beam splitter or a mirror can separate the first single photon and the second single photon.
[1770] A quantum light detection and ranging subsystem is based on quantum entanglement, when a quantum light detection and ranging subsystem transmits/sends the single photons A (e.g., split by parametric down-conversion) outward to a target by (i) an optical phased array or (ii) an array of vertical couplers or (iii) an array of nanoscaled antennas or (iv) a metamaterial surface or (v) a Rotman lens.
[1771] Other single photons B remain stationary/idle at a system location. By studying the quantum properties of idle single photons B remained at a system location or comparing/correlating with the returning single photons A with the stationary/idle photons B at a system location utilizing one or more ultra-sensitive single photon avalanche diodes, it is possible to tell what happened to the single photons A transmitted/sent outward to a target. Did single photons A hit onto a target? How large was the target? How fast was the target traveling and in what direction? What does the target look like (image)?
[1772] The long-range, ultra-sensitive and higher resolution quantum light may be noisy and error-prone. A machine learning optimization algorithm (either on a classical computer or a quantum computer) can preferentially utilize less noisy qubits/photonic qubits in computation/imaging using the fewest computational resources and fewest logic gates in an optimized (shortest) period of time without the inherent effect of (noisy)/error-prone quantum computing/imaging.
[1773] Furthermore, if needed, the long-range, ultra-sensitive and higher resolution quantum light detection and ranging subsystem can be cooled at a lower temperature, utilizing a quantum circuit refrigerator (QCR), utilizing/including voltage controlled electron tunneling.
[1774] Alternatively, (room temperature) trapped ion qubits (wherein trapped ion qubits and be coupled by DC electrode, RF electrode and ground electrode and these trapped ion qubits can be activated by one or more microwave signals and/or lasers), including an ultrahigh vacuum system, a micro-fabricated surface trap and a small form-factor ion pump can be utilized. Furthermore, each trapped ion qubit can be coupled with a cavity and a nano optical antenna.
[1775] Precious positioning of nitrogen vacancy color centers in diamond by a two-step laser activation process has been described/disclosed in the previous paragraphs. Alternatively, (room temperature) trapped ion qubits can be replaced by preciously positioned nitrogen vacancy color center in diamond based (room temperature) qubits on a substrate (the substrate may include a metamaterial and/or photonic crystal). Each nitrogen vacancy color center in diamond can be coupled with a nano optical antenna and/or a transmitting nanoscaled optical waveguide. Each nitrogen vacancy color center in diamond can be coupled with (i) a circuit to generate a microwave signal in response to a current input in the above circuit and (ii) a first light beam. A second light beam emitting from each nitrogen vacancy color center in diamond can be coupled with a photodiode (e.g., a single photon avalanche diode/photon number resolving detector) and an optical filter to filter out the first light. It should be noted that to extract light out of each nitrogen vacancy color center in diamond, an optical out-coupler (e.g., a patterned semiconductor) may be fabricated/bonded on top of diamond (e.g., a diamond thin-film with nitrogen vacancy color centers) and this problem is due to high refractive index of diamond.
[1776] Furthermore, if needed, a receiving nanoscaled optical waveguide may be coupled with a single photon avalanche diode/photon number resolving detector.
[1777] It is possible to integrate a nitrogen vacancy color center, a microwave signal generating circuit, a photodiode and an optical waveguide with a complementary metal oxide semiconductor based integrated electronic circuit.
[1778] It is also possible to integrate a nitrogen vacancy color center, a microwave signal generating circuit, a photodiode and an optical waveguide with a complementary metal oxide semiconductor based integrated electronic circuit and/or a photonic integrated circuit. This arrangement can enable accurate quantum sensing of earth's magnetic field and quantum sensing of neural imaging (in particular firing of neurons).
[1779] Furthermore, if needed, the long-range, ultra-sensitive and higher resolution quantum light detection and ranging subsystem can be cooled at a lower temperature, utilizing a quantum circuit refrigerator (QCR), utilizing/including voltage controlled electron tunneling.
[1780] However, the long-range, ultra-sensitive and higher resolution quantum light detection and ranging subsystem can be extremely fragile and it can be immediately or completely destroyed by the slightest bit of noise or atmosphere disturbance, which is known as decoherence (or loss of coherence). Additionally, the long-range, ultra-sensitive and higher resolution quantum light can be encased in an environmentally protected enclosure to reduce loss of coherence.
