Mut- methylotrophic yeast

12270034 · 2025-04-08

Assignee

Inventors

Cpc classification

International classification

Abstract

A recombinant methanol utilization pathway deficient methylotrophic yeast (Mut) host cell which is engineered: a) by one or more genetic modifications to reduce expression of a first and a second endogenous gene compared to the host cell prior to said one or more genetic modifications, wherein i. the first endogenous gene encodes alcohol oxidase 1 (AOX1) comprising the amino acid sequence identified as SEQ ID NO:1 or a homologue thereof, and ii. the second endogenous gene encodes alcohol oxidase 2 (AOX2) comprising the amino acid sequence identified as SEQ ID NO:3 or a homologue thereof, and b) by one or more genetic modifications to increase expression of an alcohol dehydrogenase (ADH2) gene compared to the host cell prior to said one or more genetic modifications, wherein the ADH2 gene encodes an alcohol dehydrogenase (ADH2).

Claims

1. A recombinant methanol utilization pathway deficient methylotrophic yeast (Mut.sup.) host cell which is engineered: a) by one or more genetic modifications to reduce expression of a first and a second endogenous gene compared to the host cell prior to said one or more genetic modifications, wherein i. the first endogenous gene encodes alcohol oxidase 1 (Aox1) comprising the amino acid sequence identified as SEQ ID NO:1 or a homologue thereof, and ii. the second endogenous gene encodes alcohol oxidase 2 (Aox2) comprising the amino acid sequence identified as SEQ ID NO:3 or a homologue thereof, and b) by one or more genetic modifications that increases expression of an alcohol dehydrogenase 2 (Adh2) gene compared to the host cell prior to said one or more genetic modifications, wherein the Adh2 gene encodes an alcohol dehydrogenase 2 (ADH2), and wherein the methylotrophic yeast is a P. pastoris strain.

2. The Mut.sup. host cell of claim 1, wherein said one or more genetic modifications to reduce expression of the first and second endogenous gene or said one or more genetic modifications that increases expression of the Adh2 gene comprises a disruption, substitution, or deletion of (i) one or more polynucleotides, or a part thereof; or (ii) an expression control sequence.

3. The Mut.sup. host cell of claim 2, wherein said expression control sequence is selected from the group consisting of a promoter, a ribosomal binding site, transcriptional or translational start and stop sequences, an enhancer and an activator sequence.

4. The Mut.sup. host cell of claim 1, wherein said first and/or second endogenous gene is knocked out by said one or more genetic modifications.

5. The Mut.sup. host cell of claim 1, wherein the Adh2 gene is endogenous or heterologous to the Mut host cell.

6. The Mut.sup. host cell of claim 1, wherein the ADH2 is any one of: a) a P. pastoris ADH2 comprising the amino acid sequence of SEQ ID NO:50, or a homologue thereof that is endogenous to a yeast species; or b) a mutant of the ADH2 of a), which is at least 60% identical to SEQ ID NO:50.

7. The Mut.sup. host cell of claim 1, wherein said one or more genetic modifications include a gain-of-function alteration in the Adh2 gene resulting in an increase in the level or activity of ADH2.

8. The Mut.sup. host cell of claim 7, wherein said gain-of-function alteration includes a knockin of the Adh2 gene.

9. The Mut.sup. host cell of claim 7, wherein said gain-of-function alteration up-regulates Adh2 gene expression in said cell.

10. The Mut.sup. host cell of claim 7, wherein said gain-of-function alteration includes an insertion of a heterologous expression cassette to overexpress the Adh2 gene in said cell.

11. The Mut.sup. host cell of claim 10, wherein said heterologous expression cassette comprises a heterologous polynucleotide comprising an Adh2 gene under the control of a promoter sequence.

12. The Mut.sup. host cell of claim 1, wherein the Mut.sup. host cell comprises a heterologous gene of interest expression cassette (GOIEC) comprising an expression cassette promoter (ECP) operably linked to a gene of interest (GOI) encoding a protein of interest (POI).

13. The Mut.sup. host cell of claim 12, wherein the ECP is a methanol-inducible promoter.

14. The Mut.sup. host cell of claim 13, wherein the ECP is any one of the following: a) a pAOX1 promoter comprising at least 60% sequence identity to SEQ ID NO: 5; b) a pAOX2 promoter comprising at least 60% sequence identity to SEQ ID NO: 6; or c) a promoter comprising a nucleotide sequence selected from the group consisting of SEQ ID NO:36-49.

15. The Mut.sup. host cell of claim 12, wherein the GOIEC further comprises a nucleotide sequence encoding a signal peptide enabling the secretion of the POI.

16. The Mut.sup. host cell of claim 15, wherein the nucleotide sequence encoding the signal peptide is fused adjacent to the 5-end of the GOI.

17. The Mut.sup. host cell of claim 12, wherein the POI is heterologous to the Mut.sup. host cell or the ECP.

18. The Mut.sup. host cell of claim 12, wherein the POI is a peptide or protein selected from the group consisting of an antigen-binding protein, a therapeutic protein, an enzyme, a peptide, a protein antibiotic, a toxin fusion protein, a carbohydrate-protein conjugate, a structural protein, a regulatory protein, a vaccine antigen, a growth factor, a hormone, a cytokine, and a process enzyme.

19. A method of producing a protein of interest (POI), comprising culturing the Mut.sup. host cell of claim 1 using methanol as a carbon source to produce the POI.

20. The method of claim 19, further comprising isolating a fermentation product from the cell culture, wherein the fermentation product comprises the POI or a host cell metabolite obtained from the Mut.sup. host cell.

21. The method of claim 19, wherein: a) a growing phase of the culturing step, during which the Mut.sup. host cell is cultured using a basal carbon source as a source of energy, is followed by b) a production phase of the culturing step, during which the Mut.sup. host cell is cultured using a methanol feed, thereby producing the POI.

22. The method of claim 21, wherein an average methanol concentration of 0.5-2.0% (v/v) is used in the host cell culture during the production phase, wherein the production phase is at least 24 hours in length.

23. The method of claim 22, wherein the methanol feed is at an average feed rate of at least 2 mg methanol/(g dry biomass*h) during the production phase of at least 24 hours.

24. The method of claim 21, wherein the Mut.sup. host cell is cultured during the production phase under conditions limiting the host cell growth to less than 10% (w/w biomass).

25. The Mut.sup. host cell of claim 1, wherein the one or more genetic modifications to reduce expression of the first and second endogenous genes comprises a knockout, or the one or more genetic modifications that increases expression of the Adh2 gene comprises a knockin, of (i) one or more polynucleotides or a part thereof; or (ii) an expression control sequence.

Description

FIGURES

(1) FIG. 1: Sequences referred to herein

DETAILED DESCRIPTION OF THE INVENTION

(2) Specific terms as used throughout the specification have the following meaning.

(3) The term carbon source as used herein shall mean a fermentable carbon substrate, typically a source carbohydrate, suitable as an energy source for microorganisms, such as those capable of being metabolized by host organisms or production cell lines, in particular sources selected from the group consisting of monosaccharides, oligosaccharides, polysaccharides, alcohols including glycerol, in the purified form, in minimal media or provided in raw materials, such as a complex nutrient material. The carbon source may be used as described herein as a single carbon source or as a mixture of different carbon sources.

(4) As described herein, methanol is used as a carbon source, e.g., as a sole carbon source during a production phase, or in a mixture with a non-methanol carbon source. Specifically, methanol is co-fed to the cell culture with any non-methanol carbon source.

(5) A non-methanol carbon source is herein understood as a carbon source which is any other than methanol, in particular a methanol-free carbon source.

(6) A basal carbon source such as described herein typically is a carbon source suitable for cell growth, such as a nutrient for host cells, in particular for eukaryotic cells. The basal carbon source may be provided in a medium, such as a basal medium or complex medium, but also in a chemically defined medium containing a purified carbon source. The basal carbon source typically is provided in an amount to provide for cell growth, in particular during the growth phase in a cultivation process, for example to obtain cell densities of at least 5 g/L cell dry mass, preferably at least 10 g/L cell dry mass, or at least 15 g/L cell dry mass, e.g. exhibiting viabilities of more than 90% during standard sub-culture steps, preferably more than 95%.

(7) The basal carbon source is typically used in an excess or surplus amount, which is understood as an excess providing energy to increase the biomass, e.g. during the cultivation of a cell line with a high specific growth rate, such as during the growth phase of a cell line in a batch or fed-batch cultivation process. This surplus amount is particularly in excess of the limited amount of a supplemental carbon source (as used under growth-limited conditions) to achieve a residual concentration in the fermentation broth that is measurable and typically at least 10 fold higher, preferably at least 50 fold or at least 100 fold higher than during feeding the limited amount of the supplemental carbon source.

(8) A supplemental carbon source such as described herein typically is a supplemental substrate facilitating the production of fermentation products by production cell lines, in particular in the production phase of a cultivation process. The production phase specifically follows a growth phase, e.g. in batch, fed-batch and continuous cultivation process. The supplemental carbon source specifically may be contained in the feed of a fed-batch process. The supplemental carbon source is typically employed in a cell culture under carbon substrate limited conditions, i.e. using the carbon source in a limited amount.

(9) Specifically, in a method described herein methanol is used as a supplemental carbon source.

(10) A limited amount of a carbon source or a limited carbon source is herein understood to specifically refer to the type and amount of a carbon substrate facilitating the production of fermentation products by production cell lines, in particular in a cultivation process with controlled growth rates of less than the maximum growth rate. The production phase specifically follows a growth phase, e.g. in batch, fed-batch and continuous cultivation process. Cell culture processes may employ batch culture, continuous culture, and fed-batch culture. Batch culture is a culture process by which a small amount of a seed culture solution is added to a medium and cells are grown without adding an additional medium or discharging a culture solution during culture.

(11) Continuous culture is a culture process by which a medium is continuously added and discharged during culture. The continuous culture also includes perfusion culture. Fed-batch culture, which is an intermediate between the batch culture and the continuous culture and also referred to as semi-batch culture, is a culture process by which a medium is continuously or sequentially added during culture but, unlike the continuous culture, a culture solution is not continuously discharged.

(12) Specifically preferred is a fed-batch process which is based on feeding of a growth limiting nutrient substrate to a culture. The fed-batch strategy, including single fed-batch or repeated fed-batch fermentation, is typically used in bio-industrial processes to reach a high cell density in the bioreactor. The controlled addition of the carbon substrate directly affects the growth rate of the culture and helps to avoid overflow metabolism or the formation of unwanted metabolic byproducts. Under carbon source limited conditions, the carbon source specifically may be contained in the feed of a fed-batch process. Thereby, the carbon substrate is provided in a limited amount.

(13) Also in chemostat or continuous culture as described herein, the growth rate can be tightly controlled.

(14) The limited amount of a carbon source is herein particularly understood as the amount of a carbon source necessary to keep a production cell line under growth-limited conditions, e.g. in a production phase or production mode. Such a limited amount may be employed in a fed-batch process, where the carbon source is contained in a feed medium and supplied to the culture at low feed rates for sustained energy delivery, e.g. to produce a POI, while keeping the biomass at low specific growth rates. A feed medium is typically added to a fermentation broth during the production phase of a cell culture.

(15) The limited amount of a carbon source may, for example, be determined by the residual amount of the carbon source in the cell culture broth, which is below a predetermined threshold or even below the detection limit as measured in a standard (carbohydrate) assay. The residual amount typically would be determined in the fermentation broth upon harvesting a fermentation product.

(16) The limited amount of a carbon source may as well be determined by defining the average feed rate of the carbon source to the fermenter, e.g. as determined by the amount added over the full cultivation process, e.g. the fed-batch phase, per cultivation time, to determine a calculated average amount per time. This average feed rate is kept low to ensure complete usage of the supplemental carbon source by the cell culture, e.g. between 0.6 g L.sup.1 h.sup.1 (g carbon source per L initial fermentation volume and h time) and 25 g L.sup.1 h.sup.1, preferably between 1.6 g L.sup.1 h.sup.1 and 20 g L.sup.1 h.sup.1.

(17) The limited amount of a carbon source may also be determined by measuring the specific growth rate, which specific growth rate is kept low, e.g. lower than the maximum specific growth rate, during the production phase, e.g. within a predetermined range, such as in the range of 0.001 h.sup.1 to 0.20 h.sup.1, or 0.005 h.sup.1 to 0.20 h.sup.1, preferably between 0.01 h.sup.1 and 0.15 h.sup.1.

(18) Specifically, a feed medium is used which is chemically defined and comprising methanol.

(19) The term chemically defined with respect to cell culture medium, such as a minimal medium or feed medium in a fed-batch process, shall mean a cultivation medium suitable for the in vitro cell culture of a production cell line, in which all of the chemical components and (poly)peptides are known. Typically, a chemically defined medium is entirely free of animal-derived components and represents a pure and consistent cell culture environment.

(20) The term cell or host cell as used herein shall refer to a single cell, a single cell clone, or a cell line of a host cell. The term host cell shall particularly apply to a cell of methylotrophic yeast, which is suitably used for recombination purposes to produce a POI or a host cell metabolite. It is well understood that the term host cell does not include human beings. Specifically, host cells as described herein are artificial organisms and derivatives of native (wild-type) host cells. It is well understood that the host cells, methods and uses described herein, e.g., specifically referring to those comprising one or more genetic modifications, said heterologous expression cassettes or constructs, said transfected or transformed host cells and recombinant proteins, are non-naturally-occurring, man-made or synthetic, and are therefore not considered as a result of law of nature.

(21) The term cell line as used herein refers to an established clone of a particular cell type that has acquired the ability to proliferate over a prolonged period of time. A cell line is typically used for expressing an endogenous or recombinant gene, or products of a metabolic pathway to produce polypeptides or cell metabolites mediated by such polypeptides.

(22) The host cell producing the POI as described herein is also referred to as production host cell, and a respective cell line a production cell line. A production cell line is commonly understood to be a cell line ready-to-use for cell culture in a bioreactor to obtain the product of a production process, such as a POI.

(23) Specific embodiments described herein refer to a Mut production host cell, which can effectively use ADH2 to enzymatically process methanol thereby providing energy to the cell.

(24) Specific embodiments described herein refer to a production cell line which is engineered to underexpress endogenous genes encoding the AOX1 and AOX2 proteins, and to overexpress a gene encoding ADH2, and is characterized by a high yield of POI production under the control of an ECP described herein, using methanol as a carbon source.

(25) The term cell culture or culturing or cultivation as used herein with respect to a host cell refers to the maintenance of cells in an artificial, e.g., an in vitro environment, under conditions favoring growth, differentiation or continued viability, in an active or quiescent state, of the cells, specifically in a controlled bioreactor according to methods known in the industry.

(26) When culturing a cell culture using appropriate culture media, the cells are brought into contact with the media in a culture vessel or with substrate under conditions suitable to support culturing the cells in the cell culture. As described herein, a culture medium is provided that can be used for the growth of host cells e.g., methylotrophic yeast. Standard cell culture techniques are well-known in the art.

(27) The cell cultures as described herein particularly employ techniques which provide for the production of a secreted POI, such as to obtain the POI in the cell culture medium, which is separable from the cellular biomass, herein referred to as cell culture supernatant, and may be purified to obtain the POI at a higher degree of purity. When a protein (such as e.g., a POI) is produced and secreted by the host cell in a cell culture, it is herein understood that such proteins are secreted into the cell culture supernatant, and can be obtained by separating the cell culture supernatant from the host cell biomass, and optionally further purifying the protein to produce a purified protein preparation.

(28) Cell culture media provide the nutrients necessary to maintain and grow cells in a controlled, artificial and in vitro environment. Characteristics and compositions of the cell culture media vary depending on the particular cellular requirements. Important parameters include osmolality, pH, and nutrient formulations. Feeding of nutrients may be done in a continuous or discontinuous mode according to methods known in the art.

(29) Whereas a batch process is a cell culture mode in which all the nutrients necessary for culturing the cells are contained in the initial culture medium, without additional supply of further nutrients during fermentation, in a fed-batch process, after a batch phase, a feeding phase takes place in which one or more nutrients are supplied to the culture by feeding. Although in most processes the mode of feeding is critical and important, the host cell and methods described herein are not restricted with regard to a certain mode of cell culture.

(30) A recombinant POI can be produced using the host cell and the respective cell line described herein, by culturing in an appropriate medium, isolating the expressed product or metabolite from the culture, and optionally purifying it by a suitable method.

(31) Several different approaches for the production of the POI as described herein are preferred. A POI may be expressed, processed and optionally secreted by transfecting or transforming a host cell with an expression vector harboring recombinant DNA encoding the relevant protein, preparing a culture of the transfected or transformed cell, growing the culture, inducing transcription and POI production, and recovering the POI.

(32) In certain embodiments, the cell culture process is a fed-batch process. Specifically, a host cell transformed with a nucleic acid construct encoding a desired recombinant POI, is cultured in a growth phase and transitioned to a production phase in order to produce a desired recombinant POI.

(33) In another embodiment, host cells described herein are cultured in a continuous mode, e.g., employing a chemostat. A continuous fermentation process is characterized by a defined, constant and continuous rate of feeding of fresh culture medium into a bioreactor, whereby culture broth is at the same time removed from the bioreactor at the same defined, constant and continuous removal rate. By keeping culture medium, feeding rate and removal rate at the same constant level, the cell culture parameters and conditions in the bioreactor remain constant.

(34) A stable cell culture as described herein is specifically understood to refer to a cell culture maintaining the genetic properties, specifically keeping the POI production level high, e.g. at least at a g level, even after about 20 generations of cultivation, preferably at least 30 generations, more preferably at least 40 generations, most preferred of at least 50 generations. Specifically, a stable recombinant host cell line is provided which is considered a great advantage when used for industrial scale production.

(35) The cell culture described herein is particularly advantageous for methods on an industrial manufacturing scale, e.g. with respect to both the volume and the technical system, in combination with a cultivation mode that is based on feeding of nutrients, in particular a fed-batch or batch process, or a continuous or semi-continuous process (e.g. chemostat).

(36) The host cell described herein is typically tested for its capacity to express the GOI for POI production, tested for the POI yield by any of the following tests: ELISA, activity assay, HPLC, or other suitable tests, such as SDS-PAGE and Western Blotting techniques, or mass spectrometry.

(37) To determine the effect of one or more genetic modifications on the underexpression or reduction of expression of the genes encoding the AOX1 and/or AOX2 protein(s) in the respective cell culture and e.g., on their effect on POI production, the host cell line may be cultured in microtiter plates, shake flask, or bioreactor using fed-batch or chemostat fermentations in comparison with strains without such genetic modification(s) in the respective cell.

(38) The production method described herein specifically allows for the fermentation on a pilot or industrial scale. The industrial process scale would preferably employ volumes of at least 10 L, specifically at least 50 L, preferably at least 1 m.sup.3, preferably at least 10 m.sup.3, most preferably at least 100 m.sup.3.

(39) Production conditions in industrial scale are preferred, which refer to e.g., fed batch culture in reactor volumes of 100 L to 10 m.sup.3 or larger, employing typical process times of several days, or continuous processes in fermenter volumes of approximately 50-1000 L or larger, with dilution rates of approximately 0.02-0.15 h.sup.1.

(40) The devices, facilities and methods used for the purpose described herein are specifically suitable for use in and with culturing any desired cell line including prokaryotic and/or eukaryotic cell lines. Further, in embodiments, the devices, facilities and methods are suitable for culturing any cell type including suspension cells or anchorage-dependent (adherent) cells and are suitable for production operations configured for production of pharmaceutical and biopharmaceutical productssuch as polypeptide products (POI), nucleic acid products (for example DNA or RNA), or cells and/or viruses such as those used in cellular and/or viral therapies.

(41) In certain embodiments, the cells express or produce a product, such as a recombinant therapeutic or diagnostic product. As described in more detail herein, examples of products produced by cells include, but are not limited to, POIs such as exemplified herein including antibody molecules (e.g., monoclonal antibodies, bispecific antibodies), antibody mimetics (polypeptide molecules that bind specifically to antigens but that are not structurally related to antibodies such as e.g. DARPins, affibodies, adnectins, or IgNARs), fusion proteins (e.g., Fc fusion proteins, chimeric cytokines), other recombinant proteins (e.g., glycosylated proteins, enzymes, hormones), or viral therapeutics (e.g., anti-cancer oncolytic viruses, viral vectors for gene therapy and viral immunotherapy), cell therapeutics (e.g., pluripotent stem cells, mesenchymal stem cells and adult stem cells), vaccines or lipid-encapsulated particles (e.g., exosomes, virus-like particles), RNA (such as e.g. siRNA) or DNA (such as e.g. plasmid DNA), antibiotics or amino acids. In embodiments, the devices, facilities and methods can be used for producing biosimilars.

(42) As mentioned, in certain embodiments, devices, facilities and methods allow for the production of eukaryotic cells, such as for example yeast cells, e.g., POIs including proteins, peptides, or antibiotics, amino acids, nucleic acids (such as DNA or RNA), synthesized by said cells in a large-scale manner. Unless stated otherwise herein, the devices, facilities, and methods can include any desired volume or production capacity including but not limited to bench-scale, pilot-scale, and full production scale capacities.

(43) Moreover, and unless stated otherwise herein, the devices, facilities, and methods can include any suitable reactor(s) including but not limited to stirred tank, airlift, fiber, microfiber, hollow fiber, ceramic matrix, fluidized bed, fixed bed, and/or spouted bed bioreactors. As used herein, reactor can include a fermentor or fermentation unit, or any other reaction vessel and the term reactor is used interchangeably with fermentor. For example, in some aspects, an example bioreactor unit can perform one or more, or all, of the following: feeding of nutrients and/or carbon sources, injection of suitable gas (e.g., oxygen), inlet and outlet flow of fermentation or cell culture medium, separation of gas and liquid phases, maintenance of temperature, maintenance of oxygen and CO.sub.2 levels, maintenance of pH level, agitation (e.g., stirring), and/or cleaning/sterilizing. Example reactor units, such as a fermentation unit, may contain multiple reactors within the unit, for example the unit can have 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, or 100, or more bioreactors in each unit and/or a facility may contain multiple units having a single or multiple reactors within the facility. In various embodiments, the bioreactor can be suitable for batch, semi fed-batch, fed-batch, perfusion, and/or a continuous fermentation processes. Any suitable reactor diameter can be used. In embodiments, the bioreactor can have a volume between about 100 mL and about 50,000 L. Non-limiting examples include a volume of 100 mL, 250 mL, 500 mL, 750 mL, 1 liter, 2 liters, 3 liters, 4 liters, 5 liters, 6 liters, 7 liters, 8 liters, 9 liters, 10 liters, 15 liters, 20 liters, 25 liters, 30 liters, 40 liters, 50 liters, 60 liters, 70 liters, 80 liters, 90 liters, 100 liters, 150 liters, 200 liters, 250 liters, 300 liters, 350 liters, 400 liters, 450 liters, 500 liters, 550 liters, 600 liters, 650 liters, 700 liters, 750 liters, 800 liters, 850 liters, 900 liters, 950 liters, 1000 liters, 1500 liters, 2000 liters, 2500 liters, 3000 liters, 3500 liters, 4000 liters, 4500 liters, 5000 liters, 6000 liters, 7000 liters, 8000 liters, 9000 liters, 10,000 liters, 15,000 liters, 20,000 liters, and/or 50,000 liters. Additionally, suitable reactors can be multi-use, single-use, disposable, or non-disposable and can be formed of any suitable material including metal alloys such as stainless steel (e.g., 316L or any other suitable stainless steel) and Inconel, plastics, and/or glass.

(44) In embodiments and unless stated otherwise herein, the devices, facilities, and methods described herein can also include any suitable unit operation and/or equipment not otherwise mentioned, such as operations and/or equipment for separation, purification, and isolation of such products. Any suitable facility and environment can be used, such as traditional stick-built facilities, modular, mobile and temporary facilities, or any other suitable construction, facility, and/or layout. For example, in some embodiments modular clean-rooms can be used. Additionally, and unless otherwise stated, the devices, systems, and methods described herein can be housed and/or performed in a single location or facility or alternatively be housed and/or performed at separate or multiple locations and/or facilities.

(45) Suitable techniques may encompass culturing in a bioreactor starting with a batch phase, followed by a short exponential fed batch phase at high specific growth rate, further followed by a fed batch phase at a low specific growth rate. Another suitable culture technique may encompass a batch phase followed by a fed-batch phase at any suitable specific growth rate or combinations of specific growth rate such as going from high to low growth rate over POI production time, or from low to high growth rate over POI production time. Another suitable culture technique may encompass a batch phase followed by a continuous culturing phase at a low dilution rate.

(46) A preferred embodiment includes a batch culture to provide biomass followed by a fed-batch culture for high yields POI production.

(47) It is preferred to culture a host cell as described herein in a bioreactor under growth conditions to obtain a cell density of at least 1 g/L cell dry weight, more preferably at least 10 g/L cell dry weight, preferably at least 20 g/L cell dry weight, preferably at least any one of 30, 40, 50, 60, 70, or 80 g/L cell dry weight. It is advantageous to provide for such yields of biomass production on a pilot or industrial scale.

(48) A growth medium allowing the accumulation of biomass, specifically a basal growth medium, typically comprises a carbon source, a nitrogen source, a source for sulphur and a source for phosphate. Typically, such a medium comprises furthermore trace elements and vitamins, and may further comprise amino acids, peptone or yeast extract.

(49) Preferred nitrogen sources include NH.sub.4H.sub.2PO.sub.4, or NH.sub.3 or (NH.sub.4).sub.2SO.sub.4,

(50) Preferred sulphur sources include MgSO.sub.4, or (NH.sub.4).sub.2SO.sub.4 or K.sub.2SO.sub.4,

(51) Preferred phosphate sources include NH.sub.4H.sub.2PO.sub.4, or H.sub.3PO.sub.4, or NaH.sub.2PO.sub.4, KH.sub.2PO.sub.4, Na.sub.2HPO.sub.4 or K.sub.2HPO.sub.4;

(52) Further typical medium components include KCl, CaCl.sub.2), and Trace elements such as: Fe, Co, Cu, Ni, Zn, Mo, Mn, I, B;

(53) Preferably the medium is supplemented with vitamin B.sub.7; A typical growth medium for P. pastoris comprises glycerol, sorbitol or glucose, NH.sub.4H.sub.2PO.sub.4, MgSO.sub.4, KCl, CaCl.sub.2), biotin, and trace elements.

(54) In the production phase a production medium is specifically used with only a limited amount of a supplemental carbon source.

(55) Preferably the host cell line is cultured in a mineral medium with a suitable carbon source, thereby further simplifying the isolation process significantly. An example of a preferred mineral medium is one containing an utilizable carbon source (in particular methanol as described herein optionally in combination with e.g., glucose, glycerol, or sorbitol), salts containing the macro elements (potassium, magnesium, calcium, ammonium, chloride, sulphate, phosphate) and trace elements (copper, iodide, manganese, molybdate, cobalt, zinc, and iron salts, and boric acid), and optionally vitamins or amino acids, e.g., to complement auxotrophies.

(56) Specifically, the cells are cultured under conditions suitable to effect expression of the desired POI, which can be purified from the cells or culture medium, depending on the nature of the expression system and the expressed protein, e.g., whether the protein is fused to a signal peptide and whether the protein is soluble or membrane-bound. As will be understood by the skilled artisan, culture conditions will vary according to factors that include the type of host cell and particular expression vector employed.

(57) A typical production medium comprises a supplemental carbon source, and further NH.sub.4H.sub.2PO.sub.4, MgSO.sub.4, KCl, CaCl.sub.2), biotin, and trace elements.

(58) For example the feed of the supplemental carbon source added to the fermentation may comprise a carbon source with up to 50 wt % utilizable sugars.

(59) The fermentation preferably is carried out at a pH ranging from 3 to 8. Typical fermentation times are about 24 to 120 hours with temperatures in the range of 20 C. to 35 C., preferably 22-30 C.

(60) The POI is preferably expressed employing conditions to produce titers of at least 1 mg/L, preferably at least 10 mg/L, preferably at least 100 mg/L, most preferred at least 1 g/L.

(61) The term expression or expression cassette as used herein refers to nucleic acid molecules containing a desired coding sequence and control sequences in operable linkage, so that hosts transformed or transfected with these sequences are capable of producing the encoded proteins or host cell metabolites. In order to effect transformation, the expression system may be included in a vector; however, the relevant DNA may also be integrated into a host cell chromosome. Expression may refer to secreted or non-secreted expression products, including polypeptides or metabolites.

(62) Expression cassettes are conveniently provided as expression constructs e.g., in the form of vectors or plasmids, which are typically DNA sequences that are required for the transcription of cloned recombinant nucleotide sequences, i.e. of recombinant genes and the translation of their mRNA in a suitable host organism. Expression vectors or plasmids usually comprise an origin for autonomous replication or a locus for genome integration in the host cells, selectable markers (e.g., an amino acid synthesis gene or a gene conferring resistance to antibiotics such as zeocin, kanamycin, G418 or hygromycin, nourseothricin), a number of restriction enzyme cleavage sites, a suitable promoter sequence and a transcription terminator, which components are operably linked together. The terms plasmid and vector as used herein include autonomously replicating nucleotide sequences as well as genome integrating nucleotide sequences, such as artificial chromosomes e.g., a yeast artificial chromosome (YAC).

(63) Expression vectors may include but are not limited to cloning vectors, modified cloning vectors and specifically designed plasmids. Preferred expression vectors described herein are expression vectors suitable for expressing of a recombinant gene in a eukaryotic host cell and are selected depending on the host organism. Appropriate expression vectors typically comprise regulatory sequences suitable for expressing DNA encoding a POI in a eukaryotic host cell. Examples of regulatory sequences include promoter, operators, enhancers, ribosomal binding sites, and sequences that control transcription and translation initiation and termination. The regulatory sequences are typically operably linked to the DNA sequence to be expressed.

(64) Specific expression constructs described herein comprise a promoter operably linked to a nucleotide sequence encoding a POI under the transcriptional control of said promoter. Specifically, the promoter is not natively associated with the coding sequence of the POI.

(65) To allow expression of a recombinant nucleotide sequence in a host cell, the expression cassette or vector described herein as GOIEC comprises an ECP, typically a promoter nucleotide sequence which is adjacent to the 5 end of the coding sequence, e.g., upstream from and adjacent to a gene of interest (GOI), or if a signal or leader sequence is used, upstream from and adjacent to said signal and leader sequence, respectively, to facilitate expression and secretion of the POI. The promoter sequence is typically regulating and initiating transcription of the downstream nucleotide sequence, with which it is operably linked, including in particular the Gal.

(66) Specific expression constructs described herein comprise a polynucleotide encoding the POI linked with a leader sequence which causes secretion of the POI from the host cell. The presence of such a secretion leader sequence in the expression vector is typically required when the POI intended for recombinant expression and secretion is a protein which is not naturally secreted and therefore lacks a natural secretion leader sequence, or its nucleotide sequence has been cloned without its natural secretion leader sequence. In general, any secretion leader sequence effective to cause secretion of the POI from the host cell may be used. The secretion leader sequence may originate from yeast source, e.g. from yeast -factor such as MFa of Saccharomyces cerevisiae, or yeast phosphatase, from mammalian or plant source, or others.

(67) In specific embodiments, multicloning vectors may be used, which are vectors having a multicloning site. Specifically, a desired heterologous gene can be integrated or incorporated at a multicloning site to prepare an expression vector. In the case of multicloning vectors, a promoter is typically placed upstream of the multicloning site.

(68) The term gene expression, or expressing a polynucleotide as used herein, is meant to encompass at least one step selected from the group consisting of DNA transcription into mRNA, mRNA processing, mRNA maturation, mRNA export, translation, protein folding and/or protein transport.

(69) The term increase expression herein also referred to as overexpression refers to any amount higher than an expression level exhibited by a reference standard, which may be the host cell prior to the genetic alteration to increase expression of a certain polynucleotide, or which is otherwise expressed in a host cell of the same type or species which is not engineered to increase expression of said polynucleotide.

(70) If a host cell does not comprise a given gene product, it is possible to introduce the gene product into the host cell for expression; in this case, any detectable expression is encompassed by the term overexpression.

(71) Overexpression of a gene encoding a protein (such as ADH2), is also referred to as overexpression of a protein (such as ADH2). Overexpression can be achieved in any ways known to a skilled person in the art. In general, it can be achieved by increasing transcription/translation of the gene, e.g. by increasing the copy number of the gene or altering or modifying regulatory sequences or sites associated with expression of a gene. For example, the gene can be operably linked to a strong promoter in order to reach high expression levels. Such promoters can be endogenous promoters or heterologous, in particular recombinant promoters. One can substitute a promoter with a heterologous promoter which increases expression of the gene. Using inducible promoters additionally makes it possible to increase the expression in the course of cultivation. Furthermore, overexpression can also be achieved by, for example, modifying the chromosomal location of a particular gene, altering nucleic acid sequences adjacent to a particular gene such as a ribosome binding site or transcription terminator, introducing a frame-shift in the open reading frame, modifying proteins (e.g., regulatory proteins, suppressors, enhancers, transcriptional activators and the like) involved in transcription of the gene and/or translation of the gene product, or any other conventional means of deregulating expression of a particular gene routine in the art (including but not limited to use of antisense nucleic acid molecules, for example, to block expression of repressor proteins or deleting or mutating the gene for a transcriptional factor which normally represses expression of the gene desired to be overexpressed. Prolonging the life of the mRNA may also improve the level of expression. For example, certain terminator regions may be used to extend the half-lives of mRNA. If multiple copies of genes are included, the genes can either be located in plasmids of variable copy number or integrated and amplified in the chromosome. It is possible to introduce one or more genes or genomic sequences into the host cell for expression.

