Combined formulation comprising four linked cytotoxic T lymphocyte (CTL) epitopes and a PD-1 pathway inhibitor and methods of use thereof to treat cancer
12251447 ยท 2025-03-18
Assignee
Inventors
Cpc classification
A61K39/395
HUMAN NECESSITIES
A61K38/16
HUMAN NECESSITIES
A61K38/16
HUMAN NECESSITIES
C12Y501/03019
CHEMISTRY; METALLURGY
A61K39/001102
HUMAN NECESSITIES
A61K47/65
HUMAN NECESSITIES
A61K39/3955
HUMAN NECESSITIES
C07K2317/76
CHEMISTRY; METALLURGY
C07K14/4748
CHEMISTRY; METALLURGY
A61K2300/00
HUMAN NECESSITIES
A61K39/395
HUMAN NECESSITIES
A61K2300/00
HUMAN NECESSITIES
A61K2039/545
HUMAN NECESSITIES
A61P35/00
HUMAN NECESSITIES
International classification
A61K39/00
HUMAN NECESSITIES
A61K39/395
HUMAN NECESSITIES
A61K47/65
HUMAN NECESSITIES
Abstract
Provided is a novel cancer treatment method that exhibits a significantly excellent antitumor effect and causes less adverse reactions. The present invention provides an antitumor agent wherein a peptide having 4 linked epitopes and an immune checkpoint modulator are administered in combination. An antitumor effect in humans can be evaluated by providing a cell coexpressing an epitope peptide of a human tumor antigen derived from SART2 and human HLA-A24.
Claims
1. A combined formulation comprising a peptide having 4 linked epitopes comprising 4 CTL epitope peptides linked via linkers and a PD-1 pathway antagonist in combination, wherein the PD-1 pathway antagonist is at least one selected from the group consisting of an anti-PD-1 antibody, an anti-PD-L1 antibody, and an anti-PD-L2 antibody, wherein the peptide having 4 linked epitopes comprises: the epitope peptide as shown in SEQ ID NO: 5, the epitope peptide as shown in SEQ ID NO: 6, the epitope peptide as shown in SEQ ID NO: 9, and one epitope peptide selected from the group consisting of the epitope peptide as shown in SEQ ID NO: 2, the epitope peptide as shown in SEQ ID NO: 4 and the epitope peptide as shown in SEQ ID NO: 10, at the C terminus wherein the 4 linked epitopes are linked via linkers, wherein the peptide optionally further comprises a peptide sequence consisting of hydrophilic amino acids, wherein the linker is an arginine dimer composed of two arginine residues linked to each other, wherein the peptide sequence consisting of hydrophilic amino acids is linked to the N terminus and is composed of an arginine trimer composed of three arginine residues linked to each other or an arginine tetramer composed of four arginine residues linked to each other.
2. The combined formulation of claim 1, wherein the combined formulation further comprises a peptide having the sequence of SEQ ID NO: 44 and a peptide having the sequence of SEQ ID NO: 45.
3. The combined formulation of claim 2, wherein the combined formulation comprises a peptide having the sequence of SEQ ID NO: 24, a peptide having the sequence of SEQ ID NO: 44, and a peptide having the sequence of SEQ ID NO: 45.
4. A method for treating a cancer in a patient by administering a peptide having 4 linked epitopes comprising 4 CTL epitope peptides linked via linkers and a PD-1 pathway antagonist, wherein the PD-1 pathway antagonist is at least one selected from the group consisting of an anti-PD-1 antibody, an anti-PD-L1 antibody, and an anti-PD-L2 antibody, wherein the peptide having 4 linked epitopes comprises: the epitope peptide as shown in SEQ ID NO: 5, the epitope peptide as shown in SEQ ID NO: 6, the epitope peptide as shown in SEQ ID NO: 9, and one epitope peptide selected from the group consisting of the epitope peptide as shown in SEQ ID NO: 2, the epitope peptide as shown in SEQ ID NO: 4 and the epitope peptide as shown in SEQ ID NO: 10, at the C terminus wherein the 4 linked epitopes are linked via linkers, wherein the peptide optionally further comprises a peptide sequence consisting of hydrophilic amino acids, wherein the linker is an arginine dimer composed of two arginine residues linked to each other, wherein the peptide sequence consisting of hydrophilic amino acids is linked to the N terminus and is composed of an arginine trimer composed of three arginine residues linked to each other or an arginine tetramer composed of four arginine residues linked to each other.
5. The method according to claim 4, wherein the peptide having 4 linked epitopes is as shown in SEQ ID NO: 24, SEQ ID NO: 25, or SEQ ID NO: 26.
6. The method according to claim 4, wherein the PD-1 pathway antagonist is at least one selected from the group consisting of an anti-PD-1 antibody and an anti-PD-L1 antibody.
7. The method according to claim 4, wherein the anti-PD-1 antibody is nivolumab or pembrolizumab, and the anti-PD-L1 antibody is atezolizumab, durvalumab or avelumab.
8. The method according to claim 4, wherein the peptide having 4 linked epitopes is administered to the patient before administration of the PD-1 pathway antagonist, simultaneously with administration of the PD-1 pathway antagonist, or after administration of the PD-1 pathway antagonist.
9. The method of claim 4, wherein the method comprises administering to the patient the peptide together with a peptide having the sequence of SEQ ID NO: 44 and a peptide having the sequence of SEQ ID NO: 45, as a mixture.
10. The method of claim 9, wherein the method comprises administering to the patient a peptide having the sequence of SEQ ID NO: 24, a peptide having the sequence of SEQ ID NO: 44, and a peptide having the sequence of SEQ ID NO: 45, as a mixture.
11. A method for enhancing the antitumor effect of a PD-1 pathway antagonist, comprising administering a peptide having 4 linked epitopes to a patient, wherein the PD-1 pathway antagonist is at least one selected from the group consisting of an anti-PD-1 antibody, an anti-PD-L1 antibody, and an anti-PD-L2 antibody, wherein the peptide having 4 linked epitopes comprises: the epitope peptide as shown in SEQ ID NO: 5, the epitope peptide as shown in SEQ ID NO: 6, the epitope peptide as shown in SEQ ID NO: 9, and one epitope peptide selected from the group consisting of the epitope peptide as shown in SEQ ID NO: 2, the epitope peptide as shown in SEQ ID NO: 4 and the epitope peptide as shown in SEQ ID NO: 10, at the C terminus wherein the 4 linked epitopes are linked via linkers, wherein the peptide optionally further comprises a peptide sequence consisting of hydrophilic amino acids, wherein the linker is an arginine dimer composed of two arginine residues linked to each other, wherein the peptide sequence consisting of hydrophilic amino acids is linked to the N terminus and is composed of an arginine trimer composed of three arginine residues linked to each other or an arginine tetramer composed of four arginine residues linked to each other.
12. The method according to claim 11, wherein the peptide having 4 linked epitopes is administered to the patient before administration of the PD-1 pathway antagonist, simultaneously with administration of the PD-1 pathway antagonist, or after administration of the PD-1 pathway antagonist.
13. The method of claim 11, wherein the method comprises administering the peptide together with a peptide having the sequence of SEQ ID NO: 44 and a peptide having the sequence of SEQ ID NO: 45, as a mixture.
14. The method of claim 13, wherein the method comprises administering a peptide having the sequence of SEQ ID NO: 24, a peptide having the sequence of SEQ ID NO: 44, and a peptide having the sequence of SEQ ID NO: 45, as a mixture.
Description
BRIEF DESCRIPTION OF DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
DESCRIPTION OF EMBODIMENTS
(10) The present invention relates to an antitumor agent, an antitumor effect enhancer and a kit formulation, and use of these agents, a tumor treatment method, and a method for enhancing an antitumor effect, wherein a peptide having 4 linked epitopes and an immune checkpoint modulator (e.g., an anti-PD-1 antibody and an anti-PD-L1 antibody) are administered in combination.
(11) In the present invention, the peptide having 4 linked CTL epitopes (herein, also referred to as a peptide having 4 linked epitopes) means a single molecule in which 4 peptides selected from among CTL epitope peptides derived from the same and/or different tumor antigen molecules are linearly linked via linkers.
(12) The following CTL epitope peptides derived from tumor antigen molecules are known:
(13) TABLE-US-00001 KLVERLGAA(SEQIDNO:1;designatedhereinas PEP1;e.g.,InternationalPublicationNo.WO 2001/011044); ASLDSDPWV(SEQIDNO:2;designatedhereinas PEP2;e.g.,InternationalPublicationNo.WO 2002/010369); ALVEFEDVL(SEQIDNO:3;designatedhereinas PEP3;e.g.,InternationalPublicationNo.WO 2002/010369); LLQAEAPRL(SEQIDNO:4;designatedhereinas PEP4;e.g.,InternationalPublicationNo.WO 2000/12701); DYSARWNEI(SEQIDNO:5;designatedhereinas PEP5;e.g.,JPPatentPublication(Kokai)No. 11-318455A(1999)); VYDYNCHVDL(SEQIDNO:6;designatedhereinas PEP6;e.g.,InternationalPublicationNo.WO 2000/12701); LYAWEPSFL(SEQIDNO:7;designatedhereinas PEP7;e.g.,JPPatentPublication(Kokai)No. 2003-000270A); DYLRSVLEDF(SEQIDNO:8;designatedhereinas PEP8;e.g.,InternationalPublicationNo.WO 2001/011044); QIRPIFSNR(SEQIDNO:9;designatedhereinas PEP9;e.g.,InternationalPublicationNo.WO 2008/007711); ILEQSGEWWK(SEQIDNO:10;designatedhereinas PEP10;e.g.,InternationalPublicationNo.WO 2009/022652); VIQNLERGYR(SEQIDNO:11;designatedhereinas PEP11;e.g.,InternationalPublicationNo.WO 2009/022652); KLKHYGPGWV(SEQIDNO:12;designatedhereinas PEP12;e.g.,InternationalPublicationNo.WO 1999/067288); RLQEWCSVI(SEQIDNO:13;designatedhereinas PEP13;e.g.,InternationalPublicationNo.WO 2002/010369); ILGELREKV(SEQIDNO:14;designatedhereinas PEP14;e.g.,InternationalPublicationNo.WO 2002/010369); DYVREHKDNI(SEQIDNO:15;designatedhereinas PEP15;e.g.,InternationalPublicationNo.WO 2005/071075); HYTNASDGL(SEQIDNO:16;designatedhereinas PEP16;e.g.,InternationalPublicationNo.WO 2001/011044); NYSVRYRPGL(SEQIDNO:17;designatedhereinas PEP17;e.g.,JPPatentPublication(Kokai)No. 2003-000270A); RYLTQETNKV(SEQIDNO:18;designatedhereinas PEP18;e.g.,InternationalPublicationNo.WO 2005/116056).
(14) Table 1 below shows information on proteins from which CTL epitope peptides PEP1 to PEP18 are derived. These proteins have been reported to be highly expressed in tumor tissues.
(15) TABLE-US-00002 TABLE1 Aminoacid Peptide Origin sequence SEQIDNO PEP1 Lck-246 KLVERLGAA SEQIDNO:1 PEP2 WHSC2-103 ASLDSDPWV SEQIDNO:2 PEP3 HNRPL-140 ALVEFEDVL SEQIDNO:3 PEP4 SART3-302 LLQAEAPRL SEQIDNO:4 PEP5 SART2-93 DYSARWNEI SEQIDNO:5 PEP6 SART3-109 VYDYNCHVDL SEQIDNO:6 PEP7 MRP3-503 LYAWEPSFL SEQIDNO:7 PEP8 Lck-488 DYLRSVLEDF SEQIDNO:8 PEP9 SART3-734 QIRFIFSNR SEQIDNO:9 PEP10 Lck-80 ILEQSGEWWK SEQIDNO:10 PEP11 Lck-449 VIQNLERGYR SEQIDNO:11 PEP12 CypB-129 KLKHYGPGWV SEQIDNO:12 PEP13 UBE2V-43 RLOEWCSVI SEQIDNO:13 PEP14 WHSC2-141 ILGELREKV SEQIDNO:14 PEP15 EGFR-800 DYVREHKDNI SEQIDNO:15 PEP16 Lck-208 HYTNASDGL SEQIDNO:16 PEP17 MRP3-1293 NYSVRYRPGL SEQIDNO:17 PEP18 PTHrP-102 RYLTQETNKV SEQIDNO:18
(16) The peptide having 4 linked CTL epitopes according to the present invention is a peptide in which 4 types of CTL epitope peptides selected from among particular 13 types of the CTL epitope peptides (the peptide as shown in SEQ ID NO: 1 (PEP1), the peptide as shown in SEQ ID NO: 2 (PEP2), the peptide as shown in SEQ ID NO: 4 (PEP4), the peptide as shown in SEQ ID NO: 5 (PEP5), the peptide as shown in SEQ ID NO: 6 (PEP6), the peptide as shown in SEQ ID NO: 7 (PEP7), the peptide as shown in SEQ ID NO: 8 (PEP8), the peptide as shown in SEQ ID NO: 9 (PEP9), the peptide as shown in SEQ ID NO: 10 (PEP10), the peptide as shown in SEQ ID NO: 13 (PEP13), the peptide as shown in SEQ ID NO: 15 (PEP15), the peptide as shown in SEQ ID NO: 17 (PEP17) and the peptide as shown in SEQ ID NO: 18 (PEP18)) are linearly linked via linkers, and which can induce and/or activate three or more CTLs specific for each CTL epitope peptide. Even if CTL epitope peptide specific induction is not directly evaluated, the occurrence of epitope peptide specific CTL induction can be determined by cleavage experiment with immunoproteasomes (International Publication No. WO 2015/060235, etc.).