[1781] Furthermore, a compact optical configuration can be realized by fabricating/constructing a network of silicon nitride waveguides on top of a substrate (e.g., glass/quartz). The network of silicon nitride waveguides can route light (e.g., light from quantum dot red/green/blue light emitting diodes/lasers or two-dimensional material based light sources). Above the silicon nitride waveguides, a layer (e.g., about 1 micron in thickness) of silicon dioxide thin-film or an electrically activated optically tunable material based thin-film can be fabricated/constructed. On top of the silicon dioxide thin-film or electrically activated optically tunable material based thin-film, there are transparent/indium tin oxide/niobium electrodes, integrated with tiny openings in the electrodes to allow light (which is guided via silicon nitride waveguides) to pass through. Beneath the tiny openings in the transparent/indium tin oxide/niobium electrodes, the waveguides in silicon nitride break into a series of sequential ridges to act as diffraction gratings in order to direct light down through the holes and concentrate the light into a beam narrow enough to activate/configure a trapped ion. Alternatively, light via an optical fiber can be activated/configured a trapped ion. In stead of a trapped ion based qubit, a neutral atom (e.g., cesium, rubidium, strontium or ytterbium atom) based Rydberg qubit can be utilized. Furthermore, a single neutral atom may be replaced by a neutral atom-molecule complex (e.g., (e.g., a cesium-rubidium complex or a strontium-ytterbium complex). A large (either one-dimensional or two-dimensional) array of Rydberg qubits may be possible, utilizing optical tweezers and/or optical traps and/or modular architectures (a modular architecture may require an array of neutral atom or neutral atom-molecule complexes are to be linked). A practical approach for error correction is to spread information over many Rydberg qubits (many Rydberg qubits may constitute a logical qubit). Thus, an error in one single Rydberg qubit may not corrupt/destroy the information that many Rydberg qubits collectively encode/process for quantum computation.
[1782] Furthermore, an array of quantum light detection and ranging subsystems can be coupled with a NN cross-connect switch or a NN Bose-Einstein condensate based optical switch or an ultrafast optical switch based on a phase transition/phase change material. The phase transition/phase change material can be activated by an electrical (e.g., current/voltage) stimulus or an optical stimulus.
[1783] Generally, a phase transition material is a solid material, wherein its lattice structure can change from a particular solid crystalline form to another solid crystalline form, still remaining crystal-graphically solid. A phase change material is a material, wherein its phase can change from (i) a solid to liquid or (ii) an amorphous to crystalline or (iii) crystalline to amorphous.
[1784] Generally, a memristor can be electrically activated/induced/controlled. Additionally, the photonic neural learning processor utilizing optically activated/induced/controlled (i) memristors (e.g., fabricated/constructed in a phase transition material) can be coupled with such room temperature photonic qubits/qubits or (ii) super memristors.
[1785] Each super memristor can include (i) a resistor, (ii) a capacitor and (iii) a phase transition/phase change material based memristor. A phase transition material based memristor can be electrically and/or optically controlled. But a phase change material based memristor can be electrically or optically controlled. A super memristor can generally mimic a set of neural activities (such as simple spikes, bursts of spikes and self-sustained oscillations with a DC voltage as an input signal)which can be used for a neuromorphic/neural processing/computing architecture. Furthermore, each super memristor can be electrically/optically controlled.
[1786] Furthermore, an ultrafast optical switch (fabricated/constructed utilizing optically induced phase transition material (e.g., vanadium dioxide) can be coupled with such room temperature photonic qubits.
[1787] Details of an ultrafast optical switch have been described/disclosed in U.S. non-provisional patent applications Nos. FAST OPTICAL SWITCH AND ITS APPLICATIONS IN OPTICAL COMMUNICATION, U.S. patent application Ser. Nos. 16/501,191 and 16/501,189, filed on Mar. 5, 2019.
[1788] The input (excitation) laser is only configured to generate light pulses mimicking a neuron to communicate with many neurons. The input (excitation) laser can be excited only when a network(s) of the first pulsed lasers and second pulsed lasers are activated by an action of weighted electrical signals (from an array/network of memristors/super memristors or by converting optical signals of distinct wavelengths from ring resonators/fast tunable ring resonators.