(72) According to a specific embodiment, a polynucleotide encoding the ADH2 protein can be presented in a single copy or in multiple copies per cell. The copies may be adjacent to or distant from each other. According to another specific embodiment, overexpression of the ADH2 protein employs recombinant nucleotide sequences encoding the ADH2 protein provided on one or more plasmids suitable for integration into the genome (i.e., knockin) of the host cell, in a single copy or in multiple copies per cell. The copies may be adjacent to or distant from each other. Overexpression can be achieved by expressing multiple copies of the polynucleotide, such as 2, 3, 4, 5, 6 or more copies of said polynucleotide per host cell.

(73) A recombinant nucleotide sequence comprising a GOI and a polynucleotide (gene) encoding the ADH2 protein may be provided on one or more autonomously replicating plasmids, and introduced in a single copy or in multiple copies per cell.

(74) Alternatively, the recombinant nucleotide sequence comprising a GOI and a polynucleotide (gene) encoding the ADH2 protein may be present on the same plasmid, and introduced in a single copy or multiple copies per cell.

(75) A heterologous polynucleotide (gene) encoding the ADH2 protein or a heterologous recombinant expression construct comprising the polynucleotide (gene) encoding the ADH2 protein is preferably integrated into the genome of the host cell.

(76) The term genome generally refers to the whole hereditary information of an organism that is encoded in the DNA (or RNA). It may be present in the chromosome, on a plasmid or vector, or both. Preferably, polynucleotide (gene) encoding the ADH2 protein is integrated into the chromosome of said cell.

(77) The polynucleotide (gene) encoding the ADH2 protein may be integrated in its natural locus. Natural locus means the location on a specific chromosome, where the polynucleotide (gene) encoding the ADH2 protein is located in a naturally-occurring wild-type cell. However, in another embodiment, the polynucleotide (gene) encoding the ADH2 protein is present in the genome of the host cell not at their natural locus, but integrated ectopically. The term ectopic integration means the insertion of a nucleic acid into the genome of a microorganism at a site other than its usual chromosomal locus, i.e., predetermined or random integration. In another embodiment, the polynucleotide (gene) encoding the ADH2 protein is integrated into the natural locus and ectopically. Heterologous recombination can be used to achieve random or non-targeted integration. Heterologous recombination refers to recombination between DNA molecules with significantly different sequences.

(78) For yeast cells, the polynucleotide (gene) encoding the ADH2 protein and/or the GOI may be inserted into a desired locus, such as AOX1, GAP, ENO1, TEF, HIS4 (Zamir et al., Proc. NatL Acad. Sci. USA (1981) 78(6):3496-3500), HO (Voth et al. Nucleic Acids Res. 2001 Jun. 15; 29(12): e59), TYR1 (Mirisola et al., Yeast 2007; 24: 761-766), His3, Leu2, Ura3 (Taxis et al., BioTechniques (2006) 40:73-78), Lys2, ADE2, TRP1, GAL1, ADH1 or on the integration of 5S ribosomal RNA gene.

(79) In other embodiments, the polynucleotide (gene) encoding the ADH2 protein and/or the GOI can be integrated in a plasmid or vector. Preferably, the plasmid is a eukaryotic expression vector, preferably a yeast expression vector. Suitable plasmids or vectors are further described herein.

(80) Overexpression of an endogenous or heterologous polynucleotide in a recombinant host cell can be achieved by modifying expression control sequences. Expression control sequences are known in the art and include, for example, promoters, enhancers, polyadenylation signals, transcription terminators, internal ribosome entry sites (IRES), and the like, that provide for the expression of the polynucleotide sequence in a host cell. Expression control sequences interact specifically with cellular proteins involved in transcription. Exemplary expression control sequences are described in, for example, Goeddel, Gene Expression Technology: Methods in Enzymology, Vol. 185, Academic Press, San Diego, Calif. (1990).

(81) In a preferred embodiment, the overexpression is achieved by using an enhancer to express the polynucleotide. Transcriptional enhancers are relatively orientation and position independent, having been found 5 and 3 to the transcription unit, within an intron, as well as within the coding sequence itself. The enhancer may be spliced into the expression vector at a position 5 or 3 to the coding sequence, but is preferably located at a site 5 from the promoter. Most yeast genes contain only one UAS, which generally lies within a few hundred base pairs of the cap site and most yeast enhancers (UASs) cannot function when located 3 of the promoter, but enhancers in higher eukaryotes can function both 5 and 3 of the promoter.

(82) Many enhancer sequences are known from mammalian genes (globin, RSV, SV40, EMC, elastase, albumin, a-fetoprotein and insulin). One may also use an enhancer from a eukaryotic cell virus, such as the SV40 late enhancer, the cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and adenovirus enhancers.

(83) Specifically, the GOI and/or the ADH2 encoding polynucleotide (gene) as described herein, are operably linked to transcriptional and translational regulatory sequences that provide for expression in the host cells. The term translational regulatory sequences as used herein refers to nucleotide sequences that are associated with a gene nucleic acid sequence and which regulate the translation of the gene. Transcriptional and/or translational regulatory sequences can either be located in plasmids or vectors or integrated in the chromosome of the host cell. Transcriptional and/or translational regulatory sequences are located in the same nucleic acid molecule of the gene which it regulates.

(84) Specifically, the overexpression of the ADH2 protein can be achieved by methods known in the art, for example by genetically modifying their endogenous regulatory regions, as described by Marx et al., 2008 (Marx, H., Mattanovich, D. and Sauer, M. Microb Cell Fact 7 (2008): 23), such methods include, for example, integration of a recombinant promoter that increases expression of a gene.

(85) For example, overexpression of an endogenous or heterologous polynucleotide in a recombinant host cell can be achieved by modifying the promoters controlling such expression, for example, by replacing a promoter (e.g., an endogenous promoter or a promoter which is natively linked to said polynucleotide in a wild-type organism) which is operably linked to said polynucleotide with another, stronger promoter in order to reach high expression levels. Such promoter may be inductive or constitutive. Modification of a promoter may also be performed by mutagenesis methods known in the art.

(86) In a preferred embodiment, expression of both, the polynucleotide encoding the ADH2 protein and the polynucleotide encoding the POI, is driven by an inducible promoter. In another preferred embodiment, expression of both, the polynucleotide encoding the ADH2 protein and the polynucleotide encoding the POI, is driven by a constitutive promoter. In yet another preferred embodiment, expression of the polynucleotide encoding the ADH2 protein is driven by a constitutive promoter and expression of the polynucleotide encoding the POI is driven by an inducible promoter. In yet another preferred embodiment, expression of the polynucleotide encoding the ADH2 protein is driven by an inducible promoter and expression of the polynucleotide encoding the POI is driven by a constitutive promoter.

(87) Specifically, a methanol-inducible promoter may be employed in expression constructs used to overexpress the gene encoding ADH2 and/or to express a Gal, as further described herein.

(88) As an example, expression of the polynucleotide encoding the ADH2 protein may be driven by a constitutive GAP promoter and expression of the polynucleotide encoding the POI may be driven by the methanol-inducible AOX1 or AOX2 promoter.

(89) In one embodiment, expression of the polynucleotides encoding the ADH2 protein and the POI is driven by the same promoter or same type of promoters in terms of promoter activity (e.g., the promoter strength) and/or expression behaviour (e.g., inducible or constitutive).

(90) The term reduce expression herein also referred to as underexpression refers to any amount or level (e.g., the activity or concentration) less than an expressed amount or level (e.g., the activity or concentration) exhibited by a reference standard, which may be the host cell prior to the genetic alteration to reduce expression of a certain polynucleotide, or which is otherwise expressed in a host cell of the same type or species which is not engineered to lower expression of said polynucleotide. Reduction of expression as described herein specifically refers to a polynucleotide or gene encoding a defined AOX1 protein or AOX2 protein, in particular a gene that is endogenous to the host cell prior to engineering. In particular, the respective gene product is the defined AOX1 protein or AOX2 protein as described herein. Upon engineering the host cell by genetic modification to reduce expression of said gene the expression of said gene product or polypeptide is at a level which is less than the expression of the same gene product or polypeptide prior to a genetic modification of the host cell or in a comparable host which has not been genetically modified. Less than includes, e.g., 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80, 90% or more. No expression of the gene product or a polypeptide is also encompassed by the term reduction of expression or underexpression.

(91) According to specific embodiments described herein, the host cell is engineered to knock-down or knockout (for inactivation or deletion of a gene or a part thereof) the endogenous host cell gene encoding the AOX1 protein or AOX2 protein (as defined herein, including e.g. homologues or orthologues of the sequences naturally-occurring in wild-type P. pastoris), or other (coding or non-coding) nucleotide sequences which confer the host cell's ability to express or produce said AOX1 protein or AOX2 protein.

(92) Specifically, a deletion strain is provided, wherein a nucleotide sequence is disrupted.

(93) The term disrupt as used herein refers to the significant reduction to complete removal of the expression or activity of one or more endogenous proteins in a host cell, such as by knock-down or knockout. This may be measured as presence of this one or more endogenous proteins in a cell culture or culture medium of the host cell, such as by mass spectrometry wherein the total content of an endogenous protein may be less than a threshold or non-detectable. Alternatively it may be measured as the enzymatic activity of the endogenous protein.

(94) The term disrupted specifically refers to a result of genetic engineering by at least one step selected from the group consisting of gene silencing, gene knock-down, gene knockout, delivery of a dominant negative construct, conditional gene knockout, and/or by gene alteration with respect to a specific gene.

(95) The term knock-down, reduction or deletion in the context of gene expression as used herein refers to experimental approaches leading to reduced expression of a given gene compared to expression in a control cell. Knock-down of a gene can be achieved by various experimental means such as introducing nucleic acid molecules into the cell which hybridize with parts of the gene's mRNA leading to its degradation (e.g., shRNAs, RNAi, miRNAs) or altering the sequence of the gene in a way that leads to reduced transcription, reduced mRNA stability, diminished mRNA translation, or reduced activity of the encoded protein.

(96) A complete inhibition of expression of a given gene is referred to as knockout. Knockout of a gene means that no functional transcripts are synthesized from said gene leading to a loss of function normally provided by this gene. Gene knockout is achieved by altering the DNA sequence leading to disruption or deletion of the gene or its regulatory sequences, or part of such gene or regulatory sequences. Knockout technologies include the use of homologous recombination techniques to replace, interrupt or delete crucial parts or the entire gene sequence or the use of DNA-modifying enzymes such as zinc-finger or mega-nucleases to introduce double strand breaks into DNA of the target gene e.g., described by Gaj et al. (Trends Biotechnol. 2013; 31(7):397-405).

(97) Specific embodiments employ one or more knockout plasmids or cassettes which are transformed or transfected into the host cells. By homologous recombination the target gene in the host cells can be disrupted. This procedure is typically repeated until all alleles of the target gene are stably removed.

(98) One specific method for knocking out a specific gene as described herein is the CRISPR-Cas9 methods as described in e.g., Weninger et al. (J. Biotechnol. 2016, 235:139-49). Another method includes the split marker approach as described by e.g. Heiss et al. 2013 (Appl Microbiol Biotechnol. 97(3):1241-9.)

(99) Another embodiment refers to target mRNA degradation by using small interfering RNA (siRNA) to transfect the host cell and targeting a mRNA encoding the target protein expressed endogenously by said host cell.

(100) Expression of a gene may be inhibited or reduced by methods which directly interfere with gene expression, encompassing, but not restricted to, inhibition or reduction of DNA transcription, e.g., by use of specific promoter-related repressors, by site specific mutagenesis of a given promoter, by promoter exchange, or inhibition or reduction of translation, e.g., by RNAi or non-coding RNA induced post-transcriptional gene silencing. The expression of a dysfunctional, or inactive gene product with reduced activity, can, for example, be achieved by site specific or random mutagenesis, insertions or deletions within the coding gene.

(101) The inhibition or reduction of the activity of gene product can, for example, be achieved by administration of, or incubation with, an inhibitor to the respective enzyme, prior to or simultaneously with protein expression. Examples for such inhibitors include, but are not limited to, an inhibitory peptide, an antibody, an aptamer, a fusion protein or an antibody mimetic against said enzyme, or a ligand or receptor thereof, or an inhibitory peptide or nucleic acid, or a small molecule with similar binding activity.

(102) Gene silencing, gene knock-down and gene knockout refers to techniques by which the expression of a gene is reduced, either through genetic modification or by treatment with an oligonucleotide with a sequence complementary to either an mRNA transcript or a gene. If genetic modification of DNA is done, the result is a knock-down or knockout organism. If the change in gene expression is caused by an oligonucleotide binding to an mRNA or temporarily binding to a gene, this results in a temporary change in gene expression without modification of the chromosomal DNA and is referred to as a transient knock-down.

(103) In a transient knock-down, which is also encompassed by the above term, the binding of this oligonucleotide to the active gene or its transcripts causes decreased expression through blocking of transcription (in the case of gene-binding), degradation of the mRNA transcript (e.g., by small interfering RNA (siRNA) or antisense RNA) or blocking mRNA translation.

(104) Other approaches to carry out gene silencing, knock-down or knockout are known to the skilled person from the respective literature, and their application in the context of the present invention is considered as routine. Gene knockout refers to techniques by which the expression of a gene is fully blocked, i.e. the respective gene is inoperative, or even removed. Methodological approaches to achieve this goal are manifold and known to the skilled person. Examples are the production of a mutant which is dominantly negative for the given gene. Such mutant can be produced by site directed mutagenesis (e.g., deletion, partial deletion, insertion or nucleic acid substitution), by use of suitable transposons, or by other approaches which are known to the skilled person from the respective literature, the application of which in the context of the present invention is thus considered as routine. One example is knockout by use of targeted Zinc Finger Nucleases. A respective Kit is provided by Sigma Aldrich as CompoZR knockout ZFN. Another approach encompasses the use of Transcription activator-like effector nucleases (TALENs).

(105) The delivery of a dominant negative construct involves the introduction of a sequence coding for a dysfunctional gene expression product, e.g., by transfection. Said coding sequence is functionally coupled to a strong promoter, in such way that the gene expression of the dysfunctional enzyme overrules the natural expression of the gene expression product, which, in turn, leads to an effective physiological defect of the respective activity of said gene expression product.

(106) A conditional gene knockout allows blocking gene expression in a tissue- or time-specific manner. This is done, for example, by introducing short sequences called loxP sites around the gene of interest. Again, other approaches are known to the skilled person from the respective literature, and their application in the context of the present invention is considered as routine.

(107) One other approach is gene alteration which may lead to a dysfunctional gene product or to a gene product with reduced activity. This approach involves the introduction of frame shift mutations, nonsense mutations (i.e., introduction of a premature stop codon) or mutations which lead to an amino acid substitution which renders the whole gene product dysfunctional, or causing a reduced activity. Such gene alteration can for example be produced by mutagenesis (e.g., deletion, partial deletion, insertion or nucleic acid substitution), either unspecific (random) mutagenesis or site directed mutagenesis. Protocols describing the practical application of gene silencing, gene knock-down, gene knockout, delivery of a dominant negative construct, conditional gene knockout, and/or gene alteration are commonly available to the skilled artisan, and are within his routine. The technical teaching provided herein is thus entirely enabled with respect to all conceivable methods leading to an inhibition or reduction of gene expression of a gene product, or to the expression of a dysfunctional, or inactive gene product, or with reduced activity.

(108) Genetic modifications described herein may employ tools, methods and techniques known in the art, such as described by J. Sambrook et al., Molecular Cloning: A Laboratory Manual (3rd edition), Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, New York (2001).

(109) The term endogenous as used herein is meant to include those molecules and sequences, in particular endogenous genes or proteins, which are present in the wild-type (native) host cell, prior to its modification to reduce expression of the respective endogenous genes and/or reduce the production of the endogenous proteins. In particular, an endogenous nucleic acid molecule (e.g., a gene) or protein that does occur in (and can be obtained from) a particular host cell as it is found in nature, is understood to be host cell endogenous or endogenous to the host cell. Moreover, a cell endogenously expressing a nucleic acid or protein expresses that nucleic acid or protein as does a host of the same particular type as it is found in nature. Moreover, a host cell endogenously producing or that endogenously produces a nucleic acid, protein, or other compound produces that nucleic acid, protein, or compound as does a host cell of the same particular type as it is found in nature.

(110) Thus, even if an endogenous protein is no more produced by a host cell, such as in a knockout mutant of the host cell, where the protein encoding gene is inactivated or deleted, the protein is herein still referred to as endogenous.

(111) The term heterologous as used herein with respect to a nucleotide sequence, construct such as an expression cassette, amino acid sequence or protein, refers to a compound which is either foreign to a given host cell, i.e. exogenous, such as not found in nature in said host cell; or that is naturally found in a given host cell, e.g., is endogenous, however, in the context of a heterologous construct or integrated in such heterologous construct, e.g., employing a heterologous nucleic acid fused or in conjunction with an endogenous nucleic acid, thereby rendering the construct heterologous. The heterologous nucleotide sequence as found endogenously may also be produced in an unnatural, e.g., greater than expected or greater than naturally found, amount in the cell. The heterologous nucleotide sequence, or a nucleic acid comprising the heterologous nucleotide sequence, possibly differs in sequence from the endogenous nucleotide sequence but encodes the same protein as found endogenously. Specifically, heterologous nucleotide sequences are those not found in the same relationship to a host cell in nature. Any recombinant or artificial nucleotide sequence is understood to be heterologous. An example of a heterologous polynucleotide is a nucleotide sequence not natively associated with a promoter, e.g., to obtain a hybrid promoter, or operably linked to a coding sequence, as described herein. As a result, a hybrid or chimeric polynucleotide may be obtained. A further example of a heterologous compound is a POI encoding polynucleotide operably linked to a transcriptional control element, e.g., a promoter, to which an endogenous, naturally-occurring POI coding sequence is not normally operably linked.

(112) The term operably linked as used herein refers to the association of nucleotide sequences on a single nucleic acid molecule, e.g., a vector, or an expression cassette, in a way such that the function of one or more nucleotide sequences is affected by at least one other nucleotide sequence present on said nucleic acid molecule. By operably linking, a nucleic acid sequence is placed into a functional relationship with another nucleic acid sequence on the same nucleic acid molecule. For example, a promoter is operably linked with a coding sequence of a recombinant gene, when it is capable of effecting the expression of that coding sequence. As a further example, a nucleic acid encoding a signal peptide is operably linked to a nucleic acid sequence encoding a POI, when it is capable of expressing a protein in the secreted form, such as a preform of a mature protein or the mature protein. Specifically, such nucleic acids operably linked to each other may be immediately linked, i.e. without further elements or nucleic acid sequences in between the nucleic acid encoding the signal peptide and the nucleic acid sequence encoding a POI.

(113) The term methylotrophic yeast as used herein refers to of yeast genera and species which share a common metabolic pathway that enables them to use methanol as a sole carbon source for their growth. In a transcriptionally regulated response to methanol induction, several of the enzymes are rapidly synthesized at high levels. Since the promoters controlling the expression of these genes are among the strongest and most strictly regulated yeast promoters, methylotrophic yeast are attractive as hosts for the large scale production of recombinant proteins.

(114) The methylotrophic yeast as described herein is mutated by one or more genetic modifications to render it deficient in the methanol utilization pathway, in particular by underexpressing one or both of the genes encoding the endogenous AOX1 and AOX2 proteins, respectively. A methylotrophic yeast which is underexpressing or otherwise deficient in expressing both, the gene encoding the AOX1 protein and the gene encoding the AOX2 protein is herein understood as Mut. For the purpose describe herein, such Mut yeast is still referred to as methylotrophic yeast, because comprising a functional methanol utilization pathway prior to such genetic modification(s).

(115) A promoter sequence is typically understood to be operably linked to a coding sequence, if the promoter controls the transcription of the coding sequence. If a promoter sequence is not natively associated with the coding sequence, its transcription is either not controlled by the promoter in native (wild-type) cells or the sequences are recombined with different contiguous sequences.

(116) The promoter which is used for the purpose described herein, is herein referred to as ECP. The ECP may be a constitutive, inducible or repressible promoter. In a specific embodiment, the ECP is a promoter which is inducible by methanol and a methanol carbon source, respectively.

(117) The ECP as described herein in particular initiates, regulates, or otherwise mediates or controls the expression of a POI coding DNA. Promoter DNA and coding DNA may be from the same gene or from different genes, and may be from the same or different organisms.

(118) An inducible ECP as described herein is specifically understood as being a regulatable promoter, which has different promoter strength in the repressed and induced state. The term regulatable with respect to an inducible or repressible regulatory element, such as a promoter described herein shall refer to an element that is repressed in a host cell in the presence of an excess amount of a substance (such as a nutrient in the cell culture medium) e.g., in the growth phase of a batch culture, and de-repressed to induce strong activity e.g., in the production phase (such as upon upon feeding of a supplemental substrate, or adding methanol for methanol-induction), according to a fed-batch strategy. A regulatory element can as well be designed to be regulatable, such that the element is inactive without addition of a cell culture additive, and active in the presence of such additive. Thus, expression of a POI under the control of such regulatory element can be induced upon addition of such additive.

(119) The strength of the ECP specifically refers to its transcription strength, represented by the efficiency of initiation of transcription occurring at that promoter with high or low frequency. The higher transcription strength, the more frequently transcription will occur at that promoter. Promoter strength is a typical feature of a promoter, because it determines how often a given mRNA sequence is transcribed, effectively giving higher priority for transcription to some genes over others, leading to a higher concentration of the transcript. A gene that codes for a protein that is required in large quantities, for example, typically has a relatively strong promoter. The RNA polymerase can only perform one transcription task at a time and so must prioritize its work to be efficient. Differences in promoter strength are selected to allow for this prioritization.

(120) A strong ECP is herein preferred, in particular an ECP which is relatively strong in the fully induced state, which is typically understood as the state of about maximal activity. The relative strength is commonly determined with respect to a comparable promoter, herein referred to as a reference promoter, which can be a standard promoter, such as the respective pGAP promoter of the cell as used as the host cell.

(121) The frequency of transcription is commonly understood as the transcription rate, e.g. as determined by the amount of a transcript in a suitable assay, e.g. RT-PCR or Northern blotting. For example, the transcription strength of a promoter according to the invention is determined in the host cell which is P. pastoris and compared to the native pGAP promoter of P. pastoris.

(122) The strength of a promoter to express a gene of interest is commonly understood as the expression strength or the capability of support a high expression level/rate. For example, the expression and/or transcription strength of a promoter of the invention is determined in the host cell which is P. pastoris and compared to the native pGAP promoter of P. pastoris.

(123) The comparative transcription strength compared to a reference promoter may be determined by standard methods, such as by measuring the quantity of transcripts, e.g. employing a microarray, or else in a cell culture, such as by measuring the quantity of respective gene expression products in recombinant cells. In particular, the transcription rate may be determined by the transcription strength on a microarray, Northern blot or with quantitative real time PCR (qRT-PCR) or with RNA sequencing (RNA-seq) where the data show the difference of expression level between conditions with high growth rate and conditions with low growth rate, or conditions employing different media composition, and a high signal intensity as compared to the reference promoter.

(124) The expression rate may, for example, be determined by the amount of expression of a reporter gene, such as eGFP.

(125) ECP as described herein exerts a relatively high transcription strength, e.g., reflected by a transcription rate or transcription strength of at least 15% as compared to the native pGAP promoter in the host cell, also called homologous pGAP promoter. Preferably the transcription rate or strength is at least any one of 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 100%, or even higher, such as at least any one of 110%, 120%, 130%, 140%, 150%, 160%, 170%, 180%, 190%, or 200%, or even higher, as compared to the native pGAP promoter, such as determined in the (e.g. eukaryotic) host cell selected as a host cell for recombination purpose to produce the POI.

(126) The native pGAP promoter typically initiates expression of the gap gene encoding glyceraldehyde-3-phosphate dehydrogenase (GAPDH), which is a constitutive promoter present in most living organisms. GAPDH (EC 1.2.1.12), a key enzyme of glycolysis and gluconeogenesis, plays a crucial role in catabolic and anabolic carbohydrate metabolism.

(127) The native pGAP promoter specifically is active in a recombinant eukaryotic cell in a similar way as in a native eukaryotic cell of the same species or strain, including the unmodified (non-recombinant) or recombinant eukaryotic cell. Such native pGAP promoter is commonly understood to be an endogenous promoter, thus, homologous to the host cell, and may serve as a standard or reference promoter for comparison purposes. The relative expression or transcription strength of a promoter as described herein is usually compared to the native pGAP promoter of a cell of the same species or strain that is used as a host for producing a POI.

(128) The term mutagenesis as used herein shall refer to a method of providing mutants of a nucleotide sequence, e.g. through insertion, deletion and/or substitution of one or more nucleotides, so to obtain variants thereof with at least one change in the non-coding or coding region. Mutagenesis may be through random, semi-random or site directed mutation. Variants can be produced by a suitable mutagenesis method using a parent sequence as a reference. Certain mutagenesis methods encompass those methods of engineering the nucleic acid or de novo synthesizing a nucleotide sequence using the respective parent sequence information as a template. Specific mutagenesis methods apply rational engineering of a mutant.

(129) The term nucleotide sequence or nucleic acid sequence used herein refers to either DNA or RNA. Nucleic acid sequence or polynucleotide sequence or simply polynucleotide refers to a single or double-stranded polymer of deoxyribonucleotide or ribonucleotide bases read from the 5 to the 3 end. It includes expression cassettes, self-replicating plasmids, infectious polymers of DNA or RNA, and non-functional DNA or RNA.

(130) The term protein of interest (POI) as used herein refers to a polypeptide or a protein that is produced by means of recombinant technology in a host cell. More specifically, the protein may either be a polypeptide not naturally-occurring in the host cell, i.e. a heterologous protein, or else may be native to the host cell, i.e. a homologous protein to the host cell, but is produced, for example, by transformation with a self-replicating vector containing the nucleic acid sequence encoding the POI, or upon integration by recombinant techniques of one or more copies of the nucleic acid sequence encoding the POI into the genome of the host cell, or by recombinant modification of one or more regulatory sequences controlling the expression of the gene encoding the POI, e.g., of a promoter sequence. In some cases the term POI as used herein also refers to any metabolite product by the host cell as mediated by the recombinantly expressed protein.

(131) The term sequence identity of a variant, homologue or orthologue as compared to a parent nucleotide or amino acid sequence indicates the degree of identity of two or more sequences. Two or more amino acid sequences may have the same or conserved amino acid residues at a corresponding position, to a certain degree, up to 100%. Two or more nucleotide sequences may have the same or conserved base pairs at a corresponding position, to a certain degree, up to 100%.

(132) Sequence similarity searching is an effective and reliable strategy for identifying homologs with excess (e.g., at least 50%) sequence identity. Sequence similarity search tools frequently used are e.g., BLAST, FASTA, and HMMER.

(133) Sequence similarity searches can identify such homologous proteins or genes by detecting excess similarity, and statistically significant similarity that reflects common ancestry. Homologues may encompass orthologues, which are herein understood as the same protein in different organisms, e.g., variants of such protein in different different organisms or species.

(134) An orthologous sequence of the same protein in different organisms or species is typically homologous to the protein sequence, specifically of orthologs originating from the same genus. Typically, orthologs have at least about any one of 25%, 30%, 35%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, or 95% identity, up to 100% sequence identity.

(135) Specifically, orthologs of a protein can be determined upon replacement of said protein or the gene encoding said protein by the orthologous sequences in a knock-out host cell, which host cell has been modified to knockout the respective gene or protein prior to such replacement.

(136) For example, if a putative ADH2, AOX1 or AOX2 protein is functional in a P. pastoris host cell replacing the respective endogenous protein in a P. pastoris host cell in which the gene encoding such endogenous protein has been knocked out, such putative ADH2, AOX1 or AOX2 protein can be considered a respective homologue for the purpose described herein.

(137) The AOX1 protein comprising or consisting of the amino acid sequence identified as SEQ ID NO:1 is of K. phaffii origin. It is well understood that there are homologous sequences present in other methylotrophic yeast host cells. For example, yeast of Pichia pastoris comprise the respective homologous sequences. Pichia pastoris has been reclassified into a new genus, Komagataella, and split into three species, K. pastoris, K. phaffii, and K. pseudopastoris.

(138) Specific homologous sequences of SEQ ID NO:1 are e.g., found in K. pastoris (e.g., SEQ ID NO:9, such as encoded by the nucleotide sequence comprising or consisting of SEQ ID NO:10), Ogataea polymorpha (e.g., SEQ ID NO:19 such as encoded by the nucleotide sequence comprising or consisting of SEQ ID NO:20) or Ogataea methanolica (e.g., SEQ ID NO:13 such as encoded by the nucleotide sequence comprising or consisting of SEQ ID NO:14).

(139) The AOX2 protein comprising or consisting of the amino acid sequence identified as SEQ ID NO:3 is of K. phaffii origin. It is well understood that there are homologous sequences present in other methylotrophic yeast host cells. For example, yeast of Pichia pastoris comprise the respective homologous sequences. Pichia pastoris has been reclassified into a new genus, Komagataella, and split into three species, K. pastoris, K. phaffii, and K. pseudopastoris.

(140) Specific homologous sequences of SEQ ID NO:3 are e.g., found in K. pastoris (e.g., SEQ ID NO:11, such as encoded by the nucleotide sequence comprising or consisting of SEQ ID NO:12), Ogataea polymorpha (e.g., SEQ ID NO:19, such as encoded by the nucleotide sequence comprising or consisting of SEQ ID NO:20), or Ogataea methanolica (e.g., SEQ ID NO:15, such as encoded by the nucleotide sequence comprising or consisting of SEQ ID NO:16).

(141) Ogataea polymorpha has only one alcohol oxidase, herein exemplified by SEQ ID NO:19. Thus, reducing expression of AOX1 and AOX2 in Ogataea polymorpha as described herein is effectively carried out by reducing expression of the endogenous alcohol oxidase of Ogataea polymorpha.

(142) Any homologous sequence of an AOX1 or AOX2 protein with a certain sequence identity described herein, in particular any such protein which is an ortholog of the P. pastoris AOX1 or AOX2 protein, is included in the definition of the respective AOX1 protein or AOX2 protein, as described herein.

(143) The ADH2 protein comprising or consisting of the amino acid sequence identified as SEQ ID NO:50 is of K. phaffii origin. It is well understood that there are homologous sequences present in other methylotrophic yeast host cells. For example, yeast of Pichia pastoris comprise the respective homologous sequences. Pichia pastoris has been reclassified into a new genus, Komagataella, and split into three species, K. pastoris, K. phaffii, and K. pseudopastoris.

(144) Specific homologous sequences of SEQ ID NO:50 are e.g., any one of SEQ ID NO:52, 54, 56, 58, 60, 62, 64, 66, 68, or 70.

(145) Any homologous sequence of an ADH2 protein with a certain sequence identity described herein, in particular any such protein which is an ortholog of the P. pastoris ADH2 protein, as described herein.

(146) Percent (%) amino acid sequence identity with respect to an amino acid sequence, homologs and orthologues described herein is defined as the percentage of amino acid residues in a candidate sequence that are identical with the amino acid residues in the specific polypeptide sequence, after aligning the sequence and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part of the sequence identity. Those skilled in the art can determine appropriate parameters for measuring alignment, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared.

(147) For purposes described herein, the sequence identity between two amino acid sequences is determined using the NCBI BLAST program version BLASTP 2.8.1 with the following exemplary parameters: Program: blastp, Word size: 6, Expect value: 10, Hitlist size: 100, Gapcosts: 11.1, Matrix: BLOSUM62, Filter string: F, Compositional adjustment: Conditional compositional score matrix adjustment.

(148) Percent (%) identity with respect to a nucleotide sequence e.g., of a promoter or a gene, is defined as the percentage of nucleotides in a candidate DNA sequence that is identical with the nucleotides in the DNA sequence, after aligning the sequence and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part of the sequence identity. Alignment for purposes of determining percent nucleotide sequence identity can be achieved in various ways that are within the skill in the art, for instance, using publicly available computer software. Those skilled in the art can determine appropriate parameters for measuring alignment, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared.

(149) For purposes described herein (unless indicated otherwise), the sequence identity between two amino acid sequences is determined using the NCBI BLAST program version BLASTN 2.8.1 with the following exemplary parameters: Program: blastn, Word size: 11, Expect threshold: 10, Hitlist size: 100, Gap Costs: 5.2, Match/Mismatch Scores: 2,-3, Filter string: Low complexity regions, Mark for lookup table only.

(150) The term isolated or isolation as used herein with respect to a POI shall refer to such compound that has been sufficiently separated from the environment with which it would naturally be associated, in particular a cell culture supernatant, so as to exist in purified or substantially pure form. Yet, isolated does not necessarily mean the exclusion of artificial or synthetic mixtures with other compounds or materials, or the presence of impurities that do not interfere with the fundamental activity, and that may be present, for example, due to incomplete purification. Isolated compounds can be further formulated to produce preparations thereof, and still for practical purposes be isolatedfor example, a POI can be mixed with pharmaceutically acceptable carriers or excipients when used in diagnosis or therapy.

