SUCROSE SYNTHETASE AND USE THEREOF

20250084449 ยท 2025-03-13

    Inventors

    Cpc classification

    International classification

    Abstract

    Provided are a sucrose synthetase and the use thereof. Compared with SEQ ID NO: 11, an amino acid sequence of the sucrose synthetase contains differences in amino acid residues selected from one or more of the following residue positions: an amino acid at position 36 being V, an amino acid at position 43 being E, an amino acid at position 179 being A, an amino acid at position 395 being R, an amino acid at position 447 being P, an amino acid at position 455 being L, and an amino acid at position 654 being R; and the sucrose synthetase has an activity not lower than that of a sucrose synthetase having an amino acid sequence as shown in SEQ ID NO: 11. By means of catalyzing the synthesis of rebaudioside A, rebaudioside D or rebaudioside M by using a glucosyltransferase and the sucrose synthetase in a combined manner, a cascade reaction is achieved, thereby providing a variety of possibilities for the selection of raw materials.

    Claims

    1. A sucrose synthase, wherein an amino acid sequence of the sucrose synthase comprises differences in amino acid residues selected from one or more of the following residue positions compared to SEQ ID NO: 11: the amino acid at position 36 is V; the amino acid at position 43 is E; the amino acid at position 179 is A; the amino acid at position 395 is R; the amino acid at position 447 is P; the amino acid at position 455 is L; the amino acid at position 654 is R; and has sucrose synthase activity not lower than that of the amino acid sequence as shown in SEQ ID NO: 11.

    2. The sucrose synthase according to claim 1, wherein the amino acid sequence of the sucrose synthase has the following differences in amino acid residues compared to SEQ ID NO: 11: the amino acid at position 36 is V; or the amino acid at position 43 is E; or the amino acid at position 179 is A; or the amino acid at position 395 is R; or the amino acid at position 447 is P; or the amino acid at position 455 is L; or the amino acid at position 654 is R.

    3. An isolated nucleic acid, wherein the nucleic acid encodes the sucrose synthase according to claim 1.

    4. A recombinant expression vector comprising the nucleic acid according to claim 3.

    5. A transformant, wherein the transformant is a host cell comprising the nucleic acid according to claim 3; preferably, the host cell is Escherichia coli, for example, E. coli BL21 (DE3).

    6. A method for preparing the sucrose synthase, wherein the method comprises culturing the transformant according to claim 5 under conditions suitable for expressing the sucrose synthase.

    7. A composition comprising one or more of the sucrose synthases according to claim 1; preferably, the composition also comprises amino acid sequences as shown in SEQ ID NO: 9, 10, and/or SEQ ID NO: 11.

    8. A method for preparing a glycosyl donor, wherein the method comprises the following steps: reacting sucrose with nucleoside diphosphate in the presence of the sucrose synthase according to claim 1 to obtain the glycosyl donor; the nucleoside diphosphate is UDP, dTDP, TDP, CDP, IDP, GDP, or ADP; preferably, the method for preparing the glycosyl donor satisfies one or more of the following conditions: the sucrose synthase is present in the form of sucrose synthase bacterial cells, crude enzyme solution, purified enzyme, purified enzyme solution, or immobilized enzyme; a mass ratio of the sucrose synthase bacterial cells to sucrose is 1:(20-200), preferably 3:200; a mass ratio of the sucrose to the nucleoside diphosphate is 100:0.5 to 300:0.1; preferably 200:0.1; a concentration of the sucrose is preferably 50-300 g/L, for example, 200 g/L.

    9. A method for preparing rebaudioside D or rebaudioside M, wherein the method comprises the following steps: in the presence of one or more of the sucrose synthase according to claim 1, SEQ ID NO: 9, 10, and SEQ ID NO: 11, reacting rebaudioside A, glycosyltransferase, sucrose, and nucleoside diphosphate to obtain rebaudioside D; preferably, the method for preparing rebaudioside D satisfies one or more of the following conditions: the sucrose synthase is present in the form of sucrose synthase bacterial cells, crude enzyme solution, purified enzyme, purified enzyme solution, or immobilized enzyme; the glycosyltransferase is present in the form of a glycosyltransferase bacterial cells, crude enzyme solution, purified enzyme, purified enzyme solution, or immobilized enzyme; a concentration of the rebaudioside A is 1-150 g/L, preferably 50 g/L or 60 g/L; a concentration of the sucrose is preferably 50-300 g/L, for example, 200 g/L; preferably, a mass ratio of the sucrose synthase bacterial cells to sucrose is 1:(20-200), preferably 3:200; more preferably, a mass ratio of the glycosyltransferase bacterial cells to the rebaudioside A is (0.1-2):1, for example, 0.24:1 or 0.3:1; a reaction solvent for the reaction is water, with a pH of 5 to 8, preferably at pH 6; the pH is controlled by a buffer solution, preferably a phosphate buffer solution; a rotation speed during the reaction is 500-1000 rpm, preferably 600 rpm; a temperature of the reaction system during the reaction is 20-90 C., preferably 60 C.

