Feruloyl esterase and application thereof
12270058 ยท 2025-04-08
Assignee
Inventors
Cpc classification
International classification
Abstract
The disclosure discloses a feruloyl esterase and application thereof, and belongs to the technical field of microorganisms. The disclosure provides a feruloyl esterase with an amino acid sequence shown in SEQ ID NO: 2 and specific enzyme activity as high as 519 U/g. The disclosure provides a recombinant Bacillus subtilis which uses Bacillus subtilis as a host, expresses a gene encoding the feruloyl esterase with an amino acid sequence shown in SEQ ID NO: 2, and can be used for producing the feruloyl esterase with a high yield. The process specifically includes inoculating a fermentation culture medium with the recombinant Bacillus subtilis for fermentation for 14 hours, and the enzyme activity of the feruloyl esterase in a cell disruption supernatant can be as high as 82.53 U/mL.
Claims
1. A microbial cell, wherein the cell comprises: a gene encoding a feruloyl esterase having the amino acid sequence set forth in SEQ ID NO:2, a recombinant plasmid comprising the gene, wherein the recombinant plasmid is a pMA5 plasmid or a pTSC plasmid.
2. The microbial cell according to claim 1, wherein the nucleotide sequence of the gene is SEQ ID NO:3.
3. The microbial cell according to claim 1, wherein the microbial cell is Bacillus pumilus or Bacillus subtilis.
4. The microbial cell according to claim 3, wherein the Bacillus subtilis is Bacillus subtilis 168, Bacillus subtilis WB800, Bacillus subtilis WB600 or Bacillus subtilis 1A751.
Description
BRIEF DESCRIPTION OF FIGURES
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
DETAILED DESCRIPTION
(9) A ferulic acid standard product involved in the following examples is purchased from Beijing Bailingwei Technology Co., Ltd.; methyl ferulate involved in the following examples is purchased from Alfa Aesar (China) Chemical Co., Ltd.; bovine albumin and coomassie brilliant blue G-250 involved in the following examples are purchased from Shanghai Sinopharm Chemical Reagent Co., Ltd.; a pMA5 plasmid involved in the following examples is purchased from YouBio; Escherichia coli DH5a involved in the following examples is purchased from General Biological Co., Ltd.; Bacillus subtilis WB800 involved in the following examples is purchased from National Type Culture Collection (NTCC); a lysozyme involved in the following examples is purchased from Sangon Biotech (Shanghai) Co., Ltd.; tris(hydroxymethyl)aminomethane (Tris) and disodium ethylenediaminetetraacetate dihydrate involved in the following examples are purchased from Shanghai Macklin Biochemical Co., Ltd.
(10) Culture Media Involved in the Following Examples are as Follows:
(11) A culture medium for strain isolation includes 200 g/L potato, 20 g/L sucrose and 15 g/L agar, and the pH is natural.
(12) A culture medium for solid screening is obtained by filtering an N,N-dimethylformamide solution containing 100 mg/L ethyl ferulate with a 0.22 m filter membrane to obtain an ethyl ferulate solution, cooling a sterilized basic culture medium to 60 C., adding 10% (v/v) of the ethyl ferulate solution into the basic culture medium and shaking the solution uniformly until the solution becomes a uniform milky white solution.
(13) The basic culture medium includes 2 g/L NaNO.sub.3, 1 g/L K.sub.2HPO.sub.4.Math.3H.sub.2O, 0.5 g/L KCl, 0.5 g/L MgSO.sub.4.Math.7H.sub.2O, 0.01 g/L FeSO.sub.4.Math.7H.sub.2O and 15 g/L agar, and the pH is natural.
(14) A seed culture medium includes 200 g/L potato and 20 g/L sucrose, and the pH is natural.
(15) A basic fermentation culture medium includes 20 g/L wheat bran, 2 g/L NaNO.sub.3, 1 g/L K.sub.2HPO.sub.4.Math.3H.sub.2O, 0.5 g/L KCl, 0.5 g/L MgSO.sub.4.Math.7H.sub.2O and 0.01 g/L FeSO.sub.4.Math.7H.sub.2O, and the pH is natural.
(16) An LB liquid culture medium includes 10 g/L tryptone, 5 g/L yeast extract and 10 g/L sodium chloride, and the pH is natural.