(17) The peptide having 4 linked epitopes according to the present invention is a peptide in which the peptide as shown in SEQ ID NO: 5 (PEP5), and 3 peptides selected from the group consisting of the peptide as shown in SEQ ID NO: 1 (PEP1), the peptide as shown in SEQ ID NO: 2 (PEP2), the peptide as shown in SEQ ID NO: 4 (PEP4), the peptide as shown in SEQ ID NO: 6 (PEP6), the peptide as shown in SEQ ID NO: 7 (PEP7), the peptide as shown in SEQ ID NO: 8 (PEP8), the peptide as shown in SEQ ID NO: 9 (PEP9), the peptide as shown in SEQ ID NO: 10 (PEP10), the peptide as shown in SEQ ID NO: 13 (PEP13), the peptide as shown in SEQ ID NO: 15 (PEP15), the peptide as shown in SEQ ID NO: 17 (PEP17) and the peptide as shown in SEQ ID NO: 18 (PEP18) are linked via linkers.
(18) In the present invention, a peptide having an amino acid sequence having substitution, insertion, deletion, and/or addition of one or several amino acids in each amino acid sequence of PEP1, PEP2, PEP4, PEP5, PEP6, PEP7, PEP8, PEP9, PEP10, PEP13, PEP15, PEP17, or PEP18 and having the ability of inducing CTL and/or the ability of inducting immunoglobulin production equivalent to or higher than those of the original peptide can be used as a CTL epitope peptide. The term several used herein refers to 2 or 3, and preferably 2. An example of such peptide is a peptide obtained by substitution of amino acids with amino acids having properties similar to those of the original amino acids (i.e., a peptide obtained by conservative amino acid substitution).
(19) Whether or not the peptide has the ability of inducing CTL and/or the ability of inducting immunoglobulin production equivalent to or higher than those of the original peptide can be evaluated in accordance with a method described in, for example, International Publication No. WO 2015/060235. In the case of evaluating the ability of inducing CTL by use of the method, the number of IFN- producing cells in wells supplemented with cells derived from a mouse given in advance a test peptide having an amino acid sequence having substitution, insertion, deletion, and/or addition of one or several amino acids, antigen presenting cells derived from a syngeneic mouse and the test peptide are used as an index, and the peptide can be confirmed to have the ability of inducing CTL equivalent to or higher than that of the original peptide when results of determining the obtained value (positive (10<100), moderately positive (100<200), strongly positive (200)) are equivalent or higher. In this case, the equivalent ability is determined when the original peptide is positive and the peptide having an amino acid sequence having substitution, insertion, deletion, and/or addition of one or several amino acids is also positive. As for the ability of inducting immunoglobulin production, CTL epitope specific IgG antibody titer in serum of a mouse given a test peptide is used as an index, and the peptide can be confirmed to have the ability of inducting immunoglobulin production equivalent to or higher than that of the original peptide when results of measured increase (fold) in the obtained IgG antibody titer (2<fold<10, 10fold<100, 100fold) are equivalent or higher. In this case, the equivalent ability is determined when the measurement results about the original peptide fall within the range of 2<fold<10 and the measurement results about the peptide having an amino acid sequence having substitution, insertion, deletion, and/or addition of one or several amino acids also fall within the range of 2<fold<10.
(20) In the present invention, any linker can be used, provided that it is cleaved upon administration of a peptide having 4 linked CTL epitopes to an organism, and the linked CTL epitope peptides can be separated from each other. Examples thereof include an ester bond, an ether bond, an amide bond, a sugar chain linker, a polyethylene glycol linker, and an amino acid linker. Examples of amino acid sequences used as amino acid linkers include arginine dimer (RR), arginine trimer (RRR), arginine tetramer (RRRR), lysine dimer (KK), lysine trimer (KKK), lysine tetramer (KKKK), glycine dimer (GG), glycine trimer (GGG), glycine tetramer (GGGG), glycine pentamer (GGGGG), glycine hexamer (GGGGGG), alanine-alanine-tyrosine (AAY), isoleucine-leucine-alanine (ILA), and arginine-valine-lysine-arginine (RVKR), with arginine dimer (RR) or arginine trimer (RRR) being preferable and arginine dimer (RR) being more preferable. Linkers for use in peptides having linked epitopes are known in the art and can be appropriately selected for use by those skilled in the art.
(21) In the peptide having 4 linked epitopes according to the present invention, CTL epitope peptides to be selected and the arrangements thereof can be determined by administering a peptide having 4 linked epitopes obtained by synthesizing it in given combinations and in a given order of epitopes to transgenic mice expressing human HLA-A, and evaluating the occurrence of CTL epitope peptide specific CTL induction in vivo. The occurrence of CTL epitope peptide specific CTL induction in vivo can be evaluated in accordance with a method described in, for example, International Publication No. WO 2015/060235. The CTL epitope peptides to be selected and the arrangements thereof can be determined, by use of the method, such that CTL epitope peptide specific CTL induction is found for at least 3 or more, preferably 4 CTL epitope peptides.
(22) The peptide having 4 linked epitopes according to the present invention preferably has any one of features selected from the following features (1) to (3): (1) the peptide comprises PEP2 at the C terminus (except for peptides comprising PEP7 and PEP8 at the N terminus successively disposed in such order from the N terminus via a linker); (2) the peptide comprises PEP4 at the C terminus; and (3) the peptide comprises PEP10 at the C terminus.
(23) Thus, preferably, in the peptide having 4 linked epitopes according to the present invention, the peptide as shown in SEQ ID NO: 5 (PEP5), and 3 peptides selected from the group consisting of the peptide as shown in SEQ ID NO: 1 (PEP1), the peptide as shown in SEQ ID NO: 2 (PEP2), the peptide as shown in SEQ ID NO: 4 (PEP4), the peptide as shown in SEQ ID NO: 6 (PEP6), the peptide as shown in SEQ ID NO: 7 (PEP7), the peptide as shown in SEQ ID NO: 8 (PEP8), the peptide as shown in SEQ ID NO: 9 (PEP9), the peptide as shown in SEQ ID NO: 10 (PEP10), the peptide as shown in SEQ ID NO: 13 (PEP13), the peptide as shown in SEQ ID NO: 15 (PEP15), the peptide as shown in SEQ ID NO: 17 (PEP17) and the peptide as shown in SEQ ID NO: 18 (PEP18) are linked via linkers, and the peptide having 4 linked epitopes has any one of features selected from the following features (1) to (3): (1) the peptide comprises PEP2 at the C terminus (except for peptides comprising PEP7 and PEP8 at the N terminus successively disposed in such order from the N terminus via a linker); (2) the peptide comprises PEP4 at the C terminus; and (3) the peptide comprises PEP10 at the C terminus.
(24) More preferably, the peptide having 4 linked epitopes according to the present invention comprises the peptide as shown in SEQ ID NO: 5 (PEP5), the peptide as shown in SEQ ID NO: 6 (PEP6) and the peptide as shown in SEQ ID NO: 9 (PEP9), and one peptide selected from the group consisting of the peptide as shown in SEQ ID NO: 2 (PEP2), the peptide as shown in SEQ ID NO: 4 (PEP4) and the peptide as shown in SEQ ID NO: 10 (PEP10),
linked via linkers, and comprises PEP2, PEP4, or PEP10 at the C terminus.
(25) More preferably, the peptide having 4 linked epitopes according to the present invention is a peptide consisting of a sequence selected from the following sequences: PEP5-(L)-PEP6-(L)-PEP9-(L)-PEP4; PEP9-(L)-PEP5-(L)-PEP6-(L)-PEP4; PEP6-(L)-PEP5-(L)-PEP9-(L)-PEP4; PEP6-(L)-PEP9-(L)-PEP5-(L)-PEP4; PEP9-(L)-PEP6-(L)-PEP5-(L)-PEP4; PEP5-(L)-PEP9-(L)-PEP6-(L)-PEP4; PEP5-(L)-PEP9-(L)-PEP6-(L)-PEP2; and PEP5-(L)-PEP9-(L)-PEP6-(L)-PEP10, wherein (L) represents a linker.
(26) More preferably, the peptide having 4 linked epitopes according to the present invention is a peptide consisting of a sequence selected from the following sequences: PEP5-(L)-PEP9-(L)-PEP6-(L)-PEP4; PEP5-(L)-PEP9-(L)-PEP6-(L)-PEP2; and PEP5-(L)-PEP9-(L)-PEP6-(L)-PEP10, wherein (L) represents a linker.
(27) More preferably, the peptide having 4 linked epitopes according to the present invention is a peptide having an arginine dimer as the linker and a sequence selected from the following sequences: PEP5-RR-PEP9-RR-PEP6-RR-PEP4 (SEQ ID NO: 24; designated herein as TPV06); PEP5-RR-PEP9-RR-PEP6-RR-PEP2 (SEQ ID NO: 25; designated herein as TPV07); and PEP5-RR-PEP9-RR-PEP6-RR-PEP10 (SEQ ID NO: 26; designated herein as TPV08).
(28) More preferably, the peptide having 4 linked epitopes according to the present invention is peptide TPV06 as shown in SEQ ID NO: 24.
(29) In one embodiment of the present invention, the peptide having 4 linked epitopes is preferably a peptide having a sequence selected from SEQ ID NOs: 19 to 28 shown in Table 2 below.
(30) TABLE-US-00003 TABLE2 Peptide Aminoacidsequence SEQIDNO TPV01 PEP5-RR-PEP6-RR-PEP9-RR-PEP4 SEQIDNO:19 TPV02 PEP9-RR-PEP5-RR-PEP6-RR-PEP4 SEQIDNO:20 TPV03 PEP6-RR-PEP5-RR-PEP9-RR-PEP4 SEQIDNO:21 TPV04 PEP6-RR-PEP9-RR-PEP5-RR-PEP4 SEQIDNO:22 TPV05 PEP9-RR-PEP6-RR-PEP5-RR-PEP4 SEQIDNO:23 TPV06 PEP5-RR-PEP9-RR-PEP6-RR-PEP4 SEQIDNO:24 TPV07 PEP5-RR-PEP9-RR-PEP6-RR-PEP2 SEQIDNO:25 TPV08 PEP5-RR-PEP9-RR-PEP6-RR-PEP10 SEQIDNO:26 TPV09 RRR-PEP5-RR-PEP9-RR-PEP6-RR-PEP4 SEQIDNO:27 TPV10 RRRR-PEP5-RR-PEP9-RR-PEP6-RR-PEP4 SEQIDNO:28
(31) More preferably, the peptide having 4 linked epitopes is any of the following peptides:
(32) TABLE-US-00004 (SEQIDNO:19) TPV01; (SEQIDNO:20) TPV02; (SEQIDNO:21) TPV03; (SEQIDNO:22) TPV04; (SEQIDNO:23) TPV05;and (SEQIDNO:24) TPV06
selected from Table 2 described above.
(33) In the present invention, 2 or more peptides having 4 linked epitopes may be used. For example, 2, 3, 4 or more peptides having 4 linked epitopes may be used separately or as a mixture, and 3 peptides having 4 linked epitopes are preferably used as a mixture. In the case of using 2 or more peptides having 4 linked epitopes, one or more of the peptides may be the peptide having 4 linked epitopes according to the present invention, or may be a peptide having 4 linked epitopes as described in, for example, International Publication No. WO 2015/060235, as long as at least one peptide having 4 linked epitopes according to the present invention is included. It is preferable to use the peptide as shown in SEQ ID NO: 24 and one or more peptides having 4 linked CTL epitopes described in International Publication No. WO 2015/060235. It is more preferable to use the peptide as shown in SEQ ID NO: 24 and 2 peptides having 4 linked epitopes described in International Publication No. WO 2015/060235. It is still more preferable to use 3 peptides, i.e., the peptide as shown in SEQ ID NO: 24, the peptide as shown in SEQ ID NO: 44 (TPV011: PEP15-RR-PEP18-RR-PEP1-RR-PEP10) and the peptide as shown in SEQ ID NO: 45 (TPV012: RRRR-PEP7-RR-PEP13-RR-PEP8-RR-PEP2), as a mixture.