    10. A method for preparing steviol glycosides by using one or more of the sucrose synthases according to claim 1, SEQ ID NO: 9, 10, and/or SEQ ID NO: 11; wherein the steviol glycoside is preferably rebaudioside A, D, or M.

    11. A transformant, wherein the transformant is a host cell comprising the recombinant expression vector according to claim 4; preferably, the host cell is Escherichia coli, for example, E. coli BL21 (DE3).

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0071] FIG. 1 presents a schematic diagram of the route for preparing rebaudioside A, D, and M from stevioside, according to one embodiment of the present disclosure

    [0072] FIG. 2 presents a chromatogram of the reference substance of the substrate rebaudioside A (with a retention time of 14.186 min).

    [0073] FIG. 3 presents a chromatogram of the reference substance of the product rebaudioside D (with a retention time of 11.821 min).

    [0074] FIG. 4 presents a chromatogram of the reference substance of the product rebaudioside M (with a retention time of 12.316 min).

    [0075] FIGS. 5A and 5B present the HPLC chromatogram of the activity of the parent enzyme Enz.8 in catalyzing the synthesis of RD (with ADP as the substrate, reaction time 30 min) in the second round of screening as listed in Table 7.

    [0076] FIGS. 6A and 6B present the HPLC chromatogram of the activity of the mutant Enz.11 in catalyzing the synthesis of RD (with ADP as the substrate, reaction time 30 min) in the second round of screening as listed in Table 7.

    [0077] FIGS. 7A and 7B present the HPLC chromatogram of the activity of the parent enzyme Enz.8 in catalyzing the synthesis of RM (reaction time 7 h) as listed in Table 8.

    [0078] FIGS. 8A and 8B present the HPLC chromatogram of the activity of Enz.11 in catalyzing the synthesis of RM (reaction time 7 h) as listed in Table 8.

    DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENT

    [0079] The present disclosure is further illustrated by way of examples, but it is not limited to the scope of these examples. Experimental methods that do not indicate specific conditions in the following examples were selected according to conventional methods and conditions, or according to the product's instruction manual.

    [0080] Unless otherwise specified, the experimental methods used in the present disclosure are conventional methods. For specific gene cloning operations, please refer to the Molecular Cloning: A Laboratory Manual by J. Sambrook et al.

    [0081] Unless otherwise specified, the abbreviations for amino acids used in the present disclosure are conventional in the field. The specific abbreviated symbols corresponding to the amino acids are shown in Table 1.

    TABLE-US-00002 TABLE 1 Names of Three-letter One-letter amino acids symbols symbols Alanine Ala A Arginine Arg R Asparagine Asn N Aspartic acid Asp D Cysteine Cys C Glutanine Gln Q Glutamic acid Glu E Glycine Gly G Histidine His H Isoleucine Ile I Leucine Leu L Lysine Lys K Methionine Met M Phenylalanine Phe F Proline Pro P Serine Ser S Threonine Thr T Tryptophan Trp W Tyrosine Tyr Y Valine Val V

    [0082] The codons corresponding to the amino acids are also conventional in the field. The specific correspondence between amino acids and codons is shown in Table 2.

    TABLE-US-00003 TABLE 2 First Third nucleo- Second nucleotide nucleo- tide T C A G tide T Phenylalanine Serine (S) Tyrosine Cysteine T (F) (Y) (C) Phenylalanine Serine (S) Tyrosine Cysteine C (F) (Y) (C) Leucine (L) Serine (S) Stop codon Stop codon A Leucine (L) Serine (S) Stop codon Tryptophan G (W) C Leucine (L) Proline Histidine Arginine T (P) (H) (R) Leucine (L) Proline Histidine Arginine C (P) (H) (R) Leucine (L) Proline Glutamine Arginine A (P) (Q) (R) Leucine (L) Proline Glutamine Arginine G (P) (Q) (R) A Isoleucine (I) Threonine Asparagine Serine (S) T (T) (N) Isoleucine (I) Threonine Asparagine Serine (S) C (T) (N) Isoleucine (I) Threonine Lysine (K) Arginine A (T) (R) Methionine Threonine Lysine (K) Arginine G (M) (T) (R) G Valine (V) Alanine Aspartic Glycine T (A) acid (D) (G) Valine (V) Alanine Aspartic Glycine C (A) acid (D) (G) Valine (V) Alanine Glutamic Glycine A (A) acid (E) (G) Valine (V) Alanine Glutamic Glycine G (A) acid (E) (G)