[1789] A quantum light detection and ranging subsystem (e.g., due to (i) an overlap of photons based qubits/single photons or (ii) nitrogen vacancy color center in diamond based qubits) can include a set of computer implementable instructions to detect an object in harsh weather/environmental conditionsrain/fog/snow/water, wherein that above set of computer implementable instructions, stored in one or more non-transitory storage media.
[1790] Furthermore, a quantum light detection and ranging subsystem (e.g., due to (i) an overlap of photons based qubits/single photons (ii) nitrogen vacancy color center in diamond based qubits) can include another set of computer implementable instructions in an artificial intelligence algorithm and/or a artificial neural network algorithm and/or a machine learning algorithm and/or a deep learning algorithm, wherein the above set of computer implementable instructions, stored in one or more non-transitory storage media.
[1791] Furthermore, a quantum light detection and ranging subsystem (e.g., due to (i) an overlap of photons based qubits/single photons (ii) nitrogen vacancy color center in diamond based qubits) can include another set of computer implementable instructions including an evolutionary based algorithm and/or a self-learning algorithm, wherein the above set of computer implementable instructions, stored in one or more non-transitory storage media.
[1792] In general (embodiments described herein can be modified in any arrangement and detail), but not limited to the following summary that a quantum light detection and ranging subsystem/quantum imaging subsystem can include the following: [1793] (a) trapping of a photonic qubit A in a first photonic crystal of a first nonlinear optical material of a first optical waveguide, trapping of a photonic qubit B in a second photonic crystal of the first nonlinear optical material of a second optical waveguide, wherein the first optical waveguide is (geometrically) perpendicular to the second optical waveguide within a manufacturing tolerance, wherein the photonic qubit A and the photonic qubit B are quantum entangled, [1794] (b) (i) an optical phased array or (ii) an array of vertical couplers or (iii) an array of nanoscaled antennas or (iv) a metamaterial surface or (v) a Rotman lens for transmitting the photonic qubit A toward an object in harsh weather/environmental conditionsrain/fog/snow/water, [1795] (c) one or more (i) single photon avalanche diodes or (ii) photon number resolving detectors (PNRDs) or (iii) complementary metal oxide semiconductor based imaging pixels to detect the photonic qubit A that is reflected from the object in harsh weather/environmental conditionsrain/fog/snow/water, wherein the photonic qubit A and the photonic qubit B are correlated for quantum imaging.
[1796] Furthermore, the first photonic crystal can include a topologically protected photonic crystal. The first photonic crystal can be replaced by a first whispering gallery mode resonator of the first nonlinear optical material or a first microring resonator of the first nonlinear optical material.
[1797] Similarly, the second photonic crystal can include a topologically protected photonic crystal. The second photonic crystal can be replaced by a second whispering gallery mode resonator of the first nonlinear optical material or a second microring resonator of the first nonlinear optical material.
[1798] Alternatively, the part (a) of a quantum light detection and ranging subsystem/quantum imaging subsystem, as described previously can include the following: [1799] (a) a correlation of a first single photon with a second single photon, wherein the first single photon and the second single photon are produced by a laser beam incident upon a second nonlinear optical material, wherein the second nonlinear optical material is coupled by a metamaterial and/or a nano optical antenna, wherein the nano optical antenna enhances excitation of the laser beam incident on the second nonlinear optical material, wherein the first single photon is quantum entangled with the second single photon, wherein the first single photon is a transmitted signal, wherein the second single photon is a non-transmitted and stationary, wherein the first single photon may be of .sub.1 wavelength, wherein the second single photon may be of .sub.2 wavelength. [1800] (b) An optical beam splitter/mirror to separate the first single photon of .sub.1 wavelength and the second single photon of .sub.1 wavelength. Alternatively, the first single photon of .sub.1 wavelength can be detected by a first detector (e.g., a single photon avalanche diode or (ii) a photon number resolving detector or (iii) a complementary metal oxide semiconductor based imaging pixel) and the second single photon of .sub.2 wavelength can be detected by a second detector.
[1801] The first detector and the second detector can be coupled with a circuit (e.g., a coincidence timing triggering circuit).
[1802] A quantum light detection and ranging subsystem/quantum imaging subsystem can include an optical switch, wherein the optical switch can be a cross-connect optical switch or an optical switch that includes a phase transition material/phase change material, wherein the phase transition material is electrically and/or optically controlled, but the phase change material is electrically or optically controlled. Furthermore, an optical switch can include a Bose-Einstein condensate based optical switch, wherein the Bose-Einstein condensate based optical switch includes polaritons.