(17) An LB solid culture medium includes 10 g/L tryptone, 5 g/L yeast extract, 10 g/L sodium chloride and 15 g/L agar powder.
(18) A Super Rich culture medium includes 25 g/L tryptone, 20 g/L yeast extract, 3.0 g/L dipotassium hydrogen phosphate and 30 g/L glucose, and the pH is natural.
(19) Solutions Involved in the Following Examples are as Follows:
(20) 1. A lysis solution includes 6.057 g/L Tris and 5.844 g/L NaCl, the pH is adjusted to 8.0 with hydrochloric acid, and the lysis solution is diluted to 1 L. 2. A dialysis solution includes 6.057 g/L Tris, the pH is adjusted to 8.0 with hydrochloric acid, and the dialysis solution is diluted to 1 L. 3. The enzyme activity of a feruloyl esterase is defined as that the amount of an enzyme required to decompose methyl ferulate to produce 1 mol ferulic acid per minute at 50 C. is 1 enzyme activity unit (1 U).
(21) A calculation formula of the activity of the feruloyl esterase is as follows:
activity of feruloyl esterase=(dilution multiple*concentration of ferulic acid*volume of reaction system)/(reaction time*relative molecular mass of ferulic acid*volume of added enzyme solution).
(22) A high performance liquid chromatogram of a ferulic acid standard product is shown in
(23) TABLE-US-00001 TABLE 1 Elution procedure Time/min A phase/% B phase/% 0 90 10 0.23 70 30 1.66 50 50 4.97 0 100 5.57 85 15 7.52 90 10 7.60 90 10 5. A method for detecting the yield of ferulic acid in a reaction solution is as follows:
(24) The reaction solution is first subjected to enzyme deactivation with boiling water for 10 minutes and then filtered with a 0.22 m membrane, a crude enzyme solution obtained after enzyme deactivation is used as a blank control, and the concentration of ferulic acid in the reaction solution is detected by HPLC (high performance liquid chromatography).
Example 1: Obtaining of Bacillus pumilus SK52.001
(25) Specific steps are as follows:
(26) 1. Isolation and Purification of Bacillus pumilus SK52.001
(27) Soil derived from a Gonghu bay wetland area in Wuxi, Jiangsu province was used as a sample, 1.0 g of the sample was added into 10 mL of sterile water filled with glass beads, and the mixture was subjected to oscillation in a shaker at 30 C. and 200 r/min for 30 minutes to make bacterial cells fully separated, so as to obtain a mixed bacterial solution; 0.5 mL of the mixed bacterial solution was sucked into a 10 mL centrifuge tube filled with 4.5 mL of normal saline in a sterile environment to obtain a 10.sup.1 diluent, and the dilution step above was repeated to sequentially obtain a 10.sup.2 diluent, a 10.sup.3 diluent, a 10.sup.4 diluent, a 10.sup.5 diluent and a 10.sup.6 diluent; 100 L of the diluents with dilution gradients of 10.sup.3, 10.sup.4, 10.sup.5 and 10.sup.6 were separately sucked, spread on a culture medium for strain isolation and subjected to inverted culture in a constant-temperature incubator at 30 C. for 24-48 hours to obtain diluted spread plates; single colonies on the diluted spread plates were picked, streaked on a culture medium for solid screening and subjected to inverted culture in the constant-temperature incubator at 30 C. for 24 hours to obtain single colonies; whether there were transparent circles around the single colonies was observed, and the single colonies with transparent circles around were screened; one single colony was screened this time, and a strain corresponding to the single colony was named SK52.001.
(28) 2. Identification of Bacillus pumilus SK52.001
(29) A genome of the strain SK52.001 was extracted, 16S rDNA of the strain SK52.001 was subjected to amplification and sequencing (completed by Tianyi Huiyuan Biotechnology Co., Ltd.), a 16S rDNA sequence of the strain SK52.001 obtained after sequencing analysis (the 16S rDNA sequence of SK52.001 is shown in SEQ ID NO: 1) was compared in GenBank, and it was shown through results that the strain was Bacillus pumilus and named Bacillus pumilus SK52.001.