(34) The peptide having 4 linked CTL epitopes according to the present invention can further has a peptide sequence consisting of hydrophilic amino acids. Such peptide sequence can be added to the N terminus and/or the C terminus of the peptide having 4 linked CTL epitopes, and it is preferably added to the N terminus. Such peptide sequence consists of 1 to 15, preferably 2 to 10, and more preferably 3 to 5 hydrophilic amino acids selected from the group consisting of arginine, histidine, lysine, threonine, tyrosine, serine, asparagine, glutamine, aspartic acid, and glutamic acid. For example, arginine trimer (RRR) or arginine tetramer (RRRR) can be used as such a peptide sequence. Examples of peptides having 4 linked CTL epitopes comprising such peptide sequences added thereto include RRR-TPV06, RRRR-TPV06, TPV06-RRR, TPV06-RRRR, RRR-TPV07, RRRR-TPV07, TPV07-RRR, TPV07-RRRR, RRR-TPV08, RRRR-TPV08, TPV08-RRR, TPV08-RRRR, KKK-TPV06, KKKK-TPV06, TPV06-KKK, TPV06-KKKK, KKK-TPV07, KKKK-TPV07, TPV07-KKK, TPV07-KKKK, KKK-TPV08, KKKK-TPV08, TPV08-KKK, TPV08-KKKK, HHH-TPV06, HHHH-TPV06, TPV06-HHH, TPV06-HHHH, HHH-TPV07, HHHH-TPV07, TPV07-HHH, TPV07-HHHH, HHH-TPV08, HHHH-TPV08, TPV08-HHH, TPV08-HHHH, RRKK-TPV06, RKRK-TPV06, RHRH-TPV06, RRHH-TPV06, KKHH-TPV06, and KHKH-TPV06, with RRR-TPV06, RRRR-TPV06, RRR-TPV07, RRRR-TPV07, RRR-TPV08, RRRR-TPV08, KKK-TPV06, KKKK-TPV06, KKK-TPV07, KKKK-TPV07, KKK-TPV08, KKKK-TPV08, HHH-TPV06, HHHH-TPV06, HHH-TPV07, HHHH-TPV07, HHH-TPV08, HHHH-TPV08, RRKK-TPV06, RKRK-TPV06, RHRH-TPV06, RRHH-TPV06, KKHH-TPV06, and KHKH-TPV06 being preferable, RRR-TPV06 (TPV09), RRRR-TPV06 (TPV10), RRR-TPV07, RRRR-TPV07, RRR-TPV08, and RRRR-TPV08 being more preferable, and RRR-TPV06 (TPV09) and RRRR-TPV06 (TPV10) being most preferable.
(35) A peptide comprising such peptide sequence consisting of hydrophilic amino acids is known to have improved solubility in an aqueous solvent (Peptides: 38, 302-311 (2012); JP Patent Publication (Kokai) No. 2006-188507 A). With the addition of such peptide sequence to the peptide having 4 linked CTL epitopes according to the present invention, the solubility of the peptide having 4 linked CTL epitopes in an aqueous solvent can be improved.
(36) The peptide having 4 linked epitopes optionally further comprising a peptide sequence consisting of hydrophilic amino acids according to the present invention is preferably a peptide having 4 linked CTL epitopes optionally comprising a peptide sequence consisting of hydrophilic amino acids at the N terminus, more preferably a peptide having 4 linked CTL epitopes optionally comprising a peptide sequence consisting of 3 to 5 hydrophilic amino acids selected from the group consisting of arginine, histidine and lysine at the N terminus, more preferably a peptide having 4 linked CTL epitopes optionally comprising an arginine trimer (RRR) or an arginine tetramer (RRRR) at the N terminus, and still more preferably a peptide having 4 linked CTL epitopes not comprising a peptide sequence consisting of hydrophilic amino acids.
(37) The peptide having 4 linked CTL epitopes according to the present invention can be synthesized in accordance with a method described in, for example, International Publication No. WO 2015/060235.
(38) The immune checkpoint modulator according to the present invention acts on an immune checkpoint molecule and has an effect of inducing in vivo antitumor immune responses in cancer patients and preventing tumor immune escape.
(39) Thus, a substance targeting an immune checkpoint molecule can be used as the immune checkpoint modulator. Examples of the immune checkpoint molecule include molecules of the B7 family (B7-1, B7-2, PD-L1, PD-L2, etc.), the CD28 family (CTLA-4, PD-1, etc.), the TNF superfamily (4-1BBL, OX40L, etc.), and the TNF receptor superfamily (4-1BB, OX40, etc.), which are broadly classified into costimulatory molecules having stimulatory action and coinhibitory molecules having suppressive action.
(40) Examples of the immune checkpoint modulator that may be suitably used in the present invention include substances promoting the functions of costimulatory molecules and substances suppressing the functions of coinhibitory molecules. More specifically, examples of the immune checkpoint modulator include a PD-1 pathway antagonist, an ICOS pathway agonist, a CTLA-4 pathway antagonist, a CD28 pathway agonist, a BTLA pathway antagonist, and a 4-1BB pathway agonist, etc.
(41) In the present invention, the immune checkpoint modulator is preferably at least one selected from the group consisting of a PD-1 pathway antagonist, an ICOS pathway agonist, a CTLA-4 pathway antagonist and a CD28 pathway agonist, more preferably at least one selected from the group consisting of a PD-1 pathway antagonist, a CTLA-4 pathway antagonist and a CD28 pathway agonist, more preferably at least one selected from the group consisting of a PD-1 pathway antagonist and a CTLA-4 pathway antagonist, and still more preferably a PD-1 pathway antagonist from the viewpoint of suppression of adverse reactions.
(42) The PD-1 pathway antagonist inhibits immunosuppressive signals induced by PD-1 expressed on T cells or its ligand PD-L1 or PD-L2. Examples thereof include an anti-PD-1 antibody, an anti-PD-L1 antibody, an anti-PD-L2 antibody, a PD-1 extracellular domain, a PD-L1 extracellular domain, a PD-L2 extracellular domain, PD-1-Ig (fusion protein of a PD-1 extracellular domain and an immunoglobulin (Ig) FC region), PD-L1-Ig, PD-L2-Ig, PD-1 siRNA, PD-L1 siRNA, and PD-L2 siRNA. The PD-1 pathway antagonist is preferably an anti-PD-1 antibody, an anti-PD-L1 antibody, or an anti-PD-L2 antibody, more preferably an anti-PD-1 antibody or an anti-PD-L1 antibody. Among them, an anti-PD-1 antibody is particularly preferable.
(43) The CTLA-4 pathway antagonist inhibits immunosuppressive signals induced by CTLA-4 expressed on T cells or its ligand B7-1 (CD80) or B7-2 (CD86). Examples thereof include an anti-CTLA-4 antibody, a CTLA-4 extracellular domain, CTLA-4-Ig, an anti-B7-1 (CD80) antibody, an anti-B7-2 (CD86) antibody, and CTLA-4 siRNA. The CTLA-4 pathway antagonist is preferably an anti-CTLA-4 antibody, a CTLA-4 extracellular domain, CTLA-4-Ig, an anti-B7-1 (CD80) antibody, or an anti-B7-2 (CD86) antibody, more preferably an anti-CTLA-4 antibody or CTLA-4-Ig. Among them, an anti-CTLA-4 antibody is particularly preferable.
(44) Examples of these antibodies include immunoglobulins (IgA, IgD, IgE, IgG, IgM, IgY, etc.), Fab fragments, F(ab).sub.2 fragments, single-chain variable fragments (scFv), single-domain antibodies, and diabody (Nat. Rev. Immunol., 6: 343-357, 2006). Examples thereof include monoclonal or polyclonal antibodies including human antibodies, humanized antibodies, chimeric antibodies, mouse antibodies, llama antibodies, and chicken antibodies.
(45) A humanized IgG monoclonal antibody or a human IgG monoclonal antibody is preferable.
(46) Examples of the anti-PD-1 antibody according to the present invention include nivolumab, pembrolizumab, cemiplimab and spartalizumab, with nivolumab or pembrolizumab being preferable.
(47) Examples of the anti-PD-L1 antibody according to the present invention include atezolizumab, durvalumab, avelumab, and the like, with atezolizumab, durvalumab or avelumab being preferable.
(48) Examples of the anti-CTLA-4 antibody according to the present invention include ipilimumab, tremelimumab, and the like, with ipilimumab being preferable.
(49) Examples of the CTLA-4-Ig according to the present invention include abatacept and the like, with abatacept being preferable.
(50) These antibodies can be produced by commonly known antibody preparation methods.
(51) The anti-PD-1 antibody is already sold or will be sold as nivolumab or pembrolizumab; the anti-PD-L1 antibody is already sold or will be sold as atezolizumab, durvalumab or avelumab; the anti-CTLA-4 antibody is already sold or will be sold as ipilimumab or tremelimumab; and CTLA-4-Ig is already sold or will be sold as abatacept, any of which can also be used.
(52) In the present invention, in the case of using 2 or more immune checkpoint modulators, for example, an anti-PD-1 antibody and/or an anti-CTLA-4 antibody may be used in combination, or a bispecific antibody capable of binding to both PD-1 and CTLA-4 may be used. Examples of the bispecific antibody include XmAb20717 (PD-1CTLA-4).
(53) The recommended dose of the peptide having 4 linked epitopes used in the present invention for humans is in the range of 3 to 9 mg/body/day per each peptide having 4 linked epitopes for monotherapy. In the present invention, the amount of the peptide having 4 linked epitopes administered per day on the day of administration is preferably 50 to 200%, more preferably 80 to 120%, particularly preferably 100%, of the recommended dose of the peptide having 4 linked epitopes for monotherapy, from the viewpoint of an effect of enhancing the antitumor effect of the immune checkpoint modulator by the peptide having 4 linked epitopes.
(54) Thus, when the recommended dose for humans is 3 mg/body/day, the amount of the peptide having 4 linked epitopes administered is preferably 1.5 to 6 mg/body/day, more preferably 2.4 to 3.6 mg/body/day, and particularly preferably 3 mg/body/day, per peptide having 4 linked epitopes. When the recommended dose for humans is 9 mg/body/day, the amount of the peptide having 4 linked epitopes administered is preferably 4.5 to 18 mg/body/day, more preferably 7.2 to 10.8 mg/body/day, and particularly preferably 9 mg/body/day, per peptide having 4 linked epitopes.
(55) In the present invention, the amount of the immune checkpoint modulator administered per day on the day of administration is preferably 50 to 100%, and more preferably 100%, of the recommended dose of the immune checkpoint modulator when administered alone, from the viewpoint of an effect of enhancing the antitumor effect of the immune checkpoint modulator by the peptide having 4 linked epitopes.
(56) Specifically, the recommended dose of nivolumab administered alone is 2 mg/kg (body weight) per dose or 3 mg/kg (body weight) per dose, which has been approved in Japan. Therefore, the amount of nivolumab administered per day on the day of administration according to the present invention is preferably 1 to 3 mg/kg (body weight) per dose, and more preferably 2 mg/kg (body weight) per dose or 3 mg/kg (body weight) per dose.
(57) The recommended dose of pembrolizumab administered alone is 2 mg/kg (body weight) per dose or 200 mg per dose, which has been approved in Japan. Therefore, the amount of pembrolizumab administered per day on the day of administration according to the present invention is preferably 1 to 2 mg/kg (body weight) per dose or 100 to 200 mg per dose, and more preferably 2 mg/kg (body weight) per dose or 200 mg per dose.
(58) The recommended dose of atezolizumab administered alone is 1200 mg per dose, which has been approved in Japan. Therefore, the amount of atezolizumab administered per day on the day of administration according to the present invention is preferably 600 to 1200 mg per dose, and more preferably 1200 mg per dose.
(59) The recommended dose of avelumab or durvalumab administered alone is 10 mg/kg (body weight) per dose, which has been approved in the USA. Therefore, the amount of avelumab or durvalumab administered per day on the day of administration according to the present invention is preferably 5 to 10 mg/kg (body weight) per dose, and more preferably 10 mg/kg (body weight) per dose.
(60) The recommended dose of ipilimumab administered alone is 3 mg/kg (body weight) per dose, which has been approved in Japan. Therefore, the amount of ipilimumab administered per day on the day of administration according to the present invention is preferably 1.5 to 3 mg/kg (body weight) per dose, and more preferably 3 mg/kg (body weight) per dose.
(61) In the present invention, the recommended dose is a range of dose that have been determined by clinical trials, etc. and can be used safely without exhibiting severe adverse events, which may provide the maximum therapeutic effect. Specifically, examples thereof include a recommended dose approved and/or recommended by a public organization or institution such as Pharmaceuticals and Medical Devices Agency (PMDA), Food and Drug Administration (FDA), or European Medicines Agency (EMA), and described in a package insert, an interview form, a treatment guideline, or the like. The recommended dose approved by any of the public organizations PMDA, FDA and EMA is preferable.
(62) The antitumor agent of the present invention can be administered in accordance with a schedule appropriately selected according to a type of cancer, stage, etc.
(63) The peptide having 4 linked epitopes is preferably administered in accordance with a schedule with one cycle set to a total of 21 days involving 3 repetitive steps of administration once a week (once a day on days 1, 8 and 15). In the 3rd cycle or later, it is preferably administered in accordance with a schedule with one cycle set to a total of 21 days involving administration on day 1 and cessation of the drug for 20 days (administration every 3 weeks).
(64) Nivolumab is preferably administered in accordance with a schedule of administration at 2-week or 3-week intervals.
(65) Pembrolizumab, atezolizumab or ipilimumab is preferably administered in accordance with a schedule of administration at 3-week intervals.
(66) Avelumab or durvalumab is preferably administered in accordance with a schedule of administration at 2-week intervals.
(67) The number of administration of the antitumor agent of the present invention per day can be appropriately selected according to a type of cancer, stage, etc.
(68) The peptide having 4 linked epitopes, nivolumab, pembrolizumab, atezolizumab, avelumab or ipilimumab is preferably administered once a day.
(69) The peptide having 4 linked epitopes according to the present invention and the immune checkpoint modulator can be administered in an order appropriately selected according to a type of cancer, stage, etc., either of which may be administered first or both of which may be administered simultaneously. In the case of not simultaneously administering these agents, the agents can be administered at an appropriately selected interval as long as an effect of enhancing an antitumor effect is exerted. The interval is preferably 1 to 21 days, more preferably 1 to 14 days, and particularly preferably 1 to 7 days. The peptide having 4 linked epitopes according to the present invention and the immune checkpoint modulator are preferably administered in an order in which the peptide having 4 linked epitopes is administered first.