[1803] A quantum light detection and ranging subsystem/quantum imaging subsystem can include a first photonic neural learning processor for photonic neural processing, wherein the first photonic neural learning processor can include the following: [1804] (i) an interferometer and a laser [1805] or [1806] (ii) one or more phase transition material/phase change material based optical switches, wherein at least one phase transition material based optical switch is electrically and/or optically controlled, but at least one phase change material based optical switch is electrically or optically controlled.
[1807] A quantum light detection and ranging subsystem/quantum imaging subsystem can include a second photonic neural learning processor for photonic neural processing, wherein the second photonic neural learning processor can include the following: an input or an output, wherein the input or the output of the second photonic neural learning processor is coupled by a Mach-Zehnder interferometer (that can include a phase transition material/phase change material/lithium niobate/polymeric material. A phase transition material is electrically and/or optically controlled, but a phase change material is electrically or optically controlled, wherein the lithium niobate or the polymeric material is electrically controlled). Moreover, the Mach-Zehnder interferometer can be coupled by a first optical waveguide in a two-dimensional/three-dimensional arrangement, wherein the first optical waveguide can be coupled by (i) a semiconductor optical amplifier and/or (ii) a second optical waveguide (made of a third nonlinear optical material) in a two-dimensional/three-dimensional arrangement (generally, a three-dimensional arrangement can include a vertical arrangement).
[1808] It should be noted that a first nonlinear material, a second nonlinear material and a third nonlinear materialall three can be distinct or even same depending on the engineering strategy.
[1809] A quantum light detection and ranging subsystem/quantum imaging subsystem can be coupled with a Super System on Chip 400A/400B/400C/400D (various embodiments have been described/disclosed in the previous paragraphs).
[1810] Furthermore, a quantum light detection and ranging subsystem can be coupled with a photonic neural learning processor (various embodiments have been described/disclosed in the previous paragraphs).
[1811] A quantum light detection and ranging subsystem/quantum imaging subsystem can also include a set of computer implementable instructions to detect an object in harsh weather/environmental conditionsrain/fog/snow/water, wherein the set of computer implementable instructions stored in one or more non-transitory storage media.
[1812] Instead of a standalone long-range, ultra-sensitive and higher resolution quantum light detection and ranging subsystem, it can be integrated with a (classical) light detection and ranging subsystem/computational camera (as described/disclosed in the previous paragraphs).
[1813]
[1814] Furthermore, the photonic neural learning processor (fabricated/constructed utilizing an array of optically induced phase transition material (e.g., vanadium dioxide) based memristors) can be coupled with a qubit based on a nitrogen vacancy color center in diamond crystal.
[1815] Furthermore, memristors can be replaced by super memristors. Each super memristor can include (i) a resistor, (ii) a capacitor and (iii) a phase transition/phase change material based memristor. A phase transition material based memristor can be electrically and/or optically controlled. But a phase change material based memristor can be electrically or optically controlled.
[1816] A super memristor can generally mimic a set of neural activities (such as simple spikes, bursts of spikes and self-sustained oscillations with a DC voltage as an input signal)which can be used for a neuromorphic/neural processing/computing architecture. Furthermore, each super memristor can be electrically/optically controlled.
[1817] Above configuration enables coupling of room temperature photonic qubits with neural processing elements hardwareall at room temperature.
[1818]
[1819]
[1820] The input (excitation) laser can be excited only when a network(s) of the first pulsed lasers and second pulsed lasers are activated by an action of weighted electrical signals (from an array of memristors/super memristors or by converting optical signals of distinct wavelengths from ring resonators/fast tunable ring resonators.
[1821]
[1822] Furthermore, the photonic neural learning processor (fabricated/constructed utilizing an array of optically induced phase transition material (e.g., vanadium dioxide) based memristors) can be coupled with a qubit based on a nitrogen vacancy color center based on trapped atomic ion. Furthermore, memristors can be replaced by super memristors.
[1823]
[1824] For fault-tolerant quantum computation, the surface code (or the concatenated Steane code) in a modular architecture can be utilized.
[1825] Bose-Einstein condensation describes a phenomenon (predicted by Satyendra Nath Bose and Albert Einstein) that quantum mechanics can force a large number of particles to behave in concert, as if they were like a single particle.