(30) 3. Observation of Bacillus pumilus SK52.001
(31) A bacterial solution of Bacillus pumilus SK52.001 was streaked on an LB solid culture medium and subjected to inverted culture in a constant-temperature incubator at 30 C. for 12 hours to obtain a single colony; the single colony was picked, and an LB liquid culture medium was inoculated with the single colony for culturing in a shaker at 30 C. and 200 r/min for 12 hours to obtain a bacterial solution; the bacterial solution was diluted 100 times with sterile water, spread on an LB solid culture medium and then cultured in an incubator at 30 C. for 18 hours, and the colony morphology was observed (the colony morphology is shown in
(32) It can be seen from
(33) It can be seen from
Example 2: Production of a Feruloyl Esterase
(34) Specific steps are as follows:
(35) A seed culture medium was inoculated with a single colony of Bacillus pumilus SK52.001 obtained in Example 1 for culturing in a shaker at 30 C. and 200 r/min for 18 hours to obtain a seed solution; a basic fermentation culture medium was inoculated with the seed solution according to an inoculation amount of 5% (v/v) for fermentation in a shaker at 30 C. and 200 r/min for 26 hours to obtain a fermentation solution.
(36) The fermentation solution is centrifuged at 4 C. and 10,000 rpm for 10 minutes to obtain a crude enzyme solution; the enzyme activity of the feruloyl esterase in the crude enzyme solution is detected, and a detection method is as follows:
(37) 250 L of the crude enzyme solution was added into 750 L of a methyl ferulate solution with a concentration of 0.003 mol/L to obtain an enzyme reaction system (the methyl ferulate solution was obtained by dissolving methyl ferulate in a Tris-HCl buffer solution with a pH of 8.0 and a concentration of 0.05 mol/L); the enzyme reaction system was subjected to a reaction in a water bath pot at 50 C. for 30 minutes and enzyme deactivation with boiling water for 10 minutes and then filtered with a 0.22 m membrane to obtain a reaction solution; the crude enzyme solution obtained after enzyme inactivation was used as a blank control, and the concentration of ferulic acid in the reaction solution was detected by HPLC (high performance liquid chromatography); the concentration of ferulic acid was substituted into a calculation formula of the activity of the feruloyl esterase to obtain the enzyme activity of the feruloyl esterase in the crude enzyme solution.
(38) According to detection results, the enzyme activity of the feruloyl esterase in the crude enzyme solution is 195 U/L.
(39) In order to further prove that Bacillus pumilus SK52.001 can produce the feruloyl esterase, the reaction solution is analyzed by LC-MS (analysis results are shown in
(40) It can be seen from
Example 3: Production of a Feruloyl Esterase
(41) Specific steps are as follows:
(42) On the basis of Example 1, the basic fermentation culture medium was separately replaced with fermentation culture media A-E to obtain fermentation solutions A-E.
(43) The fermentation culture medium A includes 45 g/L wheat bran, 5 g/L tryptone, 1.0 g/L K.sub.2HPO.sub.4.Math.3H.sub.2O, 0.5 g/L KCl, 0.5 g/L MgSO.sub.4.Math.7H.sub.2O and 0.01 g/L FeSO.sub.4.Math.7H.sub.2O, and the pH is 6.0.
(44) The fermentation culture medium B includes 10 g/L starch-removed wheat bran, 2 g/L NaNO.sub.3, 1.0 g/L K.sub.2HPO.sub.4.Math.3H.sub.2O, 0.5 g/L KCl, 0.5 g/L MgSO.sub.4.Math.7H.sub.2O and 0.01 g/L FeSO.sub.4.Math.7H.sub.2O, and the pH is natural. A treatment method of the starch-removed wheat bran includes: soaking wheat bran in a potassium acetate solution with a concentration of 0.3% (w/w) to obtain a mixture, constantly stirring the mixture in a water bath at 95 C. for 1 hour, repeatedly rinsing the mixture with deionized water until starch was completely removed and then drying the mixture at 105 C. to reach a constant weight for later use.
(45) The fermentation culture medium C includes 10 g/L wheat bran, 2 g/L NaNO.sub.3, 1.0 g/L K.sub.2HPO.sub.4.Math.3H.sub.2O, 0.5 g/L KCl, 0.5 g/L MgSO.sub.4.Math.7H.sub.2O and 0.01 g/L FeSO.sub.4.Math.7H.sub.2O, and the pH is natural.