(70) The tumor to be targeted in the present invention is not particularly limited as long as an effect of enhancing an antitumor effect is exerted. The tumor is preferably tumor on which the peptide having 4 linked epitopes exerts an antitumor effect, more preferably malignant tumor positive for Lck, WHSC2, SART2, SART3, MRP3, UBE2V, EGFR, or PTHrP, and more preferably SART2-positive malignant tumor.
(71) Specific examples of the cancer to be targeted in the present invention include brain tumor, head and neck cancer, gastrointestinal cancer (esophageal cancer, gastric cancer, duodenal cancer, liver cancer, biliary tract cancer (gallbladder cancer, bile duct cancer, etc.), pancreatic cancer, small intestine cancer, large intestine cancer (colorectal cancer, colon cancer, rectal cancer, etc.), gastrointestinal stromal tumor, etc.), lung cancer (non-small cell lung cancer and small cell lung cancer), breast cancer, ovarian cancer, uterine cancer (cervical cancer, endometrical cancer, etc.), kidney cancer, urothelial cancer (bladder cancer, renal pelvis cancer, and ureter cancer), prostate cancer, skin cancer, and cancer of unknown primary origin. In this context, the cancer includes not only primary tumor but also a cancer metastasized to other organs (liver, etc.). Among them, head and neck cancer, gastrointestinal cancer, lung cancer, kidney cancer, urothelial cancer, and skin cancer are preferable, digestive system cancer, lung cancer, urothelial cancer, and skin cancer are more preferable, and lung cancer and urothelial cancer are particularly preferable, from the viewpoint of an antitumor effect. The antitumor agent of the present invention may be the one for use in postoperative adjuvant chemotherapy which is performed for preventing recurrence after surgical extirpation of tumor, or may be the one for use in preoperative adjuvant chemotherapy which is performed before surgical extirpation of tumor.
(72) In the present invention, the peptide having 4 linked epitopes and the immune checkpoint modulator may be prepared in a plurality of formulations of the active ingredients or in the form of a single-agent formulation (e.g., formulation as a combination drug) on the basis of the dosage form of each active ingredient or the administration schedule. These formulations may be produced and distributed in one package suitable for use in combination, or may be produced and distributed in separate packages.
(73) The dosage form of the antitumor agent of the present invention is not particularly limited and can be appropriately selected according to a therapeutic purpose. Specific examples thereof can include oral formulations (tablets, coated tablets, powders, granules, capsules, liquid formulations, etc.), injections, suppositories, patches, and ointments.
(74) Examples of the dosage forms of the peptide having 4 linked epitopes, the anti-PD-1 antibody, the anti-PD-L1 antibody and the anti-CTLA-4 antibody include the dosage forms described above, with an injection being preferable.
(75) The antitumor agent according to the present invention can be prepared by a commonly known method using a pharmaceutically acceptable carrier according to the dosage form both for the peptide having 4 linked epitopes and for the immune checkpoint modulator. Examples of such carriers can include various ones generally used in common drugs, for example, excipients, binders, disintegrators, lubricants, diluents, solubilizers, suspending agents, isotonizing agents, pH adjusters, buffers, stabilizers, colorants, flavoring agents, and odor correcting agents.
(76) The present invention also relates to an antitumor effect enhancer for enhancing the antitumor effect of an immune checkpoint modulator on a cancer patient, comprising a peptide having 4 linked epitopes as an active ingredient. The antitumor effect enhancer has the dosage form of the antitumor agent described above.
(77) The present invention also relates to an antitumor agent for treating a cancer patient given an immune checkpoint modulator, comprising a peptide having 4 linked epitopes. The antitumor agent has the dosage form described above.
(78) The present invention also relates to an antitumor agent for treating a cancer patient given a peptide having 4 linked epitopes, comprising an immune checkpoint modulator. The antitumor agent has the dosage form described above.
(79) The treatment includes postoperative adjuvant chemotherapy which is performed for preventing reoccurrence after surgical extirpation of tumor, and preoperative adjuvant chemotherapy which is performed beforehand for surgical extirpation of tumor.
(80) The present invention also relates to an antitumor agent comprising a peptide having 4 linked epitopes, wherein the peptide having 4 linked epitopes is used in combination with an immune checkpoint modulator for a cancer patient. The antitumor agent has the dosage form described above.
(81) The present invention also relates to an antitumor agent comprising an immune checkpoint modulator, wherein the immune checkpoint modulator is used in combination with a peptide having 4 linked epitopes for a cancer patient. The antitumor agent has the dosage form described above.
(82) The present invention also relates to a kit formulation comprising an antitumor agent comprising a peptide having 4 linked epitopes, and an instruction for use stating that the peptide having 4 linked epitopes and an immune checkpoint modulator are administered in combination to a cancer patient.
(83) In this context, the instruction for use describes the amounts of the agents to be administered and preferably recommended dose as described above, with or without legal binding. Specific examples thereof include package inserts and pamphlets. In the kit formulation comprising an instruction for use, the instruction for use may be printed and/or attached on the package of the kit formulation, or the instruction for use may be enclosed, together with the antitumor agent, in the package of the kit formulation.
(84) Meanwhile, the group of the present inventor, et al. has established a technique of expressing an artificial chimeric gene of a human- or non-human-derived 2 microglobulin, HLA class I 1 and 2 regions, and a human- or non-human-derived MHC class I 3 region linked to each other in non-human animals, and successfully prepared a non-human animal expressing HLA class I (International Publication No. WO 2015/056774).
(85) Use of the non-human animal described above enables reconstitution of human immune responses in non-human animals. Specifically, antigen presenting cells in the non human animal express HLA class I 1 and 2 regions and can therefore present an epitope peptide of a human tumor antigen capable of binding thereto.
(86) The present inventor has further found that an effect of CTL induction by a peptide having 4 linked epitopes can be evaluated by coexpressing human HLA-A24 and an epitope peptide of a human tumor antigen derived from SART2. For example, tumor presenting an epitope peptide of a human tumor antigen derived from SART2 can be allowed to grow by coexpressing human HLA-A24 and the epitope peptide of a human tumor antigen derived from SART2 to cultured cells derived from mouse tumor, and transplanting the cultured cells to the non-human animal described above.
(87) Specifically, the present invention provides a cell which have been introduced a polynucleotide encoding an epitope peptide of a human tumor antigen derived from SART2, and a polynucleotide encoding, particularly, 1 and 2 regions of human HLA-A24. In this context, the epitope peptide of a human tumor antigen derived from SART2 preferably comprises PEP5. Thus, a polynucleotide encoding PEP5 is preferably introduced to the cell.
(88) The present inventor has successfully engrafted tumors coexpressing HLA-A24 and PEP5 in the non-human animal described above, and demonstrated that this system enables evaluation of the antitumor agent of the present invention, etc.
(89) Accordingly, the present invention relates to a cell which have been introduced a polynucleotide encoding an epitope peptide of a human tumor antigen derived from SART2 and a polynucleotide encoding 1 and 2 regions of human HLA-A24 (hereinafter, also referred to as the cell of the present invention).
(90) SART2 is one of proteins reported to be highly expressed in tumor tissues, as described above. Examples of the epitope peptide of a human tumor antigen derived from SART2 which may be presented through binding to an HLA-A24 type HLA molecule in antigen presenting cells such as dendritic cells include PEP5 described above. The amino acid sequence of the peptide PEP5 is shown in SEQ ID NO: 5, and a polynucleotide sequence encoding the peptide PEP5 is shown in SEQ ID NO: 29.
(91) The polynucleotide encoding an epitope peptide of a human tumor antigen derived from SART2 used herein is preferably a polynucleotide selected from the following polynucleotides (a) to (e): (a) a polynucleotide encoding a polypeptide comprising the amino acid sequence as shown in SEQ ID NO: 5; (b) a polynucleotide encoding a polypeptide comprising an amino acid sequence having substitution, deletion, or addition of one or several amino acids in the amino acid sequence as shown in SEQ ID NO: 5; (c) a polynucleotide encoding a polypeptide comprising an amino acid sequence having 90% or higher identity to the amino acid sequence as shown in SEQ ID NO: 5; (d) a polynucleotide comprising the nucleotide sequence as shown in SEQ ID NO: 29; and (e) a polynucleotide comprising a nucleotide sequence having 90% or higher identity to the nucleotide sequence as shown in SEQ ID NO: 29;
more preferably a polynucleotide selected from the following polynucleotides (a) to (e): (a) a polynucleotide encoding a polypeptide comprising the amino acid sequence as shown in SEQ ID NO: 5; (b) a polynucleotide encoding a polypeptide comprising an amino acid sequence having substitution, deletion, or addition of one or several amino acids in the amino acid sequence as shown in SEQ ID NO: 5 (wherein the addition of amino acids is limited to addition to the N terminal side); (c) a polynucleotide encoding a polypeptide comprising an amino acid sequence having 90% or higher identity to the amino acid sequence as shown in SEQ ID NO: 5; (d) a polynucleotide comprising the nucleotide sequence as shown in SEQ ID NO: 29; and (e) a polynucleotide comprising a nucleotide sequence having 90% or higher identity to the nucleotide sequence as shown in SEQ ID NO: 29;
and more preferably a polynucleotide selected from the polynucleotides (a) and (d).
(92) The polypeptide comprising the amino acid sequence as shown in SEQ ID NO: 5 used herein may further comprise an added signal sequence. Preferably, the polypeptide comprising the amino acid sequence as shown in SEQ ID NO: 5 is a polypeptide having a signal sequence of 10 to 30 amino acids, more preferably a signal sequence of 15 to 25 amino acids, added to the N terminal side of the amino acid sequence as shown in SEQ ID NO: 5, and is more preferably a polypeptide consisting of the amino acid sequence as shown in SEQ ID NO: 32.
(93) Likewise, the polypeptide comprising an amino acid sequence having substitution, deletion, or addition of one or several amino acids in the amino acid sequence as shown in SEQ ID NO: 5 used herein may further comprise an added signal sequence. Preferably, this polypeptide is a polypeptide having a signal sequence of 10 to 30 amino acids, more preferably a signal sequence of 15 to 25 amino acids, added to the N terminal side of the amino acid sequence having substitution, deletion, or addition of one or several amino acids in the amino acid sequence as shown in SEQ ID NO: 5, and is more preferably a polypeptide consisting of the amino acid sequence as shown in SEQ ID NO: 32.
(94) Likewise, the polypeptide comprising an amino acid sequence having 90% or higher identity to the amino acid sequence as shown in SEQ ID NO: 5 used herein may further comprise an added signal sequence. Preferably, this polypeptide is a polypeptide having a signal sequence of 10 to 30 amino acids, more preferably a signal sequence of 15 to 25 amino acids, added to the N terminal side of the amino acid sequence having 90% or higher identity to the amino acid sequence as shown in SEQ ID NO: 5, and is more preferably a polypeptide consisting of the amino acid sequence as shown in SEQ ID NO: 32.
(95) Likewise, the polynucleotide comprising the nucleotide sequence as shown in SEQ ID NO: 29 used herein may further comprise an added nucleotide sequence encoding a signal sequence. Preferably, this polynucleotide is a polynucleotide having 30 to 90 nucleotides encoding a signal sequence, more preferably 45 to 75 nucleotides encoding a signal sequence, added to the 5 terminal side of the nucleotide sequence as shown in SEQ ID NO: 29, and is more preferably a polynucleotide consisting of the nucleotide sequence as shown in SEQ ID NO: 33.
(96) Likewise, the polynucleotide comprising a nucleotide sequence having 90% or higher identity to the nucleotide sequence as shown in SEQ ID NO: 29 used herein may further comprise an added nucleotide sequence encoding a signal sequence. Preferably, this polynucleotide is a polynucleotide having 30 to 90 nucleotides encoding a signal sequence, more preferably 45 to 75 nucleotides encoding a signal sequence, added to the 5 terminal side of the nucleotide sequence having 90% or higher identity to the nucleotide sequence as shown in SEQ ID NO: 29, and is more preferably a polynucleotide consisting of the nucleotide sequence as shown in SEQ ID NO: 33.
(97) In one aspect of the present invention, the polynucleotide encoding an epitope peptide of a human tumor antigen derived from SART2 may preferably be a polynucleotide selected from the following polynucleotides (k) to (o): (k) a polynucleotide encoding a polypeptide consisting of the amino acid sequence as shown in SEQ ID NO: 32; (l) a polynucleotide encoding a polypeptide consisting of an amino acid sequence having substitution, deletion, or addition of one or several amino acids in the amino acid sequence as shown in SEQ ID NO: 32; (m) a polynucleotide encoding a polypeptide consisting of an amino acid sequence having 90% or higher identity to the amino acid sequence as shown in SEQ ID NO: 32; (n) a polynucleotide consisting of the nucleotide sequence as shown in SEQ ID NO: 33; and (o) a polynucleotide consisting of a nucleotide sequence having 90% or higher identity to the nucleotide sequence as shown in SEQ ID NO: 33;
more preferably a polynucleotide selected from the following polynucleotides (k) to (o): (k) a polynucleotide encoding a polypeptide consisting of the amino acid sequence as shown in SEQ ID NO: 32; (l) a polynucleotide encoding a polypeptide consisting of an amino acid sequence having substitution, deletion, or addition of one or several amino acids in the amino acid sequence as shown in SEQ ID NO: 32 (wherein the addition of amino acids is limited to addition to the N terminal side); (m) a polynucleotide encoding a polypeptide consisting of an amino acid sequence having 90% or higher identity to the amino acid sequence as shown in SEQ ID NO: 32; (n) a polynucleotide consisting of the nucleotide sequence as shown in SEQ ID NO: 33; and (o) a polynucleotide consisting of a nucleotide sequence having 90% or higher identity to the nucleotide sequence as shown in SEQ ID NO: 33;
and more preferably a polynucleotide selected from the polynucleotides (k) and (n).