    [0083] KOD Mix enzyme was purchased from TOYOBO CO., LTD. DpnI enzyme was purchased from Invitrogen (Shanghai) Trading Co., Ltd. E. coli Trans10 competent cells and E. coli BL21 (DE3) competent cells were both purchased from Beijing Dingguo Changsheng Biotechnology Co., Ltd. pGro7 plasmid was purchased from Shanghai Beinuo Biotech Co., Ltd. Sucrose was purchased from Sangon Biotech (Shanghai) Co., Ltd. Reference substance of Reb A was purchased from Macklin. Reference substances of RebD and RebM were purchased from Qingdao Siyuan Stevia International Trade Co., Ltd.

    [0084] HPLC detection method for conversion rate: chromatographic column: ZORBAX Eclipse Plus C18 (4.6 mm150 mm, 3.5 m). Mobile phase: 0.1% TFA aqueous solution as mobile phase A, and 0.1% TFA acetonitrile solution as mobile phase B. Gradient elution is carried out according to Table 3 below. Detection wavelength: 210 nm; flow rate: 1 mL/min; injection volume: 20 L; column temperature: 35 C. As shown in FIG. 2, the peak time of Reb A is 14.186 min; as shown in FIG. 3, the peak time of Reb D is 11.821 min. As shown in FIG. 4, the peak time of Reb M is 12.316 min.

    TABLE-US-00004 TABLE 3 Time (min) A % B % 0.00 90 10 15.00 60 40 20.00 0 100 24.00 0 100 24.10 90 10 32.00 90 10

    Example 1: Preparation of Sucrose Synthase Enzymes in the First Round

    [0085] The whole gene synthesis of the sucrose synthase genes numbered Enz.1, Enz.2, Enz.3, Enz.4, Enz.5, Enz.6, Enz.7, and Enz.8, as shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, and SEQ ID NO: 8 listed in Table 4, was carried out. These genes were respectively inserted into the pET28a plasmid vector (restriction sites NdeI and HindIII) to obtain recombinant plasmids pET28a-Enz.1, pET28a-Enz.2, pET28a-Enz.3, pET28a-Enz.4, pET28a-Enz.5, pET28a-Enz.6, pET28a-Enz.7, and pET28a-Enz.8. And they were sequenced to verify that the genes were successfully ligated into the corresponding vectors. The gene synthesis was carried out by Sangon Biotech Co., Ltd. (located at No. 698 Xiangmin Road, Songjiang District, Shanghai).

    [0086] The recombinant plasmids pET28a-Enz.1, pET28a-Enz.2, pET28a-Enz.3, pET28a-Enz.4, pET28a-Enz.5, pET28a-Enz.6, pET28a-Enz.7, pET28a-Enz.8 along with the pGro7 plasmid (which expresses chaperone proteins to increase the solubility of the target protein) were separately co-transformed into host E. coli BL21 (DE3) competent cells to obtain engineered strains containing each sucrose synthase gene, respectively. These engineered strains containing each sucrose synthase gene, were activated by plate streaking, respectively. A single colony was selected and inoculated into 5 mL of LB liquid medium containing 50 g/mL kanamycin and 25 g/mL chloramphenicol. The culture was then incubated at 37 C. for 4 h with shaking. The culture was transferred to 50 mL of fresh TB liquid medium containing also 50 g/mL kanamycin and 25 g/mL chloramphenicol with an inoculum volume of 2% (v/v), and then incubated at 37 C. with shaking until the OD.sub.600 reached approximately 0.8. IPTG was then added to a final concentration of 0.1 mM, and the culture was induced at 25 C. for 20 h. After cultivation, the culture solution was centrifuged at 4000 rpm for 20 min. The supernatant was discarded, and the bacterial cells were collected and stored at 20 C. for later use.

    [0087] The collected bacterial cells were resuspended in PBS (50 mM, pH 6.0) at a ratio of 1:10 (M/V, g/mL), and then homogenized using a high-pressure homogenizer (homogenization at 550 Mbar for 1.5 min). The homogenized enzyme solution was centrifuged at 12000 rpm for 2 min. The supernatant was collected, and the sucrose synthase reaction enzyme solution was obtained.