(46) The fermentation culture medium D includes 45 g/L wheat bran, 2 g/L NaNO.sub.3, 1.0 g/L K.sub.2HPO.sub.4.Math.3H.sub.2O, 0.5 g/L KCl, 0.5 g/L MgSO.sub.4.Math.7H.sub.2O and 0.01 g/L FeSO.sub.4.Math.7H.sub.2O, and the pH is natural.
(47) The fermentation culture medium E includes 45 g/L wheat bran, 5 g/L yeast extract, 1.0 g/L K.sub.2HPO.sub.4.Math.3H.sub.2O, 0.5 g/L KCl, 0.5 g/L MgSO.sub.4.Math.7H.sub.2O and 0.01 g/L FeSO.sub.4.Math.7H.sub.2O, and the pH is natural.
(48) The fermentation solutions A-E were separately centrifuged at 4 C. and 10,000 rpm for 10 minutes to obtain crude enzyme solutions A-E; the enzyme activity of the feruloyl esterase in the crude enzyme solutions A-E was detected; according to detection results, the enzyme activity of the feruloyl esterase in the crude enzyme solutions A-E was separately 421 U/L, 73 U/L, 102 U/L, 241 U/L and 344 U/L. It can be seen that when the fermentation culture medium A is used, the yield of the feruloyl esterase from Bacillus pumilus SK52.001 is the highest.
Example 4: Performance of a Feruloyl Esterase
(49) Specific steps are as follows:
(50) The specific enzyme activity of the feruloyl esterase in a crude enzyme solution A is detected, and a detection method is as follows:
(51) 100 mg of coomassie brilliant blue G-250 was weighed and dissolved in 50 mL of 90% (v/v) ethanol, 100 mL of 85% (v/v) phosphoric acid was added, and the mixture was diluted with distilled water to 1 L to obtain a coomassie brilliant blue G-250 dyeing solution; 100 mg of bovine albumin was weighed, dissolved and diluted with distilled water to 100 mL to obtain a standard protein solution; 0, 0.02, 0.04, 0.06, 0.08 and 0.10 mL of the standard protein solution were sucked and added into 1.0, 0.98, 0.96, 0.94, 0.92 and 0.90 mL of distilled water respectively, and 5 mL of the coomassie brilliant blue G-250 dyeing solution was separately added into the solutions and mixed uniformly to obtain mixed solutions; the mixed solutions were subjected to a reaction at 25 C. for 2 minutes to obtain reaction solutions; the absorbance of the reaction solutions was detected at a wavelength of 595 nm, and a protein concentration standard curve was drawn (the standard curve is shown in
(52) 100 L of the crude enzyme solution A obtained in Example 2 was diluted with distilled water to 1 mL to obtain a diluent; 5 mL of the coomassie brilliant blue G-250 dyeing solution was added into the diluent and mixed uniformly to obtain a mixed solution; the mixed solution was subjected to a reaction at 25 C. for 2 minutes to obtain a reaction solution; the absorbance of the reaction solution was detected at a wavelength of 595 nm; the concentration of protein in the crude enzyme solution A was calculated based on the detected absorbance and the protein concentration standard curve, and the specific enzyme activity of the feruloyl esterase in the crude enzyme solution A was calculated based on the concentration of protein in the crude enzyme solution A.
(53) A calculation formula of the specific enzyme activity of the feruloyl esterase is as follows:
specific enzyme activity=enzyme activity of crude enzyme solution/concentration of protein.
(54) According to detection results, the concentration of protein in the crude enzyme solution A is 0.81 mg/mL, and the specific enzyme activity of the feruloyl esterase in the crude enzyme solution A is 519 U/g.
(55) A genome of Bacillus pumilus SK52.001 is subjected to PCR amplification to obtain a gene of the feruloyl esterase, and the gene is subjected to sequencing; according to sequencing results, the amino acid sequence of the feruloyl esterase in the crude enzyme solution A is shown in SEQ ID NO: 2, and the nucleotide sequence of the gene encoding the feruloyl esterase in the crude enzyme solution A is shown in SEQ ID NO: 3.