(98) Preferably, the epitope peptide of a human tumor antigen derived from SART2 can be recognized by CTLs specific for the amino acid sequence as shown in SEQ ID NO: 5.
(99) In this context, whether or not the epitope peptide can be recognized by CTL specific for the amino acid sequence as shown in SEQ ID NO: 5 can be confirmed by, for example, .sup.51Cr release assay, ELISA (e.g., measurement of IFN-) or ELISPOT assay (e.g., measurement of IFN-) using the cell of the present invention and CTLs specific for the amino acid sequence as shown in SEQ ID NO: 5.
(100) The polynucleotide encoding 1 and 2 regions of human HLA-A24 used herein may preferably be a polynucleotide selected from the following polynucleotides (f) to (j): (f) a polynucleotide encoding a polypeptide comprising the amino acid sequence as shown in SEQ ID NO: 30; (g) a polynucleotide encoding a polypeptide comprising an amino acid sequence having substitution, deletion, or addition of one or several amino acids in the amino acid sequence as shown in SEQ ID NO: 30; (h) a polynucleotide encoding a polypeptide comprising an amino acid sequence having 90% or higher identity to the amino acid sequence as shown in SEQ ID NO: 30; (i) a polynucleotide comprising the nucleotide sequence as shown in SEQ ID NO: 31; and (j) a polynucleotide comprising a nucleotide sequence having 90% or higher identity to the nucleotide sequence as shown in SEQ ID NO: 31;
and more preferably a polynucleotide selected from the polynucleotides (f) and (i).
(101) The polypeptide comprising the amino acid sequence as shown in SEQ ID NO: 30 used herein may preferably be a polypeptide comprising a 2 microglobulin added to the N terminal side, and an MHC class I 3 region added to the C terminal side of the amino acid sequence as shown in SEQ ID NO: 30, and more preferably a polypeptide consisting of the amino acid sequence as shown in SEQ ID NO: 34.
(102) The polypeptide comprising an amino acid sequence having substitution, deletion, or addition of one or several amino acids in the amino acid sequence as shown in SEQ ID NO: 30 used herein may preferably be a polypeptide comprising a 2 microglobulin added to the N terminal side, and an MHC class I 3 region added to the C terminal side of the amino acid sequence having substitution, deletion, or addition of one or several amino acids in the amino acid sequence as shown in SEQ ID NO: 30, and more preferably a polypeptide consisting of the amino acid sequence as shown in SEQ ID NO: 34.
(103) The polypeptide comprising an amino acid sequence having 90% or higher identity to the amino acid sequence as shown in SEQ ID NO: 30 used herein may preferably be a polypeptide comprising a 2 microglobulin added to the N terminal side, and an MHC class I 3 region added to the C terminal side of the amino acid sequence having 90% or higher identity to the amino acid sequence as shown in SEQ ID NO: 30, and more preferably a polypeptide consisting of the amino acid sequence as shown in SEQ ID NO: 34.
(104) The polynucleotide comprising the nucleotide sequence as shown in SEQ ID NO: 31 used herein may preferably be a polynucleotide comprising a 2 microglobulin-encoding nucleotide sequence added to the 5 terminal side, and an MHC class I 3 region-encoding nucleotide sequence added to the 3 terminal side of the nucleotide sequence as shown in SEQ ID NO: 31, and more preferably a polynucleotide consisting of the nucleotide sequence as shown in SEQ ID NO: 35.
(105) The polynucleotide comprising a nucleotide sequence having 90% or higher identity to the nucleotide sequence as shown in SEQ ID NO: 31 used herein may preferably be a polynucleotide comprising a 2 microglobulin-encoding nucleotide sequence added to the 5 terminal side, and an MHC class I 3 region-encoding nucleotide sequence added to the 3 terminal side of the nucleotide sequence having 90% or higher identity to the nucleotide sequence as shown in SEQ ID NO: 31, and more preferably a polynucleotide consisting of the nucleotide sequence as shown in SEQ ID NO: 35.
(106) The 32 microglobulin used herein refers to a protein constituting the chain of an MHC class I molecule. The 2 microglobulin used herein may be derived from a human or any non-human animal (mouse, rat, hamster, guinea pig, rabbit, pig, bovine, sheep, etc.) and is preferably human 2 microglobulin (herein, also referred to as h2M).
(107) The human 2 microglobulin used herein may be a polynucleotide selected from the following polynucleotides (i) to (iii): (i) a polynucleotide encoding a polypeptide consisting of the amino acid sequence as shown in SEQ ID NO: 36; (ii) a polynucleotide encoding a polypeptide consisting of an amino acid sequence that has substitution, deletion, or addition of one or several amino acids in the amino acid sequence as shown in SEQ ID NO: 36, and has antigen presenting capacity specific for MHC class I by forming a complex with the chain of the MHC class I; and (iii) a polynucleotide encoding a polypeptide consisting of an amino acid sequence that has 90% or higher identity to the amino acid sequence as shown in SEQ ID NO: 36 and has antigen presenting capacity specific for MHC class I by forming a complex with the chain of the MHC class I;
and preferably the polynucleotide (i).
(108) The MHC class I 3 region used herein refers to an 3 region involved in binding to a coreceptor CD8 molecule expressed on CTL surface, and transmembrane region and intracellular region located on the C termini. The MHC class I 3 region used herein may be derived from a human or any non-human animal (mouse, rat, hamster, guinea pig, rabbit, pig, bovine, sheep, etc.) and is preferably mouse MHC class I 3 region (herein, also referred to as m3).
(109) The mouse MHC class I 3 region used herein may be a polynucleotide selected from the following polynucleotides (iv) to (vi): (iv) a polynucleotide encoding a polypeptide consisting of the amino acid sequence as shown in SEQ ID NO: 37; (v) a polynucleotide encoding a polypeptide consisting of an amino acid sequence that has substitution, deletion, or addition of one or several amino acids in the amino acid sequence as shown in SEQ ID NO: 37 and has CD8 molecule binding ability; and (vi) a polynucleotide encoding a polypeptide consisting of an amino acid sequence that has 90% or higher identity to the amino acid sequence as shown in SEQ ID NO: 37 and has CD8 molecule binding ability;
and preferably the polynucleotide (iv).
(110) In one aspect of the present invention, the polynucleotide encoding 1 and 2 regions of human HLA-A24 used herein may preferably be a polynucleotide selected from the following polynucleotides (p) to (t): (p) a polynucleotide encoding a polypeptide consisting of the amino acid sequence as shown in SEQ ID NO: 34; (q) a polynucleotide encoding a polypeptide consisting of an amino acid sequence having substitution, deletion, or addition of one or several amino acids in the amino acid sequence as shown in SEQ ID NO: 34; (r) a polynucleotide encoding a polypeptide consisting of an amino acid sequence having 90% or higher identity to the amino acid sequence as shown in SEQ ID NO: 34; (s) a polynucleotide consisting of the nucleotide sequence as shown in SEQ ID NO: 35; and (t) a polynucleotide consisting of a nucleotide sequence having 90% or higher identity to the nucleotide sequence as shown in SEQ ID NO: 35;
and more preferably a polynucleotide selected from the polynucleotides (p) and (s).
(111) Preferably, 1 and 2 regions encoded by the polynucleotide encoding 1 and 2 regions of human HLA-A24 can present a polypeptide consisting of the amino acid sequence as shown in SEQ ID NO: 5 as an antigen. Preferably, these regions can present a polypeptide consisting of the amino acid sequence as shown in SEQ ID NO: 5 as an antigen and have CD8 molecule binding ability. Preferably, these regions can present a polypeptide consisting of the amino acid sequence as shown in SEQ ID NO: 5 as an antigen and have CD8 molecule binding ability, and the 2 microglobulin has preferably antigen presenting ability specific for MHC class I by forming a complex with the chain of the MHC class I.
(112) Whether or not a cell has these functions can be confirmed by, for example, .sup.51Cr release assay, ELISA (e.g., measurement of IFN-) or ELISPOT assay (e.g., measurement of IFN-) using the cell of the present invention and CTL specific for the amino acid sequence as shown in SEQ ID NO: 5.
(113) Host cells for use in establishment of the cell of the present invention are preferably an animal-derived cell line and are capable of forming a tumor when transplanted to an animal. More preferably, host cells are a mouse-derived cell line and are capable of forming a tumor when transplanted to a mouse. The tumor formed by the host cells is not limited and is preferably, for example, solid tumor such as melanoma or lymphoma, because growth and regression, etc. of the tumor are easily evaluated. The host cells are preferably B16F10 cells.
(114) A vector for introducing a polynucleotide encoding an epitope peptide of a human tumor antigen derived from SART2 and a polynucleotide encoding 1 and 2 regions of human HLA-A24 to the host cells for use in establishment of the cell of the present invention is not particularly limited as long as the vector is replicable in the host cells. The vector can be appropriately selected according to the type of the host cells for introduction, an introduction method, etc. Examples thereof include plasmid DNA vectors and virus vectors. Examples of the plasmid DNA vectors include pCMV6 (OriGene Technologies, Inc.), piggyBac Transposon Vector (System Biosciences, LLC.), pCAG (FUJIFILM Wako Pure Chemical Corp.), and pcDNA3.1 (Thermo Fisher Scientific Inc.). Examples of the virus vectors include pMX (Cell Biolabs, Inc.), pLVSIN (Takara Bio Inc.), pAAV (Takara Bio Inc.), and pAdenoX (Clontech Laboratories, Inc.).
(115) The host cell can be transformed with the vector by use of lipofection, electroporation, or the like. The obtained transformant can be cultured under adequate conditions using a medium containing an assimilable carbon source, nitrogen source, metal salt, vitamin, etc.
(116) Whether or not the cell is a cell into which a polynucleotide encoding an epitope peptide of a human tumor antigen derived from SART2 and a polynucleotide encoding 1 and 2 regions of human HLA-A24 have been introduced can be confirmed, for example, by using methods for detecting expression of a polynucleotide encoding an epitope peptide of a human tumor antigen or the encoded polypeptide, and a polynucleotide encoding 1 and 2 regions of human HLA-A24 or the encoded polypeptide, and using the expression as an index.
(117) The method for detecting expression of a polynucleotide encoding an epitope peptide of a human tumor antigen derived from SART2 can employ, as a primer, for example, a polypeptide specifically hybridizing to the polynucleotide as shown in SEQ ID NO: 29 or SEQ ID NO: 33 including a polynucleotide encoding PEP5, or a polynucleotide consisting of a nucleotide sequence complementary to the polynucleotide as shown in SEQ ID NO: 29 or SEQ ID NO: 33, and a detection method commonly used such as Northern blotting, Southern blotting, RT-PCR, real-time PCR, digital PCR, DNA microarray technique, in situ hybridization, or sequencing can be used.
(118) The method for detecting expression of a polynucleotide encoding 1 and 2 regions of human HLA-A24 can employ, as a primer, for example, a polynucleotide specifically hybridizing to the polynucleotide as shown in SEQ ID NO: 31 or SEQ ID NO: 35 including a polynucleotide encoding the amino acid sequences of the 1 and 2 regions of human HLA-A24, or a polynucleotide consisting of a nucleotide sequence complementary to the polynucleotide as shown in SEQ ID NO: 31 or SEQ ID NO: 35, and the detection method commonly used as described above can be used.
(119) Such primer is produced by a commonly known method, as a polynucleotide specifically hybridizing to the polynucleotide as shown in SEQ ID NO: 29 or SEQ ID NO: 33 or a polynucleotide consisting of a nucleotide sequence complementary to the polynucleotide as shown in SEQ ID NO: 29 or SEQ ID NO: 33. Also, such primer is produced by a commonly known method, as a polynucleotide specifically hybridizing to the polynucleotide as shown in SEQ ID NO: 31 or SEQ ID NO: 35 or a polynucleotide consisting of a nucleotide sequence complementary to the polynucleotide as shown in SEQ ID NO: 31 or SEQ ID NO: 35. The number of nucleotides in such primer is 10 to 50 nucleotides, preferably 10 to 40 nucleotides, and more preferably 10 to 30 nucleotides.
(120) The primer does not have to be completely complementary as long as the primer specifically hybridizes to the polynucleotide as shown in SEQ ID NO: 29 or SEQ ID NO: 33 or a polynucleotide consisting of a nucleotide sequence complementary to the polynucleotide as shown in SEQ ID NO: 29 or SEQ ID NO: 33, or the polynucleotide as shown in SEQ ID NO: 31 or SEQ ID NO: 35 or a polynucleotide consisting of a nucleotide sequence complementary to the polynucleotide as shown in SEQ ID NO: 31 or SEQ ID NO: 35. Such a primer is a polynucleotide having 70% or higher, preferably 80% or higher, more preferably 90% or higher, more preferably 95% or higher, more preferably 98% or higher identity, to the corresponding nucleotide sequence, and a completely complementary polynucleotide is most preferable.
(121) The primer for use in the method for detecting expression of a polynucleotide encoding an epitope peptide of a human tumor antigen derived from SART2 is preferably the primer set as shown in SEQ ID NO: 42 and SEQ ID NO: 43.