    TABLE-US-00005 TABLE 4 NCBI Amino Enzyme Registration DNA Acid number Source Number Sequence Sequence Enz. 1 Arabidopsis thaliana NP_001031915.1 SEQ ID / NO: 1 Enz. 2 Solanum tuberosum P10691.1 SEQ ID / NO: 2 Enz. 3 Thermosynechococcus WP_011056890.1 SEQ ID SEQ ID elongatus NO: 3 NO: 9 Enz. 4 Acidithiobacillus WP_163099567.1 SEQ ID / ferrianus NO: 4 Enz. 5 Nitrosomonas Q820M5.1 SEQ ID SEQ ID europaea NO: 5 NO: 10 Enz. 6 Melioribacter roseus I7A3T6.1 SEQ ID / P3M-2 NO: 6 Enz. 7 Denitrovibrio D4H6M0.1 SEQ ID / acetiphilus NO: 7 DSM 12809 Enz. 8 Methylocaldum WP_156912771.1 SEQ ID SEQ ID szegediense NO: 8 NO: 11

    Example 2: Preparation of -1,2-glycosyltransferase

    [0088] According to the gene of -1,2-glycosyltransferase (enzyme number: Enz.9, those skilled in the field can obtain the amino acid sequence of this enzyme based on the nucleotide sequence as shown in SEQ ID NO: 12) as the nucleotide sequence of SEQ ID NO: 12 shown, a set of the genes of -1,2-glycosyltransferase was synthesized and then ligated into the pET28a plasmid vector to obtain the recombinant plasmid pET28a-1,2GT. Gene synthesis was conducted by Sangon Biotech (Shanghai) Co., Ltd.

    [0089] The plasmid pET28a-1,2GT was transformed into host E. coli BL21 (DE3) competent cells to obtain an engineered bacterial strain containing the -1,2-glycosyltransferase gene.

    [0090] After activating the engineered strain containing the -1,2-glycosyltransferase gene by plate streaking, A single colony was selected and inoculated into 5 mL of LB liquid medium containing 50 g/mL kanamycin, and then incubated at 37 C. for 12 h with shaking. The culture was transferred to 50 mL of fresh LB liquid medium containing 50 g/mL kanamycin with an inoculum volume of 2% (v/v), and then incubated at 37 C. with shaking until the OD.sub.600 reached 0.6-0.8. Isopropyl--D-thiogalactopyranoside (IPTG) was added to a final concentration of 0.1 mM, and the culture was induced at 24 C. for 22 h. After cultivation, the culture solution was centrifuged at 10,000 rpm for 10 min. The supernatant was discarded, and the bacterial cells were collected and stored in an ultra-low temperature refrigerator at 20 C. for later use.

    [0091] A 50 mM, pH 6.0 phosphate buffer solution (PBS) was prepared. The collected bacterial cells were suspended at a ratio of 1:10 (M/V, g/mL), then high-pressure homogenization (550-600 Mbar for 1 minute) was carried out. After homogenization, the suspension was centrifuged at 12,000 rpm for 2 min. The supernatant was collected, and the crude enzyme solution of -1,2-glycosyltransferase was obtained.

    Example 3: Screening of Sucrose Synthase in the First Round

    [0092] Using Reb A (content of 96%, purchased from Bidepharm) as the substrate, 150 L of reaction enzyme solution of -1,2-glycosyltransferase was added into 1 mL reaction system, and the final concentration of Reb A is 50 g/L, the final concentration of ADP or UDP is 0.1 g/L, and the final concentration of sucrose is 200 g/L. Then, 30 L of the sucrose synthase reaction enzyme solution was added. Finally, 50 mM (pH 6.0) phosphate buffer solution was added to a final volume of 1 mL. The prepared reaction system was placed in a metal bath and reacted at 60 C. and 600 rpm for 1 h. Afterwards, 10 L of the reaction solution was added into 190 L of hydrochloric acid (pH 2.0), the mixture was then vortexed, followed by 800 L of deionized water was added and mixed well. After the mixture was centrifuged at 13,000 rpm for 10 min, the supernatant was collected for HPLC to analyze the concentration of Reb D (see Table 5 for RD %).

    TABLE-US-00006 TABLE 5 Sucrose synthase RD % (ADP) RD % (UDP) Enz. 1 0.82 2.50 Enz. 2 0.53 0.34 Enz. 3 15.96 13.98 Enz. 4 1.11 0.59 Enz. 5 18.97 8.71 Enz. 6 10.99 1.66 Enz. 7 4.66 0.09 Enz. 8 38.70 7.03

    [0093] The results in Table 5 indicated that when ADP was used as the substrate for sucrose synthase catalysis, Enz.8 had the highest enzyme activity, followed by Enz.5 and Enz.3. When UDP was used as the substrate for sucrose synthase catalysis, Enz.3 had the highest enzyme activity, followed by Enz.5 and Enz.8. Additionally, the activities of Enz.3, Enz.5, and Enz.8 with ADP as the substrate were higher than those with UDP as the substrate, and Enz.8 had the best effect with ADP as the substrate. Therefore, in the next round of experiments, ADP will be used as the substrate for sucrose synthase, and mutations and screenings will be conducted based on Enz.8.