(151) The term purified as used herein shall refer to a preparation comprising at least 50% (mol/mol), preferably at least 60%, 70%, 80%, 90% or 95% of a compound (e.g., a POD. Purity is measured by methods appropriate for the compound (e.g., chromatographic methods, polyacrylamide gel electrophoresis, HPLC analysis, and the like). An isolated, purified POI as described herein may be obtained by purifying the cell culture supernatants to reduce impurities.

(152) As isolation and purification methods for obtaining a recombinant polypeptide or protein product, methods, such as methods utilizing difference in solubility, such as salting out and solvent precipitation, methods utilizing difference in molecular weight, such as ultrafiltration and gel electrophoresis, methods utilizing difference in electric charge, such as ion-exchange chromatography, methods utilizing specific affinity, such as affinity chromatography, methods utilizing difference in hydrophobicity, such as reverse phase high performance liquid chromatography, and methods utilizing difference in isoelectric point, such as isoelectric focusing may be used.

(153) The following standard methods are preferred: cell (debris) separation and wash by Microfiltration or Tangential Flow Filter (TFF) or centrifugation, POI purification by precipitation or heat treatment, POI activation by enzymatic digest, POI purification by chromatography, such as ion exchange (IEX), hydrophobic interaction chromatography (HIC), Affinity chromatography, size exclusion (SEC) or HPLC Chromatography, POI precipitation of concentration and washing by ultrafiltration steps.

(154) A highly purified product is essentially free from contaminating proteins, and preferably has a purity of at least 90%, more preferred at least 95%, or even at least 98%, up to 100%. The purified products may be obtained by purification of the cell culture supernatant or else from cellular debris.

(155) An isolated and purified POI can be identified by conventional methods such as Western blot, HPLC, activity assay, or ELISA.

(156) The term recombinant as used herein shall mean being prepared by or the result of genetic engineering. A recombinant host may be engineered to delete and/or inactivate one or more nucleotides or nucleotide sequences, and may specifically comprise an expression vector or cloning vector containing a recombinant nucleic acid sequence, in particular employing nucleotide sequence foreign to the host. A recombinant protein is produced by expressing a respective recombinant nucleic acid in a host. The term recombinant with respect to a POI as used herein, includes a POI that is prepared, expressed, created or isolated by recombinant means, such as a POI isolated from a host cell transformed to express the POI. In accordance with the present invention conventional molecular biology, microbiology, and recombinant DNA techniques within the skill of the art may be employed. Such techniques are explained fully in the literature. See, e.g., Maniatis, Fritsch & Sambrook, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, (1982).

(157) Certain recombinant host cells are engineered host cells which are understood as host cells which have been manipulated using genetic engineering, i.e. by human intervention. When a host cell is engineered to reduce expression or to underexpress a given gene or the respective protein, the host cell is manipulated such that the host cell has no longer the capability to express such gene and protein, respectively, compared to the host cell under the same condition prior to manipulation, or compared to the host cells which are not engineered such that said gene or protein is underexpressed.

(158) The foregoing description will be more fully understood with reference to the following examples. Such examples are, however, merely representative of methods of practicing one or more embodiments of the present invention and should not be read as limiting the scope of invention.

EXAMPLES

Example 1: Generation of Methanol Utilization Negative Strains of Pichia pastoris

(159) In order to generate the methanol utilization negative strains (Mut.sup.) two genes responsible for the methanol utilization named AOX1 and AOX2 were deleted from the genome of Pichia pastoris (syn. Komagataella phaffii). a) For this purpose the P. pastoris strain (CBS2612, CBS-KNAW Fungal Biodiversity Centre, Centraalbureau voor Schimmelcultures, Utrecht, The Netherlands) was made electrocompetent. The strain was inoculated into 100 mL YPD media (main culture) for 16-20 hours (25 C.; 180 rpm) and harvested at an optical density (OD.sub.600) from 1.8-3 by centrifugation (5 min, 1500 g, 4 C.) in two 50 mL falcon tubes. The cell pellet was resuspended in 10 mL YPD+20 mM HEPES+25 mM DTT and incubated (30 min; 25 C.; 180 rpm). After the incubation period the falcon tubes were filled with 40 mL ice cold sterile distilled water and centrifuged (5 min, 1500 g; 4 C.) (Eppendorf AG, Germany). The cell pellet was resuspended in ice cold sterile 1 mM HEPES buffer, pH 8 and centrifuged (5 min, 1500 g, 4 C.). The cell pellet was resuspended in 45 mL ice cold 1 M sorbitol and centrifuged (5 min, 1500 g, 4 C.). The pellet was resuspended in 500 L ice cold 1M sorbitol and 80 L aliquoted into ice cold 1.5 mL Eppendorf tubes. The aliquoted electro competent cells were kept at 80 C. till used. b) Cultivation of yeast strains was done in YPD media (10 g/L yeast extract, 20 g/L peptone, 20 g/L glucose) or YPD agar plates (10 g/L yeast extract, 20 g/L peptone, 20 g/L glucose, 20 g/L agar-agar) containing 500 g/mL Geneticin or 200 g/mL Hygromycin when necessary for selection. c) For generating the deletion strains of AOX1 and AOX2 the split marker cassette approach was used (Gasser et al., 2013). The DNA fragments for generating the gene deletions are found in Table 1. The split marker cassette was carrying an antibiotic resistance cassette for Geneticin flanked by LoxP sites. d) The deletions were done by adding 0.5 g AOX1 split marker cassette 1 and 0.5 g AOX1 split marker cassette 2 to the aliquoted electro competent cells and incubated for 5 min on ice. The electroporation was performed at 2 kV for 4 milliseconds (Gene Pulser, Bio-Rad Laboratories, Inc, USA). After transformation the electroporated cells were suspended in 1 mL YPD media and regenerated for 1.5 h to 3 h on 30 C. shaking at 700 rpm on a thermoshaker (Eppendorf AG, Germany). Later 20 L and 150 L of the cell suspension was plated on YPD plates containing 500 g/mL Geneticin for selection and incubated on 28 C. for 48 hours. The colonies that appeared were re-streaked onto fresh YPD plates containing 500 g/mL Geneticin. The correct disruption of AOX1 locus was verified by PCR on genomic DNA using the primers AOX1_ctrl_Fwd and AOX1_ctrl_Rev (Table 2) binding outside of the deletion cassette. One clone was selected based on PCR amplification and sequencing of the PCR amplicon confirming correct deletion of the desired gene creating a P. pastoris aox1::KanMX strain. A liquid culture was incubated from a single positive colony and made electrocompetent as explained in Example 1a), except for the addition of 500 g/mL Geneticin to the liquid medium for generating the main culture. The strains were electroporated with 500 g pTAC_Cre_Hph_Mx4 plasmid carrying a Cre recombinase needed for deletion of the Geneticin antibiotic resistance cassette between the LoxP regions and a Hygromycin resistance cassette for selection (Marx, Mattanovich, & Sauer, 2008). The electroporation was done as described and selected for loss of Geneticin resistance by restreaking the transformants in parallel on YPD with 500 g/mL Geneticin and 200 g/mL Hygromycin and YPD plates with only 200 g/mL Hygromycin. Clones were selected which were unable to grow on YPD plates with 500 g/mL Geneticin and 200 g/mL Hygromycin, but could grow on YPD plates with only 200 g/mL Hygromycin. The successful deletion of the AOX1 coding region and antibiotic marker was verified by PCR amplification with the primers AOX1_ctrl_Fwd and AOX1_ctrl_Rev (Table 2) and sequencing of the PCR amplicon (Microsynth AG, Swiss). The generated strain is called P. pastoris CBS2612 aox1 and has a Mut.sup.S phenotype. It was selected for further genetic manipulation. e) The P. pastoris CBS2612 aox1 was used to generate electro competent cells with the protocol described in a) and was electroporated with 0.5 g AOX2 split marker cassette 1 and 0.5 g AOX2 split marker cassette 2 (Table 1) with the procedure described in d). The antibiotic marker was removed with the same procedure as described in d). The successful deletion of the AOX2 coding region and antibiotic marker was verified by PCR amplification with the primers AOX2_ctrl_fwd & AOX2_ctrl_rev (Table 2) and sequencing of the PCR amplicon (Microsynth AG, Swiss). The generated strain is called P. pastoris CBS2612 aox1aox2 and has a methanol utilization negative (Mut.sup.) phenotype. f) Genomic DNA for PCR amplifications was isolated with the Wizard Genomic DNA Purification Kit (Promega Corporation, USA) as per the manufacturer's recommendation. The PCR amplification reactions were done with the Q5 polymerase (New England Biolabs, Inc., USA) as per the manufacturer's recommendations.

(160) TABLE-US-00001 TABLE1 SplitmarkercassetteDNAsequenceusedforgeneratingtheAOX1and AOX2deletionstrains. DNAfragment DNAsequence5to3 AOX1 (SEQIDNO:25) splitmarker AGGGGTCCAAGTAAGAAGCTTCTTGCTGTAGAATTTGGGCATATGTGCTGGTGACAAAG cassette1 GCATCTCTGCCTTGAGTTTCTGACGGCGGGACAGCATTCTTACCGGATATATAACACCA ATTGCCAGCACCACCAATCTCAGAGGTACCCCTAACAAACTTAATAAAATCTTGGGTAT CAACTTCATTAAGCTTTGTAGTTTGCAAGTACTTATAAACAAAATTCCGTAAGGTGTCG TCTTGAGGCTGGGACTTGACAAACTGCCAAAATGGCAACAAATCTACTGGCTTGGCCAT AATTTTGACATTCGAGTCATCAAAGGTAAATTCAACCGGAGACTTGTATTCTTTATTGA TAACTTTCTCATATAGGACATTGTCAGGAACACGATGAAACCAGGATGCCCCCAAATCC AATGAGACTGAGGTTTCATGAGTCGCAACCAACCTACCTCCAATACGGTCCCTACCCTC TAAAATCAACGCATTCACGCCATTGCTTTTGAGATCGACTGCAGCTTTGATGCCTGAAA TCCCAGCGCCTACAATGATGACATTTGGATTTGGTTGACTCATGTTGGTATTGTGAAAT AGACGCAGATCGGGAACACTGAAAAATAACAGTTATTATTCGAGATCTAACATCCAAAG ACGAAAGGTTGAATGAAACCTTTTTGCCATCCGACATCCACAGGTCCATTCTCACACAT AAGTGCCAAACGCAACAGGAGGGGATACACTAGCAGCAGACCGTTGCAAACGCAGGACC TCCACTCCTCTTCTCCTCAACACCCACTTTTGCCATCGAAAAACCAGCCCAGTTATTGG GCTTGATTGGAGCTCGCTCATTCCAATTCCTTCTATTAGGCTACTAACACCATGACTTT ATTAGCCTGTCTATCCTGGCCCCCCTGGCGAGGTTCATGTTTGTTTATTTCCGAATGCA ACAAGCTCCGCATTACACCCGAACATCACTCCAGATGAGGGCTTTCTGAGTGTGGGGTC AGTACGCTGCAGGTCGACAACCCTTAATATAACTTCGTATAATGTATGCTATACGAAGT TATTAGGTCTAGATCGGTACCGACATGGAGGCCCAGAATACCCTCCTTGACAGTCTTGA CGTGCGCAGCTCAGGGGCATGATGTGACTGTCGCCCGTACATTTAGCCCATACATCCCC ATGTATAATCATTTGCATCCATACATTTTGATGGCCGCACGGCGCGAAGCAAAAATTAC GGCTCCTCGCTGCAGACCTGCGAGCAGGGAAACGCTCCCCTCACAGACGCGTTGAATTG TCCCCACGCCGCGCCCCTGTAGAGAAATATAAAAGGTTAGGATTTGCCACTGAGGTTCT TCTTTCATATACTTCCTTTTAAAATCTTGCTAGGATACAGTTCTCACATCACATCCGAA CATAAACAACCATGGGTAAGGAAAAGACTCACGTTTCGAGGCCGCGATTAAATTCCAAC ATGGATGCTGATTTATATGGGTATAAATGGGCTCGCGATAATGTCGGGCAATCAGGTGC GACAATCTATCGATTGTATGGGAAGCCCGATGCGCCAGAGTTGTTTCTGAAACATGGCA AAGGTAGCGTTGCCAATGATGTTACAGATGAGATGGTCAGACTAAACTGGCTGACGGAA TTTATGCCTCTTCCGACCATCAAGCATTTTATCCGTACTCCTGATGATGCATGGTTACT CACCACTGCGATCCCCGGCAAAACAGCATTCCAGGTATTAGAAGAATATCCTGATTCAG GTGAAAATATTGTTGATGCGCTGGCAGTGTTCCTGCGCCGGTTGCATTCGATTCCTGTT TGTAATTGTCCTTTTAACAGCGATCGCGTATTTCGTCTCGCTCAGGCGCAATCACGAAT GAATAACGGTTTGGTTGATGCGAGTGATTTTGATGACGAGCGTAATGGCTGGCCTGTTG AACAAGTCTGGAAAGAAATGCATAAGCTTTTGCCATTCTCACCG AoX1 (SEQIDNO:26) splitmarker AAGCCCGATGCGCCAGAGTTGTTTCTGAAACATGGCAAAGGTAGCGTTGCCAATGATGT cassette2 TACAGATGAGATGGTCAGACTAAACTGGCTGACGGAATTTATGCCTCTTCCGACCATCA AGCATTTTATCCGTACTCCTGATGATGCATGGTTACTCACCACTGCGATCCCCGGCAAA ACAGCATTCCAGGTATTAGAAGAATATCCTGATTCAGGTGAAAATATTGTTGATGCGCT GGCAGTGTTCCTGCGCCGGTTGCATTCGATTCCTGTTTGTAATTGTCCTTTTAACAGCG ATCGCGTATTTCGTCTCGCTCAGGCGCAATCACGAATGAATAACGGTTTGGTTGATGCG AGTGATTTTGATGACGAGCGTAATGGCTGGCCTGTTGAACAAGTCTGGAAAGAAATGCA TAAGCTTTTGCCATTCTCACCGGATTCAGTCGTCACTCATGGTGATTTCTCACTTGATA ACCTTATTTTTGACGAGGGGAAATTAATAGGTTGTATTGATGTTGGACGAGTCGGAATC GCAGACCGATACCAGGATCTTGCCATCCTATGGAACTGCCTCGGTGAGTTTTCTCCTTC ATTACAGAAACGGCTTTTTCAAAAATATGGTATTGATAATCCTGATATGAATAAATTGC AGTTTCATTTGATGCTCGATGAGTTTTTCTAATCAGTACTGACAATAAAAAGATTCTTG TTTTCAAGAACTTGTCATTTGTATAGTTTTTTTATATTGTAGTTGTTCTATTTTAATCA AATGTTAGCGTGATTTATATTTTTTTTCGCCTCGACATCATCTGCCCAGATGCGAAGTT AAGTGCGCAGAAAGTAATATCATGCGTCAATCGTATGTGAATGCTGGTCGCTATACTGG TACCATTCGAGAACCCTTAATATAACTTCGTATAATGTATGCTATACGAAGTTATTAGG TGATATCAGATCCACTGCCATTTGCCTGAGAGATGCAGGCTTCATTTTTGATACTTTTT TATTTGTAACCTATATAGTATAGGATTTTTTTTGTCATTTTGTTTCTTCTCGTACGAGC TTGCTCCTGATCAGCCTATCTCGCAGCTGATGAATATCTTGTGGTAGGGGTTTGGGAAA ATCATTCGAGTTTGATGTTTTTCTTGGTATTTCCCACTCCTCTTCAGAGTACAGAAGAT TAAGTGAGACGTTCGTTTGTGCAAGCTTCAACGATGCCAAAAGGGTATAATAAGCGTCA TTTGCAGCATTGTGAAGAAAACTATGTGGCAAGCCAAGCCTGCGAAGAATGTATTTTAA GTTTGACTTTGATGTATTCACTTGATTAAGCCATAATTCTCGAGTATCTATGATTGGAA GTATGGGAATGGTGATACCCGCATTCTTCAGTGTCTTGAGGTCTCCTATCAGATTATGC CCAACTAAAGCAACCGGAGGAGGAGATTTCATGGTAAATTTCTCTGACTTTTGGTCATC AGTAGACTCGAACTGTGAGACTATCTCGGTTATGACAGCAGAAATGTCCTTCTTGGAGA CAGTAAATGAAGTCCCACCAATAAAGAAATCCTTGTTATCAGGAACAAACTTCTTGTTT CGAACTTTTTCGGTGCCTTGAACTATAAAATGTAGAGTGGATATGTCGGGTAGGAATGG AGCGGGCAAATGCTTACCTTCTGGACCTTCAAGAGGTATGTAGGGTTTGTAGATACTGA TGCCAACTTCAGTGACAACGTTGCTATTTCGTTCAAACCATTCCGAATCCAGAGAAATC AAAGTTGTTTGTCTACTATTGATCCAAGCCAGTGCGGTCTTGAAACTGACAATAGTGTG CTCGTGTTTTGAGGTCATCTTTGT AOX2 (SEQIDNO:27) splitmarker GTACGGGTTTACTGATTTGACATATCTTGGTACTAACGTTACCAATGGTGTTCCAAATA cassette1 ACGCAGATGATGAGCGTGGTTGCATTGCTGGATTTGACAACACTGGTTTCGTGCTGGGA ACTTCATCCTCGTTGTTTAATCAGTTTATTCTGCAACTGAATACGAGTGATCTTTCAGG AGCAATTTACCAAATCATTGAGCATTTTCTGACTGGACTTAGCGAAGACGAAGACGACA TTGCTATCTATTCCCCCAACCCTTTCTACAAAAGTACGTATGCAGGAGTAGGTGCCATT GCGGAAAATGACACCCTTTACTTGGTTGATGGTGGAGAGGATAACCAAAACGTCCCTCT GCAGCCTCTACTTCAAAAGGAGCGTGACGTTGATATCATCTTTGCGTTTGACAACAGTG CAGACACTGACCTCTCTTGGCCAAACGGTTCATCATTAGTCAACACCTACATGAGACAG TTTTCTTCTCAAGCAAATGGAACAACGTTCCCTTATGTACCTGATACCACCACTTTCCT AAACTTGAATCTTTCGAGTAAGCCAACCTTCTTTGGTTGTGATGCTAGAAATTTGACAG ACATTGTTGAAGGCACGGATCACATTCCTCCCCTGGTTGTTTATCTGGCCAATAGACCT TTCTCGTATTGGAGTAACACTTCAACTTTCAAGTTAGACTACTCTGAATCCGAGAAGAG AGGAATGATCCAAAACGGTTTTGAAGTGTCGTCTCGTTTGAACATGACTATTGATGAAG AATGGCGTACTTGTGTTGGATGTGCAATCATTCGTAGACAGCAGGAGAGATCCAATGCA ACACAAACAGAGCAATGTAGAAGATGTTTTGAGAATTATTGTTGGAACGGTGATATTGA CACTTCCACCGAAGATATCCCCGTTAATTTTACCACTACTGGAGCAACCAATGAGGAGA ATGACAACTCCACTTCAATATCATCGGCCAATTCGGTAGCACCTTCCAAACTTTGGTAC CAAGCACCATTGCTGTTGGTCGGCCTTGTCGCATTCTTCATCTAGTACGTACGCTGCAG GTCGACAACCCTTAATATAACTTCGTATAATGTATGCTATACGAAGTTATTAGGTCTAG ATCGGTACCGACATGGAGGCCCAGAATACCCTCCTTGACAGTCTTGACGTGCGCAGCTC AGGGGCATGATGTGACTGTCGCCCGTACATTTAGCCCATACATCCCCATGTATAATCAT TTGCATCCATACATTTTGATGGCCGCACGGCGCGAAGCAAAAATTACGGCTCCTCGCTG CAGACCTGCGAGCAGGGAAACGCTCCCCTCACAGACGCGTTGAATTGTCCCCACGCCGC GCCCCTGTAGAGAAATATAAAAGGTTAGGATTTGCCACTGAGGTTCTTCTTTCATATAC TTCCTTTTAAAATCTTGCTAGGATACAGTTCTCACATCACATCCGAACATAAACAACCA TGGGTAAGGAAAAGACTCACGTTTCGAGGCCGCGATTAAATTCCAACATGGATGCTGAT TTATATGGGTATAAATGGGCTCGCGATAATGTCGGGCAATCAGGTGCGACAATCTATCG ATTGTATGGGAAGCCCGATGCGCCAGAGTTGTTTCTGAAACATGGCAAAGGTAGCGTTG CCAATGATGTTACAGATGAGATGGTCAGACTAAACTGGCTGACGGAATTTATGCCTCTT CCGACCATCAAGCATTTTATCCGTACTCCTGATGATGCATGGTTACTCACCACTGCGAT CCCCGGCAAAACAGCATTCCAGGTATTAGAAGAATATCCTGATTCAGGTGAAAATATTG TTGATGCGCTGGCAGTGTTCCTGCGCCGGTTGCATTCGATTCCTGTTTGTAATTGTCCT TTTAACAGCGATCGCGTATTTCGTCTCGCTCAGGCGCAATCACGAATGAATAACGGTTT GGTTGATGCGAGTGATTTTGATGACGAGCGTAATGGCTGGCCTGTTGAACAAGTCTGGA AAGAAATGCATAAGCTTTTGCCATTCTCACCG AoX2 (SEQIDNO:28) splitmarker AAGCCCGATGCGCCAGAGTTGTTTCTGAAACATGGCAAAGGTAGCGTTGCCAATGATGT cassette2 TACAGATGAGATGGTCAGACTAAACTGGCTGACGGAATTTATGCCTCTTCCGACCATCA AGCATTTTATCCGTACTCCTGATGATGCATGGTTACTCACCACTGCGATCCCCGGCAAA ACAGCATTCCAGGTATTAGAAGAATATCCTGATTCAGGTGAAAATATTGTTGATGCGCT GGCAGTGTTCCTGCGCCGGTTGCATTCGATTCCTGTTTGTAATTGTCCTTTTAACAGCG ATCGCGTATTTCGTCTCGCTCAGGCGCAATCACGAATGAATAACGGTTTGGTTGATGCG AGTGATTTTGATGACGAGCGTAATGGCTGGCCTGTTGAACAAGTCTGGAAAGAAATGCA TAAGCTTTTGCCATTCTCACCGGATTCAGTCGTCACTCATGGTGATTTCTCACTTGATA ACCTTATTTTTGACGAGGGGAAATTAATAGGTTGTATTGATGTTGGACGAGTCGGAATC GCAGACCGATACCAGGATCTTGCCATCCTATGGAACTGCCTCGGTGAGTTTTCTCCTTC ATTACAGAAACGGCTTTTTCAAAAATATGGTATTGATAATCCTGATATGAATAAATTGC AGTTTCATTTGATGCTCGATGAGTTTTTCTAATCAGTACTGACAATAAAAAGATTCTTG TTTTCAAGAACTTGTCATTTGTATAGTTTTTTTATATTGTAGTTGTTCTATTTTAATCA AATGTTAGCGTGATTTATATTTTTTTTCGCCTCGACATCATCTGCCCAGATGCGAAGTT AAGTGCGCAGAAAGTAATATCATGCGTCAATCGTATGTGAATGCTGGTCGCTATACTGG TACCATTCGAGAACCCTTAATATAACTTCGTATAATGTATGCTATACGAAGTTATTAGG TGATATCAGATCCACTTCCTCTTACGGCTTTCTTTCCCAAAAAATCATTGGGGAAATGT GCCCCTCATCAGAGTCCAATGACCCATGAATAAAGTTTCTTGTACTGTTTAAGACGATG AATTGCAACGATAATCCGAGCAGTTTACGGGGTACATCACGTGCTTTGCATATGATCTC GGAGTCGGATCAGTTCCGGATGTGATGTATTACCCCATAGTTTCAAACTCTAATGCAGC CGCCAAGTGCCATACACCCTCCATCAATCTATGCTTAAAGTTTTTCACCATCGTTGGGT GGTGATGATGACTCGCTTAGTCTCTGCTGTTCGATATTAACTTTGTAAGGATCGCCCTT GGATGGAAAATTGAGGGGTTGTAACCTGAATTTGCAGGCTACTTACATTGGACTTTTGA GAAGGCTGGACGGTTGATGAAGAGGGCTGGGTGCAGAGGAATGGAAAAAAATTTAGTTG AGAGGACTGCTTGAAATTTTAGGAAATGGAGTCCTTTAAGCTGACAAAACTTCAAGGAT GGGGATTTTCATGTAGCTTTTTCATGCCTTCGACAAGCTAAAGGAAGGTAATTGATTCT GGATAAATGGATATTTGATCTGCTTTAGCAGATGTCAAAGTTCTACTAGTGATAGTCTG GTATCTCGTAGCCTTCAATTGGGCGTATCTTACTCGAAGTGTTATATTTTTAGCTGACG AGACGAAGAACGAGAGAGTATTGACACATTCAGAGGTAAGACAATATGTCGTATTATCA AAATAAGTATCGAACCTCTATTAGGAGCCTACTGGCTCAAATGTGCAACCTTAGTGGTG ATTGTCTCTGCTTCTTGATCACAATCTGTCGTGTTTGAGAGTGCCGATGTATGATTTTT AGTAAATGTTTTTCAGAAAAGGCGCTAAGTAAATAACCAGTAAGTAATAAATAACGTAA AAGTGATTTGAATCATAAAAGAATCAAGATAGAGGTCAAAGCATAGATAATCCCCC

(161) TABLE-US-00002 TABLE2 Polymerasechainreactionprimers PrimerName DNAsequence5to3 AOX1_ctrl_Fwd GGCTGGAAATAGATGTAGGGAG (SEQIDNO:29) AOX1_ctrl_Rev TCGCATCTCCGCAAATTTCTC (SEQIDNO:30) AOX2_ctrl_fwd GATCCCATTCCCTATCCATGT (SEQIDNO:31) AOX2_ctrl_rev CTCTCCCCCCTCGTAATCTT (SEQIDNO:32)

Example 2: Production of Intracellular eGFP with P. pastoris Aox1 and P. pastoris Aox1Aox2 Under the Methanol Inducible AOX1 Promoter

(162) To test the protein producing ability and promoter activity the P. pastoris aox1aox2 and P. pastoris aox1 strains were transformed with an expression constructs for enhanced green fluorescent protein (eGFP) (Table 4). The eGFP coding sequence was under the expression control of the PAOX.sub.1: PP7435_chr4 (237941 . . . 238898). a) The expression construct BB3aN_pAOX1_GFP_ScCYCtt was assembled using the Golden Gate assembly procedure as described (Prielhofer et al., 2017) from the plasmids BB1_12_pAOX1, BB1_23_eGFP, BB1_34_ScCYC1tt and BB3aN_14*. The plasmids and sequences are available in the Golden PiCS kit #1000000133 (Addgene, Inc., USA). Before electroporation the plasmids were linearized with the restriction enzyme AscI (New England Biolabs, Inc., USA) as per the manufacturer's protocol and purified with the Hi Yield Gel/PCR DNA Fragment Extraction Kits (Sd-Laborbedarf GmbH, Germany). 500 ng of the linearized plasmid was transformed into electrocompetent P. pastoris aox1aox2 and P. pastoris aox1 as previously described in Example 1a) and 1d). Positive transformants were selected on YPD with 100 g/L Nourseothricin and used for later screening experiments. b) Small scale screening experiments of intracellular eGFP expression in the P. pastoris aox1aox2 and P. pastoris aox1. Ten transformants from Example 2a) were picked and inoculated into an overnight culture in 24 deep well plates containing 2 mL YPD and 100 g/L Nourseothricin per well. All transformants were tested in duplicates. The 24 well plates were sealed with an air permissible membrane and incubated at 25 C. and 280 rpm. For screening of the intracellular expression level of eGFP the overnight cultures were transferred to 24 deep well plates with 2.5 mL minimal ASMv6 media with 25 g/L polysaccharide and 0.3% amylase (m2p-labs GmbH, Germany) for slow glucose release and incubated for two hours followed by an addition of either 0.2% (v/v) or 1% (v/v) methanol for induction of eGFP production. eGFP measurements were done 4 and 20 hours after induction using a Gallios flow cytometer (Beckman Coulter, Inc., USA). For this purpose the cells were diluted to an OD.sub.600 of 0.5 in phosphate buffered saline containing 0.24 g/L KH.sub.2PO.sub.4, 1.8 g/L Na.sub.2HPO.sub.4*2H.sub.2O, 0.2 g/L KCl, 8 g/L NaCl. 20,000 events were measured. FX values were calculated with the software FACS Express version 3 (De Novo Software, USA) using the equation:

(163) FX = ( FL 1 FSC 1.5 ) * 8000 FX = Dimensionless value FL 1 = Fluorescence measured with a 505 - 545 nm filter FSC = Forward scatter The method was already described (Ata, Prielhofer, Gasser, Mattanovich, & custom characteralik, 2017; Hohenblum, Borth, & Mattanovich, 2003; Prielhofer et al., 2013). c) Minimal media ASMv6: 6.3 g/L (NH.sub.4).sub.2HPO.sub.4, 0.8 g/L (NH.sub.4).sub.2SO.sub.4, 0.49 g/L MgSO.sub.4*7H.sub.2O, 2.64 g/L KCl, 0.054 g/L CaCl.sub.2*2H.sub.2O, 22 g/L citric acid monohydrate, 1.47 mL/L PTM0 trace metals, 0.8 mg/L biotin 20 mL/L NH.sub.4OH (25%); pH set to 6.5 with KOH. d) The results are displayed in Table 3. Fluorescence was a proxy to determine the intracellular eGFP levels and the intracellular eGFP levels were a proxy for determining the activity of the P.sub.AOX1. The results show that at 20 hours under 1% methanol induction the promoter is active in the P. pastoris aox1aox2 strain and eGFP is produced. The induction of the P. pastoris aox1 aox2 BB3aN_pAOX1_GFP_ScCYCtt strain is better at 1% than at 0.2% methanol after 20 h, no difference between methanol concentrations is observed in the P. pastoris aox1 strain.