Example 5: Production of Ferulic Acid
(56) Specific steps are as follows:
(57) A seed culture medium was inoculated with a single colony of Bacillus pumilus SK52.001 obtained in Example 1 for culturing in a shaker at 30 C. and 200 r/min for 18 hours to obtain a seed solution; a basic fermentation culture medium was inoculated with the seed solution according to an inoculation amount of 5% (v/v) and fermented in a shaker at 30 C. and 200 r/min for 40 hours to obtain a fermentation solution; the fermentation solution was continuously sampled during fermentation; the sampled fermentation solution was centrifuged at 4 C. and 10,000 rpm for 10 minutes to obtain a crude enzyme solution; 250 L of the crude enzyme solution was added into 750 L of a methyl ferulate solution with a concentration of 0.003 mol/L to obtain an enzyme reaction system (the methyl ferulate solution was obtained by dissolving methyl ferulate in a Tris-HCl buffer solution with a pH of 8.0 and a concentration of 0.05 mol/L); the enzyme reaction system was subjected to a reaction in a water bath pot at 50 C. for 30 minutes to obtain a reaction solution.
(58) The yield of ferulic acid in the reaction solution was detected.
(59) According to results shown in
Example 6: Construction of Recombinant Bacillus subtilis
(60) Specific steps are as follows:
(61) A genome of Bacillus pumilus SK52.001 obtained in Example 1 was used as a template, fae-F and fae-R were used as primers, and a gene encoding a feruloyl esterase (SEQ ID NO: 3) was obtained by PCR amplification; the gene encoding the feruloyl esterase and a pMA5 plasmid were ligated by using a homologous recombinase Exnase II to obtain a ligation product; the ligation product was transformed into competent cells of Escherichia coli DH5a; the transformed competent cells of Escherichia coli DH5a were spread on an LB solid culture medium (containing 100 g/mL ampicillin) and subjected to inverted culture at 37 C. for 24 hours; positive transformants were picked, plasmids were extracted, and a recombinant plasmid PMA5-fae was obtained after correct sequencing verification; the obtained recombinant plasmid PMA5-fae was transformed into Bacillus subtilis WB800 to obtain a transformation product; the transformation product was spread on an LB solid culture medium (containing 100 g/mL kanamycin) and subjected to inverted culture in a constant-temperature incubator at 37 C. for 8-12 hours to obtain a transformant; the transformant was subjected to PCR verification, and recombinant Bacillus subtilis WB800/PMA5-fae was obtained after correct verification.
(62) The primers are as follows:
(63) TABLE-US-00002 fae-F: (SEQIDNO:4) aaaaggagcgatttacatatgATGAAC TTACAAGAGCAAATCAAAATCGCTGC; and fae-R: (SEQIDNO:5) gagctcgactctagaggatccTTAATG GTGATGGTGATGATGTTCAAATGCCTTT.
Example 7: Production of a Feruloyl Esterase
(64) Specific steps are as follows:
(65) A transformant of recombinant Bacillus subtilis WB800/PMA5-fae obtained in Example 1 was streaked on an LB solid culture medium (containing 100 g/mL kanamycin) and subjected to inverted culture in a constant-temperature incubator at 30 C. for 12 hours to obtain a single colony; the single colony was picked, and an LB liquid culture medium (containing 100 g/mL kanamycin) was inoculated with the single colony for culturing at 37 C. and 200 r/min for 12 hours to obtain a seed solution; a Super Rich culture medium was inoculated with the seed solution according to an inoculation amount of 3% (v/v) for culturing at 37 C. and 200 r/min for 60 hours to obtain a fermentation solution.
(66) 1 mL of the fermentation solution was sampled at regular intervals during fermentation; the fermentation solution was centrifuged at 4 C. and 10,000 rpm for 15 minutes to obtain a fermentation supernatant and a precipitate; 1 mL of a lysis solution was added into the precipitate for resuspending bacterial cells to obtain a resuspension solution (whole cells).
(67) The enzyme activity of the feruloyl esterase in the fermentation supernatants and resuspension solutions obtained after different fermentation times is detected (detection results are shown in Table 2), and a detection method is as follows:
(68) 10 L of the fermentation supernatant or resuspension solution was added into 990 L of a methyl ferulate solution with a concentration of 0.003 mol/L to obtain an enzyme reaction system (the methyl ferulate solution was obtained by dissolving methyl ferulate in a Tris-HCl buffer solution with a pH of 8.0 and a concentration of 0.05 mol/L); the enzyme reaction system was subjected to a reaction in a water bath pot at 50 C. for 10 minutes and enzyme deactivation with boiling water for 10 minutes and then filtered with a 0.22 m membrane to obtain a reaction solution; a crude enzyme solution obtained after enzyme inactivation was used as a blank control, and the concentration of ferulic acid in the reaction solution was detected by HPLC (high performance liquid chromatography); the concentration of ferulic acid was substituted into a calculation formula of the activity of the feruloyl esterase to obtain the enzyme activity of the feruloyl esterase in the crude enzyme solution.