[1826] An ultrafast NN Bose-Einstein condensate based optical switch can be realized, utilizing an array of single-mode/multi-mode optical waveguides on the left-hand side and an array of single-mode/multi-mode optical waveguides on the right-hand side, wherein the array of single-mode/multi-mode optical waveguides on the left-hand side and the array of single-mode/multi-mode optical waveguides on the right-hand side are optically coupled with polariton Bose-Einstein condensate.
[1827] Short-lived room temperature polariton Bose-Einstein condensate can be created through the interaction of a laser light (bouncing back and forth within multiple dielectric thin-films) and a luminescent polymeric thin-film of about 30 nanometers in thickness. The luminescent polymeric thin-film is embedded within multiple dielectric thin-films, wherein the multiple dielectric thin-films is then illuminated from the bottom (of the multiple dielectric thin-films, each dielectric thin-film is about 40 nanometers in thickness) by a vertical surface emitting laser or an in-plane laser integrated with a mirror and a lens.
[1828] Details of an ultrafast NN Bose-Einstein condensate based optical switch (
[1829] Alternatively, Bose-Einstein condensate at room temperature can be realized in hybrid surface plasmon polaritons (utilizing a periodic array of metal (e.g., silver) nanostructures and dye molecules, when excited by a femtosecond laser), which are mostly light, but also contain a small part of electron plasma oscillations. The geometry of the array can be varied to obtain various properties of Bose-Einstein condensate.
[1830] Ultrafast (sub-picoseconds) Bose-Einstein condensation based optical switch at room temperature can include NN optical fibers or optical waveguides.
[1831]
[1832] However, an ultrafast optical switch based on a phase transition/phase change material or a NN microelectromechanical system based optical cross-connect switch may replace the Bose-Einstein condensate based optical switch in some applications.
[1833]
[1834]
[1835]
PREFERRED EMBODIMENTS & SCOPE OF THE INVENTION
[1836] As used in the above disclosed specifications, the above disclosed specifications / has been used to indicate an or.
[1837] As used in the above disclosed specifications and in the claims, the singular forms a, an and the include also the plural forms, unless the context clearly dictates otherwise.
[1838] As used in the above disclosed specifications, the term includes means comprises. Also, the term including means comprising.
[1839] As used in the above disclosed specifications, the term couples or coupled does not exclude the presence of an intermediate element(s) between the coupled items.
[1840] As used in the above disclosed specifications, any weight % in the above disclosed specifications is by way of an approximation only and not by way of any limitation.
[1841] Any dimension in the above disclosed specifications is by way of an approximation only and not by way of any limitation.
[1842] As used in the above disclosed specifications, unless otherwise specified in the relevant paragraph(s), a nanoscaled dimension shall generally mean a dimension from about 1 nanometer to about 1000 nanometers.
[1843] As used in the above disclosed specifications, the word unit is synonymous with the word media unit or with the word media.
[1844] As used in the above disclosed specifications, the word cloud based storage unit is synonymous with a cloud based server.
[1845] As used in the above disclosed specifications, the cloud based storage can be replaced by a local storage on a device/subsystem/system, if the electrical power consumption is not a limiting factor.
[1846] As used in the above disclosed specifications, real time means near real time in practice.
[1847] As used in these disclosed specifications, a computational camera sensor is generally equivalent to a Light Detection and Ranging (LiDAR) device in practice.
[1848] As used in the above disclosed specifications, a phase transition material transforms from one lattice phase to another lattice phase, but generally remains in a lattice structure. However, a phase change material transforms from a lattice phase to a non-lattice phase (e.g., amorphous phase) or from a solid phase to a liquid phase. For example, in case of a phase transition material (e.g., vanadium dioxide (VO.sub.2)): Volatile phase transition from insulating (band gap 0.7 eV) monoclinic crystalline phase to metallic (i.e., bands gap collapse and delocalized electrons) in a rutile crystalline phase, with a corresponding change in symmetry and reduced (by half) unit cell. Similarly in case of a phase change material (e.g., Ge.sub.2Sb.sub.2Te.sub.5 (GST): Non-volatile phase change from glassy phase to crystalline phase with accompanying change of dielectric function.
[1849] As used in the above disclosed specifications, an algorithm is defined as an organized set of computer-implementable instructions to achieve a desired task.