(164) TABLE-US-00003 TABLE 3 Results (FX values) with standard deviation from experiment described in Example 2b) P. pastoris aox1aox2 P. pastoris aox1 negative control BB3aN_pAOX1_ BB3aN_pAOX1_ P. pastoris P. pastoris GFP_ScCYCtt GFP_ScCYCtt aox1aox2 aox1 0.2% MeOH at 4h 4.39 0.90 6.26 1.74 2.92 1% MeOH at 4h 5.59 1.09 7.39 1.57 2.95 2.89 0.2% MeOH at 20h 37.81 12.71 84.18 4.57 2.37 2.70 1% MeOH at 20h 62.89 8.81 89.85 3.90 2.35 2.42

(165) TABLE-US-00004 TABLE4 CodingsequencesoftheGenesofinterestexpressedinP.pastoris aox1aox2andP.pastorisaox1. Geneofinterest name DNAsequence5to3 enhancedgreen (SEQIDNO:33) fluorescent ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCG protein(eGFP) AGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGA GGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGC AAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGC AGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTC CGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGAC GGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGA ACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGG GCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGAC AAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGG ACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGA CGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTG AGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGA CCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTAA Humanserum (SEQIDNO:34) albumin(HSA)with ATGAAGTGGGTTACTTTCATCTCCTTGTTGTTCTTGTTCTCCTCAGCTTACT itsnative CCAGAGGTGTTTTCAGAAGAGATGCTCACAAGTCCGAGGTTGCTCACAGATT secretionleader CAAGGACTTGGGTGAAGAGAACTTCAAGGCTTTGGTTTTGATCGCTTTCGCT CAGTACTTGCAGCAGTGTCCATTCGAGGACCACGTTAAGTTGGTTAACGAGG TTACTGAGTTCGCTAAGACTTGTGTTGCTGACGAATCCGCTGAGAACTGTGA TAAGTCCTTGCACACTTTGTTCGGTGACAAGTTGTGTACTGTTGCTACTTTG AGAGAAACTTACGGTGAGATGGCTGACTGTTGTGCTAAGCAAGAGCCTGAGA GAAACGAGTGTTTCTTGCAACACAAGGACGACAACCCAAACTTGCCAAGATT GGTTAGACCAGAGGTTGACGTTATGTGTACTGCTTTCCACGACAACGAAGAG ACTTTCTTGAAGAAGTACTTGTACGAGATCGCTAGAAGACACCCATACTTCT ACGCTCCAGAGTTGTTGTTCTTCGCTAAGAGATACAAGGCTGCTTTCACTGA GTGTTGTCAGGCTGCTGATAAGGCTGCTTGTTTGTTGCCAAAGTTGGACGAG TTGAGAGATGAGGGTAAGGCTTCTTCCGCTAAGCAGAGATTGAAGTGTGCTT CCTTGCAGAAGTTCGGAGAGAGAGCTTTTAAGGCTTGGGCTGTTGCTAGATT GTCCCAGAGATTCCCAAAGGCTGAGTTCGCTGAGGTTTCCAAGTTGGTTACT GACTTGACTAAGGTTCACACAGAGTGTTGTCACGGTGACTTGTTGGAATGTG CTGATGACAGAGCTGACTTGGCTAAGTACATCTGTGAGAACCAGGATTCCAT CTCCTCCAAGTTGAAAGAATGTTGTGAGAAGCCTTTGTTGGAGAAGTCCCAC TGTATCGCTGAGGTTGAAAACGACGAAATGCCAGCTGACTTGCCATCTTTGG CTGCTGACTTCGTTGAATCCAAGGACGTCTGCAAGAACTACGCTGAGGCTAA GGACGTTTTCTTGGGTATGTTCTTGTATGAGTACGCTAGAAGACATCCAGAC TACTCCGTTGTTTTGTTGTTGAGATTGGCTAAGACTTACGAGACTACTTTGG AGAAGTGTTGTGCTGCTGCTGACCCACATGAGTGTTACGCTAAGGTTTTCGA CGAGTTCAAGCCATTGGTTGAGGAACCACAGAACTTGATCAAGCAGAACTGT GAGTTGTTCGAGCAGTTGGGTGAGTACAAGTTCCAGAACGCTTTGTTGGTTA GATACACTAAGAAGGTTCCACAGGTTTCCACTCCAACTTTGGTTGAGGTTTC CAGAAACTTGGGTAAGGTTGGTTCCAAGTGTTGTAAGCACCCAGAGGCTAAG AGAATGCCATGTGCTGAGGACTACTTGTCTGTTGTTTTGAACCAGTTGTGTG TCTTGCACGAAAAGACACCAGTTTCCGACAGAGTTACTAAGTGTTGTACTGA ATCCTTGGTTAACAGAAGACCTTGTTTCTCCGCTTTGGAGGTTGACGAGACT TACGTTCCAAAAGAGTTCAACGCTGAGACTTTCACTTTCCACGCTGACATCT GTACTTTGTCCGAGAAAGAGAGACAGATCAAGAAGCAGACTGCTTTGGTTGA GTTGGTTAAGCACAAGCCAAAGGCTACAAAAGAGCAGTTGAAGGCTGTTATG GACGACTTCGCTGCTTTCGTTGAGAAATGTTGTAAGGCTGACGACAAAGAGA CTTGTTTCGCTGAAGAGGGTAAGAAGTTGGTTGCTGCTTCCCAAGCTGCTTT GGGTCTGTAA variableregionof (SEQIDNO:35) acamelidantibody ATGAGATTCCCATCTATTTTCACCGCTGTCTTGTTCGCTGCCTCCTCTGCAT (VHH)withtheS. TGGCTGCCCCTGTTAACACTACCACTGAAGACGAGACTGCTCAAATTCCAGC cerevisiaea- TGAAGCAGTTATCGGTTACTCTGACCTTGAGGGTGATTTCGACGTCGCTGTT matingfactor TTGCCTTTCTCTAACTCCACTAACAACGGTTTGTTGTTCATTAACACCACTA leader TCGCTTCCATTGCTGCTAAGGAAGAGGGTGTCTCTCTCGAGAAGAGACAAGC CGGTGGTTCATTAAGATTGTCCTGTGCTGCCTCTGGTAGAACTTTCACTTCT TTCGCAATGGGTTGGTTTAGACAAGCACCTGGAAAAGAGAGAGAGTTTGTTG CTTCTATCTCCAGATCCGGTACTTTAACTAGATACGCTGACTCTGCCAAGGG TAGATTCACTATTTCTGTTGACAACGCCAAGAACACTGTTTCTTTGCAAATG GACAACCTTAACCCAGATGACACCGCAGTCTATTACTGTGCCGCTGACTTGC ACAGACCATACGGTCCAGGAACCCAAAGATCCGATGAGTACGATTCTTGGGG TCAGGGAACTCAAGTCACTGTCTCTTCAGGTGGTGGATCTGGTGGTGGAGGT TCAGGTGGTGGAGGATCCGGTGGTGGTGGTTCTGGTGGTGGTGGATCTGGTG GAGGTGAAGTTCAACTTGTCGAATCCGGTGGTGCACTTGTCCAACCTGGTGG ATCTCTTAGACTTTCTTGTGCCGCCTCCGGTTTTCCTGTTAACCGTTACTCT ATGCGTTGGTACAGACAAGCCCCTGGAAAAGAACGTGAATGGGTTGCCGGAA TGTCCTCAGCTGGTGACAGATCCTCCTACGAAGATTCTGTGAAGGGACGTTT CACCATCTCCAGAGATGACGCCCGTAACACCGTTTACCTTCAAATGAACTCC CTTAAGCCTGAGGATACTGCCGTCTACTATTGTAACGTGAATGTCGGATTTG AATACTGGGGACAGGGAACCCAAGTTACTGTCTCTTCCGGTGGACATCACCA CCACCATCACTAATAG

Example 3: Generation of P. pastoris Aox1 and P. pastoris Aox1Aox2 Strains Producing Secreted HSA and VHH Under the Methanol Inducible AOX1 Promoter

(166) To test the ability to produce secreted recombinant proteins in the P. pastoris aox1 aox2 strain and compare it with the P. pastoris aox1 strains, the strains were transformed with expression constructs for two secreted model proteins: (1) Human serum albumin with its native secretion leader (HSA) or (2) variable region of a camelid antibody with the S. cerevisiae -mating factor secretion leader (VHH). The coding sequence of these genes of interest (codon-optimized and synthesized by external providers) can be found in Table 4. a) The pPM2pN21_pAOX1_HSAopt_CycTT and pPM2pZ30_pAOX1_MF-vHH_CycTT expression constructs used for HSA and VHH production are derivatives of the pPuzzle ZeoR vector described in WO2008128701A2, consisting of the E. coli pUC19 on and the Zeocin antibiotic resistance cassette. In this case of pPM2pN21_pAOX1_HSAopt_CycTT the Zeocin resistance is exchanged for Nourseothricin resistance via restriction and ligation. Additionally the vectors are carrying an integration sequence that is homologous to the PGI locus PP7435_Chr3 (1366329 . . . 1367193) for efficient integration. The expression vector is described in more details elsewhere (Gasser et al., 2013; Stadlmayr et al., 2010). Expression of the gene of interest (GOI) was mediated by the P.sub.AOX1 PP7435_chr4 (237941 . . . 238898) and the Saccharomyces cerevisiae CYC1 transcription terminator. The gene for human serum albumin (HSA) (GenBank NP_000468) was codon optimized for P. pastoris and synthesized. It has a native secretion leader and is therefore secreted into the supernatant. The gene for VHH is codon optimized for P. pastoris and synthetized (Table 4), it has an N-terminal S. cerevisiae -mating type leader for secretion into the supernatant. For the purpose of transformation of the expression constructs the circular vectors were linearized by restriction in the PGI1 homologous sequence with XmnI (New England Biolabs, Inc., USA) and purified with the Hi Yield Gel/PCR DNA Fragment Extraction Kits (Sd-Laborbedarf GmbH, Germany). b) Electroporation of electrocompetent P. pastoris aox1 aox2 and P. pastoris aox1 with 500 ng linearized pPM2pN21_pAOX1_HSAopt_CycTT and pPM2pZ30_pAOX1_MF-vHH_CycTT plasmid and selection were carried out as previously described in Example 1a) and Example 1d). The selection was carried out on YPD plates with 100 g/mL Nourseothricin or 25 g/mL Zeocin, respectively.

Example 4: Small Scale Screening of the HSA and VHH Producing P. pastoris Aox1 Aox2 and P. pastoris Aox1

(167) a) For the pre-culture the transformants were inoculated in 2 mL YPD with 100 g/mL Nourseothricin or 25 g/mL Zeocin based on the antibiotic resistance used for selection. For each expression construct twelve transformants were picked for screening. Pre-culture and screening cultures were cultivated in 24 well plates sealed with an air permeable membrane and incubated on 25 C. on 280 rpm. The screening culture was inoculated with a start optical density (OD.sub.600) of 8 into 2 mL of minimal media (ASMv6) with a slow glucose release system based on 6 mm feedbeads (Kuhner Shaker GmbH, Germany) to keep the cultures in glucose limit. The strains were compared with different methanol feed procedures differing in total methanol received and duration (Table 5). b) After the incubation period 1 mL of the each culture was removed and centrifuged in a pre-weighted Eppendorf tube. The supernatant was removed and the protein concentration was measured with the Caliper LabChip GXII Touch (Perkin Elmer, inc., USA) as per the manufacturer's instructions. The wet cell weight was determined by weighting the Eppendorf tube with the cell pellet and calculated as follows: Weight (full)Weight (empty)=Wet cell weight (WCW) (g/L). Out of this data the yield was calculated: Yield (g/g)=Protein concentration/Wet cell weight. Data of transformants that had double the concentration or had no detectible protein in the supernatant were removed from analysis as outliers. The outliers are considered as transformants that have either two copies of the expression construct or no copy at all (Aw & Polizzi, 2013; Schwarzhans et al., 2016).

(168) TABLE-US-00005 TABLE 5 Overview of the screening strategies used for testing the secreted protein production yield of the transformed strains. Incu- Methanol bation Start Methanol Total shot Protocol period Feedbeads OD.sub.600 pulse methanol time points Standard 48 h 12 mm 8 4 3.5% 4 h*, 19 h, (v/v) 27 h, 43 h One shot 48 h 3 6 mm 8 1 1% (v/v) 3 h Two shot 48 h 3 6 mm 8 2 2% (v/v) 3 h, 23 h One shot - 72 h 3 6 mm 8 1 1% (v/v) 3 h extended Two shot - 72 h 3 6 mm 8 2 2% (v/v) 3 h, 43 h extended *The first shot was 0.5% methanol. c) The results show that the P. pastoris aox1aox2 can produce secreted proteins under the induction of the P.sub.AOX1 and that the yield is comparable to the P. pastoris aox1 used as industry standard (Table 6). In the Two shotextended strategy the P. pastoris aox1aox2 shows a better yield indicating that under longer cultivation times with less methanol the P. pastoris aox1aox2 has an yield advantage. Furthermore this shows that it is possible to use limited glucose conditions to screen P. pastoris aox1aox2 strains producing secreted proteins controlled by the P.sub.AOX1 and methanol induction.

(169) TABLE-US-00006 TABLE 6 Average secreted product yield with standard deviation in pg product / g WCW of the tested strains in different screening conditions. One shot Two shot Standard One shot Two shot extended extended P. pastoris aox1aox2 733 59 219 32 379 38 0 410 16 pPM2pZ30_pAOXl_M F-vHH_CycTT P. pastoris aox1 1465 239 195 66 413 114 0 239 77 pPM2pZ30_pAOXl_MF-vHH_CycTT P. pastoris aox1aox2 443 111 138 24 251 110 228 33 363 55 pPM2pN21_pAOX1_HSAopt_CycTT P. pastoris aox1 840 36 79 9 388 61 83 18 277 23 pPM2pN21_pAOX1_HSAopt_CycTT

Example 5: Bioreactor Cultivations

(170) To determine the behavior and process parameters of P. pastoris aox1aox2 in fed-batch mode in a recombinant protein production setting, bioreactor cultivations were performed. The cultivations were performed as follows. a) DASGIP bioreactors were used with a working volume of 0.7 L (Eppendorf AG, Germany). One Bioreactor system consists of four reactors that are arranged in one bio-block for controlling the temperature. Each reactor was connected to 4 peristaltic pumps that were software controlled. Additionally each reactor had 2 balances available that were connected to the DASGIP control software (Eppendorf AG, Germany) for adjusting the pump speed gravimetrically. Each reactor was connected with a controllable gas supply (pressured air, N.sub.2, O.sub.2 could be mixed in any desired amount) and a gas analyzer for O.sub.2 and CO.sub.2 concentration measurement in the reactor off gas. The reactors had a pH probe and Dissolved Oxygen (DO) probe connected to the DASGIP control software. The DASGIP control software was recording all parameters in one minute intervals. b) The bioreactor cultivation media consisted of BSM medium (Mellitzer et al., 2014): 11.48 g/L H.sub.3PO.sub.4, 0.5 g/L CaCl.sub.2*2H.sub.2O, 7.5 g/L MgSO.sub.4*7H.sub.2O, 9 g/L K.sub.2SO.sub.4, 2 g/L KOH, 40 g/L Glycerol, 0.25 g/L NaCl, 4.35 mL/L PTM0, 0.87 mg/L Biotin, 0.1 mL/L Glanapon 2000, pH set to 5.5 with 25% NH.sub.3. c) PTM0 consisted of: 6.0 g CuSO.sub.4*5H.sub.2O, 0.08 g NaI, 3.36 g MnSO.sub.4*H.sub.2O, 0.2 g Na.sub.2MoO.sub.4*2H.sub.2O, 0.02 g H.sub.3BO.sub.3, 0.82 g CoCl.sub.2, 20.0 g ZnCl.sub.2, 65.0 g FeSO.sub.4*7H.sub.2O, 5 mL/L H.sub.2SO.sub.4 (95%-98%). d) The Glucose feed media consisted of: 50% (w/w) glucose, 2.08 mg/kg Biotin, 10.4 mL/kg PTM0. The methanol feed media was: 50% (v/v) or 100% (v/v) methanol. The glycerol feed media consisted of: 60% (w/w) glycerol, 2.08 mg/kg Biotin, 10.4 mL/kg PTM0. e) The Dissolved Oxygen (DO) set point was 20%. In certain cases the DO control was deactivated and the agitation and aeration were manually set to a constant 750 rpm and 9.5 sL/h. The pH was set to 5.0 or 5.5 with either 12.5% or 25% NH.sub.3 controlled by the DASGIP control software. Acid control was achieved with 10% H.sub.3PO.sub.4 by manual addition when necessary. The temperature was set at 25 C. The start OD.sub.600 was 2 and the start volume was 300 mL plus 15 mL of inoculation culture. f) Sampling was done on a daily basis (approximately every 24 hours). First a 3 mL aspirate was taken from the reactor to remove the dead volume of the sampling port. Then 9 mL of sample were taken. 32 mL were pipetted into reweighted 2 mL Eppendorf tubes and 11.5 mL into one 1.5 mL Eppendorf tube. The samples were centrifuged (16,000 g, 10 min, 4 C.). The supernatant was collected for protein and HPLC analysis and stored at 20 C. The pellet was washed by resuspension in 1 mL 0.1 M HCl to remove trace salts and centrifuged again (16,000 g, 10 min, 4 C.). The pellet was then dried for 24 hours at 105 C. to determine the dry cell weight. The dry cell weight was calculated as follows: (Weight (full)Weight (empty))/2=Dry cell weight (g/L) and calculated as the average of three replicates. If only a HPLC sample was need only 2 mL of sample were taken. g) Cell viability was measured by staining the cell suspension with propidium iodide. For this the cell suspension from the reactor sample was diluted with phosphate buffered saline to on OD.sub.600 of 0.5 and mixed with a stock solution of propidium iodide to a final concentration of 10 M prior to measurement with the Gallios flow cytometer (Beckman coulter, Inc., USA) with a filter of 590-650 nm. 50,000 events were measured per sample.

Example 6: Determining the Evaporation Rate of Methanol from the Bioreactors without Cells

(171) To assess the evaporation rate of methanol from the reactors by aeration and agitation the reactors were filled with sterile media and pulsed with methanol, samples were taken to determine the methanol concentration. a) For this example two reactors were filled with 310 mL of BSM media without glycerol and two reactors were filled with 500 mL BSM media without glycerol to simulate the media at the end of the batch phase where the glycerol is consumed by the growing culture. b) The reactor stirrer speed was set to 760 rpm and gassing to 9.5 sL/h as would be the case in a cultivation of the P. pastoris aox1aox2. The parameters can be found in Table 7. c) A 50% (v/v) methanol pulse was added manually to increase the methanol concentration to 1% (v/v) and a sample was taken to determine the actual achieved concentration. Samples were taken at 3.4, 6.5, 22.4, 31.0, 47.9 hours by first removing 3 mL of dead volume from the sample port and discarding the aspirate. Immediately after that a 4 mL sample was taken. d) HPLC measurement of methanol concentration were done as described previously (Blumhoff, Steiger, Marx, Mattanovich, & Sauer, 2013). For identification and quantification pure standards were used. The column was an Aminex HPX-87H (Bio-Rad Laboratories, Inc, USA) run at 60 C. with a 4 mM H.sub.2SO.sub.4 mobile phase at 0.6 mL/min. The detector was a refraction index detector RID-10 A (Shimadzu, Corp., Japan) and the calculations were done with the LabSolutions v5.85 software (Shimadzu, Corp., Japan). e) The evaporation rate was calculated only from the first and last sample with the biggest time and concentration difference. The changes in concentration between the adjacent samples were marginal and measurement error could have a significant impact on the calculation. The data can be found in Table 8. R1 and R2 filled with 500 mL media had a mean value of 0.063 g*L.sup.1*h.sup.1.

(172) TABLE-US-00007 TABLE 7 Reactor parameters and methanol pulse volume. Volume Agitation Gassing 50% (v/v) methanol Reactor (mL) (rpm) (sL/h) (ml) R1 310 760 9.5 6.2 R2 310 760 9.5 6.2 R3 500 760 9.5 10 R4 500 760 9.5 10

(173) TABLE-US-00008 TABLE 8 Methanol concentration at the sampling timepoints and the calculated evaporation rate. Time (h) 0 3.4 6.5 22.4 31.0 46.9 dc/dt Reactor Methanol (g/L) (g L.sup.1 h.sup.1) R1 7.91 6.13 7.53 6.76 6.10 5.49 0.052 R2 7.80 7.14 7.49 6.72 6.28 4.29 0.075 R3 7.47 7.73 5.07* 7.05 6.93 6.43 0.022 R4 7.54 7.80 6.33* 6.97 4.39* 6.49 0.022 *are too low and are considered as outliers.

Example 7: Determining the Methanol Uptake Rate of P. pastoris Aox1Aox2

(174) To determine the methanol uptake rate the P. pastoris aox1aox2 pPM2pN21_pAOX1_HSAopt_CycTT strain was cultivated in a bioreactor. The culture was grown till a certain biomass concentration. Then a methanol pulse was applied and samples were taken immediately after the pulse and approximately 20 hours later. The goal was to determine the methanol uptake rate of the Mut.sup. strain and compare it to the methanol evaporation rate measured in Example 6. a) Pre-culture: 24 hours prior to reactor inoculation 50 mL YPD containing 100 g/L Nourseothricin were inoculated with P. pastoris aox1aox2 pPM2pN21_pAOX1_HSAopt_CycTT. 3 hours prior to inoculation of the reactors the pre-culture was diluted by another 50 mL YPD containing 100 g/L Nourseothricin. Before inoculation the appropriate amount of culture was centrifuged (1500 g, 5 min, 20 C.) and resuspended in 15 mL of BSM media with an OD.sub.600 of 42. b) The reactors filled with 300 mL BSM media were inoculated with 15 mL of P. pastoris aox1aox2 pPM2pN21_pAOX1_HSAopt_CycTT culture. The target inoculation OD.sub.600 in the reactor was 2. At the end of the batch phase as indicated by a dissolved oxygen spike, a 50% (w/w) glucose feed was started at 2.4 mL/h for 24 hours to increase the biomass. Two hours after the glucose feed start a 9.5 mL 50% (v/v) methanol shot was given to increase the methanol concentration to 1.5% (measured concentration was R1=1.47% and R2=1.48%). This was done to induce methanol consumption. At the end of the glucose feed phase samples for cell dry weight and HPLC were taken. c) After the glucose phase the agitation and gassing was set to a constant 750 rpm and 9.5 sL/h. An additional 50% methanol pulse was added to increase the concentration to 1.5% and immediately a sample was taken (measured concentration was R1=1.36% and R2=1.36%). The concentration was measured again after 19.5 hours and used to determine the specific methanol uptake rate (q.sub.methanol). d) The methanol concentration decrease (dc/dt) for this experiment was substantially higher at 0.37 g L.sup.1 h.sup.1 on average compared to the values obtained for the evaporation rate in Example 6e), Table 8 that ranges from 0.022 to 0.063 g L.sup.1 h.sup.1.
The specific methanol uptake rate was calculated based on the data represented in Table 9 as follows.
q.sub.methanol=((C.sub.methanol.sup.t0C.sub.methanol.sup.t19.5)/C.sub.biomass)/(t.sub.0t.sub.19.5)

(175) The volume was constant over the measured time period. The average specific methanol uptake rate (q.sub.methanol) without subtracted evaporation was 5.07 mg g.sup.1 h.sup.1. For the calculations of the specific methanol uptake rate with subtracted evaporation an evaporation rate of 22 mg L.sup.1 h.sup.1 was estimated based on the results in Example 6e), Table 8. This outcome was completely new and unexpected. Till now it was reported and accepted in published literature that the Mut.sup. is unable to metabolise methanol and that the decrease of methanol is due to evaporation loss (Looser et al., 2015).

(176) TABLE-US-00009 TABLE 9 Data overview specific methanol uptake rate (q.sub.methanol) and apparent methanol loss (dc/dt). q.sub.methanol- evaporated Methanol Methanol (subtracted Volume CDW at 0 h at 19.5 h dc/dt q.sub.methanol evaporation) Reactor (mL) (g/L) (g/L) (g/L) (g L.sup.1 h.sup.1) (mg g.sup.1 h.sup.1) (mg g.sup.1 h.sup.1) R1 378 73.4 10.71 3.67 0.361 4.92 4.61 R2 372 72.6 10.74 3.35 0.379 5.22 4.90

Example 8: Cultivation Strategy 1Applying a Constant Glucose/Methanol Co-Feed to the P. pastoris Aox1 Aox2

(177) The P. pastoris aox1 aox2 pPM2pN21_pAOX1_HSAopt_CycTT strain was cultivated in a recombinant protein production scenario. The strain was fed with a constant limited glucose feed and induced with methanol for protein production. a) The inoculation was done as described in Example 7a) b). The cultivation was separated into two phases. (1) Phase one: The batch was started at OD.sub.600 of 2 in BSM medium. The batch phase end was indicated by a dissolved oxygen spike at 22.27 h for reactor R1 and 21.52 h for reactor R2. b) (2) Phase two: A fed-batch phase with a 50% (w/w) glucose feed was started after phase one at a feed rate of 2.4 mL/h for 97 hours. At the same time a 50% (v/v) methanol pulse was added with the aim to increase the methanol concertation to 1.5% (v/v). A HPLC sample was taken as described in Example 6d) to measure the exact concentration and an additional pulse was added if necessary. A methanol feed calculated based on the predicted biomass concentration and the specific methanol uptake rate of 5 mg g.sup.1 h.sup.1 as measured in Example 7d) was applied. The methanol concentration was measured daily at line by HPLC. c) The methanol feed was calculated in hourly intervals as follows:

(178) R methanol = q methanol * X predicted * t interval T methanol = T methanol - previous interval - R methanol + A methanol - previous interval - ( T methanol - previous interval V reactor - previous interval * V sample - previous interval ) A methanol = V reactor * C methanol , target - T methanol F methanol = ( A methanol methanol ) * 0.002 V reactor = V reactor - previous interval + F Glucose + F methanol X predicted = X predicted - previous + ( Y ( x s ) * ( F glucose * 50 % glucose * 50 % ) ) - ( V sample * ( X predicted - previous interval V reactor - previous interval ) ) q methanol = specific methanol uptake rate ( mg g - 1 h - 1 ) X predicted = predicted total biomass in cell dry weight ( g ) i interval = time interval ( h ) R methanol = methanol consumption at t interval ( mg ) T methanol = total methanol ( mg ) A methanol = methanol addition ( mg ) F methanol = 50 % ( v / v ) methanol feed ( mL ) C methanol target = target methanol concentration ( mg / mL ) V reactor = reactor volumen ( mL ) F glucose = 50 % ( v / v ) glucose feed ( mL ) V sample = volume of sample if applicable in the interval , else it is 0 Y ( x s ) = biomass yield on glucose ( g / g ) d) Because of the predicted specific methanol uptake rate based on example 7d) it was possible to keep the methanol concentration at excess during the bioreactor cultivation from 1.19% to 1.5% (v/v) of methanol with only once per day at line methanol concentration measurements and feed adjustment. e) The process and productivity data can be found in Table 10. The overall average specific productivity was 29.4 g g.sup.1 h.sup.1. The methanol concentration at the end of the cultivation was 10.4 and 10.0 g/L (1% (v/v) methanol corresponds to 7.92 g/L) for reactor R1 and R2. The total amount of consumed methanol in phase two by reactor R1 and R2 was 25.03 g and 24.07 g. This was calculated by the following equation:

(179) T consumed methanol = ( ( m start - m end ) 50 % methanol * 50 % * methanol ) - ( C methanol - end * V reactor - end ) T consumed methanol = total consumed methanol ( g ) m start = 50 % m ethanol container weight at phase start ( g ) m end = 50 % methanol container weight at feedend ( g ) 50 % methanol = 50 % methanol density ( g / ml ) methanol = 100 % methanol density ( g / ml ) C methanol - end = methanol concentration at feedend ( g / L ) V reactor - end = reactor volume at feedend ( L )

(180) TABLE-US-00010 TABLE 10 Bioreactor cultivation process data and specific productivity (q.sub.P) for Example 8. The methanol concentration was adjusted 2.22 hours after the sample was taken by an additional 50% (v/v) methanol pulse for R1 = 5.6 mL, R2 = 2.3 mL. Recombinant Specific protein productivity Methanol concentration (q.sub.P) concentration Time Volume (mL) YDM (g/L) (mg/L) (g g.sup.1 h.sup.1) (g/L) (h) R1 R2 R1 R2 R1 R2 R1 R2 R1 R2 22.30 318.2 318.0 25.2 25.0 0.0 0.0 24.60 4.9* 9.0* 43.22 382.9 378.3 66.4 67.0 75.4 75.2 64.50 63.63 10.3 11.9 68.20 458.5 453.1 99.0 101.5 164.0 142.5 31.74 23.35 9.4 10.0 92.45 528.9 521.5 119.8 122.0 235.9 211.6 18.83 17.28 11.0 10.7 116.37 621.6 613.5 135.1 136.9 363.6 338.4 28.30 27.17 10.3 9.9 120.12 625.3 617.6 136.0 137.3 390.9 378.6 28.90 30.17 10.4 10.0 *Represents a control sample after the methanol pulse.

Example 9: Cultivation Strategy 2a Feed Strategy with a Separated Glucose Feed Phase and a Methanol Only Feed Phase

(181) The P. pastoris aox1aox2 pPM2pN21_pAOX1_HSAopt_CycTT strain was tested in a recombinant protein production scenario where first a limited glucose feed was applied to increase the biomass followed by a separated phase with a methanol pulse and feed to induce protein production. a) The bioreactor cultivation was separated into three phases. (1) Phase one consisted of the batch phase on BSM media with a start OD.sub.600 of 2. The inoculation was done as described in Example 7a) b). The batch phase lasted for 19.68 and 19.50 hours for reactor R3 and R4, respectively. (2) Phase two was a 50% (w/w) glucose feed at 4.8 mL/h for 25 hours to increase the biomass concentration. (3) Phase three was started with a 50% (v/v) methanol pulse to reach a target concentration of 1.5% (v/v) and a methanol feed profile calculated based on the predicted cell dry weigh and specific methanol uptake rate as described in Example 8c) for 72.7 hours. Methanol concentration was measured at line with HPLC every day as described in Example 6d) to measure the exact concentration and an additional compensation pules was added if necessary. In this phase the reactor stirrer speed was set to a constant 760 rpm and gassing to 9.5 sL/h. b) The process and productivity data can be found in Table 11. The maximal and minimal methanol concentration throughout the cultivations ranged from 4.3 g/L to 12.55 g/L. The overall average specific productivity was 32.9 g g.sup.1 h.sup.1. The methanol concentration at the end of the cultivation was 7.10 and 7.47 g/L for reactor R3 and R4. The amount of consumed methanol in Phase three by reactor R3 and R4 was 12.0 g and 12.6 g. This was calculated as in Example 8e). Because the biomass was constant in phase three the methanol uptake rate (q.sub.methanol) for phase three was calculated as in the following equation.

(182) q methanol = T consumed methanol X biomass - average * t phase 3 T consumed methanol = total consumed methanol in phase 3 ( mg ) X biomass - average = average biomass in phase 3 ( g ) t phase 3 = duration of phase 3 ( h ) In phase three the q.sub.methanol for reactor R3 is 3.79 mg g.sup.1 h.sup.1 and for reactor R4 it is 3.92 mg g.sup.1 h.sup.1. c) The total biomass in Table 11 was corrected for the sample withdraw of 12 mL and shows that the biomass was not increasing. Overall the total biomass in phase three decreased by 4.5% and 3.4% for reactor R3 and R4. Astonishingly, the culture was nonetheless producing secreted recombinant proteins. This shows that the P. pastoris aox1aox2 pPM2pN21_pAOX1_HSAopt_CycTT strain can efficiently produce recombinant secreted proteins even when fed only with methanol at no apparent growth. The total average amount of proteins produced in phase three with methanol as the only carbon source is 105 mg.
T.sub.biomass=V.sub.reactor*CDW+(CDW.sub.previous*V.sub.sample)
T.sub.biomass=total corrected biomass
CDW=cell dry weight
V.sub.sample=volume of sample

(183) TABLE-US-00011 TABLE 11 Bioreactor cultivation process data and productivity (q.sub.P) for Example 9. The total biomass was corrected for 12 mL sampling as in Example 9 b). Recombinant Specific Total protein productivity Methanol Biomass concentration (q.sub.P) concentration Time Volume (mL) YDM (g/L) (g) (mg/L) (g g.sup.1 h.sup.1) (g/L) Phase (h) R3 R4 R3 R4 R3 R4 R3 R4 R3 R4 R3 R4 1 20.13 317.9 318.5 25.5 25.5 8.1 8.1 2 29.92 366.5 368.0 67.2 67.0 24.9 24.9 0.0 0.0 0.0 0.0 45.02 445.8 447.8 108.0 107.7 49.2 49.3 0.0 0.0 0.0 0.0 3 47.08 12.1* 12.5* 53.00 444.2 446.1 104.4 103.7 48.8 48.6 46.1 45.7 35.56 35.6 69.58 432.2 435.7 103.3 102.9 48.3 48.5 106.7 107.8 22.51 23.3 4.3 5.9 93.93 434.7 437.0 98.5 99.1 47.7 48.2 244.0 251.0 38.67 39.9 6.6 7.4 118.12 434.4 435.9 94.2 95.3 47.0 47.6 350.9 350.2 33.07 30.0 7.1 7.5 *Represents a control sample after the methanol pulse.

Example 10: Cultivation Strategy 3a Feed Strategy with a Glucose/Methanol Co-Feed Phase and a Separated Methanol Only Feed Phase

(184) The P. pastoris aox1aox2 pPM2pN21_pAOX1_HSAopt_CycTT strain was tested in a recombinant protein production scenario where after the batch phase a limited glucose feed and an additional methanol pulse and feed was applied to achieve a biomass increase and recombinant protein production simultaneously. After the desired biomass was reached the glucose feed was stopped but the methanol feed continued for the rest of the cultivation. a) This bioreactor cultivation was separated into three phases. (1) Phase one was the batch phase. For this the reactors were inoculated with the production strain P. pastoris aox1aox2 pPM2pN21_pAOX1_HSAopt_CycTT with a start OD.sub.600 of 2. The inoculation was done as described in Example 7a) b). The batch phase lasted for 19.35 and 19.37 hours for reactor R1 and R2, respectively. The end of the batch phase was indicated by a dissolved oxygen peak. (2) At this point Phase two was started. Phase two consisted of a 50% (w/w) glucose feed at 4.8 mL/h for 25 hours. At the start of Phase two a 50% (v/v) methanol pulse was applied to increase methanol concentration to the target of 1.5% (v/v) and a subsequent methanol feed was started to counteract methanol consumption, evaporation and dilution by the glucose feed. (3) Phase three consisted of a methanol only feed for 72.9 hours. In this phase the reactor stirrer speed was set to a constant 760 rpm and gassing to 9.5 sL/h. Methanol concentration was measured at line with HPLC every day as described in Example 6d). An additional compensation pulse was added if necessary. b) The methanol feed was calculated in hourly intervals as in Example 9b): c) The process and productivity data can be found in Table 12. The maximal and minimal methanol concentration throughout the cultivation of the two repeats ranged from 6.9 g/L to 11.4 g/L. The overall average specific productivity was 45.8 g g.sup.1 h.sup.1, the average specific productivity in phase three was 34.0 g g.sup.1 h.sup.1. The methanol concentration at the end of the cultivation was 8.0 g/L for reactor R1 and R2. The amount of consumed methanol in phase three by reactor R1 and R2 was 14.4 g and 14.1 g. This was calculated by the equation as shown in Example 9b). Because the biomass was constant in phase three the methanol uptake rate was calculated (q.sub.methanol) for phase three as shown in Example 9b). In phase three the q.sub.methanol for reactor R1 was 4.61 mg g.sup.1 h.sup.1 and for reactor R2 it was 4.54 mg g.sup.1 h.sup.1. Overall the biomass decreased by 5.7% and 5.5% for reactor R1 and R2 in phase three. Again, this shows that with the P. pastoris aox1aox2 strain production at no apparent growth is possible. The average total amount of recombinant protein produced in phase three with methanol as the only carbon source is 106 mg which is similar to the 105 mg of recombinant protein produced in Example 9, phase three. This is also illustrated by the similar specific productivity in phase three from Example 9 at 32.9 g g.sup.1 h.sup.1 and at 34.0 g g.sup.1 h.sup.1 in this example. In conclusion the productivity in phase three (methanol only feed phase) did not depend whether the cultures were induced in phase two (glucose feed phase) or not. Because recombinant protein production is independent of growth the methanol only feed strategy has several advantages when used with the P. pastoris aox1aox2 strain. In a bioreactor cultivation without a methanol only feed phase as in Example 8 the process is constrained by the maximal reactor volume and the yeast dry mass concentration. After a certain time this constraints stop the cultivation process either by reaching the maximal volume or maximal desired biomass concentration. By using a methanol feed phase in combination with the P. pastoris aox1aox2 as in Example 9 the cultivation time is no longer limited by the biomass concentration or volume as the biomass is not increasing and the volume increase is negligible. As a consequence cultures at high biomass concentrations can be kept in the bioreactor for longer periods of time without reaching these constraints and allow for longer production phases that increase the concentration of the protein of interest. A methanol only feed phase is also applied when using the methanol utilization slow P. pastoris aox1 strain as shown in the following Example 12 but these advantages are not present there because P. pastoris aox1 is continuously growing on a methanol only feed and therefore exhibits the same constraints as discussed. Restricting the P. pastoris aox1 to the same methanol feed rate as the P. pastoris aox1aox2 results in productivity loss. Further process related improvements of the P. pastoris aox1aox2 strain are discussed in Example 12.