(122) A detection method commonly used such as ELISA, Western blotting, flow cytometry, or immunohistochemical staining, for example, using an antibody specifically binding to the polypeptide as shown in SEQ ID NO: 5 can be used as the method for detecting expression of a polypeptide encoding an epitope peptide of a human tumor antigen derived from SART2. Flow cytometry is preferable. The antibody specifically binding to the polypeptide as shown in SEQ ID NO: 5 may be commercially available, or may be prepared by a commonly known method.
(123) A detection method commonly used such as ELISA, Western blotting, flow cytometry, or immunohistochemical staining, for example, using an antibody specifically binding to the polypeptide as shown in SEQ ID NO: 30 or SEQ ID NO: 34 including HLA-A24 1 and 2 regions can be used as the method for detecting expression of a polypeptide encoding 1 and 2 regions of human HLA-A24. Flow cytometry is preferable. The antibody specifically binding to the polypeptide as shown in SEQ ID NO: 30 or SEQ ID NO: 34 may be commercially available, or may be prepared by a commonly known method. Examples of commercially available antibody include anti-human HLA-A,B,C Antibody (Clone: W6/32, BioLegend, Inc.), Anti-HLA-A24 (Human) mAb (Clone: 22E1, MBL), and Anti-HLA A antibody (Clone: EP1395Y, Abcam plc), with anti-human HLA-A,B,C Antibody (Clone: W6/32, BioLegend, Inc.) being preferable. When such antibody is, for example, anti-human HLA-A,B,C Antibody (Clone: W6/32, BioLegend, Inc.), its labeled form such as a PE-labeled form, PE anti-human HLA-A,B,C Antibody (Clone: W6/32, BioLegend, Inc.) or an FITC-labeled form, FITC anti-human HLA-A,B,C Antibody (Clone: W6/32, BioLegend, Inc.) is also included in anti-human HLA-A,B,C Antibody (Clone: W6/32, BioLegend, Inc.).
(124) For enabling in vivo evaluation, it is preferable that the cell of the present invention should form tumor in a non-immunodeficient non-human animal when transplanted to the non-immunodeficient non-human animal, and should not spontaneously regress. The cell can be confirmed not to spontaneously regress, by subcutaneously transplanting the cell of the present invention to, for example, a human HLA-A24 gene knock-in mouse (International Publication No. WO 2015/056774), and measuring a tumor size. It is preferable that the tumor size should not be reduced (the tumor size should be increased) for at least 20 days or longer after transplantation of the cell of the present invention to a non-immunodeficient non human animal. If the absence of regression of transplanted cells (increased tumor size) is confirmed in a drug non-administration group (control group) in an in vivo test period, the cells may be included in the cell of the present invention even if a period without spontaneous regression is shorter than 20 days.
(125) In the present invention, the term non-immunodeficient in the non-immunodeficient non-human animal refers to having the inherent immune system or modified immune system of the animal. Thus, such non-immunodeficient animal excludes immunodeficient animals such as nude mice. The non-human animal is not particularly limited as long as the animal has 2 microglobulin loci and a foreign gene can be introduced thereto. A rodent is preferable, and a mouse or a rat is more preferable. A mouse is particularly preferable from the viewpoint of rearing and experimental operation.
(126) The present invention also relates to the cell of the present invention for evaluating the antitumor effect of an epitope peptide of a human tumor antigen derived from SART2.
(127) The present invention also relates to the cell of the present invention for evaluating the antitumor effect of a peptide having 4 linked epitopes and/or an immune checkpoint modulator.
(128) The present invention also relates to a method for evaluating the antitumor effect of an epitope peptide of a human tumor antigen derived from SART2 using the cell of the present invention. The method is preferably performed using a human HLA-A24 gene knock-in non-immunodeficient non-human animal to which the cell of the present invention has been transplanted. In this context, the human HLA-A24 gene knock-in non-immunodeficient non human animal can be a non-immunodeficient non-human animal having 1 and 2 regions of human HLA-A24 and is preferably a human HLA-A24 gene knock-in mouse (B2m.sup.tm2(HLA-A24/H-2Db/B2M)Tai mouse) disclosed in International Publication No. WO 2015/056774.
(129) In this method, the number of the cells of the present invention to be transplanted can be appropriately selected, and is preferably 110.sup.5 to 110.sup.7 cells/body, more preferably 110.sup.5 to 510.sup.5 cells/body, and more preferably 510.sup.5 cells/body, for a human HLA-A24 gene knock-in mouse (B2m.sup.tm2(HLA-A24/H-2Db/B2M)Tai mouse). In the method, the amount of the epitope peptide of a human tumor antigen derived from SART2 administered per dose can be appropriately selected, and is preferably 10 to 1000 g/body, more preferably 100 to 1000 g/body, and more preferably 300 g/body, for a human HLA-A24 gene knock-in mouse (B2m.sup.tm2(HLA-A24/H-2Db/B2M)Tai mouse).
(130) Evaluation of the antitumor effect of epitope peptides of a human tumor antigen derived from SART2 using the cell of the present invention can be performed by a method comprising the following steps.
(131) Specifically, the method can be performed by a method comprising the steps of: (I) administering an epitope peptide of a human tumor antigen derived from SART2 to a human HLA-A24 gene knock-in non-immunodeficient non-human animal; and (II) transplanting the cell of the present invention to the human HLA-A24 gene knock-in non-immunodeficient non-human animal.
(132) Preferably, the method is a method comprising the following steps (I) and (II): (I) a step of administering an epitope peptide of a human tumor antigen derived from SART2 to a human HLA-A24 gene knock-in mouse; and (II) a step of transplanting the cell of the present invention to the human HLA-A24 gene knock-in mouse.
(133) More preferably, the method is a method comprising the following steps (I) and (II): (I) a step of administering twice or more an epitope peptide of a human tumor antigen derived from SART2 to a human HLA-A24 gene knock-in mouse; and (II) a step of transplanting the cell of the present invention to the human HLA-A24 gene knock-in mouse after the step (I).
(134) More preferably, the method is a method comprising the following steps (I) and (II): (I) a step of administering three times or more an epitope peptide of a human tumor antigen derived from SART2 to a human HLA-A24 gene knock-in mouse; and (II) a step of transplanting the cell of the present invention to the human HLA-A24 gene knock-in mouse after the step (I).
(135) The present invention also relates to a method for evaluating the antitumor effect of a peptide having 4 linked epitopes and/or an immune checkpoint modulator using the cell of the present invention. The method is preferably performed using a human HLA-A24 gene knock-in non-immunodeficient non-human animal to which the cell of the present invention has been transplanted. In this context, the human HLA-A24 gene knock-in non-immunodeficient non-human animal can be a non-immunodeficient non-human animal having 1 and 2 regions of human HLA-A24 and is preferably a human HLA-A24 gene knock-in mouse (B2m.sup.tm2(HLA-A24/H-2Db/B2M)Tai mouse) disclosed in International Publication No. WO 2015/056774.
(136) In this method, the number of the cells of the present invention to be transplanted can be appropriately selected, and is preferably 110.sup.5 to 110.sup.7 cells/body, more preferably 110.sup.5 to 510.sup.5 cells/body, and more preferably 510.sup.5 cells/body, for a human HLA-A24 gene knock-in mouse (B2m.sup.tm2(HLA-A24/H-2Db/B2M)Tai mouse). In the method, the amount of the peptide having 4 linked epitopes administered per dose can be appropriately selected, and is preferably 10 to 1000 g/body, more preferably 100 to 1000 g/body, and more preferably 300 g/body, for a human HLA-A24 gene knock-in mouse (B2m.sup.tm2(HLA-A24/H-2Db/B2M)Tai mouse). In the method, the amount of the immune checkpoint modulator administered per dose can be appropriately selected, and is preferably 10 to 1000 g/body, more preferably 30 to 500 g/body, and more preferably 50 to 200 g/body, for a human HLA-A24 gene knock-in mouse (B2m.sup.tm2(HLA-A24/H-2Db/B2M)Tai mouse).
(137) The method for evaluating the antitumor effect of a peptide having 4 linked epitopes and/or an immune checkpoint modulator using the cell of the present invention can comprise the following steps.
(138) Specifically, the method can be performed by a method comprising the steps of: (I) administering the peptide having 4 linked epitopes and/or the immune checkpoint modulator to a human HLA-A24 gene knock-in non-immunodeficient non-human animal; and (II) transplanting the cell of the present invention to the human HLA-A24 gene knock-in non-immunodeficient non-human animal.
(139) Preferably, the method is a method comprising the following steps (I) and (II): (I) a step of administering the peptide having 4 linked epitopes and/or the immune checkpoint modulator to a human HLA-A24 gene knock-in mouse; and (II) a step of transplanting the cell of the present invention to the human HLA-A24 gene knock-in mouse.
(140) More preferably, the method is a method comprising the following steps (I) and (II): (I) a step of administering twice or more the peptide having 4 linked epitopes to a human HLA-A24 gene knock-in mouse; and (II) a step of transplanting the cell of the present invention to the human HLA-A24 gene knock-in mouse after the step (I).
(141) More preferably, the method is a method comprising the following steps (I) to (III): (I) a step of administering three times or more the peptide having 4 linked epitopes to a human HLA-A24 gene knock-in mouse; (II) a step of transplanting the cell of the present invention to the human HLA-A24 gene knock-in mouse after the step (I); and (III) a step of administering the immune checkpoint modulator to the human HLA-A24 gene knock-in mouse after the step (I).
(142) In the method of the present invention, evaluation of the antitumor effect of the peptide having 4 linked epitopes can be performed by a method comprising the following steps.
(143) Specifically, the method can be performed by a method comprising the steps of: (I) administering the peptide having 4 linked epitopes to a human HLA-A24 gene knock-in non-immunodeficient non-human animal; and (II) transplanting the cell of the present invention to the human HLA-A24 gene knock-in non-immunodeficient non-human animal.
(144) Preferably, the method is a method comprising the following steps (I) and (II): (I) a step of administering the peptide having 4 linked epitopes to a human HLA-A24 gene knock-in mouse; and (II) a step of transplanting the cell of the present invention to the human HLA-A24 gene knock-in mouse.
(145) More preferably, the method is a method comprising the following steps (I) and (II): (I) a step of administering twice or more the peptide having 4 linked epitopes to a human HLA-A24 gene knock-in mouse; and (II) a step of transplanting the cell of the present invention to the human HLA-A24 gene knock-in mouse after the step (I).
(146) More preferably, the method is a method comprising the following steps (I) and (II): (I) a step of administering three times or more the peptide having 4 linked epitopes to a human HLA-A24 gene knock-in mouse; and (II) a step of transplanting the cell of the present invention to the human HLA-A24 gene knock-in mouse after the step (I).
(147) In the present invention, evaluation of the antitumor effect of the immune checkpoint modulator can be performed by a method comprising the following steps.
(148) Specifically, the method can be performed by a method comprising the steps of: (I) administering the immune checkpoint modulator to a human HLA-A24 gene knock-in non-immunodeficient non-human animal; and (II) transplanting the cell of the present invention to the human HLA-A24 gene knock-in non-immunodeficient non-human animal.
(149) Preferably, the method is a method comprising the following steps (I) and (II): (I) a step of administering the immune checkpoint modulator to a human HLA-A24 gene knock-in mouse; and (II) a step of transplanting the cell of the present invention to the human HLA-A24 gene knock-in mouse.
(150) More preferably, the method is a method comprising the following steps (I) and (II): (I) a step of administering the immune checkpoint modulator to a human HLA-A24 gene knock-in mouse; and (II) a step of transplanting the cell of the present invention to the human HLA-A24 gene knock-in mouse on the same day as that of the step (I).
(151) In the present invention, evaluation of the antitumor effects of the peptide having 4 linked epitopes and the immune checkpoint modulator can be performed by a method comprising the following steps.
(152) Specifically, the method can be performed by a method comprising the steps of: (I) administering the peptide having 4 linked epitopes and the immune checkpoint modulator to a human HLA-A24 gene knock-in non-immunodeficient non-human animal; and (II) transplanting the cell of the present invention to the human HLA-A24 gene knock-in non-immunodeficient non-human animal.
(153) Preferably, the method is a method comprising the following steps (I) and (II): (I) a step of administering the peptide having 4 linked epitopes and the immune checkpoint modulator to a human HLA-A24 gene knock-in mouse; and (II) a step of transplanting the cell of the present invention to the human HLA-A24 gene knock-in mouse.
(154) More preferably, the method is a method comprising the following steps (I) and (II): (I) a step of administering twice or more the peptide having 4 linked epitopes to a human HLA-A24 gene knock-in mouse; and (II) a step of transplanting the cell of the present invention to the human HLA-A24 gene knock-in mouse after the step (I).
(155) More preferably, the method is a method comprising the following steps (I) to (III): (I) a step of administering three times or more the peptide having 4 linked epitopes to a human HLA-A24 gene knock-in mouse; (II) a step of transplanting the cell of the present invention to the human HLA-A24 gene knock-in mouse after the step (I); and (III) a step of administering the immune checkpoint modulator to the human HLA-A24 gene knock-in mouse after the step (I).
(156) The method of the present invention described above may comprise the step of evaluating the antitumor effect of the peptide having 4 linked epitopes and/or the immune checkpoint modulator after the steps described above. The antitumor effect can be evaluated by using, for example, suppression of tumor growth of transplanted cells in an animal, regression and disappearance of the tumor, or increase in survival rate as an index.