(69) It can be seen from Table 2 that when fermentation is performed for 14 hours, the enzyme activity of the feruloyl esterase in the resuspension solution obtained by fermentation of recombinant Bacillus subtilis WB800/PMA5-fae reaches 3.20 U/mL; when fermentation is performed for 60 hours, the enzyme activity of the feruloyl esterase in the fermentation supernatant obtained by fermentation of recombinant Bacillus subtilis WB800/PMA5-fae reaches 20.80 U/mL; when fermentation is performed for 14 hours or above, the enzyme activity of the feruloyl esterase in the resuspension solution obtained by fermentation of recombinant Bacillus subtilis WB800/PMA5-fae is first reduced and then improved; when fermentation is performed for 40 hours or above, the enzyme activity of the feruloyl esterase in the fermentation supernatant obtained by fermentation of recombinant Bacillus subtilis WB800/PMA5-fae is constantly improved.
(70) TABLE-US-00003 TABLE 2 The enzyme activity of the feruloyl esterase in the fermentation supernatants and resuspension solutions obtained after different fermentation times Fermentation Resuspension Group supernatant (U/mL) solution (U/mL) Fermentation 0.20 0.17 for 6 hours Fermentation 2.13 3.20 for 14 hours Fermentation 1.24 1.01 for 20 hours Fermentation 10.01 1.51 for 25 hours Fermentation 17.92 1.94 for 37 hours Fermentation 15.10 2.27 for 42 hours Fermentation 16.15 1.86 for 48 hours Fermentation 18.81 1.45 for 54 hours Fermentation 20.80 1.60 for 60 hours
Example 8: Production of a Feruloyl Esterase
(71) Specific steps are as follows:
(72) Bacillus subtilis WB800 was used as a contrast, and a transformant of recombinant Bacillus subtilis WB800/PMA5-fae obtained in Example 7 was streaked on an LB solid culture medium (containing 100 g/mL kanamycin) and subjected to inverted culture in a constant-temperature incubator at 30 C. for 12 hours to obtain a single colony; the single colony was picked, and an LB liquid culture medium (containing 100 g/mL kanamycin) was inoculated with the single colony for culturing at 37 C. and 200 r/min for 12 hours to obtain a seed solution; a Super Rich culture medium was inoculated with the seed solution according to an inoculation amount of 3% (v/v) and cultured at 37 C. and 200 r/min for 14 hours to obtain a fermentation solution.
(73) After fermentation was completed, 5 mL of the fermentation solution was taken and centrifuged at 4 C. and 8,000 rpm for 15 minutes to obtain a fermentation supernatant and a precipitate; 5 mL of a lysis solution was added into the precipitate for resuspending bacterial cells to obtain a resuspension solution (whole cells); the resuspension solution was subjected to ultrasonication for 15 minutes to obtain a cell disruption solution; the cell disruption solution was centrifuged at 4 C. and 8,000 rpm for 15 minutes to obtain a cell disruption supernatant.
(74) The enzyme activity of the feruloyl esterase in the fermentation supernatants and cell disruption supernatants obtained by fermentation of Bacillus subtilis WB800 and recombinant Bacillus subtilis WB800/PMA5-fae is detected (detection results are shown in Table 3).
(75) It can be seen from Table 3 that when fermentation is performed for 14 hours, the enzyme activity of the intracellular feruloyl esterase obtained by fermentation of recombinant Bacillus subtilis WB800/PMA5-fae is 82.53 U/mL and is 4 times higher than 20.80 U/mL which is the enzyme activity of the extracellular feruloyl esterase when fermentation is performed for 60 hours; at the same time, the activity of the intracellular feruloyl esterase of recombinant Bacillus subtilis WB800/PMA5-fae is significantly higher than that of the intracellular feruloyl esterase of Bacillus subtilis WB800. Therefore, the intracellular feruloyl esterase after fermentation is performed for 14 hours is used as a basis for subsequent enzyme purification.