(185) TABLE-US-00012 TABLE 12 Bioreactor cultivation process data and specific productivity (q.sub.P) for Example 10. The total biomass was corrected for 12 mL sampling as in Example 9 b). Recombinant Specific Total protein productivity Methanol Biomass concentration (q.sub.P) concentration Time Volume (mL) YDM (g/L) (g) (mg/L) (g g.sup.1 h.sup.1) (g/L) Phase (h) R1 R2 R1 R2 R1 R2 R1 R2 R1 R2 R1 R2 1 20.13 318.0 317.7 25.0 24.9 7.9 7.9 0.0 0.0 0.0 0.0 2 21.87 11.0* 11.4* 29.92 374.5 374.2 65.3 64.6 24.7 24.5 47.7 51.9 88.6 97.3 45.02 464.2 461.8 104.0 103.1 49.4 48.7 203.0 243.4 87.1 108.6 7.2 6.9 3.sup.3 53.00 462.7 460.9 99.7 99.5 48.4 48.2 246.1 265.5 38.6 21.5 69.58 457.4 455.6 95.9 96.3 47.4 47.4 357.3 371.8 47.3 44.9 7.9 7.5 93.93 459.8 458.3 91.9 91.2 46.9 46.5 459.5 515.0 33.9 47.4 8.2 7.1 118.12 462.0 460.8 88.3 87.3 46.6 46.0 494.8 568.2 14.8 21.6 8.0 8.0 *Represents a control sample after the methanol pulse.

Example 11: Cultivation Strategy 3a Feed Strategy with a Glucose/Methanol Co-Feed Phase and a Separated Methanol Only Feed Phase Applied to P. pastoris Aox1Aox2 Secreting VHH

(186) To check secreted recombinant protein production with another secreted protein the bioreactor cultivation described in Example 10a) was repeated with the strain P. pastoris aox1aox2 pPM2pZ30_pAOX1_MF-vHH_CycTT. a) As in Example 10a), this bioreactor cultivation was separated into three phases. (1) Phase one was the batch phase. For this the reactors were inoculated with the production strain P. pastoris aox1aox2 pPM2pZ30_pAOX1_MF-vHH_CycTT with a start OD.sub.600 of 2 as described in Example 7a) b). The batch phase lasted for 18.79 and 19.33 hours for reactor R1 and R2, respectively. The end of the batch phase was indicated by a dissolved oxygen peak. (2) At this point Phase two was started. Phase two consisted of a 50% (w/w) glucose feed at 4.8 mL/h for 33.9 hours to increase the biomass even higher than in Example 10. At the start of Phase two a 50% (v/v) methanol pulse was added to increase the methanol concentration to the target value of 1.5% (v/v) and a subsequent methanol feed was started to counteract methanol consumption, evaporation and dilution by the glucose feed. (3) Phase three consisted of a methanol only feed for 63.9 hours. The stirrer speed was set to a constant 760 rpm and gassing to 9.5 sL/h. Methanol concentration was measured at line with HPLC every day as described in Example 6d). An additional compensation pulse was added if necessary. b) The methanol feed was calculated as described in Example 9b) The process and productivity data can be found in Table 13. The maximal and minimal methanol concentration throughout the cultivation of the two repeats ranged from 8.7 g/L (R1) to 11.3 g/L (R1). The overall average specific productivity was 118.0 g g.sup.1 h.sup.1 and in phase three 88.2 g g.sup.1 h.sup.1. The methanol concentration at the end of the cultivation was 10.5 and 10.8 g/L for reactor R1 and R2. The amount of consumed methanol by reactor R1 and R2 was 26.6 g and 26.0 g. This was calculated by the following equation as shown in Example 8e). This amount is higher as in Example 10 due to the higher biomass concentration, but still significantly (5-times) lower than in a Mut.sup.S strain (as described in Example 12). Because the biomass was constant in phase three the methanol uptake rate (q.sub.methanol) was calculated for phase three as shown in Example 9b). In phase three the q.sub.methanol for reactor R1 was 4.75 mg g.sup.1 h.sup.1 and for reactor R2 it was 4.68 mg g.sup.1 h.sup.1. c) Overall the biomass decreased by 4.4% and 4.9% for reactor R1 and R2 in phase three as in previous Examples. The data in Table 13 clearly show that the P. pastoris aox1aox2 strains can produce secreted recombinant proteins even in gram per liter amounts. In the methanol only feed phase the vHH concentration increased by 815.5 mg/L, meaning that an average total of 323.1 mg of antibody fragment was produced using methanol as the only carbon source.

(187) TABLE-US-00013 TABLE 13 Bioreactor cultivation process data and productivity (q.sub.P) for Example 11. The total biomass was corrected for 12 mL sampling as in Example 9 b) Recombinant Total protein Specific Methanol biomass concentration productivity (q.sub.P) concentration Time Volume (mL) YDM (g/L) (g) (mg/L) (g g.sup.1 h.sup.1) (g/L) Phase (h) R1 R2 R1 R2 R1 R2 R1 R2 R1 R2 R1 R2 1 20.00 316.7 316.7 25.1 25.2 7.9 8.0 0.0 0.0 0.0 0.0 2 21.42 10.9* 10.9* 28.22 358.4 358.7 60.2 60.1 21.9 21.9 58.2 59.7 137.8 141.5 44.83 449.9 449.8 105.8 105.2 48.6 48.3 494.4 464.5 222.8 208.3 7.8 7.9 53.58 499.8 499.4 124.1 122.9 64.3 63.7 776.8 854.1 176.0 246.2 3 68.83 502.5 503.3 115.5 116.3 61.8 62.3 1156.0 1030.0 142.5 72.2 8.7 9.5 92.00 511.3 511.1 110.8 109.4 61.8 61.1 1337.2 1374.0 55.8 97.5 11.3 9.8 117.92 525.0 527.3 104.7 102.7 61.5 60.6 1623.2 1638.6 85.7 85.8 10.5 10.8 *Represents a control sample after the methano pulse.

Example 11.1: Process Parameters Obtained with P. pastoris Aox1Aox2 (Mut.SUP..) Strains Compared to a Methanol Utilization Slow P. pastoris Aox1 (Mut.SUP.S.) Cultivated with an Established Bioreactor Cultivation Protocol

(188) For comparison the P. pastoris aox1 pPM2pN21_pAOX1_HSAopt_CycTT was cultivated with an established cultivation protocol for the Mut.sup.S phenotype (Potvin, Ahmad, & Zhang, 2012). a) This bioreactor cultivation was separated into four phases. (1) Phase one was the batch phase. For this the reactors were inoculated with the production strain P. pastoris aox1 pPM2pN21_pAOX1_HSAopt_CycTT with a start OD.sub.600 of 2 as described in Example 7a) b). The batch phase lasted for 20.17 and 20.30 hours for reactors R1 and R2, respectively. The end of the batch phase was indicated by a dissolved oxygen peak. (2) Phase two is a linearly increasing (y=0.225x+1.95) 60% glycerol feed for 8 hours. (3) Phase three was a co-feed phase with a linearly decreasing (y=3.750.111x) 60% glycerol feed and a linearly increasing (y=0.028x+0.6) 100% methanol feed for 18 hours (4) Phase four is a methanol only feed phase with a linearly increasing 100% methanol feed (y=0.028x+1.10) for 72 hours. The total run time was 119.25 hours. b) The glycerol and methanol feed was gravimetrically controlled based on the equations in a) by the DASGIP control software (Eppendorf AG, Germany) c) The process and productivity data can be found in Table 13.1. The overall average specific productivity from phase three to four (the production phases) was 61.7 g g.sup.1 h.sup.1. The average total amount of consumed methanol was 165.8 g over the whole cultivation period and 150.6 g in phase four (methanol only feed phase). The residual methanol concentration in the culture broth was considered to be zero as this was a methanol limited cultivation. Phase four in this example corresponds to phase three in Examples 9, 10 and 11. Based on the average biomass in phase four the methanol uptake rate (q.sub.methanol) as shown in Example 9b) was calculated. The q.sub.methanol in phase four for reactor R1 is 37.1 mg g.sup.1 h.sup.1 and 37.6 mg g.sup.1 h.sup.1 for reactor R2. The q.sub.methanol in phase four facilitates an unwanted biomass increase. 53.2% (R1) and 52.4% (R2) of the total biomass at cultivation finish are generated during phase four growth on methanol. d) The comparison of strain related process parameters are depicted in table Table 13.2 and an overview of the specific methanol uptake rates and feed rates from the presented examples can be found in Table 13.3. By using the P. pastoris aox1aox2 Mut.sup. for recombinant protein production several of the key processes parameters improved considerably compared to a process with the P. pastoris aox1. The heat of reaction is reduced substantially by more than 80% leading to a reduced need for cooling. The specific oxygen uptake rate and oxygen transfer rate is reduced by more than 80% leading to a reduced need for mixing and aeration, reducing the flow rate of aeration as well as the need to supply pure oxygen to the bioreactor vessels. The lower specific methanol uptake rate reduces the amount of methanol needed in a cultivation. Methanol is toxic and flammable.

(189) Use of the Mut.sup. strains represents a technical and safety improvement as it reduces the quantities of methanol that need to be handled and stored in a production facility. Another advantage is the lower sensitivity of the P. pastoris aox1aox2 to high methanol concentrations. This is confirmed by cell viability data of the strain P. pastoris aox1aox2 in Example 10 and P. pastoris aox1 in this example. In Example 10 the viability of the Mut.sup. cells in reactors R1 and R2 at the end of the process was 99.8% and 99.7%. In contrast the cell viability of the Mut.sup.S cells in reactors R1 and R2 in this example was 95.9% and 96.5%. The lower sensitivity and higher viability of the P. pastoris aox1aox2 strain has an effect on the purity of the recombinant produced secreted protein. Lysed cells release proteases that degrade the protein of interest and add unwanted soluble protein in the supernatant, both effects lead to lower purity and loss of the protein of interest in the supernatant. The purity of the P. pastoris aox1 in this example was 72% and 77% for reactors R1 and R2, in comparison the purity of the P. pastoris aox1aox2 in Example 10 was 85% for both reactors R1 and R2.

(190) TABLE-US-00014 TABLE 13.1 Bioreactor cultivation process data and specific productivity (q.sub.product) for Example 11.1. Recombinant protein Specific Total biomass concentration productivity (q.sub.P) Time Volume (mL) YDM (g/L) (g) (mg/L) (pg g.sup.1 h.sup.1) Phase (h) R1 R2 R1 R2 R1 R2 R1 R2 R1 R2 1 20.3 318.1 316.5 26.6 25.9 8.5 8.2 2 28.5 330.4 328.6 51.6 51.4 17.0 16.9 0.0 0.0 0.00 0.0 3 47.1 392.5 390.3 99.6 100.4 39.1 39.2 129.6 112.9 65.57 56.6 4 69.8 428.4 426.5 111.5 111.4 47.7 47.5 260.9 306.7 36.89 53.9 92.9 487.8 487.3 126.9 124.6 61.9 60.7 548.1 534.7 67.14 56.7 119.3 581.9 584.9 143.7 140.8 83.6 82.3 893.9 927.9 61.55 72.7

(191) TABLE-US-00015 TABLE 13.2 Comparison of key bioreactor cultivation parameters overall and on the methanol only feed phases of P. pastoris aox1aox2 pPM2pN21_pAOX1_HSAopt_CycTT in Example 10 and P. pastoris aox1 pPM2pN21_pAOX1_HSAopt_CycTT in Example 11.1. P. pastoris P. pastoris aox1aox2 aox1 pPM2pN21_ pPM2pN21_ pAOX1_HSAopt_CycTT pAOX1_HSAopt_CycTT Example 10 Example 11.1 Change Overall HSA 531 911 42% concentration (mg/L) q.sub.product 46 62 26% (g g.sup.-1 h.sup.-1) Methanol Duration (h) 73.1 72.2 only feed Heat production 3 19.2 84% phase: rate (W/L) Example OTR 23 149 85% 10- Phase (mM/h) three; Heat of reaction 359 2286 84% Example (kJ) 11.1 - Integrated OTR Phase four (MA 120 min) Heat of 324 2468 87% combustion (kJ) qO2 81% (mmol g.sup.-1 h.sup.-1) q.sub.methanol 4.6 37.4 88% (mg g.sup.-1 h.sup.-1) Protein (mg) 106 250 58% Protein/methanol 7 1.7 +311% (mg g.sup.-1) Protein/0.sub.2 135 51 +164% (mg mol.sup.-1) Protein/Heat of 0.30 0.11 +172% reaction (mg kJ.sup.-1)

(192) TABLE-US-00016 TABLE 13.3 Specific methanol uptake rates and methanol feed rates based on average cell dry weight in the methanol only feed phase. Example 7 Example 9 Example 10 Example 11 Example 11.1 Reactor R1 R2 R3 R4 R1 R2 R1 R2 R1 R2 q.sub.methanol 4.92 5.22 3.79 3.92 4.61 4.54 4.75 4.68 37.1* 37.1* (mg g.sup.1 h.sup.1) Feed rate NA NA 4.79 4.89 5.80 5.73 5.78 7.71 37.1 37.6 (mg g.sup.1 h.sup.1) *As Example 11.1 has a limited methanol feed the q.sub.methanol and feed rate are considered equal.

Example 12: Generation of Methanol Utilization Negative and Alcohol Dehydrogenase Defective Strains

(193) The methanol consumption of the P. pastoris Mut.sup. strain observed in Example 7 was unexpected and new. Based on this knowledge the hypothesis was formed that alcohol dehydrogenases might be responsible for this characteristic. To test the effect of alcohol dehydrogenases on methanol consumption in the P. pastoris aox1aox2 two potential alcohol dehydrogenases were selected ADH2: PP7435_Chr2-0821 and ADH900: PP7435 Chr2-0990 for deletion. Three strains were created, (1) an ADH2 defective strain, (2) an ADH900 defective strain and (3) a double deletion ADH2 & ADH900 strain by exchanging the coding region of the gene with an antibiotic resistance. Effectively the strains (1) P. pastoris aox1aox2 adh2::HphR, (2) P. pastoris aox1aox2 Adh900::KanMX and (3) P. pastoris aox1aox2 adh2::HphR adh900::KanMX were created. a) P. pastoris aox1aox2 was made electrocompetent as described in Example 1a). For generating the ADH2 deletions the spilt marker approach was used described in example 1b). The electrocompetent cells were transformed with 500 ng of Adh2 split marker cassette 1 and 500 ng Adh2 split marker cassette 2 as described in Example 1d). The cassette sequences can be found in Table 14. The transformants were selected on YPD plates with 200 g/mL Hygromycin. One clone was selected based on PCR amplification and sequencing of the PCR amplicon. The successful substitution of the ADH2 coding region with the antibiotic marker was verified by PCR amplification with the primers Adh2_KO_ctrl_fwd & Adh2_KO_ctrl_rev (Table 15) and sequencing of the PCR amplicon (Microsynth AG, Swiss). The generated strain is called (1) P. pastoris aox1aox2 adh2::HphR. b) The P. pastoris aox1aox2 strain was made electrocompetent as described in Example 1a). The electrocompetent cells were transformed with 500 ng of Adh900 split marker cassette 1 and 500 ng Adh900 split marker cassette 2 as described in Example 1d). The cassette sequences can be found in Table 14. The transformants were selected on YPD plates with 500 g/mL Geneticin. One clone was selected based on PCR amplification and sequencing of the PCR amplicon. The successful substitution of the ADH900 coding region with antibiotic marker was verified by PCR amplification with the primers Adhl1_KO_Ctrl_fwd & Adhl1_KO_Ctrl_rev (Table 15) and sequencing of the PCR amplicon (Microsynth AG, Swiss). The generated strain is called (2) P. pastoris aox1aox2 Adh900::KanMX. c) The P. pastoris aox1aox2 adh2::HphR strain was made electrocompetent as described in Example 1a) apart from that 200 g/mL Hygromycin were added to the main culture medium. The electrocompetent cells were transformed with 500 ng of Adh900 split marker cassette 1 and 500 ng Adh900 split marker cassette 2 as described in Example 1d). The cassette sequences can be found in Table 14. The transformants were selected on YPD plates with 200 g/mL Hygromycin and 500 g/mL Geneticin. One clone was selected based on PCR amplification and sequencing of the PCR amplicon. The successful substitution of the ADH900 coding region with the antibiotic marker was verified by PCR amplification with the primers Adhl1_KO_Ctrl_fwd & Adhl1_KO_Ctrl_rev (Table 15) and sequencing of the PCR amplicon (Microsynth AG, Swiss). The generated strain is called (3) P. pastoris aox1aox2 Adh2::Hph R Adh900::KanMX. d) Genomic DNA for PCR amplifications was isolated with the Wizard Genomic DNA Purification Kit (Promega Corporation, USA) as per manufacturer's recommendations. The PCR amplification reactions were done with the Q5 polymerase (New England Biolabs, Inc., USA) as per manufacturer's recommendations.

(194) TABLE-US-00017 TABLE14 SplitmarkercassetteDNAsequenceusedforgeneratingtheAdh2and Adh900deletionstrains. DNAfragment DNAsequence5to3 Adh2 (SEQIDNO:72) splitmarker CGTATCTACCGATGATGGCACCAGCCTCCATCTGTTCGTAGACCTTAGCAAGTTCAGACA cassette1 GACCGATAATCTTGATAGGAGCCTTGACCAAACCTCTGGTGAACAAGTCGATGGCCTCGG CACTGTCCTCTCTGTTTCCAACGTAAGATCCCTTGATCTCGATGGACTTCAGAACGTGCC AGAAAACGTCAGAGTTGACAACGGCACCAGATGGCAGACCAACCAAAACAACCTTACCCA AAGTTCTAACGTATTGGACAGATTGGTTGATAGCATGTGGGGAAACGGAGACGTTAATAA CACCGTGTGGACCACCGTTGGTGAGCTTTTGGACTTCAGCAACGACGTCCTTAGTCTTAG TGAAGTCGACGAAGACCTCAGCACCCAAGGACTTGACAAATTCACCCTTGTCGGCACCAC CATCAATACCCAAAACTCTCAAACCCAGAGCCTTGGCGTATTGAACGGCAAGAGAACCCA GTCCTCCACCAGCACCAGAAATGGCAACCCATTGGCCAATACGCAAGTCAGCGGTCTTAA GAGCCTTGTAAACGGTGATACCAGCACACAGAATTGGGGCAACTTCAGCCAAGTCAGCCT CCTTTGGAATTCTGGCGGCTTGGGTGGCATCAGCAGTAGCATACTGCTGGAAAGATCCGT CGTGGGTGAAACCAGACAGGTCAGCCTTGGCACAACTGGATTCAGCACCTTGGATACAGT ACTCACAGTTCAAACAAGAACCGTTCAACCATTTGATACCAGCGTAGTCACCGATAGTGG ATCTGATATCACCTAATAACTTCGTATAGCATACATTATACGAAGTTATATTAAGGGTTC TCGAATGGTACCTTGCTCACATGTTGATCTCCAGCTTGCAAATTAAAGCCTTCGAGCGTC CCAAAACCTTCTCAAGCAAGGTTTTCAGTATAATGTTACATGCGTACACGCGTCTGTACA GAAAAAAAAGAAAAATTTGAAATATAAATAACGTTCTTAATACTAACATAACTATAAAAA AATAAATAGGGACCTAGACTTCAGGTTGTCTAACTCCTTCCTTTTCGGTTAGAGCGGATG TGGGGGGAGGGCGTGAATGTAAGCGTGACATAACTAATTACATGATATCGACAAAGGAAA AGGGGGACGGATCTCCGAGGTAAAATAGAACAACTACAATATAAAAAAACTATACAAATG ACAAGTTCTTGAAAACAAGAATCTTTTTATTGTCAGTACTGATTATTCCTTTGCCCTCGG ACGAGTGCTGGGGCGTCGGTTTCCACTATCGGCGAGTACTTCTACACAGCCATCGGTCCA GACGGCCGCGCTTCTGCGGGCGATTTGTGTACGCCCGACAGTCCCGGCTCCGGATCGGAC GATTGCGTCGCATCGACCCTGCGCCCAAGCTGCATCATCGAAATTGCCGTCAACCAAGCT CTGATAGAGTTGGTCAAGACCAATGCGGAGCATATACGCCCGGAGCCGCGGCGATCCTGC AAGCTCCGGATGCCTCCGCTCGAAGTAGCGCGTCTGCTGCTCCATACAAGCCAACCACGG CCTCCAGAAGAAGATGTTGGCGACCTCGTATTGGGAATCCCCGAACATCGCCTCGCTCCA GTCAATGACCGCTGTTATGCGGCCATTGTCCGTCAGGACATTGTTGGAGCCGAAATCCGC GTGCACGAGGTGCCGGACTTCGGGGCAGTCCTCGGCCCAAAGCATCAGCTCATCGAGAGC CTGCGCGACGGACGCACTGACGGTGTCGTCCATCACAGTTTGCCAGTGATACACATGGGG ATCAGCAATCGCGCATATGAAATCACGCCATGTAGTGTATTGACCGATTCCTTGCGGTCC GAATGGGCCGAACCCGCTCGTCTGGCTAAGATCGGCCGCAGCGATCGCATCCATGGCCTC CGCGACCGGCTGCAGAACAGCGGGCAGTTCGGTTTCAGGCAGGTCT Adh2 (SEQIDNO:73) splitmarker AGATGTTGGCGACCTCGTATTGGGAATCCCCGAACATCGCCTCGCTCCAGTCAATGACCG cassette2 CTGTTATGCGGCCATTGTCCGTCAGGACATTGTTGGAGCCGAAATCCGCGTGCACGAGGT GCCGGACTTCGGGGCAGTCCTCGGCCCAAAGCATCAGCTCATCGAGAGCCTGCGCGACGG ACGCACTGACGGTGTCGTCCATCACAGTTTGCCAGTGATACACATGGGGATCAGCAATCG CGCATATGAAATCACGCCATGTAGTGTATTGACCGATTCCTTGCGGTCCGAATGGGCCGA ACCCGCTCGTCTGGCTAAGATCGGCCGCAGCGATCGCATCCATGGCCTCCGCGACCGGCT GCAGAACAGCGGGCAGTTCGGTTTCAGGCAGGTCTTGCAACGTGACACCCTGTGCACGGC GGGAGATGCAATAGGTCAGGCTCTCGCTGAATTCCCCAATGTCAAGCACTTCCGGAATCG GGAGCGCGGCCGATGCAAAGTGCCGATAAACATAACGATCTTTGTAGAAACCATCGGCGC AGCTATTTACCCGCAGGACATATCCACGCCCTCCTACATCGAAGCTGAAAGCACGAGATT CTTCGCCCTCCGAGAGCTGCATCAGGTCGGAGACGCTGTCGAACTTTTCGATCAGAAACT TCTCGACAGACGTCGCGGTGAGTTCAGGCTTTTTACCCATGGTTTAGTTCCTCACCTTGT CGTATTATACTATGCCGATATACTATGCCGATGATTAATTGTCAACACCGCCCTTAGATT AGATTGCTATGCTTTCTTTCTAATGAGCAAGAAGTAAAAAAAGTTGTAATAGAACAAGAA AAATGAAACTGAAACTTGAGAAATTGAAGACCGTTTATTAACTTAAATATCAATGGGAGG TCATCGAAAGAGAAAAAAATCAAAAAAAAAAAATTTTCAAGAAAAAGAAACGTGATAAAA ATTTTTATTGCCTTTTTAGACGAAGAAAAAGAAACGAGGCGGTCTCTTTTTTCTTTTCCA AACCTTTAGTACGGGTAATTAACGACACCCTAGAGGAAGAAAGAGGGGAAATTTAGTATG CTGTGCTTGGGGGTTTTGNAAATGGTACGGCGATGCGCGGAATCCGAGAAAATCTGGAAG AGTAAAAAAGGAGTAGAAACATTTTGAAGCTATGGTGTGTGGTACCGATCTAGACCTAAT AACTTCGTATAGCATACATTATACGAAGTTATATTAAGGGTTGTCGACCTGCAGCGTACG GCACGAATTCGCACCCCGGAGAGCGCTCACCCCCGTTTTCAAACAGCGGGGGGAGCACAA AATGTTGAAAACTACACAGATCTTTTCGGACACCGGTCGCTTTATGTAGTCGACATGCAG ATTCTCCCAAATGGAAAACGAGATTGGACAATTTGTGGAGTTGGAAAGGGGGGTGGGAAT CAACGAAATTAGCAGATTCATGGGCAATTGGCAGGACTGGGCAGAAGGGGTGAGAATTGC AATCGAATGGAACAGGCACTCCCGTTGCGAAATCAAAAAAGTCTCGCTATCTGAACTGAT TTTTTTTAAGCAGCAACTTACGGTCAATACATCTCCGATGGAGGAATTTTTCACCCCTCG CTAACTAGATGGGCCCCTTCTAAGAAATTTGGGTTTAAGGTTGGGCAGTCAGTCAGTGCA CCAATGCTAACTGCCATTTGTCCAAAGAGGGGTGCAAGGATGAGGGACCGTTGAGAATAA GATTTGGGGTGTTAATCGGTGATACTGATTTGTCAAAGAGTGGGGAGGACTGCTGGGCAT TGTTCACCCCCCTAGTTGTTAGAGTTCGATAGCCGGCCGAATCACCCCCCTCTTCTTACA TAATCATTGTCACTATGTGGGGTCTCTACAGTCTCACCCTGCGATCCGGGACGACGCCGC GAAATTAGGGGGCAAGTCTCCTCCGGGCATGCAATATTGGTAACAGGATCAATTGATGCG AGAAAAGTTGGAGGGGGTGTAAAATTCAAGCCCACAAAGTCACACCCTTATGCCTGTAGA GGGGCAATCGGAGAGCAGCCATGGGGTGT Adh900 (SEQIDNO:74) splitmarker CACTCCAGTTGGGCCATTACCGAACATTTTGCCATTGTAGGCGATTAGTAAGTATTAACA cassette1 AGACAGCTGACTATACGTTTATTCTCAAACAATATTTCCCTTTTTGGTTTTGACCTCGCT TTAATCAATTTTTCAGACCTGATCCCACCTACTTTTCTTCGGCCTCAACTTCAATCTGAC TCTTCTCTCTCAATTGGTACCAACCAGCCAGAAAATGTCCTTCCGTTACTTGAAACGGCA TTTCTCTACAGCTACAAACGCAATTGCTCTCCTTAGCAGACCTGAATTCAAAATAGGTCG AATTGTGGACGTCGTGAAACATCCAAATGCAGACAAACTTTATGTCTCGTCGATTTCTGT GGGAAACAATTATGCCTCGGGTACATCCAACACCCTAACCGTTTGCAGCGGCTTGGTGGA CTACTTTTCAGTTCCCGAATTGCTTCAGCGACGGGTCGTTGTGGTCACAAACCTCAAGCC ATCGAAGATGAGAGGTGTAACATCGGAGGCAATGCTTTTGGCAGGGGAAAAGTCGGGGAA AGTGGAATTGGTCGAGCCGCCAATGTCCGGGAGAGAGGGCGAATCACTCCACTTCGAAGG TGTAGAAATTACATCAGAGGAGAGCGCCAATCAATTGCATTTGCCTGCTAAGCGATTGAA GAAGTCAGAGTGGAGTCAACTGGCGGAAGGTCTACAGACAAATGACCAGCGTGAAGTGGT CTTCCACAGCCAAATTGGCTCCAAACGAATTTACGCTTTAGTAGGAGCGAGTACTGAAAA ATGCACGTTAGCGACTCTTGCGCAGGCCGTCGTACGATAAGGGCAATATGGTTGAGAACG TTCCTCACCCAAATAAAATCATCGTACGCTGCAGGTCGACAACCCTTAATATAACTTCGT ATAATGTATGCTATACGAAGTTATTAGGTCTAGATCGGTACCGACATGGAGGCCCAGAAT ACCCTCCTTGACAGTCTTGACGTGCGCAGCTCAGGGGCATGATGTGACTGTCGCCCGTAC ATTTAGCCCATACATCCCCATGTATAATCATTTGCATCCATACATTTTGATGGCCGCACG GCGCGAAGCAAAAATTACGGCTCCTCGCTGCAGACCTGCGAGCAGGGAAACGCTCCCCTC ACAGACGCGTTGAATTGTCCCCACGCCGCGCCCCTGTAGAGAAATATAAAAGGTTAGGAT TTGCCACTGAGGTTCTTCTTTCATATACTTCCTTTTAAAATCTTGCTAGGATACAGTTCT CACATCACATCCGAACATAAACAACCATGGGTAAGGAAAAGACTCACGTTTCGAGGCCGC GATTAAATTCCAACATGGATGCTGATTTATATGGGTATAAATGGGCTCGCGATAATGTCG GGCAATCAGGTGCGACAATCTATCGATTGTATGGGAAGCCCGATGCGCCAGAGTTGTTTC TGAAACATGGCAAAGGTAGCGTTGCCAATGATGTTACAGATGAGATGGTCAGACTAAACT GGCTGACGGAATTTATGCCTCTTCCGACCATCAAGCATTTTATCCGTACTCCTGATGATG CATGGTTACTCACCACTGCGATCCCCGGCAAAACAGCATTCCAGGTATTAGAAGAATATC CTGATTCAGGTGAAAATATTGTTGATGCGCTGGCAGTGTTCCTGCGCCGGTTGCATTCGA TTCCTGTTTGTAATTGTCCTTTTAACAGCGATCGCGTATTTCGTCTCGCTCAGGCGCAAT CACGAATGAATAACGGTTTGGTTGATGCGAGTGATTTTGATGACGAGCGTAATGGCTGGC CTGTTGAACAAGTCTGGAAAGAAATGCATAAGCTTTTGCCATTCTCACCG Adh900 (SEQIDNO:75) splitmarker AAGCCCGATGCGCCAGAGTTGTTTCTGAAACATGGCAAAGGTAGCGTTGCCAATGATGTT cassette2 ACAGATGAGATGGTCAGACTAAACTGGCTGACGGAATTTATGCCTCTTCCGACCATCAAG CATTTTATCCGTACTCCTGATGATGCATGGTTACTCACCACTGCGATCCCCGGCAAAACA GCATTCCAGGTATTAGAAGAATATCCTGATTCAGGTGAAAATATTGTTGATGCGCTGGCA GTGTTCCTGCGCCGGTTGCATTCGATTCCTGTTTGTAATTGTCCTTTTAACAGCGATCGC GTATTTCGTCTCGCTCAGGCGCAATCACGAATGAATAACGGTTTGGTTGATGCGAGTGAT TTTGATGACGAGCGTAATGGCTGGCCTGTTGAACAAGTCTGGAAAGAAATGCATAAGCTT TTGCCATTCTCACCGGATTCAGTCGTCACTCATGGTGATTTCTCACTTGATAACCTTATT TTTGACGAGGGGAAATTAATAGGTTGTATTGATGTTGGACGAGTCGGAATCGCAGACCGA TACCAGGATCTTGCCATCCTATGGAACTGCCTCGGTGAGTTTTCTCCTTCATTACAGAAA CGGCTTTTTCAAAAATATGGTATTGATAATCCTGATATGAATAAATTGCAGTTTCATTTG ATGCTCGATGAGTTTTTCTAATCAGTACTGACAATAAAAAGATTCTTGTTTTCAAGAACT TGTCATTTGTATAGTTTTTTTATATTGTAGTTGTTCTATTTTAATCAAATGTTAGCGTGA TTTATATTTTTTTTCGCCTCGACATCATCTGCCCAGATGCGAAGTTAAGTGCGCAGAAAG TAATATCATGCGTCAATCGTATGTGAATGCTGGTCGCTATACTGGTACCATTCGAGAACC CTTAATATAACTTCGTATAATGTATGCTATACGAAGTTATTAGGTGATATCAGATCCACT CTGTAGTGAGGGTTGGTGGTCTGACGAACATCCAGCAAGGTGTTCCACCTGAAATTTTTC ACCTTGGAGGGTAATGTGATGACGCCATTTCCTGTGCAAATGCTTTTCGTTTTGAACAGT GCAACTTTTGTATCAGATCTTCATCTACTTGATGCCATCTCAACAAATCCCTCATTTACT AGCGTGTGAAGGAATCTAGATTTTCCACTGATAAGCCAATTTGTCGGAAATCCCCCGCGC GGGAGTTGGCGTTCAGTACGAGCCACACACGTTTCTTTTGGACAACCAAAGCATCCGCCT GAAGGGACAACTTGCATTCAACGGCTTCAGTTGGAAACGTCAGAGCTGACCTATAGTTTG CTAGAACCGTTTTCTCTGTTTACGTTTACGTCTCCTCAAATTTGCGCTCGGTATGTCCTT CCTAATTAGCGGGAAAAGCTGTTCTTAGTTAATACGGAGAAAGTTTCGGGGTTACCGTTC CGGGAAGAGGAGGGGTCATCTCTCTCATCTCATCCAACCATTAAGTTTCTTCCAAAACTT CAGGATAATCAGTTTAACCACCGACAGGAGTCAGATTTGAGATTGACAGAAAGTTTTTCC GTCCATTTCCTCATCTTGTCGCCGTTATCAGTCAATCTCTATGGTTATCTGGAATTTCTT TTTTCTTTTAATTCATCTTCTTTTTATCCCGCGCCTTTGGCGTTCTAGCTCATCTCATGA AAACAAAACCCTCTCATGTTCGGATAATTCCAGCGGCTTTCACTTTCAGATGACACATAG ATTGGACTCAACCATGGCTATCTGGGGTATACGGACGTTGGCAAGGGCGTTAATTTTTCA GGACAAACGGAAATGCCATGGCTCCAGGGAAAGGCATTCCTATTGCAAACCTAGACCGTC GAACCTCTCCTATCGCCTACCAGTCACCCAGCTATCCCTAGGCAACTCATCTCCTTCAAG CGGATTGCAACCTGCTAAGCCAAATTAGATCTGGCCACAGAAATGCCGCAATATTTCTTG GCTCTCCCCTCCC

(195) TABLE-US-00018 TABLE15 Polymerasechainreactionprimers. PrimerName DNAsequence5to3 Adh2_KO_ctrl_fwd GAATTGAGCCAAAAAAGGAGAGG (SEQIDNO:76) Adh2_KO_ctrl_rev GATGGAATAGGAGACTAGGTGTG (SEQIDNO:77) AdhII_KO_Ctrl_fwd TGGTTGAGACGTTTGTATTG (SEQIDNO:78) AdhII_KO_Ctrl_rev TGGGTTGGGAGTTTAGTG (SEQIDNO:79)

Example 13: Generation of Adh2 and Adh900 Overexpression Methanol Utilization Negative Strains

(196) For the purpose of checking the effect of ADH2 and ADH900 overexpression. An expression construct was created being composed of a constitutive promoter PGAP: PP7425_Chr1 (596296 . . . 596790) and the ADH2 coding sequence or the ADH900 coding sequence, respectively. The ADH2 and ADH900 coding sequence (Table 16) were modified to eliminate BbsI and BsaI restriction sites in the coding sequence without affecting the amino acid sequence of the gene product. The generated strains were designated P. pastoris aox1 aox2 BB3aZ_pGAP_Adh2_CycTT and P. pastoris aox1aox2 BB3aZ_pGAP_Adh900_CycTT. a) For the purpose of using the Golden Gate assembly method the restriction sites of restriction enzymes BbsI and BsaI (New England Biolabs, Inc., USA) needed to be removed from the coding sequence without affecting the amino acid sequence of the gene product. This process is called Curing. The coding sequence of ADH2 PP7435_Chr2-0821 was modified at c.45G>A and c.660C>G. The coding sequence of ADH900 PP7435_Chr2-0990 was modified at c.42C>G. The cured coding sequence used for Golden Gate assembly can be found in Table 15. Note that the first 12 base pairs and the last 15 base pairs are not part of the coding sequence and are needed for Golden Gate assembly. b) Golden Gate assembly as used here was already described (Prielhofer et al., 2017). (1) The expression construct BB3aZ_pGAP_Adh2_CycTT was assembled as follows. The Adh2_GG_cured DNA fragment (Table 15) was cloned into the BB1_23 backbone, creating the BB1_23_Adh2. The expression construct was generated by Golden Gate assembly of BB3aZ_14* (backbone), BB1_23_Adh2 (coding sequence) BB1_12_pGAP (promoter), BB1_34_ScCYC1tt (terminator). (2) The expression construct BB3aZ_pGAP_Adh900_CycTT was assembled as follows. The Adh900_GG_cured DNA fragment (Table 15) was cloned into the BB1_23 backbone, creating the BB1_23_Adh900. The expression construct was generated by Golden Gate assembly of BB3aZ_14* (backbone), BB1_23_Adh900 (coding sequence) BB1_12_pGAP (promoter), BB1_34_ScCYC1tt (terminator). The plasmids and sequences are available in the Golden PiCS kit #1000000133 (Addgene, Inc., USA).