[1850] As used in the above disclosed specifications, a software module is defined as a collection of consistent algorithms to achieve a desired task.
[1851] Any example in the above disclosed specifications is by way of an example only and not by way of any limitation. Having described and illustrated the principles of the disclosed technology with reference to the illustrated embodiments, it will be recognized that the illustrated embodiments can be modified in any arrangement and detail with departing from such principles. The technologies from any example can be combined in any arrangement with the technologies described in any one or more of the other examples. Alternatives specifically addressed in this application are merely exemplary and do not constitute all possible examples. Claimed invention is disclosed as one of several possibilities or as useful separately or in various combinations. See Novozymes A/S v. DuPont Nutrition Biosciences APS, 723 F3d 1336, 1347.
[1852] The best mode requirement requires an inventor(s) to disclose the best mode contemplated by him/her, as of the time he/she executes the application, of carrying out the invention. . . . [T]he existence of a best mode is a purely subjective matter depending upon what the inventor(s) actually believed at the time the application was filed. See Bayer AG v. Schein Pharmaceuticals, Inc. The best mode requirement still exists under the America Invents Act (AIA). At the time of the invention, the inventor(s) described preferred best mode embodiments of the present invention. The sole purpose of the best mode requirement is to restrain the inventor(s) from applying for a patent, while at the same time concealing from the public preferred embodiments of their inventions, which they have in fact conceived. The best mode inquiry focuses on the inventor(s)' state of mind at the time he/she filed the patent application, raising a subjective factual question. The specificity of disclosure required to comply with the best mode requirement must be determined by the knowledge of facts within the possession of the inventor(s) at the time of filing the patent application. See Glaxo. Inc. v. Novopharm Ltd., 52 F.3d 1043, 1050 (Fed. Cir. 1995). The above disclosed specifications are the preferred best mode embodiments of the present invention. However, they are not intended to be limited only to the preferred best mode embodiments of the present invention.
[1853] Embodiment by definition is a manner in which an invention can be made or used or practiced or expressed. A tangible form or representation of the invention is an embodiment.
[1854] Numerous variations and/or modifications are possible within the scope of the present invention. Accordingly, the disclosed preferred best mode embodiments are to be construed as illustrative only. Those who are skilled in the art can make various variations and/or modifications without departing from the scope and spirit of this invention. It should be apparent that features of one embodiment can be combined with one or more features of another embodiment to form a plurality of embodiments. The inventor(s) of the present invention is not required to describe each and every conceivable and possible future embodiment in the preferred best mode embodiments of the present invention within the context of a predictable technological field. See SRI Int'l v. Matsushita Elec. Corp. of America, 775F.2d 1107, 1121, 227 U.S.P.Q. (BNA) 577, 585 (Fed. Cir. 1985) (enbanc).
[1855] The scope and spirit of this invention shall be defined by the claims and the equivalents of the claims only. The exclusive use of all variations and/or modifications within the scope of the claims is reserved. The general presumption is that claim terms should be interpreted using their plain and ordinary meaning without improperly importing a limitation from the specification into the claims. See Continental Circuits LLC v. Intel Corp. (Appeal Number 2018-1076, Fed. Cir. Feb. 8, 2019) and Oxford Immunotec Ltd. v. Qiagen, Inc. et al., Action No. 15-cv-13124-NMG. Unless a claim term is specifically defined in the preferred best mode embodiments, then a claim term has an ordinary meaning, as understood by a person with an ordinary skill in the art, at the time of the present invention. Plain claim language will not be narrowed, unless the inventor(s) of the present invention clearly and explicitly disclaims broader claim scope. See Sumitomo Dainippon Pharma Co. v. Emcure Pharm. Ltd., Case Nos. 17-1798; -1799; -1800 (Fed. Cir. Apr. 16, 2018) (Stoll, J). As noted long ago: Specifications teach. Claims claim. See Rexnord Corp. v. Laitram Corp., 274 F.3d 1336, 1344 (Fed. Cir. 2001). The rights of claims (and rights of the equivalents of the claims) under the Doctrine of Equivalents-meeting the Triple Identity Test (a) performing substantially the same function, (b) in substantially the same way and (c) yielding substantially the same result. See Crown Packaging Tech., Inc. v. Rexam Beverage Can Co., 559 F.3d 1308, 1312 (Fed. Cir. 2009)) of the present invention are not narrowed or limited by the selective imports of the specifications (of the preferred embodiments of the present invention) into the claims.