(157) The antitumor effect of the epitope peptide of a human tumor antigen derived from SART2 and the antitumor effect of the peptide having 4 linked epitopes can be evaluated, for example, by using a human HLA-A24 gene knock-in mouse, subcutaneously administering three times the epitope peptide of a human tumor antigen derived from SART2 or the peptide having 4 linked epitopes to the mouse, then subcutaneously transplanting the cell of the present invention to the mouse, and measuring a tumor size to confirm whether or not the antitumor effect is observed.
(158) The antitumor effect of the immune checkpoint modulator can be evaluated, for example, by using a human HLA-A24 gene knock-in mouse, intravenously or intraperitoneally administering the immune checkpoint modulator to the mouse on the same day as that of transplantation of the cell of the present invention, and measuring a tumor size to confirm whether or not the antitumor effect is observed.
EXAMPLES
(159) Next, the present invention will be described in more detail with reference to Examples. However, the present invention is not limited by these examples by any means. Those having an ordinary knowledge in the art could make various changes or modification without departing from the technical idea of the present invention.
(160) For easier understanding of the present invention, SEQ ID NOs: 29 to 43 described herein are explained in Table 3 below.
(161) TABLE-US-00005 TABLE 3 Nucleotide sequence of SART2-93 SEQ ID NO: 29 Amino acid sequence of HLA-A24 1 and 2 regions SEQ ID NO: 30 Nucleotide sequence of HLA-A24 1 and 2 regions SEQ ID NO: 31 Amino acid sequence of signal sequence + SART2-93 SEQ ID NO: 32 Nucleotide sequence of signal sequence + SART2-93 SEQ ID NO: 33 Amino acid sequence of h2M-HLA-A24 1 and 2 regions-m3 SEQ ID NO: 34 Nucleotide sequence of h2M-HLA-A24 1 and 2 regions-m3 SEQ ID NO: 35 Amino acid sequence of human 2 microglobulin (except for signal SEQ ID NO: 36 sequence) Amino acid sequence of mouse MHC class I 3 region SEQ ID NO: 37 Sense primer for h2M-HLA-A24 1 + 2-m3 amplification SEQ ID NO: 38 Antisense primer for h2M-HLA-A24 1 + a2-m3 amplification SEQ ID NO: 39 Antisense primer for signal sequence + SART2-93 introduction SEQ ID NO: 40 Sense primer for signal sequence + SART2-93 introduction SEQ ID NO: 41 Sense primer for signal sequence + SART2-93 detection SEQ ID NO: 42 Antisense primer for signal sequence + SART2-93 detection SEQ ID NO: 43
Example 1 Peptide Synthesis and Purification
(162) Peptides TPV07 and TPV08 having 4 linked epitopes were synthesized using an automated peptide synthesizer Prelude (Protein Technologies, Inc.) by the solid-phase synthesis method based on the 9-fluorenylmethyl-oxycarbonyl (Fmoc) method. Specifically, an amino acid with its a-amino group protected with a Fmoc group and its side chain functional group protected with a general protective group was condensed onto Wang ChemMatrix resin under 1-(mesithylene-2-sulfonyl)-3-nitro-1,2,4-triazole/Nmethylimidazole/dichloromethane conditions, to complete supporting of a C terminal amino acid onto the resin. A deblocking solution (20% piperidine/N,N-dimethylformamide (DMF)) was injected thereinto, to remove the Fmoc group. Then, an amino acid with its a-amino group protected with a Fmoc group and its side chain functional group protected with a general protective group was condensed thereonto under 1-[bis (dimethylamino) methylene]-5-chloro-IH-benzo-triazolium 3-oxide hexafluorophosphate (HCTU)/N-methylmorpholine (NMM)/DMF conditions, to synthesize a dipeptide. By repeating the procedures of deprotecting the Fmoc group with a deblocking solution and condensing an amino acid under HCTU/NMM/DMF conditions, peptides comprising sequences of interest were synthesized. After completion of synthesis of protected peptide resin, removal of protective groups on the peptide side chains as well as excision of free peptides from the resin were performed by conducting a reaction for 4 hours in a deprotective solution (2.5% triisopropylsilane, 2.5% water, 2.5% 1,2-ethanedithiol, 92.5% trifluoroacetic acid) added to the protected peptide resin. The resin was filtered off, and with the addition of the resulting filtrate to cold ether, peptides were recovered in the form of precipitates. The resulting various synthetic peptides were purified using the Proteonavi column (Shiseido Japan Co., Ltd.) and a solvent system with an aqueous solution of 0.1% TF A and acetonitrile. After the final process of purification, the purity of the peptides was confirmed by the CAPCELL PAK UG120 column (Shiseido Japan Co., Ltd.) and the HPLC system (Hitachi, Ltd.). The molecular weight was also confirmed by the ESI-MS system (Synapt HDMS, Waters Corp.). The peptides were lyophilized, stored at cool temperature in the dark, and then subjected to the examples described below.
(163) Table 4 shows the molecular weights of TPV07 and TPV08 measured by mass spectrometry (MS).
(164) TABLE-US-00006 TABLE 4 Molecular weight Molecular weight Peptide (Calculated) (Deconvoluted) TPV07 5396.03 5395.20 TPV08 5682.41 5682.00
(165) TPV01 to TPV06, TPV09 and TPV10 may be synthesized in accordance with the method described in, for example, International Publication No. WO 2015/060235, or may be synthesized in the same manner as the method for synthesizing TPV07 and TPV08 as described above. All the peptides were obtained with purity of 90% or more.
Example 2 Establishment of B16F10.A24/SART2.SUP.93-101 .Cell Line and EL4.A24/SART2.SUP.93-101 .Cell Line
(166) B2m.sup.tm2(HLA-A24/H-2Db/B2M)Tai mice were prepared by the method described in Example 8 of International Publication No. WO 2015/056774. This mouse can express an artificial chimeric protein comprising a human 2 microglobulin, HLA-A24 1 and 2 regions, and a mouse MHC class I 3 region linked to each other.
(167) The spleen was harvested from the obtained mouse, ground with slide glass, and then hemolyzed using BD Pharm Lyse (BD Bioscience) to prepare a single-cell suspension. RNA was extracted from the obtained single-cell suspension using RNeasy kit (Qiagen N.V.). Specifically, after addition of 350 L of Buffer RLT to 110.sup.6 cells, the mixture was added to QIAshredder spin column (Qiagen N.V.) and centrifuged (15000 rpm, 2 min), and a flow-through fraction was recovered. After addition of 350 L of an aqueous solution of 70% ethanol to the recovered RNA solution, the mixture was added to RNeasy Mini column and centrifuged (10000 rpm, 15 sec). The column was further washed with 350 L of Buffer RW1 and then treated with DNase using RNase-Free DNase set (Qiagen N.V.). The column was washed with 350 L of Buffer RW1, followed by RNA purification according to the protocol of RNeasy Mini Kit. 30 L of RNase Free H.sub.2O was added to the RNA thus purified, to recover total RNA.
(168) cDNA was synthesized from the obtained total RNA using Superscript III First-Strand Synthesis System for RT-PCR (Thermo Fisher Scientific Inc.). Specifically, 2 g of the total RNA was suspended in 8 L of purified water. 1 L of oligo (dT).sub.20 and 1 L of 10 mM dNTP were added to the suspension, and the mixture was incubated at 65 C. for 5 minutes. After cooling for 2 minutes on ice, 2 L of 10RT buffer, 1 L of 25 mM MgCl.sub.2, 2 L of 0.1 M DTT, 1 L of RNaseOUT (40 U/L), and 1 L of SuperScript III RT were added thereto and mixed. The mixture was incubated at 50 C. for 50 minutes and then treated at 85 C. for 5 minutes, to terminate the reaction.
(169) A polynucleotide encoding the artificial chimeric protein described above having the sequence as shown in SEQ ID NO: 35 was obtained by conducting PCR (94 C. for 2 min.fwdarw.30 cycles each involving 94 C. for 30 sec, 55 C. for 30 sec, and 68 C. for 2 min.fwdarw.68 C. for 2 min.fwdarw.4 C.) using the synthesized cDNA as a template, Primer 1
(170) TABLE-US-00007 (TCAAGCTTAACTAGCATGGCCGTCATGGC:SEQIDNO:38)
as a sense primer, Primer 2
(171) TABLE-US-00008 (TTAAACCTCGAGTGCTCACGCTTTACAATCTCGGAGAGA: SEQIDNO:39)
as an antisense primer, and KOD-Plus-ver. 2 (Toyobo Co., Ltd.). The amplified polynucleotide was inserted to PiggyBac Transposon Vector (System Biosciences, LLC.) using InFusion HD Cloning Kit (Clontech Laboratories, Inc.) to obtain plasmid vector A having the sequence of SEQ ID NO: 35.
(172) Subsequently, in order to obtain a polynucleotide encoding PEP5, PCR (25 cycles each involving 98 C. for 10 sec, 55 C. for 15 sec, and 68 C. for 6 min.fwdarw.68 C. for 3 min.fwdarw.4 C.) was conducted using the plasmid vector A having the sequence of SEQ ID NO: 35 thus obtained as a template, Primer 3
(173) TABLE-US-00009 (CTCAAATTTCATTCCAGCGGGCACTGTAGTCTGCCCAGGTCTGGGT: SEQIDNO:40)
as an antisense primer, Primer 4
(174) TABLE-US-00010 (GCAGACTACAGTGCCCGCTGGAATGAAATTTGAGCACTCGAGGTTTA A:SEQIDNO:41)
as a sense primer, and PrimeSTAR GXL DNA Polymerase (Takara Bio Inc.). As a result, plasmid vector B having the nucleotide sequence as shown in SEQ ID NO: 33 including a nucleotide sequence encoding a signal sequence and PEP5 within the PiggyBac Transposon Vector was obtained.
(175) The thus prepared plasmid vectors A and B, together with Super PiggyBac Transposase Expression Vector (System Biosciences, LLC.) were introduced into a mouse melanoma cell line B16F10 (American Type Culture Collection, ATCC), using Lipofectamine LTX Reagent with PLUS Reagent (Thermo Fisher Scientific Inc.). Single-clone cells were obtained from the cells thus transfected by use of the limiting dilution technique.
(176) The plasmid vectors A and B prepared as described above and Super PiggyBac Transposase Expression Vector (System Biosciences, LLC.) were also introduced into a mouse lymphoma cell line EL4 (ATCC) using Cell line Nucleofector Kit L (Lonza Group AG) and Nucleofector Device (Lonza Group AG). Single-clone cells were obtained from the cells thus transfected by use of the limiting dilution technique.
(177) The obtained single-clone cells were recovered, and RNA was extracted therefrom using RNeasy kit (Qiagen N.V.). Specifically, after addition of 350 L of Buffer RLT to 510.sup.5 cells, the mixture was added to QIAshredder spin column (Qiagen N.V.) and centrifuged (15000 rpm, 2 min), and a flow-through fraction was recovered. After addition of 350 L of an aqueous solution of 70% ethanol to the recovered RNA solution, the mixture was added to RNeasy Mini column and centrifuged (10000 rpm, 15 sec). The column was further washed with 350 L of Buffer RW1 and then treated with DNase using RNase-Free DNase set (Qiagen N.V.). The column was washed with 350 L of Buffer RW1, followed by RNA purification according to the protocol of RNeasy Mini Kit. 30 L of RNase Free H.sub.2O was added to the RNA thus purified, to recover total RNA.
(178) cDNA was synthesized from the obtained RNA using SuperScript VILO cDNA Synthesis Kit (Thermo Fisher Scientific Inc.). Specifically, 2 g of the total RNA was suspended in 14 L of DPEC-treated water and mixed with 4 L of 5VILO Reaction Mix and 2 L of 10 SuperScript Enzyme Mix. The mixture was incubated at 25 C. for 10 minutes and at 42 C. for 60 minutes and then treated at 85 C. for 5 minutes, to terminate the reaction.
(179) In order to confirm expression of the polynucleotide encoding PEP5 in the obtained single-clone cells, PCR (94 C. for 2 min.fwdarw.30 cycles each involving 98 C. for 10 sec, 55 C. for 30 sec, and 68 C. for 30 sec.fwdarw.68 C. for 1 min.fwdarw.4 C.) was conducted using the synthesized cDNA as a template, Primer 5
(180) TABLE-US-00011 (ATGGCCGTCATGGC:SEQIDNO:42)
as a sense primer, Primer 6
(181) TABLE-US-00012 (TCAAATTTCATTCCAGCG:SEQIDNO:43)
as an antisense primer, and KOD-Plus-ver. 2 (Toyobo Co., Ltd.), and amplification of the polynucleotide sequence as shown in SEQ ID NO: 33 was confirmed by agarose gel electrophoresis. The amplification of the polynucleotide having the sequence as shown in SEQ ID NO: 33 could not be confirmed in B16F10 and EL4 cells without gene introduction, whereas the amplification of the polynucleotide having the sequence as shown in SEQ ID NO: 33 could be confirmed in the obtained single clones. Thus, PEP5-expressing cells were confirmed to be obtained by the introduction of the plasmid vector B.
(182) In order to analyze expression of an HLA molecule in the obtained single-clone cells, the cells were stained with PE Anti-human HLA-A,B,C Antibody (Clone: W6/32, BioLegend, Inc.). The cells thus stained were analyzed using BD FACSVerse (BD Biosciences). As a result, elevation in fluorescence intensity caused by the antibody staining could not be confirmed in B16F10 and EL4 cells without gene introduction, whereas elevation in fluorescence intensity caused by the antibody staining could be confirmed in the obtained single clones. Thus, HLA-A24-expressing cells were confirmed to be obtained by the introduction of the plasmid vector A.