(197) TABLE-US-00019 TABLE16 ADH2andADH900nativecodingsequenceandADH2curedcoding sequencewithmutationsinc.45G>Aandc.660C>GandADH900curedcoding sequencewithmutationsinc.42C>GusedforGoldenGateassembly.The first12basepairsandthelast15basepairsarenotpartofthecoding sequenceandareusedforGoldenGateassembly. DNAfragment DNAsequence5to3 ADH2 (SEQIDNO:80) coding ATGTCTCCAACTATCCCAACTACACAAAAGGCTGTTATCTTCGAGACCAACGGCG sequence GTCCCCTAGAGTACAAGGACATTCCAGTCCCAAAGCCAAAGTCAAACGAACTTTT GATCAACGTTAAGTACTCCGGTGTCTGTCACACTGATTTGCACGCCTGGAAGGGT GACTGGCCATTGGACAACAAGCTTCCTTTGGTTGGTGGTCACGAAGGTGCTGGTG TCGTTGTCGCTTACGGTGAGAACGTCACTGGATGGGAGATCGGTGACTACGCTGG TATCAAATGGTTGAACGGTTCTTGTTTGAACTGTGAGTACTGTATCCAAGGTGCT GAATCCAGTTGTGCCAAGGCTGACCTGTCTGGTTTCACCCACGACGGATCTTTCC AGCAGTATGCTACTGCTGATGCCACCCAAGCCGCCAGAATTCCAAAGGAGGCTGA CTTGGCTGAAGTTGCCCCAATTCTGTGTGCTGGTATCACCGTTTACAAGGCTCTT AAGACCGCTGACTTGCGTATTGGCCAATGGGTTGCCATTTCTGGTGCTGGTGGAG GACTGGGTTCTCTTGCCGTTCAATACGCCAAGGCTCTGGGTTTGAGAGTTTTGGG TATTGATGGTGGTGCCGACAAGGGTGAATTTGTCAAGTCCTTGGGTGCTGAGGTC TTCGTCGACTTCACTAAGACTAAGGACGTCGTTGCTGAAGTCCAAAAGCTCACCA ACGGTGGTCCACACGGTGTTATTAACGTCTCCGTTTCCCCACATGCTATCAACCA ATCTGTCCAATACGTTAGAACTTTGGGTAAGGTTGTTTTGGTTGGTCTGCCATCT GGTGCCGTTGTCAACTCTGACGTTTTCTGGCACGTTCTGAAGTCCATCGAGATCA AGGGATCTTACGTTGGAAACAGAGAGGACAGTGCCGAGGCCATCGACTTGTTCAC CAGAGGTTTGGTCAAGGCTCCTATCAAGATTATCGGTCTGTCTGAACTTGCTAAG GTCTACGAACAGATGGAGGCTGGTGCCATCATCGGTAGATACGTTGTGGACACTT CCAAATAA ADH900 (SEQIDNO:81) coding ATGTCTGTGATGAAAGCCCTCGTGTACGGTGGTAAGAACGTCTTCGCCTGGAAAA sequence ACTTCCCTAAACCAACTATCTTGCACCCAACAGATGTCATCGTTAAGACGGTGGC TACTACCATCTGCGGAACAGACTTGCACATCTTGAAAGGTGATGTTCCAGAGGTC AAACCTGAAACCGTCTTGGGTCATGAAGCAATTGGAGTCGTCGAATCTATCGGTG ATAACGTCAAAAACTTCAGCATTGGTGATAAGGTGCTGGTTTCATGCATCACCAG TTGTGGAAGCTGTTACTACTGTAAGAGAAACTTGCAGAGTCATTGCAAGACCGGT GGATGGAAATTAGGTCACGATTTGAACGGTACGCAGGCTGAGTTTGTCCGTATCC CATATGGAGACTTCTCATTGCACCGTATTCCTCATGAAGCAGATGAAAAGGCAGT TCTGATGCTGTCTGACATCTTACCTACTGCTTACGAAGTTGGTGTTCTTGCCGGA AATGTCCAAAAGGGAGACTCAGTTGCCATTGTCGGCGCCGGTCCAGTTGGTCTTG CCGCTCTGCTGACTGTCAAAGCCTTTGAGCCTTCTGAAATTATTATGATTGACAC TAACGATGAAAGACTGAGTGCCTCCTTGAAATTGGGAGCCACCAAGGCAGTCAAC CCAACCAAGGTCAGCAGTGTCAAAGATGCTGTTTATGATATTGTCAATGCCACTG TCCGCGTCAAGGAGAACGACCTGGAGCCAGGTGTCGATGTTGCCATTGAGTGTGT TGGTGTTCCTGACACGTTTGCAACTTGTGAAGAGATTATCGCCCCAGGTGGCCGT ATTGCCAATGTTGGTGTTCACGGCACTAAAGTGGATTTACAACTGCAAGACCTAT GGATCAAGAACATTGCTATCACCACCGGTTTGGTAGCCACATACTCCACTAAAGA CCTGTTGAAGCGAGTCTCTGACAAGTCTCTAGACCCTACACCACTGGTTACACAT GAGTTCAAGTTCAGTGAATTTGAGAAGGCCTATGAGACTTCTCAAAATGCTGCCA CCACCAAAGCCATCAAGATTTTCTTATCTGCCGATTAA Adh2_GG_ (SEQIDNO:82) cured GATAGGTCTCACATGTCTCCAACTATCCCAACTACACAAAAGGCTGTTATCTTCG AAACCAACGGCGGTCCCCTAGAGTACAAGGACATTCCAGTCCCAAAGCCAAAGTC AAACGAACTTTTGATCAACGTTAAGTACTCCGGTGTCTGTCACACTGATTTGCAC GCCTGGAAGGGTGACTGGCCATTGGACAACAAGCTTCCTTTGGTTGGTGGTCACG AAGGTGCTGGTGTCGTTGTCGCTTACGGTGAGAACGTCACTGGATGGGAGATCGG TGACTACGCTGGTATCAAATGGTTGAACGGTTCTTGTTTGAACTGTGAGTACTGT ATCCAAGGTGCTGAATCCAGTTGTGCCAAGGCTGACCTGTCTGGTTTCACCCACG ACGGATCTTTCCAGCAGTATGCTACTGCTGATGCCACCCAAGCCGCCAGAATTCC AAAGGAGGCTGACTTGGCTGAAGTTGCCCCAATTCTGTGTGCTGGTATCACCGTT TACAAGGCTCTTAAGACCGCTGACTTGCGTATTGGCCAATGGGTTGCCATTTCTG GTGCTGGTGGAGGACTGGGTTCTCTTGCCGTTCAATACGCCAAGGCTCTGGGTTT GAGAGTTTTGGGTATTGATGGTGGTGCCGACAAGGGTGAATTTGTCAAGTCCTTG GGTGCTGAGGTGTTCGTCGACTTCACTAAGACTAAGGACGTCGTTGCTGAAGTCC AAAAGCTCACCAACGGTGGTCCACACGGTGTTATTAACGTCTCCGTTTCCCCACA TGCTATCAACCAATCTGTCCAATACGTTAGAACTTTGGGTAAGGTTGTTTTGGTT GGTCTGCCATCTGGTGCCGTTGTCAACTCTGACGTTTTCTGGCACGTTCTGAAGT CCATCGAGATCAAGGGATCTTACGTTGGAAACAGAGAGGACAGTGCCGAGGCCAT CGACTTGTTCACCAGAGGTTTGGTCAAGGCTCCTATCAAGATTATCGGTCTGTCT GAACTTGCTAAGGTCTACGAACAGATGGAGGCTGGTGCCATCATCGGTAGATACG TTGTGGACACTTCCAAATAAGCTTAGAGACCGATC Adh900_GG_ (SEQIDNO:83) cured GATAGGTCTCACATGTCTGTGATGAAAGCCCTCGTGTACGGTGGTAAGAACGTGT TCGCCTGGAAAAACTTCCCTAAACCAACTATCTTGCACCCAACAGATGTCATCGT TAAGACGGTGGCTACTACCATCTGCGGAACAGACTTGCACATCTTGAAAGGTGAT GTTCCAGAGGTCAAACCTGAAACCGTCTTGGGTCATGAAGCAATTGGAGTCGTCG AATCTATCGGTGATAACGTCAAAAACTTCAGCATTGGTGATAAGGTGCTGGTTTC ATGCATCACCAGTTGTGGAAGCTGTTACTACTGTAAGAGAAACTTGCAGAGTCAT TGCAAGACCGGTGGATGGAAATTAGGTCACGATTTGAACGGTACGCAGGCTGAGT TTGTCCGTATCCCATATGGAGACTTCTCATTGCACCGTATTCCTCATGAAGCAGA TGAAAAGGCAGTTCTGATGCTGTCTGACATCTTACCTACTGCTTACGAAGTTGGT GTTCTTGCCGGAAATGTCCAAAAGGGAGACTCAGTTGCCATTGTCGGCGCCGGTC CAGTTGGTCTTGCCGCTCTGCTGACTGTCAAAGCCTTTGAGCCTTCTGAAATTAT TATGATTGACACTAACGATGAAAGACTGAGTGCCTCCTTGAAATTGGGAGCCACC AAGGCAGTCAACCCAACCAAGGTCAGCAGTGTCAAAGATGCTGTTTATGATATTG TCAATGCCACTGTCCGCGTCAAGGAGAACGACCTGGAGCCAGGTGTCGATGTTGC CATTGAGTGTGTTGGTGTTCCTGACACGTTTGCAACTTGTGAAGAGATTATCGCC CCAGGTGGCCGTATTGCCAATGTTGGTGTTCACGGCACTAAAGTGGATTTACAAC TGCAAGACCTATGGATCAAGAACATTGCTATCACCACCGGTTTGGTAGCCACATA CTCCACTAAAGACCTGTTGAAGCGAGTCTCTGACAAGTCTCTAGACCCTACACCA CTGGTTACACATGAGTTCAAGTTCAGTGAATTTGAGAAGGCCTATGAGACTTCTC AAAATGCTGCCACCACCAAAGCCATCAAGATTTTCTTATCTGCCGATTAAGCTTA GAGACCGATC c) The P. pastoris aox1aox2 strain was made electrocompetent as described in Example 1a). The BB3aZ_pGAP_Adh2_CycTT expression construct and the BB3aZ_pGAP_Adh900_CycTT expression construct was linearized with AscI (New England Biolabs, Inc., USA) as per the manufacturer's protocol and purified with the Hi Yield Gel/PCR DNA Fragment Extraction Kits (Sd-Laborbedarf GmbH, Germany). 500 ng of the linearized plasmid was transformed into electrocompetent P. pastoris aox1aox2 as previously described in Example 1a) and 1d). Positive transformants were selected on YPD plates with 25 g/mL Zeocin. The successful integration of the expression construct was verified by PCR amplification with primers 109_BB3aN_ctrl_fwd and pGAP_goi_rev_v2 (Table 17) with genomic DNA as template. The created strains are called P. pastoris aox1aox2 BB3aZ_pGAP_Adh2_CycTT and P. pastoris aox1aox2 BB3aZ_pGAP_Adh900_CycTT. d) Genomic DNA for PCR amplifications was isolated with the Wizard Genomic DNA Purification Kit (Promega Corporation, USA) as per manufacturer's recommendations. The PCR amplification reactions were done with the Q5 polymerase (New England Biolabs, Inc., USA) as per manufacturer's recommendations.

(198) TABLE-US-00020 TABLE17 Polymerasechainreactionprimers. PrimerName DNAsequence5to3 109_BB3aN_ctrl_fwd TTGATCTTTTCTACGGGGTGG (SEQIDNO:84) pGAP_goi_rev_v2 GGTGTTTTGAAGTGGTACGG (SEQIDNO:85)

Example 14: Measurement of Alcohol Dehydrogenase Activity in Cell Free Extract of Methanol Utilization Negative Alcohol Dehydrogenase Defective Strains

(199) To check for the successful deletion of the alcohol dehydrogenases on the phenotype level the alcohol dehydrogenase activity in cell free extracts with ethanol as a substrate was measured. Ethanol is generally regarded as the primary substrate for Adh2. a) An overnight culture was done in 2 mL of YPD media in 24 well plates sealed by an air permeable membrane at 25 C. and 280 rpm. The strains used, were from Example 12a) P. pastoris aox1aox2 Adh2::HphR, Example 12b) P. pastoris aox1aox2 Adh2::HphR Adh900::KanMX and Example 1e) P. pastoris aox1aox2. As an additional control the P. pastoris X33 (Thermo Fisher Scientific Inc., USA) and the P. pastoris X33 Adh2 (Nocon et al., 2014) was used. b) The cell free extracts were prepared by centrifuging (16.000 g, 5 min, 4 C.) the overnight culture and resuspending it in 1 mL phosphate buffered saline. After a second centrifuge step (16.000 g, 5 min, 4 C.) the cells were resuspended in 0.5 mL of cell lysis buffer with glass beats. The cultures were lysed in a ribolyser (MP Biomedicals, Inc., USA) by bead beating for 320 seconds at 6 m/s with 1 minute cooling on ice in-between steps. After the lysis step the cultures were centrifuged (16.000 g, 5 min, 4 C.) and the supernatant was transferred to a fresh Eppendorf tube and centrifuged again (16.000 g, 30 min, 4 C.) to remove any carried over cell debris. After the second centrifugation step the supernatant was stored at 20 C. till use. c) The cell lysis buffer consisted of 20 mM HEPES, 420 mM NaCl, 1.5 mM MgCl.sub.2, 10% Glycerol, 1 SIGMAFAST Protease Inhibitor Cocktail Tablets (Sigma-Aldrich GmbH) per 50 mL. The assay buffer consisted of 100 mM MOPS, 5 mM MgSO.sub.4, 2 mM NAD.sup.+ at pH 8.9. d) The protein concertation of the cell free extracts was measured by Pierce BCA Protein Assay (Thermo Scientific, Inc., USA) as per manufacturer's recommendations and uniformly adjusted to a common concentration of 3.8 mg/mL for all samples. e) The alcohol dehydrogenase activity assays were done in a 96 well plate. The measurements were done in a microplate reader (Tecan Group Ltd., Swiss) by measuring the absorbance of NADH at 340 nm. Temperature was set at 42 C. To start the assay 20 L cell free extracts were added to the assay buffer and equilibrated for 10 to 15 minutes before the addition of 1 M of ethanol as a substrate. The total end volume was 300 L. The activity in mU/mg was calculated from the maximal linear absorption increase after addition of the substrate ethanol. One activity unit corresponds to 1 mol substrate (NAD.sup.+) consumed per minute. This was calculated from the absorption data using the Lambert-Beer law and the coefficient .sub.NADH=6220 M.sup.1 cm.sup.1. f) The results show clearly the effect of AHD gene deletion on the Alcohol dehydrogenase activity of the cell free extracts (Table 18). By deleting the ADH2 gene an activity reduction of 94% is achieved. This is additionally confirmed by the P. pastoris X33 strains. By deleting also the second alcohol dehydrogenase gene ADH900 a combined activity reduction by 99% is observed.

(200) TABLE-US-00021 TABLE 18 Alcohol dehydrogenase activity of cell free extracts on ethanol as a substrate. Alcohol dehydrogenase activity (mU/mg) Mean Standard Error Clones tested P. pastoris CBS2612 aox1aox2 1293.8 244.9 3 P. pastoris CB52612 aox1aox2 80.8 7.9 6 Adh2::HphR P. pastoris CBS2612 aox1aox2 8.0 0.4 6 Adh2::HphR Adh900::KanMX P. pastoris X33 1196.5 28.3 3 P. pastoris X33 88.5 2.1 7 Adh2::HphR

Example 15: Measurement of Methanol Uptake Rates of Methanol Utilization Negative and Alcohol Dehydrogenase Deficient Strains

(201) To determine the methanol uptake rate the Mut.sup. and alcohol dehydrogenase deficient strains were cultivated in a bioreactor. The strains tested were the P. pastoris aox1aox2 Adh2::HphR, P. pastoris aox1aox2 Adh900::KanMX and P. pastoris aox1aox2 Adh2::HphR Adh900::KanMX. The cultures was grown till a certain biomass concentration. Then a methanol pulse was applied and the methanol concentration was measured immediately after the pulse and approximately 20 hours later. The experimental setup is already described in detail in Example 7. The goal was to determine the specific methanol uptake rate of the alcohol dehydrogenase deficient strains and compare it to the methanol uptake rate measured in Example 7. a) The reactors filled with 300 mL BSM media were inoculated with 15 mL of P. pastoris aox1aox2 adh2::HphR (reactor aR2 and aR4) and P. pastoris aox1aox2 adh900::KanMX (reactor aR1 and aR3). The target start OD.sub.600 was 2. At the end of the batch phase as indicated by a dissolved oxygen spike, a 50% (w/w) glucose feed was started at 2.8 mL/h for 24 hours to increase the biomass. Two hours after the glucose feed start a 50% (v/v) methanol shot was given to increase the methanol concentration to 1.5% (measured concentration was aR1=1.64%, aR2=1.66%, aR3=1.59% and aR4=1.67%). This was done to induce methanol consumption. At the end of the glucose feed phase samples for cell dry weight and HPLC were taken. b) After the glucose feed phase the agitation and gassing was set to a constant 750 rpm and 9.5 sL/h. An additional 50% methanol pulse was added to increase the concentration to 1.5% and immediately a HPLC sample was taken (measured concentration was aR1=1.36%, aR2=1.44%, aR3=1.34% and aR4=1.45%). The concentration was measured again after 18.4 hours and used to determine the specific methanol uptake rate (q.sub.methanol). c) A separate bioreactor cultivation was started to measure the uptake rate of the double ADH deletion strain P. pastoris aox1aox2 adh2::HphR adh900::KanMX. The cultivation was carried as explained in this example and Example 7. The P. pastoris aox1aox2 Adh2::HphR Adh900::KanMX was inoculated into reactor cR3 and cR4. The target start OD.sub.600 was 2. At the end of the batch phase as indicated by a dissolved oxygen spike, a 50% (w/w) glucose feed was started at 2.4 mL/h for 24 hours to increase the biomass. Two hours after the glucose feed start a 50% (v/v) methanol shot was given to increase the methanol concentration to 1.5% (measured concentration was cR3=1.50% and cR4=1.47%). This was done to induce methanol consumption. At the end of the glucose feed phase samples for cell dry weight and HPLC were taken. d) After the glucose feed phase the agitation and gassing was set to a constant 750 rpm and 9.5 sL/h. An additional 50% methanol pulse was added to increase the concentration to 1.5% and immediately a HPLC sample was taken (measured concentration was cR3=1.37% and cR4=1.49%). The concentration was measured again after 19.5 hours and used to determine the specific methanol uptake rate (q.sub.methanol). e) The specific methanol uptake rate was calculated as in Example 7d). By deleting the ADH2 a surprising and substantial reduction in methanol uptake rate was achieved (Table 19). The dc/dt of methanol is at 0.07 to 0.06 g L.sup.1 h.sup.1 for aR2 and aR4 which is only slightly higher that the evaporation observed in Example 6. In contrast the methanol uptake rate of the ADH900 deletion strain is not reduced and was in fact slightly higher than the measured uptake rate of the P. pastoris aox1aox2 in Example 7. This difference can be attributed to slightly different conditions between Example 7 and this example, the difference being a slightly higher reactor volume and methanol concentration after the methanol pulse. The double ADH deletion strain does not show an observable reduction of the methanol uptake rate compared to the already low uptake rate of the ADH2 deletion strain. These results unexpectedly confirmed that the ADH2 gene and its product, the enzyme Adh2, are to the biggest extend responsible for the characteristics observed for P. pastoris aox1aox2 and that the observations in Example 7 are not the consequence of spontaneous methanol oxidation or the promiscuous activity of any other enzyme. Therefore, it was concluded that the main responsible gene and enzyme for methanol uptake in the P. pastoris aox1aox2 is the ADH2 gene and its product the enzyme Adh2.

(202) TABLE-US-00022 TABLE 19 Overview specific methanol uptake rates (q.sub.methanol) and apparent methanol loss (dc/dt) for the ADH deletion strains. Methanol Methanol dc/dt q.sub.methanol Volume CDW at 0 h at 18.4 h (g L.sup.1 (mg g.sup.1 Reactor ADH gene (mL) (g/L) (g/L) (g/L) h.sup.1) h.sup.1) aR1 Adh900::KanMX 392 73.4 10.75 3.49 0.40 5.38 aR2 Adh2::HphR 385 74.1 11.40 10.20 0.07 0.89 aR3 Adh900::KanMX 395 71.2 10.61 3.24 0.40 5.63 aR4 Adh2::HphR 382 74.7 11.47 10.34 0.06 0.82 cR3 Adh2::HphR 373 73.9 10.8 10.0* 0.04 0.55 Adh900::KanMX cR4 Adh2::HphR 369 73.9 11.8 10.6* 0.06 0.85 Adh900::KanMX *The methanol concentration is measured at 19.5 h.

Example 16: Measurement of Methanol Uptake Rates of Methanol Utilization Negative and Alcohol Dehydrogenase Overexpression Strains

(203) To confirm that Adh2 is the responsible enzyme for the consumption of methanol in the P. pastoris aox1aox2 and to investigate if it is possible to increase the methanol uptake rate with overexpression of the ADH2 or ADH900 genes the specific methanol uptake rate of P. pastoris aox1aox2 BB3aZ_pGAP_Adh2_CycTT and P. pastoris aox1aox2 BB3aZ_pGAP_Adh900_CycTT strain was measured in a bioreactor cultivation. The experiment was done as described in Example 7 and 15. a) The reactors filled with 300 mL BSM media were inoculated with 15 mL of P. pastoris aox1aox2 BB3aZ_pGAP_Adh2_CycTT (reactor R1 and R3) and P. pastoris aox1aox2 BB3aZ_pGAP_Adh900_CycTT (R2 and R4). The target start OD.sub.600 was 2. At the end of the batch phase as indicated by a dissolved oxygen spike, a 50% (w/w) glucose feed was started at 2.8 mL/h for 24 hours to increase the biomass. Two hours after the glucose feed start a 50% (v/v) methanol shot was given to increase the methanol concentration to 1.5% (measured concentration was R1=1.56%, R2=1.53%, R3=1.52% and R4=1.54%). This was done to induce methanol consumption. At the end of the glucose feed phase samples for cell dry weight and HPLC were taken. b) After the glucose feed phase the agitation and gassing was set to a constant 750 rpm and 9.5 sL/h. An additional 50% methanol pulse was added to increase the concentration to 1.5% and immediately a HPLC sample was taken (measured concentration was R1=1.30%, R2=1.30%, R3=1.35% and R4=1.30%). The concentration was measured again after 4.1, 20.1 hours and used to determine the specific methanol uptake rate (q.sub.methanol). c) An additional sampling time point at 4.1 hours was chosen because a higher methanol uptake rate was expected. The average methanol uptake rate at 4.1 hours was 7.72 mg g.sup.1 h.sup.1 for the ADH2 overexpressing strain P. pastoris aox1aox2 BB3aZ_pGAP_Adh2_CycTT and 5.61 mg g.sup.1 h.sup.1 for the ADH900 overexpressing strain P. pastoris aox1aox2 BB3aZ_pGAP_Adh900_CycTT. After 20.1 hours the average uptake rate decreases to 6.35 mg g.sup.1 h.sup.1 for the ADH2 overexpressing strain and to 5.16 mg g.sup.1 h.sup.1 for the ADH900 overexpressing strain (Table 20). As previously discussed in Example 15e) no significant difference to the parent P. pastoris aox1aox2 can be observed when deleting the ADH900 gene and the same is true when overexpressing the ADH900 gene. On the other hand, the ADH2 overexpressing strain had a 37% and 23% higher uptake rate at 4.1 and 21.7 hours compared to the ADH900 overexpressing strain. Further underlining the unexpected finding that Adh2 is the responsible enzyme for the consumption of methanol and that it is possible to increase the methanol consumption with overexpression of the ADH2 gene.

(204) TABLE-US-00023 TABLE 20 Overview specific methanol uptake rates (q.sub.methanol) and apparent methanol loss (dc/dt) for the ADH overexpressing strains. Methanol Methanol Methanol q.sub.methanol q.sub.methanol Volume CDW at 0 h at 4.1 h at 20.1 h (mg g.sup.1 h.sup.1) (mg g.sup.1 h.sup.1) Reactor ADH gene (mL) (g/L) (g/L) (g/L) (g/L) At 4.1 h At 20.1 h R1 P.sub.GAPADH2 398 72.9 10.3 8.0 1.2 7.65 6.18 R2 P.sub.GAPADH900 400 71.7 10.3 8.7 2.9 5.30 5.09 R3 P.sub.GAPADH2 406 70.7 10.7 8.4 1.3 7.80 6.51 R4 P.sub.GAPADH900 399 71.3 10.3 8.6 2.8 5.91 5.23

Example 17: Strain Generation with Methanol-Inducible Promoters for ADH2 Overexpression

(205) For the purpose of investigating the effect of methanol inducible ADH2 overexpression, two overexpression constructs were created being composed of methanol inducible promoters P.sub.AOX1 PP7435_chr4 (237941 . . . 238898) and P.sub.FLD1 PP7435_Chr3 (262922 . . . 263518) controlling the expression of the ADH2 coding sequence. The ADH2 coding sequence was modified to eliminate BbsI and BsaI restriction sites in the coding sequence without affecting the amino acid sequence of the gene product (Table 16). The generated strains were designated P. pastoris aox1aox2 BB3aZ_pAOX1_Adh2_CycTT and P. pastoris aox1aox2 BB3aZ_pFLD1_Adh2_CycTT. a) The expression constructs were created using Golden Gate assembly as already described (Prielhofer et al., 2017). (1) The expression construct BB3aZ_pAOX1_Adh2_CycTT was assembled as follows. The Adh2_GG_cured DNA fragment (Table 16) was cloned into the BB1_23 backbone, creating the BB1_23_Adh2. The expression construct was generated by Golden Gate assembly of BB3aZ_14* (backbone), BB1_23_Adh2 (coding sequence) BB1_12_pAOX1 (promoter), BB1_34_ScCYC1tt (terminator). (2) The expression construct BB3aZ_pFLD1_Adh2_CycTT was generated by Golden Gate assembly of BB3aZ_14* (backbone), BB1_23_Adh2 (coding sequence) BB1_12_pFLD1 (promoter), BB1_34_ScCYC1tt (terminator). The plasmids and sequences are available in the Golden PiCS kit #1000000133 (Addgene, Inc., USA). b) The P. pastoris aox1aox2 strain was made electrocompetent as described in Example 1a). The BB3aZ_pAOX1_Adh2_CycTT expression construct and the BB3aZ_pFLD1_Adh2_CycTT expression construct was linearized with AscI (New England Biolabs, Inc., USA) as per the manufacturer's protocol and purified with the Hi Yield Gel/PCR DNA Fragment Extraction Kits (Sd-Laborbedarf GmbH, Germany). 500 ng of the linearized plasmid was transformed into electrocompetent P. pastoris aox1aox2 as previously described in Example 1a) and 1d). Positive transformants were selected on YPD plates with 25 g/mL Zeocin. The successful integration of the expression construct was verified by PCR amplification with primers 109_BB3aN_ctrl_fwd and pGAP_goi_rev_v2 (Table 17) with genomic DNA as template. The created strains are called P. pastoris aox1aox2 BB3aZ_pAOX1_Adh2_CycTT and P. pastoris aox1aox2 BB3aZ_pFLD1_Adh2_CycTT. c) Genomic DNA for PCR amplifications was isolated with the Wizard Genomic DNA Purification Kit (Promega Corporation, USA) as per manufacturer's recommendations. The PCR amplification reactions were done with the Q5 polymerase (New England Biolabs, Inc., USA) as per manufacturer's recommendations.