(76) TABLE-US-00004 TABLE 3 The enzyme activity of the feruloyl esterase in the fermentation supernatants and cell disruption supernatants obtained by fermentation of different kinds of Bacillus subtilis Recombinant Bacillus subtilis Bacillus subtilis WB800 WB800/PMA5-fae Fermentation Cell disruption Fermentation Cell disruption supernatant supernatant supernatant supernatant 0.85 U/mL 2.08 U/mL 2.13 U/mL 82.53 U/mL
Example 9: Performance of a Feruloyl Esterase
(77) Specific steps are as follows:
(78) A cell disruption supernatant obtained by fermentation of recombinant Bacillus subtilis WB800/PMA5-fae obtained in Example 3 was purified with a nickel column, dialyzed three times with a dialysis solution containing 0.01 mol/L EDTA and then dialyzed three times with a dialysis solution without EDTA to obtain a pure enzyme; the pure enzyme was placed in a refrigerator at 4 C. for later use.
(79) After the pure enzyme is diluted 0-50 times, the enzyme activity of the feruloyl esterase in the pure enzyme is detected according to the method in Example 5, and detection results are shown in Table 4.
(80) It can be seen from Table 4 that a dilution multiple of 20 times is the best choice; the enzyme activity of the feruloyl esterase in the pure enzyme diluted 20 times is detected, and a detection method is as follows:
(81) 100 mg of coomassie brilliant blue G-250 was weighed and dissolved in 50 mL of 90% (v/v) ethanol, 100 mL of 85% (v/v) phosphoric acid was added, and the mixture was diluted with distilled water to 1 L to obtain a coomassie brilliant blue G-250 dyeing solution; 100 mg of bovine albumin was weighed, dissolved and diluted with distilled water to 100 mL to obtain a standard protein solution; 0, 0.02, 0.04, 0.06, 0.08 and 0.10 mL of the standard protein solution were sucked and added into 1.0, 0.98, 0.96, 0.94, 0.92 and 0.90 mL of distilled water respectively, and 5 mL of the coomassie brilliant blue G-250 dyeing solution was separately added into the solutions and mixed uniformly to obtain mixed solutions; the mixed solutions were subjected to a reaction at room temperature (25 C.) for 5 minutes to obtain reaction solutions; the absorbance of the reaction solutions was detected at a wavelength of 595 nm, and a protein concentration standard curve was drawn (the standard curve is shown in
(82) 500 L of distilled water and 5 mL of the coomassie brilliant blue G-250 dyeing solution were sequentially added into 500 L of the pure enzyme and then uniformly mixed to obtain a mixed solution; the mixed solution was subjected to a reaction at room temperature (25 C.) for 5 minutes to obtain a reaction solution; the absorbance of the reaction solution was detected at a wavelength of 595 nm; the concentration of protein in the pure enzyme was calculated based on the detected absorbance and the protein concentration standard curve, and the specific enzyme activity of the feruloyl esterase was calculated based on the activity of the feruloyl esterase in the pure enzyme diluted 20 times.
(83) A calculation formula of the specific enzyme activity of the feruloyl esterase is as follows:
specific enzyme activity=enzyme activity of crude enzyme solution/concentration of protein.
(84) According to detection results, the concentration of protein in the pure enzyme diluted 20 times is 0.15 mg/mL, and the specific enzyme activity of the feruloyl esterase in the pure enzyme diluted 20 times is 2230 U/mg.
(85) TABLE-US-00005 TABLE 4 The enzyme activity of the feruloyl esterase in the pure enzymes diluted different times Dilution Volume of added Enzyme multiple of enzyme (after activity pure enzyme dilution)/L (U/mL) Note 0 10 47.85 A reaction of a substrate is complete 2 10 60.53 A reaction of a substrate is almost complete 5 10 142.25 A reaction of a substrate is almost complete 20 10 334.50 A peak height ratio is 4:3 50 10 210.89 A peak height ratio is 1:4
(86) Although the disclosure has been disclosed above in preferred examples, the examples are not intended to limit the disclosure. Various changes and modifications can be made by those skilled in the art without departing from the spirit and scope of the disclosure. Therefore, the protection scope of the disclosure should be defined by the claims.