(183) Specifically, the obtained cells were confirmed to be cells expressing HLA-A24 and also expressing PEP5 (B16F10.A24/SART2.sup.93-101 cells and EL4.A24/SART2.sup.93-101 cells).
Example 3 Confirmation of Engraftment of B16F10.A24/SART2.SUP.93-101 .Cell Line and EL4.A24/SART2.SUP.93-101 .Cell Line
(184) The B16F10.A24/SART2.sup.93-101 cell line and the EL4.A24/SART2.sup.93-101 cell line obtained in Example 2 were cultured using Dulbecco's Modified Eagle's Medium (Sigma-Aldrich Co. LLC.) containing 10% FBS. For passages, the cells were subcultured at a ratio of 1:25 to 1:40 twice a week at 37 C. in a 5% CO.sub.2 incubator.
(185) The B16F10.A24/SART2.sup.93-101 cell line or the EL4.A24/SART2.sup.93-101 cell line was subcutaneously transplanted at 110.sup.5 cells/0.1 mL to the right flank region of each 9- to 11-week-old B2 m.sup.tm2(HLA-A24/H-2Db/B2M)Tai mouse.
(186) The major axis and minor axis of tumor were measured using Digimatic calipers from 7 days after transplantation, and a tumor volume (TV) was calculated according to the following formula.
TV (mm.sup.3)=Major axis (mm)Minor axis (mm)Minor axis (mm)/2
(187) The results are shown in
(188) As shown in
Example 4 Effect of TPV06 and Anti-Mouse PD-1 Antibody Used m Combination in B16F10.A24/SART2.SUP.93-101 .Cell Line Subcutaneously Transplanted Model
(189) 8-week-old B2m.sup.tm2(HLA-A24/H-2Db/B2M)Tai mice were randomly assigned to groups each involving 15 animals. The day of grouping was defined as Day 0. A 6 mg/mL peptide solution was prepared by dissolving a peptide having 4 linked epitopes TPV06 in distilled water (Otsuka Pharmaceutical Factory Inc.), and filled into the B Braun Injekt syringe (B. Braun Melsungen AG). After the equivalent amount of Montanide ISA 51 VG (SEPPIC) was filled into another syringe, these syringes were connected to each other via a connector, and the peptide solution was thoroughly mixed with Montanide ISA 51 VG to prepare an emulsion. Also, an emulsion of distilled water mixed with the equivalent amount of Montanide ISA 51 VG was prepared as a vehicle control. Each of these emulsions was subcutaneously administered weekly in amounts of 100 L each in the vicinity of base of tail of each B2m.sup.tm2(HLA-A24/H-2Db/B2M)Tai mouse, and administrations were carried out three times in total (Days 0, 7, and 14).
(190) GoInVivo Purified anti-mouse CD279 (PD-1) (Clone: RMP-1-14, BioLegend, Inc.) was prepared as an anti-mouse PD-1 antibody (anti-mPD-1 Ab) into 1 mg/mL using D-PBS (FUJIFILM Wako Pure Chemical Corp.) immediately before administration. One week after final administration of the emulsions (Day 21), the anti-mouse PD-1 antibody was intraperitoneally administered at 100 g/body.
(191) The B16F10.A24/SART2.sup.93-101 cell line was cultured using Dulbecco's Modified Eagle's Medium (Sigma-Aldrich Co. LLC.) containing 10% FBS. B16F10.A24/SART2.sup.93-101 was subcultured at a ratio of 1:25 to 1:40 twice a week at 37 C. in a 5% CO.sub.2 incubator.
(192) On the same day (Day 21) after administration of the anti-mouse PD-1 antibody, a cell suspension prepared using D-PBS (FUJIFILM Wako Pure Chemical Corp.) was subcutaneously transplanted at 510.sup.5 cells/0.1 mL to the right flank region of the mouse.
(193) The major axis and minor axis of tumor were measured using Digimatic calipers from 7 days after transplantation of the B16F10.A24/SART2.sup.93-101 cell line, and a tumor volume (TV) was calculated according to the following formula.
TV (mm.sup.3)=Major axis (mm)Minor axis (mm)Minor axis (mm)/2
(194) As shown in
(195) Table 5 below shows results obtained on 18 days after cell transplantation. In the table, the value of TV represents the average value of each group. A rate of relative change in tumor volume (T/C) was calculated from TV according to the following formula.
T/C(%)=(Average TV of Each Drug Administration Group)/(Average TV of the control group)100
(196) Body weight was measured using an electronic balance for animals, and a rate of change in body weight (BWC) was calculated from the body weight measured on Day 0 (the day of grouping, BW0) and the body weight on 18 days after cell transplantation (BW) according to the following formula.
Rate of change in body weight BWC (%)=(BWBW0)/BW0100
(197) The proportion of tumor-free mice (Tumor Free) on 57 days after cell transplantation was calculated according to the following formula.
Tumor Free (%)=(The number of tumor-free mice in each group)/(The number of mice used in the study in each group)100
(198) TABLE-US-00013 TABLE 5 57 days after 18 days after transplantation transplantation TV(mean SE) T/C BWC (%) Tumor Free (%) Control 1183.14 205.04 28.3 0.0 TPV06 247.45 89.16 20.9 27.0 13.3 Anti-mPD-1 Ab 703.36 141.55 59.5 26.9 0.0 TPV06 + 71.45 46.72 6.0 23.8 53.3 Anti-mPD-1 Ab
(199) On 18 days after cell transplantation, the TPV06 or anti-mouse PD-1 antibody single administration group and the TPV06+anti-mouse PD-1 antibody combined administration group had a lower value of TV than that of the control group, showing an antitumor effect. In addition, the TPV06+anti-mouse PD-1 antibody combined administration group had a lower value of TV than that of the TPV06 or anti-mouse PD-1 antibody single-drug group, showing a stronger antitumor effect. On 57 days after cell transplantation, 53.3% of the mice in the TPV06+anti-mouse PD-1 antibody combined administration group were tumor-free. In addition, the TPV06+anti-mouse PD-1 antibody combined administration group was confirmed to have an improved survival rate on 57 days after cell transplantation, as compared with the single-drug administration group.
(200) The rate of change in average body weight of the combined administration group indicated that no enhancement of toxicity was involved, as compared with the TPV06 or anti-mouse PD-1 antibody single-drug group.
Example 5 Effect of TPV06 and Anti-Mouse PD-L1 Antibody Used in Combination in B16F10.A24/SART2.SUP.93-101 .Cell Line Subcutaneously Transplanted Model
(201) 9-week-old B2m.sup.tm2(HLA-A24/H-2Db/B2M)Tai mice were randomly assigned to groups each involving 15 animals. The day of grouping was defined as Day 0.
(202) This study was conducted in the same way as in Example 4 except that an anti-mouse PD-L1 antibody was used instead of the anti-mouse PD-1 antibody. GoInVivo Purified anti-mouse CD274 (B7-H1, PD-L1) (Clone: 10F.9G2, BioLegend, Inc.) was prepared as an anti-mouse PD-L1 antibody (anti-mPD-L1 Ab) into 1 mg/mL using D-PBS (FUJIFILM Wako Pure Chemical Corp.) immediately before administration. One week after final administration of the emulsions (Day 21), the anti-mouse PD-L1 antibody was intraperitoneally administered at 200 g/body.
(203) As shown in
(204) Table 6 below shows a tumor volume, a rate of relative change in tumor volume and change in body weight (BWC) on 18 days after cell transplantation, and a proportion of tumor-free mice on 57 days after cell transplantation.
(205) TABLE-US-00014 TABLE 6 57 days after 18 days after transplantation transplantation TV(mean SE) T/C BWC (%) Tumor Free (%) Control 627.2 82.7 19 0.0 TPV06 205.8 73.9 32.8 21.9 0.0 Anti-mPD-L1 Ab 987.4 168.9 157.4 21.2 0.0 TPV06 + 17.7 14.9 2.8 20.4 66.7 Anti-mPD-L1 Ab
(206) On 18 days after cell transplantation, the TPV06 single administration group and the TPV06+anti-mouse PD-L1 antibody combined administration group had a lower value of TV than that of the control group, showing an antitumor effect. In addition, the TPV06+anti-mouse PD-L1 antibody combined administration group had a lower value of TV than that of the TPV06 or anti-mouse PD-L1 antibody single-drug group, showing a stronger antitumor effect. On 57 days after cell transplantation, 66.7% of the mice in the TPV06+anti-mouse PD-L1 antibody combined administration group were tumor-free. In addition, the TPV06+anti-mouse PD-L1 antibody combined administration group was confirmed to have an improved survival rate on 57 days after cell transplantation, as compared with the single-drug administration groups.
(207) The rate of change in average body weight in the combined administration group indicated that no enhancement of toxicity was involved, as compared with the TPV06 or anti-mouse PD-L1 antibody single-drug group.
Example 6 Effect of TPV07 or TPV08 and Anti-Mouse PD-1 Antibody Used in Combination in B16F10.A24/SART2.SUP.93-101 .Cell Line Subcutaneously Transplanted Model
(208) 9-week-old B2 m.sup.tm2(HLA-A24/H-2Db/B2M)Tai mice were randomly assigned to groups each involving 15 animals. The day of grouping was defined as Day 0.
(209) This study was conducted in the same way as in Example 4 except that TPV07 or TPV08 was used instead of TPV06 as a peptide having 4 linked epitopes. TPV07 and TPV08, as in TPV06, were each prepared into 6 mg/mL using distilled water (Otsuka Pharmaceutical Factory Inc.) and then mixed with the equivalent amount of Montanide ISA 51 VG (SEPPIC) to prepare an emulsion, which was administered. This Example did not include an anti-mouse PD-1 antibody single administration group.
(210)
(211) TABLE-US-00015 TABLE 7 56 days after 18 days after transplantation transplantation TV(mean SE) T/C BWC (%) Tumor Free (%) Control 850.8 176.6 23.1 0.0 TPV07 58.2 24.4 6.8 18.9 13.3 TPV07 + 8.6 6.8 1.0 18.6 80.0 Anti-mPD-1 Ab TPV08 129.7 67.0 15.2 21.7 6.7 TPV08 + 21.6 12.7 2.5 16.1 40.0 Anti-mPD-1 Ab
(212) As shown in
(213) As shown in Table 7, on 18 days after cell transplantation, the TPV07 or TPV08 single administration group and the TPV07+anti-mouse PD-1 antibody or TPV08+anti-mouse PD-1 antibody combined administration group had lower values of TV than that of the control group, showing an antitumor effect. In addition, the TPV07+anti-mouse PD-1 antibody combined administration group had a lower value of TV than that of the TPV07 single-drug group, showing a stronger antitumor effect. Likewise, the TPV08+anti-mouse PD-1 antibody combined administration group had a lower value of TV than that of the TPV08 single-drug group, showing a stronger antitumor effect. On 56 days after cell transplantation, 80.0% of the mice in the TPV07+anti-mouse PD-1 antibody combined administration group were tumor-free, and 40.0% of the mice in the TPV08+anti-mouse PD-1 antibody combined administration group were tumor-free. In addition, the TPV07+anti-mouse PD-1 antibody or TPV08+anti-mouse PD-1 antibody combined administration group was confirmed to have an improved survival rate on 56 days after cell transplantation, as compared with the single-drug administration group.
(214) The rate of change in average body weight in the combined administration group indicated that no enhancement of toxicity was involved, as compared with the TPV07 or TPV08 single-drug group.
Example 7 Effect of 3 Mixed Peptides Having 4 Linked Epitopes (TPV06, TPV011 and TPV012) and Anti-Mouse PD-1 Antibody Used in Combination in B16F10.A24/SART293-101 Cell Line Subcutaneously Transplanted Model
(215) 9-week-old B2 m.sup.tm2(HLA-A24/H-2Db/B2M)Tai mice were randomly assigned to groups each involving 15 animals. The day of grouping was defined as Day 0.
(216) This study was conducted in the same way as in Example 4 except that a total of 3 mixed peptides having 4 linked epitopes composed of TPV06 and other two peptides having 4 linked epitopes (TPV011 and TPV012) were used instead of TPV06. Specifically, the study was conducted with a control group, a group of 3 mixed peptides having 4 linked epitopes (TPV06, TPV011 and TPV012), an anti-mouse PD-1 antibody group and a combined administration group of 3 mixed peptides having 4 linked epitopes (TPV06, TPV011 and TPV012)+anti-mouse PD-1 antibody. The 3 mixed peptides having 4 linked epitopes (TPV06, TPV011 and TPV012) were prepared into 6 mg/mL each of TPV06, TPV011 and TPV012 (i.e., total amount of the peptides: 18 mg/mL), using distilled water (Otsuka Pharmaceutical Factory Inc.), and mixed with the equivalent amount of Montanide ISA 51 VG (SEPPIC) to prepare an emulsion, which was administered.
(217) As a result, the combined administration group of 3 mixed peptides having 4 linked epitopes (TPV06, TPV011 and TPV012)+anti-mouse PD-1 antibody was able to be confirmed to have an improved survival rate on 56 days after cell transplantation, as compared with the single administration group of the 3 mixed peptides having 4 linked epitopes (TPV06, TPV011 and TPV012) or the anti-mouse PD-1 antibody.
(218) The rate of change in average body weight in the combined administration group indicated that no enhancement of toxicity was involved, as compared with the single-drug group.
(219) All publications, patents and patent applications cited herein are incorporated herein by reference in their entirety.