Example 18: Measurement of Specific Methanol Uptake Rates of Methanol Utilization Negative Strains with Methanol Inducible Promoters for PH2 Overexpression

(206) To investigate the effect of ADH2 overexpression with methanol inducible promotors on the specific methanol uptake rate, a bioreactor cultivation was set up as described in Example 7 and Example 16. For this purpose, the strains P. pastoris aox1aox2 BB3aZ_pAOX1_Adh2_CycTT and P. pastoris aox1aox2 BB3aZ_pFLD1_Adh2_CycTT generated in Example 17 were used. a) The reactors filled with 300 mL BSM media were inoculated with 15 mL of P. pastoris aox1aox2 BB3aZ_pAOX1_Adh2_CycTT (reactor R1 and R2) and P. pastoris aox1aox2 BB3aZ_pFLD1_Adh2_CycTT (R3 and R4). The target start OD.sub.600 was 2. At the end of the batch phase as indicated by a dissolved oxygen spike, a 50% (w/w) glucose feed was started at 2.8 mL/h for 24 hours to increase the biomass. Two hours after the glucose feed start a 50% (v/v) methanol shot was given to increase the methanol concentration to 1.5% (measured concentration was R1=1.57%, R2=1.57%, R3=1.57% and R4=1.70%). This was done to induce methanol consumption and the methanol inducible promotors. At the end of the glucose feed phase samples for cell dry weight and HPLC were taken. b) After the glucose feed phase the agitation and gassing was set to a constant 750 rpm and 9.5 sL/h. An additional 50% methanol pulse was added to increase the concentration to 1.5% and immediately a HPLC sample was taken (measured concentration was R1=1.42%, R2=1.39%, R3=1.39% and R4=1.42%). The concentration was measured again after 4.2 hours and used to determine the specific methanol uptake rate (q.sub.methanol). After the initial pulse was nearly consumed a second methanol pulse was applied and immediately a HPLC sample was taken (measured concentration was R1=1.61%, R2=1.65%, R3=1.50% and R4=1.47%). The concentration was measured again after 6.2 hours and used to determine the specific methanol uptake rate (q.sub.methanol) a second time. c) The specific methanol uptake rate (q.sub.methanol) was determined using two methanol pulses. The time between the first pulse and the sampling time point was 4.2 hours. The time between the second methanol pulse and the sampling point was 6.2 hours. The average methanol uptake rate after 4.2 hours after the first pulse was 8.3 mg g.sup.1 h.sup.1 for the P.sub.FLD1ADH2 overexpressing strain P. pastoris aox1aox2 BB3aZ_pFLD1_Adh2_CycTT and 11.6 mg g.sup.1 h.sup.1 for the P.sub.AOX1ADH2 overexpressing strain P. pastoris aox1aox2 BB3aZ_pAOX1_Adh2_CycTT (Table 21). 6.2 hours after the second methanol pulse the average uptake rate increased to 10.1 mg g.sup.1 h.sup.1 for the P.sub.FLD1ADH2 overexpressing strain and to 13.8 mg g.sup.1 h.sup.1 for the P.sub.AOX1ADH2 overexpressing strain (Table 22). This data shows that longer methanol induction times lead to an increased expression of Adh2 and specific methanol uptake rate when methanol inducible promotors are used. The strains can therefore sustain and even increase the specific methanol uptake rate over time in a medium with methanol as the only energy and carbon source. Compared to the P. pastoris aox1aox2 pPM2pN21_pAOX1_HSAopt_CycTT strain described in Example 7 the specific methanol uptake rate was increased on average by 1.6 fold for the P. pastoris aox1aox2 BB3aZ_pFLD1_Adh2_CycTT and by 2.3 fold for the P. pastoris aox1 aox2 BB3aZ_pAOX1_Adh2_CycTT.

(207) TABLE-US-00024 TABLE 21 Overview of the specific methanol uptake rates (q.sub.methanol) with the methanol inducible ADH2 overexpression after the first methanol pulse. Methanol 4.2 h after 1.sup.st Methanol methanol Volume CDW 1.sup.st pulse pulse q.sub.methanol Reactor ADH gene (mL) (g/L) (g/L) (g/L) (mg g.sup.1 h.sup.1) R1 P.sub.AOX1ADH2 400 77.7 11.2 7.6 11.2 R2 P.sub.AOX1ADH2 401 76.4 11.0 7.2 11.9 R3 P.sub.FLD1ADH2 400 75.1 11.0 8.5 8.0 R4 P.sub.FLD1ADH2 401 75.8 11.3 8.6 8.5

(208) TABLE-US-00025 TABLE 22 Overview of the specific methanol uptake rates (q.sub.methanol) with the methanol inducible ADH2 overexpression after the second methanol pulse. Methanol 6.2 h after 2.sup.nd Methanol methanol Volume CDW 2.sup.nd pulse pulse q.sub.methanol Reactor ADH gene (mL) (g/L) (g/L) (g/L) (mg g.sup.1 h.sup.1) R1 P.sub.AOX1ADH2 394 72.7 12.7 6.3 14.4 R2 P.sub.AOX1ADH2 393 72.6 13.1 7.1 13.3 R3 P.sub.FLD1ADH2 393 71.1 11.9 7.4 10.2 R4 P.sub.FLD1ADH2 394 73.0 11.7 7.1 10.1

Example 19: Generation of ADH2 Overexpressing Strains Producing a Secreted Recombinant Protein

(209) To investigate if the ADH2 overexpression and the consequential increase in specific methanol uptake rate have an impact on the recombinant protein production the P. pastoris aox1 aox2 producing HSA and vHH from Example 3 were transformed with the P.sub.AOX1ADH2 and P.sub.FLD1ADH2 overexpression constructs and screened in small scale with an adapted protocol described in Example 4. a) The overexpression constructs were done using Golden Gate assembly as already described (Prielhofer et al., 2017). (1) The expression construct BB3aK_pAOX1_Adh2_CycTT was generated by Golden Gate assembly of BB3aK_14* (backbone), BB1_23_Adh2 (coding sequence) from Example 17, BB1_12_pAOX1 (promoter), BB1_34_ScCYC1tt (terminator). (2) The expression construct BB3aK_pFLD1_Adh2_CycTT was generated by Golden Gate assembly of BB3aK_14* (backbone), BB1_23_Adh2 (coding sequence) from Example 17, BB1_12_pFLD1 (promoter), BB1_34_ScCYC1tt (terminator). The plasmids and sequences are available in the Golden PiCS kit #1000000133 (Addgene, Inc., USA). b) The P. pastoris aox1 aox2 pPM2pN21_pAOX1_HSAopt_CycTT and P. pastoris aox1aox2 pPM2pZ30_pAOX1_MF-vHH_CycTT strain were made electrocompetent as described in Example 1a). The BB3aK_pAOX1_Adh2_CycTT expression construct and the BB3aK_pFLD1_Adh2_CycTT expression construct was linearized with AscI (New England Biolabs, Inc., USA) as per the manufacturer's protocol and purified with the Hi Yield Gel/PCR DNA Fragment Extraction Kits (Sd-Laborbedarf GmbH, Germany). 500 ng of the linearized plasmid was transformed into electrocompetent P. pastoris aox1 aox2 pPM2pN21_pAOX1_HSAopt_CycTT and P. pastoris aox1aox2 pPM2pZ30_pAOX1_MF-vHH_CycTT as previously described in Example 1a) and 1d). Positive transformants were selected on YPD plates with 500 g/mL geneticin and 25 g/mL zeocin for the P. pastoris aox1 aox2 pPM2pZ30_pAOX1_MF-vHH_CycTT_BB3aK_pAOX1_Adh2_CycTT and the P. pastoris aox1 aox2 pPM2pZ30_pAOX1_MF-vHH_CycTT_BB3aK_pFLD1_Adh2_CycTT transformants. The P. pastoris aox1aox2 pPM2pN21_pAOX1_HSAopt_CycTT_BB3aK_pAOX1_Adh2_CycTT and P. pastoris aox1aox2 pPM2pN21_pAOX1_HSAopt_CycTT_BB3aK_pFLD1_Adh2_CycTT transformants were selected on YPD plates with 500 g/mL geneticin and 100 g/L nourseothricin. Multiple clones per transformation were selected for further screening (Example 20). The created strains are named: P. pastoris aox1 aox2 P.sub.AOX1FISA P.sub.AOX1ADH2, P. pastoris aox1 aox2 P.sub.AOX1HSA, P.sub.FLD1ADH2, P. pastoris aox1 aox2 P.sub.AOX1vHH P.sub.AOX1ADH2 and P. pastoris aox1 aox2 P.sub.AOX1vHH P.sub.FLD1ADH2.

Example 20: Small Scale Screening of ADH2 Overexpressing Strains Producing a Secreted Recombinant Protein

(210) Multiple clones from the transformants described in Example 19 were tested in small scale screening to investigate the impact of the ADH2 overexpression on recombinant protein production. The screening procedure was adapted from the two shot-extended protocol and the standard protocol described in Example 4. a) For the pre-culture of the P. pastoris aox1 aox2 P.sub.AOX1HSA P.sub.AOX1ADH2 and P. pastoris aox1 aox2 P.sub.AOX1HSA P.sub.FLD1ADH2 clones were inoculated in 2 mL YPD with 500 g/mL geneticin and 100 g/mL nourseothricin, the P. pastoris aox1 aox2 P.sub.AOX1vHH P.sub.AOX1ADH2 and P. pastoris aox1 aox2 P.sub.AOX1vHH P.sub.FLD1ADH2 clones were inoculated on 500 g/mL Geneticin and 25 g/mL Zeocin. The parental strains were inoculated in two replicates on YPD with 100 g/mL Nourseothricin or 25 g/mL Zeocin based on the antibiotic resistance used for selection. For each expression construct eleven clones were picked for screening. Pre-culture and screening cultures were cultivated in 24 well plates sealed with an air permeable membrane and incubated on 25 C. on 280 rpm. The screening culture was inoculated with a start optical density (OD.sub.600) of 8 into 2 mL of minimal media (ASMv6) with a slow glucose release system EnPump200 (Enpresso GmbH, Germany) based on a polysaccharide solution and an enzyme to keep the cultures in glucose limit. The strains were compared with two different methanol feed procedures differing in total methanol received and incubation time (Table 23). b) After the incubation period 1 mL of each culture was removed and centrifuged in a pre-weighted Eppendorf tube. The supernatant was removed and the protein concentration was measured with the Caliper LabChip GXII Touch (Perkin Elmer, inc., USA) as per the manufacturer's instructions. The wet cell weight was determined by weighting the Eppendorf tubes with the cell pellet and calculated as follows: Weight (full)weight (empty)=wet cell weight (WCW) (g/L). Out of this data the yield was calculated: Yield (g/g)=protein concentration/wet cell weight.

(211) TABLE-US-00026 TABLE 23 Overview of the screening strategies used for testing the secreted protein production yield of the transformed strains in Example 20. Total Incubation Polysaccharide Enzyme Methanol methanol Methanol shot Protocol period (g/L) (%) shot (v/v) time points (h) Standard 48 h 25 0.35 4 x 3.5% 4*, 19, 27, 43 Two shot- 72 h 25 0.20 2 x 2% 3, 43 extended *The first shot was 0.5% (v/v) methanol. c) The results are summed up in Table 24. Surprisingly, the overexpression increased the protein yield (g/g) by up to 1.7 fold for vHH and 2.3 fold for HSA when compared to the parental Mut.sup. strains. Indeed, proving that the overexpression of the ADH2 improves recombinant protein production of the P. pastoris aox1 aox2. d) Average performing strains were selected for bioreactor cultivation. The successful integration of the expression construct was verified by PCR amplification with primers 109_BB3aN_ctrl_fwd and pGAP_goi_rev_v2 (Table 17) with genomic DNA as template. Genomic DNA for PCR amplifications was isolated with the Wizard Genomic DNA Purification Kit (Promega Corporation, USA) as per manufacturer's recommendations. The PCR amplification reactions were done with the Q5 polymerase (New England Biolabs, Inc., USA) as per manufacturer's recommendations.

(212) TABLE-US-00027 TABLE 24 Average secreted product yield in g product / g WCW with standard deviation in different screening conditions. *t-test statistically significant difference (p<0.05) from the parent strain. Screening protocol Two shot - Standard Descriptive name Name extended Mut.sup.S Parent strain: P. pastoris aox1a0x2 1766 1428 aox1aox2 pPM2pZ30_pAOX1_MF-vHH_CycTT P.sub.AOX1vHH aox1aox2 P. pastoris aox1aox2 2394* 640 2441* 211 P.sub.AOX1vHH pPM2pZ30_pAOX1_MF-vHH_CycTT P.sub.AOX1ADH2 BB3aK_pAOX1_Adh2_CycTT aox1aox2 P. pastoris aox1aox2 1907 381 1810* 175 P.sub.AOX1vHH pPM2pZ30_pAOX1_MF-vHH_CycTT P.sub.FLD1ADH2 BB3aK_pFLD1_Adh2_CycTT Parent strain: P. pastoris aox1aox2 635 459 aox1aox2 pPM2pN21_pAOX1_HSAopt_CycTT P.sub.AOX1HSA aox1aox2 P. pastoris aox1aox2 1485* 183 711* 135 P.sub.AOX1HSA pPM2pN21_pAOX1_HSAopt_CycTT P.sub.AOX1ADH2 BB3aK_pAOX1_Adh2_CycTT aox1aox2 P. pastoris aox1aox2 1198 96 621* 85 P.sub.AOX1HSA pPM2pN21_pAOX1_HSAopt_CycTT P.sub.FLD1ADH2 BB3aK_pFLD1_Adh2_CycTT

Example 21: The Methanol Utilization Negative Strain with ADH2 Overexpression Producing HSA as a Model Protein. Cultivated with Strategy 3a Feed Strategy with a Glucose/Methanol Co-Feed Phase and a Separated Methanol Only Feed Phase

(213) A bioreactor cultivation was performed to evaluate the recombinant protein producing ability of the methanol utilization negative ADH2 overexpressing strain generated in Example 19 and selected in Example 20. For this purpose, P. pastoris aox1aox2 pPM2pN21_pAOX1_HSAopt_CycTT BB3aK_pAOX1_Adh2_CycTT (aox1aox2 P.sub.AOX1HSA P.sub.AOX1ADH2) and P. pastoris aox1aox2 pPM2pN21_pAOX1_HSAopt_CycTT BB3aK_pFLD1_Adh2_CycTT (aox1aox2 P.sub.AOX1HSA P.sub.FLD1ADH2) strains were cultivated with the strategy 3 as described in Example 10 and Example 11. a) This bioreactor cultivation was separated into three phases. (1) Phase one was the batch phase. The reactors were inoculated with the production strains with a start OD.sub.600 of 2. The inoculation was done as described in Example 7a) b). The end of the batch phase was indicated by a dissolved oxygen spike. (2) At this point Phase two was started. Phase two consisted of a 50% (w/w) glucose feed at 4.8 mL/h for 25 hours. At the start of Phase two a 50% (v/v) methanol pulse was applied to increase methanol concentration to the target of 1.5% (v/v) and a subsequent methanol feed was started to counteract methanol consumption, evaporation and dilution by the glucose feed. (3) Phase three consisted of a methanol only feed for 19.6 (R1, R2) and 21.6 (R5, R6) hours. Methanol concentration was measured at line with HPLC as described in Example 6d). An additional compensation pulse was added if necessary. The methanol feed was calculated in hourly intervals as in Example 8 and 9b). The strains used in each of the reactors R1, R2, R5 and R6 are identified in Table 25. b) The process and productivity data can be found in Table 26 and Table 27. The maximal and minimal methanol concentration throughout the cultivation of reactors R1, R2, R5 and R6 ranged from 8.0 g/L to 13.6 g/L. Reactors R1, R2 and R5, R6 were producing HSA as a model protein. The specific productivity (q.sub.P) at 68.7 hours in phase 3 shows a positive impact of the ADH2 overexpression with either the P.sub.AOX1 or P.sub.FLD1 compared to Example 10 (Table 28, Table 29). A weighted average of the q.sub.P was calculated for Example 10, timepoints 45.02 to 69.58 hours for easier comparison. The q.sub.P in Example 10 from timepoint 45.02 to 69.58 h is on average 40.9 g g.sup.1 h.sup.1. The q.sub.P in the present example for reactor the P.sub.AOX1ADH2 overexpression (R1, R2) from timepoint 49.1 to 68.7 hours is on average 84.3 g g.sup.1 h.sup.1. This is a 2 fold increase compared to Example 10 (Table 28). The P.sub.FLD1ADH2 overexpression (R5, R6) in the similar timeframe (47.1 to 68.7 hours) show an average q.sub.P of 71 g g.sup.1 h.sup.1. This represents a 1.7 fold increase in q.sub.P (Table 29). Volumetric productivity at timepoint 68.7 hours is increased by 1.21 fold for P.sub.AOX1ADH2 overexpression (Table 30) and 1.13 for the P.sub.FLD1ADH2 overexpression (Table 31). The increased q.sub.P and volumetric productivity in this example is demonstrating the benefits of the ADH2 overexpression in the P. pastoris aox1 aox2 strain for recombinant protein production.

(214) TABLE-US-00028 TABLE 25 Overview of the strains used in Example 21 and Example 22. Reactor Descriptive name Name R1 P. pastoris aox1aox2 P. pastoris aox1aox2 P.sub.AOX1HSA P.sub.AOX1ADH2 pPM2pN21_pAOX1_HSAopt_CycTT BB3aK_pAOX1_Adh2_CycTT R2 P. pastoris aox1aox2 P. pastoris aox1aox2 P.sub.AOX1HSA P.sub.AOX1ADH2 pPM2pN21_pAOX1_HSAopt_CycTT BB3aK_pAOX1_Adh2_CycTT R3 P. pastoris aox1aox2 P. pastoris aox1aox2 P.sub.AOX1vHH P.sub.AOX1ADH2 pPM2pZ30_pAOX1_MF-vHH_CycTT BB3aK_pAOX1_Adh2_CycTT R4 P. pastoris aox1aox2 P. pastoris aox1aox2 P.sub.AOX1vHH P.sub.AOX1ADH2 pPM2pZ30_pAOX1_MF-vHH_CycTT BB3aK_pAOX1_Adh2_CycTT R5 P. pastoris aox1aox2 P. pastoris aox1aox2 P.sub.AOX1HSA P.sub.FLD1ADH2 pPM2pN21_pAOX1_HSAopt_CycTT BB3aK_pFLD1_Adh2_CycTT R6 P. pastoris aox1aox2 P. pastoris aox1aox2 P.sub.AOX1HSA P.sub.FLD1ADH2 pPM2pN21_pAOX1_HSAopt_CycTT BB3aK_pFLD1_Adh2_CycTT R7 P. pastoris aox1aox2 P. pastoris aox1aox2 P.sub.AOX1vHH P.sub.FLD1ADH2 pPM2pZ30_pAOX1_MF-vHH_CycTT BB3aK_pFLD1_Adh2_CycTT R8 P. pastoris aox1aox2 P. pastoris aox1aox2 P.sub.AOX1vHH P.sub.FLD1ADH2 pPM2pZ30_pAOX1_MF-vHH_CycTT BB3aK_pFLD1_Adh2_CycTT

(215) TABLE-US-00029 TABLE 26 Bioreactor cultivation process data and specific productivity (q.sub.P) for HSA with the P.sub.AOX1ADH2 overexpression from Example 21. P.sub.AOX1 Recombinant Specific HSA protein productivity Methanol P.sub.AOX1 Volume concentration (q.sub.P) concentration ADH2 Time (mL) YDM (g/L) (mg/L) (g g.sup.1 h.sup.1) (g/L) Phase (h) R1 R2 R1 R2 R1 R2 R1 R2 R1 R2 1 24.0 318 317 24.8 24.0 0.0 0.0 2 26.2 *9.4 *9.9 49.1 502 501 100.4 100.2 208.9 218.6 96.0 101.1 13.8 13.6 3 68.7 517 517 95.2 95.8 445.6 423.8 90.2 78.3 8.0 8.7 *Represents a control sample after the methanol pulse.

(216) TABLE-US-00030 TABLE 27 Bioreactor cultivation process data and specific productivity (q.sub.P) for HSA with the P.sub.FLD1ADH2 overexpression from Example 21. P.sub.A0X1 Recombinant Specific HSA protein productivity Methanol P.sub.FLD1 Volume concentration (q.sub.P) concentration ADH2 Time (mL) YDM (g/L) (mg/L) (g g.sup.1 h.sup.1) (g/L) Phase (h) R5 R6 R5 R6 R5 R6 R5 R6 R5 R6 1 21.9 308 306 25.2 25.2 2 23.8 *10.6 *11.0 47.1 488 486 101.2 100.5 208.5 203.9 94.2 93.1 11.6 11.0 3 68.7 515 513 95.4 95.2 412.5 395.6 73.0 69.0 10.8 10.4 *Represents a control sample after the methanol pulse.

(217) TABLE-US-00031 TABLE 28 Comparison of specific productivity (q.sub.P) of methanol utilization negative strain producing HSA from Example 10 to the P.sub.AOX1ADH2 overexpressing strain from Example 21 in phase 3. Example 10 Example 21 Example 10 Example 21 aoxlaox2 aoxlaox2 aoxlaox2 aoxlaox2 P.sub.AOX1HSA P.sub.AOX1HSA P.sub.AOX1ADH2 P.sub.AOX1HSA P.sub.AOX1HSA q.sub.P (g g.sup.1 h.sup.1) q.sub.P (g g.sup.1 h.sup.1) q.sub.P (g g.sup.1 h.sup.1) P.sub.AOX1ADH2 Fold Time (h) R1 R2 Time (h) R1 R2 Time (h) Average Time (h) Average increase 45.02 49.1 45.02 49.1 53.00 38.6 21.5 53.00 Weighted average 69.58 47.3 44.9 68.7 90.2 78.3 69.58 40.9 68.7 84.3 2.06

(218) TABLE-US-00032 TABLE 29 Comparison of specific productivity (q.sub.P) of methanol utilization negative strain producing HSA from Example 10 to the P.sub.FLD1ADH2 overexpressing strain from Example 21 in phase 3. Example 10 Example 21 Example 10 Example 21 aoxlaox2 aoxlaox2 aoxlaox2 aoxlaox2 P.sub.AOX1HSA P.sub.AOX1HSA P.sub.FLD1ADH2 P.sub.AOX1HSA P.sub.AOX1HSA q.sub.P (g g.sup.1 h.sup.1) q.sub.P (g g.sup.1 h.sup.1) q.sub.P (g g.sup.1 h.sup.1) P.sub.FLD1ADH2 Fold Time (h) R1 R2 Time (h) R5 R6 Time (h) Average Time (h) Average increase 45.02 47.1 45.02 47.1 53.00 38.6 21.5 53.00 Weighted average 69.58 47.3 44.9 68.7 73.0 69.0 69.58 40.9 68.7 71.0 1.74

(219) TABLE-US-00033 TABEL 30 Comparison of volumetric productivity of methanol utilization negative strain producing HSA from Example 10 to the P.sub.AOX1ADH2 overexpressing strain from Example 21. Example 21 Example 21 Example 10 aoxlaox2 Example 10 aoxlaox2 aoxlaox2 P.sub.AOX1HSA aoxlaox2 P.sub.AOX1HSA P.sub.AOX1HSA P.sub.AOX1ADH2 P.sub.AOX1HSA P.sub.AOX1ADH2 Fold R1 R2 R1 R2 Average Average increase Recombinant 357.3 371.8 445.6 423.8 364.6 434.7 protein (mg/L) Biomass (g/L) 95.9 96.3 95.2 95.8 96.1 95.5 *Corrected 244.2 253.6 305.6 289.8 248.9 297.7 recombinant protein (mg/L) Time (h) 69.58 68.7 Volumetric 3.58 4.33 1.21 productivity (mg L.sup.1h.sup.1) *Corrected recombinant concentration (C.sub.cP) for the biomass volume, C.sub.cP = C.sub.p*(1-C.sub.x*F.sub.c), F.sub.c = 0.0033.

(220) TABLE-US-00034 TABLE 31 Comparison of volumetric productivity of methanol utilization negative strain producing HSA from Example 10 to the P.sub.FLD1ADH2 overexpressing strain from Example 21. Example 21 Example 21 Example 10 aoxlaox2 Example 10 aoxlaox2 aoxlaox2 P.sub.AOX1HSA aoxlaox2 P.sub.AOX1HSA P.sub.AOX1HSA P.sub.FLD1ADH2 P.sub.AOX1HSA P.sub.FLD1ADH2 Fold R1 R2 R5 R6 Average Average increase Recombinant 357.3 371.8 412.5 395.6 364.6 404.1 protein (mg/L) Biomass (g/L) 95.9 96.3 95.4 95.2 96.1 95.3 *Corrected 244.2 253.6 282.6 271.3 248.9 277.0 recombinant protein (mg/L) Time (h) 69.58 68.7 Volumetric 3.58 4.03 1.13 productivity (mg L.sup.1h.sup.1) *Corrected recombinant concentration (C.sub.cP) for the biomass volume, C.sub.cP = C.sub.p*(1-C.sub.x*F.sub.c), Fc = 0.0033.

Example 22: The Methanol Utilization Negative Strain with ADH2 Overexpression Producing vHH as a Model Protein. Cultivated with Strategy 3A Feed Strategy with a Glucose/Methanol Co-Feed Phase and a Separated Methanol Only Feed Phase

(221) A bioreactor cultivation was performed to evaluate the recombinant protein producing ability of the methanol utilization negative ADH2 overexpressing strain generated in Example 19 and selected in Example 20. For this purpose, P. pastoris aox1aox2 pPM2pZ30_pAOX1_vHH_CycTT BB3aK_pAOX1_Adh2_CycTT (aox1aox2 P.sub.AOX1vHH P.sub.AOX1ADH2) and P. pastoris aox1aox2 pPM2pZ30_pAOX1_vHH_CycTT BB3aK_pFLD1_Adh2_CycTT (aox1aox2 P.sub.AOX1vHH P.sub.FLD1ADH2) strains were cultivated with the strategy 3 as described in Example 10 and Example 11. a) This bioreactor cultivation was separated into three phases. (1) Phase one was the batch phase. The reactors were inoculated with the production strains with a start OD.sub.600 of 2. The inoculation was done as described in Example 7a) b). The end of the batch phase was indicated by a dissolved oxygen spike. (2) At this point Phase two was started. Phase two consisted of a 50% (w/w) glucose feed at 4.8 mL/h for 25 hours. At the start of Phase two a 50% (v/v) methanol pulse was applied to increase methanol concentration to the target of 1.5% (v/v) and a subsequent methanol feed was started to counteract methanol consumption, evaporation and dilution by the glucose feed. (3) Phase three consisted of a methanol only feed for 43.6 (R3, R4) and 44.6 (R7, R8) hours. Methanol concentration was measured at line with HPLC as described in Example 6d). An additional compensation pulse was added if necessary. The methanol feed was calculated in hourly intervals as in Example 8 and 9b). The strains used in each reactors R3, R4, R7 and R8 can be found in Table 25. b) The process and productivity data can be found in Table 32 and Table 33. The maximal and minimal methanol concentration throughout the cultivation of reactors R3, R4, R7 and R8 ranged from 8.6 g/L to 14.4 g/L. Reactors R3, R4 and R7, R8 were producing vHH as a model protein. The ADH2 overexpression had a positive impact on specific productivity (q.sub.P) compared to Example 11. For easier comparison a weighted average of the q.sub.P was calculated for phase two (timepoints 20.0 to 53.6 hours) of Example 11. The comparison shows that P.sub.AOX1ADH2 overexpression (R3, R4) has a 1.71 fold and the P.sub.FLD1ADH2 overexpression (R7, R8) a 1.78 fold increase on q.sub.P in phase two (Table 34, Table 35). At later timepoints in phase three the improvements are even larger. At timepoints 92.7 and 91.7 the q.sub.P is the increase by 3.76 fold (P.sub.AOX1ADH2 overexpression) and 3.86 fold (P.sub.FLD1ADH2 overexpression) (Table 34, Table 35). Additionally, volumetric productivity was improved at least 1.9 fold compared to the parental strain in Example 11 in both cases (Table 35, Table 36). The increased q.sub.P and volumetric productivity in this example is demonstrating the benefits of the ADH2 overexpression in the P. pastoris aox1aox2 strain for recombinant protein production.

(222) TABLE-US-00035 TABLE 32 Bioreactor cultivation process data and specific productivity (q.sub.P) for vHH with the P.sub.AOX1ADH2 overexpression from Example 22. P.sub.A0X1 Recombinant Specific vHH protein productivity Methanol P.sub.AOX1 Volume concentration (q.sub.P) concentration ADH2 Time (mL) YDM (g/L) (mg/L) (g g.sup.1 h.sup.1) (g/L) Phase (h) R3 R4 R3 R4 R3 R4 R3 R4 R3 R4 1 24.0 318 318 24.9 24.3 2 26.2 *9.8 *10.3 49.1 501 502 102.6 100.6 696.1 783.0 310.3 359.4 13.9 14.4 3 68.7 518 518 94.9 94.6 1688.5 1724.9 376.1 362.0 9.4 9.7 92.7 544 543 86.7 85.2 2466.5 2364.8 307.4 268.3 8.6 8.9 *Represents a control sample after the methanol pulse.

(223) TABLE-US-00036 TABLE 33 Bioreactor cultivation process data and specific productivity (q.sub.P) for vHH with the P.sub.FLD1ADH2 overexpression from Example 22. P.sub.AOX1 Recombinant Specific vHH protein productivity Methanol P.sub.FLD1 Volume concentration (q.sub.P) concentration ADH2 Time (mL) YDM (g/L) (mg/L) (g g.sup.1 h.sup.1) (g/L) Phase (h) R7 R8 R7 R8 R7 R8 R7 R8 R7 R8 1 21.9 306 307 24.5 24.3 23.8 *10.8 *10.7 2 47.1 485 484 100.3 98.6 738.1 761.1 339.0 358.0 10.8 11.5 68.7 514 513 93.3 92.3 1511.7 1555.3 284.7 297.8 11.2 11.7 3 91.7 516 514 85.8 85.2 2270.9 2364.4 285.7 305.6 10.5 10.5 *Represents a control sample after the methanol pulse.

(224) TABLE-US-00037 TABLE 34 Comparison of specific productivity (q.sub.P) of methanol utilization negative strain producing vHH from Example 11 to the P.sub.AOX1ADH2 overexpressing strain from Example 22. Example 22 Example 22 Example 11 aoxlaox2 Example 11 aoxlaox2 aoxlaox2 P.sub.AOX1vHH aoxlaox2 P.sub.AOX1vHH P.sub.AOX1vHH P.sub.AOX1ADH2 P.sub.AOX1vHH P.sub.AOX1ADH2 q.sub.P(g g.sup.1 h.sup.1) Time q.sub.P(g g.sup.1 h.sup.1) Time q.sub.P(g g.sup.1 h.sup.1) Time q.sub.P(g g.sup.1 h.sup.1) Fold Time (h) R1 R2 (h) R3 R4 (h) Average (h) Average increase 20.00 24.0 20.00 Weighted 24.0 28.22 137.8 141.5 28.22 average 44.83 222.8 208.3 44.83 195.8 53.58 176.0 246.2 49.1 310.3 359.4 53.58 49.1 335 1.71 68.83 142.5 72.2 68.7 376.1 362 68.83 107.4 68.7 369 3.44 92.00 55.8 97.5 92.7 307.4 268.3 92.00 76.7 92.7 288 3.76

(225) TABLE-US-00038 TABLE 35 Comparison of specific productivity (qP) of methanol utilization negative strain producing vHH from Example 11 to the PFLD1ADH2 overexpressing strain from Example 22. Example 22 Example 11 Example 22 Example 11 aoxlaox2 aoxlaox2 aoxlaox2 aoxlaox2 P.sub.AOX1vHH P.sub.AOX1vHH P.sub.AOX1vHH P.sub.FLD1ADH2 P.sub.AOX1vHH P.sub.FLD1ADH2 q.sub.P(g g.sup.1 h.sup.1) q.sub.P(g g.sup.1 h.sup.1) q.sub.P(g g.sup.1 h.sup.1) q.sub.P(g g.sup.1 h.sup.1) Fold Time (h) R1 R2 Time (h) R7 R8 Time (h) Average Time (h) Average increase 20.00 21.9 20.00 Weighted 21.9 28.22 137.8 141.5 28.22 average 44.83 222.8 208.3 44.83 195.8 53.58 176.0 246.2 47.1 339.0 358.0 53.58 47.1 349 1.78 68.83 142.5 72.2 68.7 284.7 297.8 68.83 107.4 68.7 291 2.71 92.00 55.8 97.5 91.7 285.7 305.6 92.00 76.7 91.7 296 3.86

(226) TABLE-US-00039 TABLE 36 Comparison of volumetric productivity of methanol utilization negative strain producing vHH from Example 11 to the P.sub.AOX1ADH2 overexpressing strain from Example 22. Example 22 Example 22 Example 11 aoxlaox2 Example 11 aoxlaox2 aoxlaox2 P.sub.AOX1vHH aoxlaox2 P.sub.AOX1vHH P.sub.AOX1vHH P.sub.AOX1ADH2 P.sub.AOX1vHH P.sub.AOX1ADH2 Fold R1 R2 R3 R4 Average Average increase Recombinant 1337.2 1374.0 2466.5 2364.8 1355.6 2415.7 protein (mg/L) Biomass (g/L) 110.8 109.4 86.7 85.2 110.1 86.0 *Corrected 848.3 878.0 1760.8 1699.9 863.1 1730.4 recombinant protein (mg/L) Time (h) 92.0 92.0 92.7 92.7 92.0 92.7 Volumetric 9.38 18.67 1.99 productivity (mg L.sup.1 h.sup.1) *Corrected recombinant concentration (C.sub.cP) for the biomass volume, C.sub.cP = C.sub.p*(1-C.sub.x*F.sub.c), F.sub.c = 0.0033.

(227) TABLE-US-00040 TABLE 37 Comparison of volumetric productivity of methanol utilization negative strain producing vHH from Example 11 to the P.sub.FLD1ADH2 overexpressing strain from Example 22. Example 22 Example 22 Example 11 aoxlaox2 Example 11 aoxlaox2 aoxlaox2 P.sub.AOX1vHH aoxlaox2 P.sub.AOX1vHH P.sub.AOX1vHH P.sub.FLD1ADH2 P.sub.AOX1vHH P.sub.FLD1ADH2 Fold R1 R2 R7 R8 Average Average increase Recombinant 1337.2 1374.0 2270.9 2364.4 1355.6 2317.7 protein (mg/L) Biomass (g/L) 110.8 109.4 85.8 85.2 110.1 85.5 *Corrected 848.3 878.0 1627.9 1699.9 863.1 1663.8 recombinant protein (mg/L) Time (h) 92.0 92.0 91.7 91.7 92.00 91.7 Volumetric 9.38 18.14 1.93 productivity (mg L.sup.1 h.sup.1) *Corrected recombinant concentration (C.sub.cP) for the biomass volume, C.sub.cP = C.sub.p*(1-C.sub.x*F.sub.c), F.sub.c = 0.0033.