[1856] While absolute precision is unattainable in patented claims, the definiteness requirement mandates clarity. See Nautilus, Inc. v. Biosig Instruments, Inc. 527 U.S., 134 S. Ct. 2120, 2129, 110 USPQ2d 1688, 1693 (2014). Definiteness of claim language must be analyzed NOT in a vacuum, but in light of: [1857] (a) The content of the particular application disclosure, [1858] (b) The teachings of any prior art and [1859] (c) The claim interpretation that would be given by one possessing the ordinary level of skill in the pertinent art at the time the invention was made. (Id.).
See Orthokinetics. Inc. v. Safety Travel Chairs, Inc., 806 F.2d 1565, 1 USPQ2d 1081 (Fed. Cir. 1986)
[1860] There are a number of ways the written description requirement is satisfied. Applicant(s) does not need to describe every claim element exactly, because there is no such requirement (MPEP 2163). Rather to satisfy the written description requirement, all that is required is reasonable clarity (MPEP 2163.02). An adequate description may be made in any way through express, implicit or even inherent disclosures in the application, including word, structures, figures, diagrams and/or equations (MPEP 2163(I), 2163.02). The set of claims in this invention generally covers a set of sufficient number of embodiments to conform to written description and enablement doctrine. See Ariad Pharm., Inc. v. Eli Lilly & Co., 598 F.3d 1336, 1355 (Fed. Cir. 2010), Regents of the University of California v. Eli Lilly & Co., 119 F.3d 1559 (Fed. Cir. 1997) & Amgen Inc. v. Chugai Pharmaceutical Co. 927 F.2d 1200 (Fed. Cir. 1991).
[1861] Drawings under 37 C.F.R. 1.83(a): In particular, as outlined in MPEP 608.02 Drawing [R-07.2015], the statutory requirement for showing the claimed invention only requires that the applicant shall furnish a drawing where necessary for the understanding of the subject matter to be patented . . . (See 35 U.S.C. 113, See also 37 CFR 1.81(a), which states [t]he applicant for a patent is required to furnish a drawing of the invention where necessary for the understanding of the subject matter sought to be patented . . . ).
[1862] Furthermore, Amgen Inc. v. Chugai Pharmaceutical Co. exemplifies Federal Circuit's strict enablement requirements. Additionally, the set of claims in this invention is intended to inform the scope of this invention with reasonable certainty. See Interval Licensing, LLC v. AOL Inc. (Fed. Cir. Sep. 10, 2014). A key aspect of the enablement requirement is that it only requires that others will not have to perform undue experimentation to reproduce it. Enablement is not precluded by the necessity of some experimentation, [t]he key word is undue, not experimentation. Enablement is generally considered to be an important factor for determining the scope of claim protection allowed. However, enablement does not require that an inventor disclose every possible embodiment of his invention. The scope of enablement must be commensurate with the scope of the claims. The scope of the claims must be less than or equal to the scope of enablement. See Promega v. Life Technologies Fed. Cir., December 2014, Magsil v. Hitachi Global Storage Fed. Cir. August 2012.
[1863] The term means was not used nor intended nor implied in the disclosed preferred best mode embodiments of the present invention. Thus, the inventor(s) has not limited the scope of the claims as mean plus function. The standard is whether the words of the claim are understood by person of ordinary skill in the art to have a sufficiently definite meaning as the name for structure. See Williamson v. Citrix Online. LLC, 792 F.3d 1339 (2015).
[1864] An apparatus claim with functional language is not an impermissible hybrid claim; instead, it is simply an apparatus claim including functional limitations. Additionally, apparatus claims are not necessarily indefinite for using functional language . . . [f]unctional language may also be employed to limit the claims without using the means-plus-function format. See National Presto Industries, Inc. v. The West Bend Co., 76 F. 3d 1185 (Fed. Cir. 1996), R.A.C.C. Indus. v. Stun-Tech, Inc., 178 F.3d 1309 (Fed. Cir. 1998) (unpublished), Microprocessor Enhancement Corp. v. Texas Instruments Inc. & Williamson v. Citrix Online, LLC, 792 F.3d 1339 (2015).
[1865] In conclusion, it is intended that the scope of the invention is not limited by this detailed specification with preferred embodiments, but rather by claims appended hereto.