(228) TABLE-US-00041 TABLE38 Methanolinduciblepromotersandtheirrespectivechromosomal positionsinthestrainP.pastorisCBS7435(Gasser,Steiger,& Mattanovich,2015) P.sub.SHB17 PP7435_chr2 (SEQIDNO:36) (340616...341606) GCAAGGCAACTGAGAAATTGAATAGTGGTTTCAAGCCCGCTGACTTTTT GTATTATCTCAATGTCGGTGTTTCACAGTCCCCAGAAGGGGGCTTTGCC TTCAAGGGAGACGGAAGAGACATCGTCAACCCTGGGGAGAAGTATTTCA AATGGCGCAAGTTCGCTAATTTTTACGATTAAGCAGTGCTGTATGGGGT AGTTAATAAATCGGGAATATCCTTCTGACGTGACTGTAACAAATCTCTT TTTACGTGGTGCGCATACTGGACAGAGGCAGAGTCTCAATTTCTTCTTT TGAGACAGGCTACTACAGCCTGTGATTCCTCTTGGTACTTGGATTTGCT TTTATCTGGCTCCGTTGGGAACTGTGCCTGGGTTTTGAAGTATCTTGTG GATGTGTTTCTAACACTTTTTCAATCTTCTTGGAGTGAGAATGCAGGAC TTTGAACATCGTCTAGCTCGTTGGTAGGTGAACCGTTTTACCTTGCATG TGGTTAGGAGTTTTCTGGAGTAACCAAGACCGTCTTATCATCGCCGTAA AATCGCTCTTACTGTCGCTAATAATCCCGCTGGAAGAGAAGTTCGAACA GAAGTAGCACGCAAAGCTCTTGTCAAATGAGAATTGTTAATCGTTTGAC AGGTCACACTCGTGGGCTATGTACGATCAACTTGCCGGCTGTTGCTGGA GAGATGACACCAGTTGTGGCATGGCCAATTGGTATTCAGCCGTACCACT GTATGGAAAATGAGATTATCTTGTTCTTGATCTAGTTTCTTGCCATTTT AGAGTTGCCACATTCGTAGGTTTCAGTACCAATAATGGTAACTTCCAAA CTTCCAACGCAGATACCAGAGATCTGCCGATCCTTCCCCAACAATAGGA GCTTACTACGCCATACATATAGCCTATCTATTTTCACTTTCGCGTGGGT GCTTCTATATAAACGGTTCCCCATCTTCCGTTTCATACTACTTGAATTT TAAGCACTAAA P.sub.ALD4 PP7435_chr2 (SEQIDNO:37) (1466285...1467148) CTTTTCTTTGGGCAAGGAAAAATCAAGAAAAAGCAGAGGTTAAAGTTTT CAGGGGAATGGCAATTGCTTTATATATGGGAGAAAGTTAACTACGTCGG TGCTGTAGGCGTAGAGAGCGACTGGAGAATGCGTGATGAGGTCGTCTCT TTTCGCCCCCCCTTGGCGGGGTAAAAATTGCACTACTGCAGAATTACTA CACCCCTATTCCGAGGAGACGGAGTGCGACAAAAATGGTAAAGTTCACC CTAGTCTGCGACTTTTAATTGACGGACACCGGCGTTTACATGCGAAAAA AACTAAAGTGCGCGCATTTCACGGCCGAGGGGGGTCCCACTTGGGACTG AGAGGGGGTGGGATCTGAAATCGAGGAGGTATCAAGACCCCCCGTTTCT CAACTCCCTAATCAAAAATTACGAAGTCCTCGTTGGAAAGGAGTTAAAA TAATTAAGCGGGGTCGGACGCCATACCGAGGTTATCTTGCAGGCATTTT ACTAATATTGGAATTCGGAGCTCAACTTGCAACCAGGCAGGGTTTAGCT ATGTAATCAATGTAATCAATATAATAAAGCACTACCACATCGAAGGTTT GGGAGGGAGGCCAATAGTGTCCCCCACAGGGTGCTGATATCGCGATTCT TGGGTGAGGAGACACATATTTCACTCCTCTCACCAACCAACCAAGCGGC TCCTCGCAAGATGATTTATCCGATTATCCGGACACTATACTCCCATCCA GTTTGATGCCGATTTCATCGATTGTCCTAAATAATCCTTAAATATGTAT AGAACGGTACCCTGGGGTTACATAATCCTTATTTAATAATCCCTCCCCC ACCGCTTTTCTTTTTTTTTCTTCTTATTGTC P.sub.FDH1 PP7435_chr3 (SEQIDNO:38) (423504...424503) AAATGGCAGAAGGATCAGCCTGGACGAAGCAACCAGTTCCAACTGCTAA GTAAAGAAGATGCTAGACGAAGGAGACTTCAGAGGTGAAAAGTTTGCAA GAAGAGAGCTGCGGGAAATAAATTTTCAATTTAAGGACTTGAGTGCGTC CATATTCGTGTACGTGTCCAACTGTTTTCCATTACCTAAGAAAAACATA AAGATTAAAAAGATAAACCCAATCGGGAAACTTTAGCGTGCCGTTTCGG ATTCCGAAAAACTTTTGGAGCGCCAGATGACTATGGAAAGAGGAGTGTA CCAAAATGGCAAGTCGGGGGCTACTCACCGGATAGCCAATACATTCTCT AGGAACCAGGGATGAATCCAGGTTTTTGTTGTCACGGTAGGTCAAGCAT TCACTTCTTAGGAATATCTCGTTGAAAGCTACTTGAAATCCCATTGGGT GCGGAACCAGCTTCTAATTAAATAGTTCGATGATGTTCTCTAAGTGGGA CTCTACGGCTCAAACTTCTACACAGCATCATCTTAGTAGTCCCTTCCCA AAACACCATTCTAGGTTTCGGAACGTAACGAAACAATGTTCCTCTCTTC ACATTGGGCCGTTACTCTAGCCTTCCGAAGAACCAATAAAAGGGACCGG CTGAAACGGGTGTGGAAACTCCTGTCCAGTTTATGGCAAAGGCTACAGA AATCCCAATCTTGTCGGGATGTTGCTCCTCCCAAACGCCATATTGTACT GCAGTTGGTGCGCATTTTAGGGAAAATTTACCCCAGATGTCCTGATTTT CGAGGGCTACCCCCAACTCCCTGTGCTTATACTTAGTCTAATTCTATTC AGTGTGCTGACCTACACGTAATGATGTCGTAACCCAGTTAAATGGCCGA AAAACTATTTAAGTAAGTTTATTTCTCCTCCAGATGAGACTCTCCTTCT TTTCTCCGCTAGTTATCAAACTATAAACCTATTTTACCTCAAATACCTC CAACATCACCCACTTAAACA P.sub.DAS1 PP7435_chr3 (SEQIDNO:39) (634140...634688) AATGATATAAACAACAATTGAGTGACAGGTCTACTTTGTTCTCAAAAGG CCATAACCATCTGTTTGCATCTCTTATCACCACACCATCCTCCTCATCT GGCCTTCAATTGTGGGGAACAACTAGCATCCCAACACCAGACTAACTCC ACCCAGATGAAACCAGTTGTCGCTTACCAGTCAATGAATGTTGAGCTAA CGTTCCTTGAAACTCGAATGATCCCAGCCTTGCTGCGTATCATCCCTCC GCTATTCCGCCGCTTGCTCCAACCATGTTTCCGCCTTTTTCGAACAAGT TCAAATACCTATCTTTGGCAGGACTTTTCCTCCTGCCTTTTTTAGCCTC AGGTCTCGGTTAGCCTCTAGGCAAATTCTGGTCTTCATACCTATATCAA CTTTTCATCAGATAGCCTTTGGGTTCAAAAAAGAACTAAAGCAGGATGC CTGATATATAAATCCCAGATGATCTGCTTTTGAAACTATTTTCAGTATC TTGATTCGTTTACTTACAAACAACTATTGTTGATTTTATCTGGAGAATA ATCGAACAAA P.sub.DAS2 PP7435_chr3 (SEQIDNO:40) (632201...633200) ATTACTGTTTTGGGCAATCCTGTTGATAAGACGCATTCTAGAGTTGTTT CATGAAAGGGTTACGGGTGTTGATTGGTTTGAGATATGCCAGAGGACAG ATCAATCTGTGGTTTGCTAAACTGGAAGTCTGGTAAGGACTCTAGCAAG TCCGTTACTCAAAAAGTCATACCAAGTAAGATTACGTAACACCTGGGCA TGACTTTCTAAGTTAGCAAGTCACCAAGAGGGTCCTATTTAACGTTTGG CGGTATCTGAAACACAAGACTTGCCTATCCCATAGTACATCATATTACC TGTCAAGCTATGCTACCCCACAGAAATACCCCAAAAGTTGAAGTGAAAA AATGAAAATTACTGGTAACTTCACCCCATAACAAACTTAATAATTTCTG TAGCCAATGAAAGTAAACCCCATTCAATGTTCCGAGATTTAGTATACTT GCCCCTATAAGAAACGAAGGATTTCAGCTTCCTTACCCCATGAACAGAA ATCTTCCATTTACCCCCCACTGGAGAGATCCGCCCAAACGAACAGATAA TAGAAAAAAGAAATTCGGACAAATAGAACACTTTCTCAGCCAATTAAAG TCATTCCATGCACTCCCTTTAGCTGCCGTTCCATCCCTTTGTTGAGCAA CACCATCGTTAGCCAGTACGAAAGAGGAAACTTAACCGATACCTTGGAG AAATCTAAGGCGCGAATGAGTTTAGCCTAGATATCCTTAGTGAAGGGTT GTTCCGATACTTCTCCACATTCAGTCATAGATGGGCAGCTTTGTTATCA TGAAGAGACGGAAACGGGCATTAAGGGTTAACCGCCAAATTATATAAAG ACAACATGTCCCCAGTTTAAAGTTTTTCTTTCCTATTCTTGTATCCTGA GTGACCGTTGTGTTTAATATAACAAGTTCGTTTTAACTTAAGACCAAAA CCAGTTACAACAAATTATAACCCCTCTAAACACTAAAGTTCACTCTTAT CAAACTATCAAACATCAAAA P.sub.PMP20 PP7435_Chr1 (SEQIDNO:41) (2418090...2419089) GTCAACTGCGTACTCTTTTGTCGAATGGACTACTGAATCTGCCTCGATA GCCACTATAGGAAGGTCCATAGAGGCCAGTTTTTCAACTAGTCTTGGTG GAAAGAAACCGACAAAGCCTTTCATGGAGTCACCGATACTGAAAGGTTC AAACAAAGAATGCTTGGGTAGTCTCTTAATACCCATGGCAACGAAAAAG GGGTCTTCATTGTTCAACATGAATTCGTATCCACCTTTAATGTAGTCAT AAAGCTGCTGAAGTTCCGAATCAGTGATGGAACTGTCTACAGTGACAAT ATAGGAGTTCTCAATCACCTTATATCCAGTCGAATATATCTGGATAGGG TCGGGTCTCACTGTGGAAGATTCAAATGGGTTAGATCCCTGTAATTTCA GCGATGGAGACTCAGTATGATGGGGCAAGGAAAACGGCAATTGGATATT CAATTGGTCAAGAGATGGTATCAAAAGCGAGTGTGCCAGGGTAGCCACG GTAGCCACTGATGCTAATCTGATAATTTTCATTTCTGGAGTGTCAAAAC AGTAGTGATAAAAGGCTATGAAGGAGGTTGTCTAGGGGCTCGCGGAGGA AAGTGATTCAAACAGACCTGCCAAAAAGAGAAAAAAGAGGGAATCCCTG TTCTTTCCAATGGAAATGACGTAACTTTAACTTGAAAAATACCCCAACC AGAAGGGTTCAAACTCAACAAGGATTGCGTAATTCCTACAAGTAGCTTA GAGCTGGGGGAGAGACAACTGAAGGCAGCTTAACGATAACGCGGGGGGA TTGGTGCACGACTCGAAAGGAGGTATCTTAGTCTTGTAACCTCTTTTTT CCAGAGGCTATTCAAGATTCATAGGCGATATCGATGTGGAGAAGGGTGA ACAATATAAAAGGCTGGAGAGATGTCAATGAAGCAGCTGGATAGATTTC AAATTTTCTAGATTTCAGAGTAATCGCACAAAACGAAGGAATCCCACCA AGCAAAAAAAAAAATCTAAG P.sub.FBA1-2 PP7435_Chr1 (SEQIDNO:42) (1162918_1163621) AAATTAATCCATAAGATAAGGCAAATGTGCTTAAGTAATTGAAAACAGT GTTGTGATTATATAAGCATGGTATTTGAATAGAACTACTGGGGTTAACT TATCTAGTAGGATGGAAGTTGAGGGAGATCAAGATGCTTAAAGAAAAGG ATTGGCCAATATGAAAGCCATAATTAGCAATACTTATTTAATCAGATAA TTGTGGGGCATTGTGACTTGACTTTTACCAGGACTTCAAACCTCAACCA TTTAAACAGTTATAGAAGACGTACCGTCACTTTTGCTTTTAATGTGATC TAAATGTGATCACATGAACTCAAACTAAAATGATATCTTTTACTGGACA AAAATGTTATCCTGCAAACAGAAAGCTTTCTTCTATTCTAAGAAGAACA TTTACATTGGTGGGAAACCTGAAAACAGAAAATAAATACTCCCCAGTGA CCCTATGAGCAGGATTTTTGCATCCCTATTGTAGGCCTTTCAAACTCAC ACCTAATATTTCCCGCCACTCACACTATCAATGATCACTTCCCAGTTCT CTTCTTCCCCTATTCGTACCATGCAACCCTTACACGCCTTTTCCATTTC GGTTCGGATGCGACTTCCAGTCTGTGGGGTACGTAGCCTATTCTCTTAG CCGGTATTTAAACATACAAATTCACCCAAATTCTACCTTGATAAGGTAA TTGATTAATTTCATAAAT P.sub.PMP47 PP7435_Chr3 (SEQIDNO:43) (2033196...2034195) AGCTCAGATTGGAAATGATTTTTGATCCTACCAAGAAGCCTTTGATTTC CAGAATCTCCGCTAAGTAAGTAACCCCCGCAAACGCATGCATCCATGCA AACAAAATACTAACAATTTTAGCCCCGTTGTTGAGAAACCCAGAAAATT GAATGTTCAACCAATCCAGACGATCAATAAGAAAAAAGGCCCAAAGGCT ACTTCCAAACCTGCTGCCGCCAAACCTGCTCCTTCAAAAGCCGGTCCCA AGGGAGGTAAGAAGGTGAGAAAGCCAAAGAAGACAGTTGAAGAATTGGA TCAGGAAATGGCTGACTACTTTGAAAATAAGAATTAGCCCAACAAAATA TGTACAAGTATTATATAAATGAATCTACATGGTGTGTTTTATTTAGATC CTCCAAACCAAGGAAAGAAACTAAACTTATCTCCGGACTTACGAGTCAA ATAACTATCCGCAGTTCCTTGGAACTCAGACTTTCTTCCATAAGCGGTC ATATCATCTTTGGACTGTGGGAATCCTGGACGAATCTTTGAAATGTCAT AATCTTGCTCTCTATCTCCAAGCACAGCGTCCGGTAAATGCTGGTTCTT CTTTCTCAGATGAATCTTGGATTTAACAAATAAAGCCGTGCCTATGGCT AATGTACTCAAAAACAAAGTCTGCTTCCAGAATTTCGCAAACGATGGAA TGCCATTTCCTGTAAATGTACTCATTGAACCTATGTTTGATTAAAGTTG GTGTGAAGTCATCAAACGAGAGTAAAATCAGATACTCGTGCACCGGCCA AAATTGACTGAGCTAATCTCTGCAGGCTTGACATCCGAACACAACAAAT AGGCGACAAATCTTAACTATCTAATCGTAGGCTATGGTAGAACTTTGTG GGGGTAGAGGAAGACTACAACAGCAAGACAAAACAAAAGAGTCATAGTT TGACTCTCTGCTTTTTTCTTCTTTCTCTTCTTTTTCTTCCTCCATATTC GTTATTTATTTCGAACTGGA P.sub.FLD PP7435_Chr3 (SEQIDNO:44) (262519...263518) CAGCCATTAATCTCACCTCAGTTTTTGAATCAGTAGAATTTTTAATGAA ACAAACGGTTGGTATATTATTTGATAGAGTTGCCAAATTTCCAAAGATA AATTTTTCATCAGGTAATATCCTGAATACCGTAACATAGTGACTATTGG AAGACACTGCTATCATATTATATTTCGGATAAAAATCCAAACCCCAGAC CGACCTCTTGAGTCTCAACTCCAAGTCAGCCGCAACTTTAATTATCCGT GGATTGGGAGCTAGTTTGGACAACGCATCAGTATAATATAACTTTACGG TTCCATTATCAGACGCTATTGCAAGAACTTCCTTTCCATTGATCTCGCC AATGCGGCAGTAATTGATATCGTAGGGTAGGTCTGGAAAGACGCTGGCG CTTGTGTCCCATTCTGCAGGAATCTCTGGCACGGTGCTAATGGTAGTTA TCCAACGGAGCTGAGGTAGTCGATATATCTGGATATGCCGCCTATAGGA TAAAAACAGGAGAGGGTGAACCTTGCTTATGGCTACTAGATTGTTCTTG TACTCTGAATTCTCATTATGGGAAACTAAACTAATCTCATCTGTGTGTT GCAGTACTATTGAATCGTTGTAGTATCTACCTGGAGGGCATTCCATGAA TTAGTGAGATAACAGAGTTGGGTAACTAGAGAGAATAATAGACGTATGC ATGATTACTACACAACGGATGTCGCACTCTTTCCTTAGTTAAAACTATC ATCCAATCACAAGATGCGGGCTGGAAAGACTTGCTCCCGAAGGATAATC TTCTGCTTCTATCTCCCTTCCTCATATGGTTTCGCAGGGCTCATGCCCC TTCTTCCTTCGAACTGCCCGATGAGGAAGTCCTTAGCCTATCAAAGAAT TCGGGACCATCATCGATTTTTAGAGCCTTACCTGATCGCAATCAGGATT TCACTACTCATATAAATACATCGCTCAAAGCTCCAACTTTGCTTGTTCA TACAATTCTTGATATTCACA P.sub.FGH1 PP7435_Chr3 (SEQIDNO:45) (555587...556586) TGGTTCCCTCTCGGTCCAATACCAAAAATATTATCACCATACAGGTCTC CCTTCGATACCAGTGCAAAGTTGAACCGTGGGATTACCTTGGAATCTAC AAAAATAGTGTCACTCACAAGTTTGTCATCAACCACGCTGCCGCTTGCA AAGGAGAACTGAACATGAAGGTTGTTAGGGTTTGTTATATTGGAATAAG TGGTGGATTTGTTGAAGGCGAACGCACCAAAGCTACATCCGTCCTGAGC ACACTGTGAATTTGTCACGGAATTGACCAAGAGGTCAGACGATCCTGTA TCCCATTGAGCCGTTATGCTTTGTGGGGGAAACCCTATTTCTATCGTAC TAAGAAAACCAATGGTGAACTCATATTCGGTATCAATGGCGACGATTCC AGCATAGCCTGTAGACAGTAACAACACTAGGGCAACAGCAACTAACATA TCTTCATTGATGAAACGTTGTGATCGGTGTGACTTTTATAGTAAAAGCT ACAACTGTTTGAAATACCAAGATATCATTGTGAATGGCTCAAAAGGGTA ATACATCTGAAAAACCTGAAGTGTGGAAAATTCCGATGGAGCCAACTCA TGATAACGCAGAAGTCCCATTTTGCCATCTTCTCTTGGTATGAAACGGT AGAAAATGATCCGAGTATGCCAATTGATACTCTTGATTCATGCCCTATA GTTTGCGTAGGGTTTAATTGATCTCCTGGTCTATCGATCTGGGACGCAA TGTAGACCCCATTAGTGGAAACACTGAAAGGGATCCAACACTCTAGGCG GACCCGCTCACAGTCATTTCAGGACAATCACCACAGGAATCAACTACTT CTCCCAGTCTTCCTTGCGTGAAGCTTCAAGCCTACAACATAACACTTCT TACTTAATCTTTGATTCTCGAATTGTTTACCCAATCTTGACAACTTAGC CTAAGCAATACTCTGGGGTTATATATAGCAATTGCTCTTCCTCGCTGTA GCGTTCATTCCATCTTTCTA P.sub.TAL1-2 PP7435_Chr2 (SEQIDNO:46) (644082...645082) GATATCGATCTACACTTAATAGTAGATGACGAGGCATCTCTCCAATAGG TACCATATCTGGTGTTTCTTGTAATTTAAGAATCTGTTGGTCTATGAAT GTAGATTTGTCATGAACAATGATATATGGGTCAGGAGGACAAGATGGTT TCTCTGAGTTGGGTTGTTGAGGTGCCTGGCAAGACTTCGGAGCGTTGAT ATCCCCAAGACTTGTAGTGACCGATAGTTGAAGCGTGTGTTTGCAGGAA CGGCACATCAATGCAACTTTCGTAACTTTGGAATTGAGAGTTGATGCAC TGATGACGATACCCGAAATTTTGACGATTTTACCAATATGACTTGAAGA CAAGTCTCTCATTGAAACCTTATTATCGTTACTAAGCAAAACGAGCTGA CAAGAAGGGAAGGTGGTCGGTATTTCCTCGTTGTTCAAATATATGATTC TCCTGGCAATATCTGTGATGGCCTGTTCAAAAAGTGGAATCATTTCTGC AGGATCATCTACCAACTTTTTATTGAGCTCCTCATTGAATACGATTAAG TGGTCATTTTGAATCGTCAGTAAGTACTTGTTTACAAGTAAATTCTGTC TGAGTTGTTCTCTGTAGATGTACTGATTTTCCATACGAAACTCCAAAAT GAACGAACGGAATGCCTTAATGACCTCACTGAACTGGTCATCGTTCTGT TCTCCGGGAAGGACACTTGTGTTAAAGACTGATGCTCTATCAAAGGACA TTGCAACAAAGTATAAACGGTTGTGAGCGGGAAAAAGATGTGTAGGTAA TTGTCGTAGATGAGACTGATTCAGTAGAAAACGCGTCCTGCACTATTTT TTTCTTTCTTCATTACATTTCCTAATCGGGACAAAATGAATCTAAAGAC GTGGTTATGTAGTACACGCATCGATAGGCTATCCCCATACCAAAACACT ATTTTACCCCATCCTTGACAGGTTATAAATATGCGATAGTATGAGTATC TTCAAATTCAGCTGAAATATC P.sub.DAS2 PP7435_Chr3 SEQIDNO:47) (633689-634688) AATAAAAAAACGTTATAGAAAGAAATTGGACTACGATATGCTCCAATCC AAATTGTCAAAATTGACCACCGAAAAAGAACAATTGGAATTTGACAAGA GGAACAACTCACTAGATTCTCAAACGGAGCGTCACCTAGAGTCAGTTTC CAAGTCAATTACAGAAAGTTTGGAAACAGAAGAGGAGTATCTACAATTG AATTCCAAACTTAAAGTCGAGCTGTCCGAATTCATGTCGCTAAGGCTTT CTTACTTGGACCCCATTTTTGAAAGTTTCATTAAAGTTCAGTCAAAAAT TTTCATGGACATTTATGACACATTAAAGAGCGGACTACCTTATGTTGAT TCTCTATCCAAAGAGGATTATCAGTCCAAGATCTTGGACTCTAGAATAG ATAACATTCTGTCGAAAATGGAAGCGCTGAACCTTCAAGCTTACATTGA TGATTAGAGCAATGATATAAACAACAATTGAGTGACAGGTCTACTTTGT TCTCAAAAGGCCATAACCATCTGTTTGCATCTCTTATCACCACACCATC CTCCTCATCTGGCCTTCAATTGTGGGGAACAACTAGCATCCCAACACCA GACTAACTCCACCCAGATGAAACCAGTTGTCGCTTACCAGTCAATGAAT GTTGAGCTAACGTTCCTTGAAACTCGAATGATCCCAGCCTTGCTGCGTA TCATCCCTCCGCTATTCCGCCGCTTGCTCCAACCATGTTTCCGCCTTTT TCGAACAAGTTCAAATACCTATCTTTGGCAGGACTTTTCCTCCTGCCTT TTTTAGCCTCAGGTCTCGGTTAGCCTCTAGGCAAATTCTGGTCTTCATA CCTATATCAACTTTTCATCAGATAGCCTTTGGGTTCAAAAAAGAACTAA AGCAGGATGCCTGATATATAAATCCCAGATGATCTGCTTTTGAAACTAT TTTCAGTATCTTGATTCGTTTACTTACAAACAACTATTGTTGATTTTAT CTGGAGAATAATCGAACAAA P.sub.CAM1 PP7435_Chr3 SEQIDNO:48) (178828-179827) ATTGTTGTGAATACTCTCCTTCATTTGGATTTCTTGGACTTCGGACTCT CTTGATCTCTCTTCGAAAGTTTTAACTCTGTTCATGTATAATTTTACCC GCTGTAGGTCGCTCATAATACCATGAGTATGCACATCTTTTACTCCATT AACTTTCAGGTATGCAAAATACAATGAAGATAGTATATAGCTCAAAGAA TTTAGCATTTTGCATTGATCTAATTGTGACATTTTCTCTATGATATCAT CTAGCTTCTTAAACTCGAGAATCTCGTCCAACGAGGCAGAAACATTGTC CAGTCTTACGTCAAGATTATTCACGAGTTTCTGGACCGTATCAACGTTT TCCATCTTAAGATTACAGTAAGTATCGTCCTTTTGAACTGCAAAGGTAG AAAAGTTAATTTTTGATTTGGTAGTACACTATGAAACTTGCTCACCCCA ATCTTTCCTCCTGACAGGTTGATCTTTATCCCTCTACTAAATTGCCCCA AGTGTATCAAGTAGACTAGATCTCGCGAAAGAACAGCCTAATAAACTCC GAAGCATGATGGCCTCTATCCGGAAAACGTTAAGAGATGTGGCAACAGG AGGGCACATAGAATTTTTAAAGACGCTGAAGAATGCTATCATAGTCCGT AAAAATGTGATAGTACTTTGTTTAGTGCGTACGCCACTTATTCGGGGCC AATAGCTAAACCCAGGTTTGCTGGCAGCAAATTCAACTGTAGATTGAAT CTCTCTAACAATAATGGTGTTCAATCCCCTGGCTGGTCACGGGGAGGAC TATCTTGCGTGATCCGCTTGGAAAATGTTGTGTATCCCTTTCTCAATTG CGGAAAGCATCTGCTACTTCCCATAGGCACCAGTTACCCAATTGATATT TCCAAAAAAGATTACCATATGTTCATCTAGAAGTATAAATACAAGTGGA CATTCAATGAATATTTCATTCAATTAGTCATTGACACTTTCATCAACTT ACTACGTCTTATTCAACAAT P.sub.PP7435_ PP7435_Ch1 SEQIDNO:49) .sub.Chr1-0336 (615194-615193) TATACGGTCTATCCACTTTGGAAACGATGTAGTTGAAACGGGGAAGTAA TAGTGGTTCCCAAACGACATGAAGAGGTTATATAAGTTTGCAAGAGGGT GACACCATTTTAGTTGTGGTTCCCGGGTATTTTTTTAATCTTTTTAGTC TAAGATAGCCTCCCCAGATATTACCGAGTTGGGCCATTTGGGGCGGTAT CGGTGGTATCTGATGGTAGCGCGTTTTTACATGCCTGTGCATTGAACTG GCAAAGAGTATACTATCGTGGGGCCCTGAAGGAGGCAGCAAATGGACCG TCAATTGGTTGATCAGGGACTCAAGACAGGTATTGAGCTTTTCAAACAA AAAGAGTATAGGCGCTGCTACAAGGCATTTACTTCTACTATCAATTTCA TTGAGAATGATCCCGAGTTGGCCGCCAGCTGTGTATCTCAACTGATATC TCTGTTAGATTGTAGGGCAGCCTGTTTGGAAAAGCTAGATCAATTGAAT ATGGCCTTGAAAGATGGTCTTAAAATGATCAAGAGAGAGTGCCACAACT GCAAGGGTTATTTGAGAACTTGCAAAATTTTAGACCTACAAGGGAAGAT CAGTGAGGCTTTGTCTACAGCAAGAGAAGGGATCTCCATAATAGAAACT AGAAGAGATCAGGATAATCAATTTAGATATTCCAAGGTTCTTTTGGAAC AATTAAAGGAACTGAAAAATGCACTGAAAATCAAATTGGACAAGAAAAA TCAGCTACACTTCAAAGTTTTAAAGTTTGACGCACCAGTGCCTTGTACA AAGAAACTAAGATTAGTCACTCCAAGAACAATAGATCCTTCCATTTTTT TGCCGATAGAGCTAGTGAAGCTGATCTTTCGCCTGTTGAATTTCTCAGA CATGTATGCCTGTTTATTGGTCTCAACAAAATGGAACTCAATTATATCC TCATCACCGGAACTGTTTCGAAAACTTCAGTTGAAATCCCAACTGTCCA ACAAGGCGTTAAACAATTGT

REFERENCES

(229) Ata, ., Prielhofer, R., Gasser, B., Mattanovich, D., & alik, P. (2017). Transcriptional engineering of the glyceraldehyde-3-phosphate dehydrogenase promoter for improved heterologous protein production in Pichia pastoris: Transcriptional Engineering of the P GAP for Gene Overexpression in P. pastoris. Biotechnology and Bioengineering, 114 (10), 2319-2327. Aw, R., & Polizzi, K. M. (2013). Can too many copies spoil the broth? Microbial Cell Factories, 12, 128. Blumhoff, M., Steiger, M. G., Marx, H., Mattanovich, D., & Sauer, M. (2013). Six novel constitutive promoters for metabolic engineering of Aspergillus niger. Applied Microbiology and Biotechnology, 97 (1), 259-267. Gasser, B., Prielhofer, R., Marx, H., Maurer, M., Nocon, J., Steiger, M., . . . . Mattanovich, D. (2013). Pichia pastoris: protein production host and model organism for biomedical research. Future Microbiology, 8 (2), 191-208. Gasser, B., Steiger, M. G., & Mattanovich, D. (2015). Methanol regulated yeast promoters: production vehicles and toolbox for synthetic biology. Microbial Cell Factories, 14 (1). Hohenblum, H., Borth, N., & Mattanovich, D. (2003). Assessing viability and cell-associated product of recombinant protein producing Pichia pastoris with flow cytometry. Journal of Biotechnology, 102 (3), 281-290. Looser, V., Bruhlmann, B., Bumbak, F., Stenger, C., Costa, M., Camattari, A., . . . . Kovar, K. (2015). Cultivation strategies to enhance productivity of Pichia pastoris: A review. Biotechnology Advances, 33 (6), 1177-1193. Marx, H., Mattanovich, D., & Sauer, M. (2008). Overexpression of the riboflavin biosynthetic pathway in Pichia pastoris. Microbial Cell Factories, 7 (1), 23. Mellitzer, A., Ruth, C., Gustafsson, C., Welch, M., Birner-Grnberger, R., Weis, R., . . . . Glieder, A. (2014). Synergistic modular promoter and gene optimization to push cellulase secretion by Pichia pastoris beyond existing benchmarks. Journal of Biotechnology, 191, 187-195. Nocon, J., Steiger, M. G., Pfeffer, M., Sohn, S. B., Kim, T. Y., Maurer, M., . . . . Mattanovich, D. (2014). Model based engineering of Pichia pastoris central metabolism enhances recombinant protein production. Metabolic Engineering, 24, 129-138. Prielhofer, R., Barrero, J. J., Steuer, S., Gassler, T., Zahrl, R., Baumann, K., . . . . Marx, H. (2017). GoldenPiCS: a Golden Gate-derived modular cloning system for applied synthetic biology in the yeast Pichia pastoris. BMC Systems Biology, 11 (1). Prielhofer, R., Maurer, M., Klein, J., Wenger, J., Kiziak, C., Gasser, B., & Mattanovich, D. (2013). Induction without methanol: novel regulated promoters enable high-level expression in Pichia pastoris. Microbial Cell Factories, 12 (1), 5. Schwarzhans, J.-P., Wibberg, D., Winkler, A., Luttermann, T., Kalinowski, J., & Friehs, K. (2016). Integration event induced changes in recombinant protein productivity in Pichia pastoris discovered by whole genome sequencing and derived vector optimization. Microbial Cell Factories, 15, 84. Stadlmayr, G., Mecklenbruker, A., Rothmller, M., Maurer, M., Sauer, M., Mattanovich, D., & Gasser, B. (2010). Identification and characterisation of novel Pichia pastoris promoters for heterologous protein production. Journal of Biotechnology, 150 (4), 519-529.