    Example 4: Preparation of Sucrose Synthase Mutants in the Second Round

    [0094] Using the recombinant plasmid pET28a-Enz.8 as a template, and the primer sequences shown in Table 6 were used, with Enz.X-F/Km-R and Km-F/Enz.X-R as primers, respectively (wherein Enz.X refers to: Enz.10, Enz.11, Enz.12, Enz.13, Enz.14, Enz.15, and Enz.16). PCR amplification of the target DNA fragments and vector fragments was performed using KOD enzyme.

    TABLE-US-00007 TABLE6 Mutation Enzyme Primer SEQID site ID name Primersequence NO: E36V Enz.10 Enz.10-F AAAAAACTGGTACGCTCCTTCCTTCA 13 GCGT Enz.10-R AAGGAGCGTACCAGTTTTTTAATCTG 14 GTGC S43E Enz.11 Enz.11-F TTCAGCGTGAAGAACTGTGCGACGC 15 GTTTG Enz.11-R GCACAGTTCTTCACGCTGAAGGAAG 16 GAGCGT R179A Enz.12 Enz.12-F GGTGGTGAAGCCATCCTGAACTTCCT 17 GCGC Enz.12-R GTTCAGGATGGCTTCACCACCTTCAC 18 CCAGT L395R Enz.13 Enz.13-F GTTACACTCGGGATAGCGAACGTGAA 19 CTG Enz.13-R GTTCGCTATCCCGAGTGTAACGTTCC 20 AGGTA R447P Enz.14 Enz.14-F ACCAAATACCCTCACGCCGACCTGTT 21 CTGG Enz.14-R GTCGGCGTGAGGGTATTTGGTTTTTTC 22 CAG E455L Enz.15 Enz.15-F GTTCTGGCAGCTAAACGAAGCGCAGT 23 ATCAT Enz.15-R GCTTCGTTTAGCTGCCAGAACAGGTC 24 GGCG D654R Enz.16 Enz.16-F CTGCCGAAACGTCTGGCGGGTGAATT 25 TTAC Enz.16-R CCGCCAGACGTTTCGGCAGACGCAG 26 ACCC / Uni- Km-F GCCCGACATTATCGCGAGC 27 versal Km-R GGGTATAAATGGGCTCGCG 28 primer

    [0095] The PCR amplification reaction system is: [0096] KOD Mix: 25 L [0097] ddH.sub.2O: 20 L [0098] Primer: 2 L2 [0099] Template: 1 L.

    [0100] PCR procedure: [0101] (1) 98 C. 3 min [0102] (2) 98 C. 10 s [0103] (3) 55 C. 5 s [0104] (4) 68 C. 5 s/kbp [0105] (5) 68 C. 5 min [0106] (6) hold at 12 C.

    [0107] Steps (2) to (4) are repeated for 34 cycles.

    [0108] The PCR products were digested using DpnI, and the target DNA fragments were obtained by gel electrophoresis and gel recovery. Two-fragment homologous recombinase (Exnase CE II) purchased from Vazyme Biotech, was used for recombination and ligation. After ligation, the mixture was transformed into E. coli Trans 10 competent cells. The cells were then spread onto LB medium containing 50 g/mL kanamycin, and the plate was incubated upside down at 37 C. overnight. A single colony was then picked and inoculated into LB tubes (Km resistance) and incubated for 8-10 h. Plasmids were extracted for sequencing and identification, the recombinant plasmid containing the target mutant gene was obtained.

    [0109] The recombinant plasmid sequenced correctly was then transformed into the host E. coli BL21 (DE3) competent cells, an engineered strain containing sucrose synthase gene with point mutations was obtained. The engineered strain containing sucrose synthase gene was activated by plate streaking, and a single colony was selected and inoculated into 5 mL of LB liquid medium containing 50 g/mL kanamycin. The cultures were incubated at 37 C. for 4 h with shaking. The culture was then transferred to 50 mL of fresh TB liquid medium containing 50 g/mL kanamycin with an inoculum volume of 2% (v/v), and then incubated at 37 C. with shaking until the OD.sub.600 reached approximately 0.8. IPTG was added to a final concentration of 0.1 mM, and the culture was induced at 25 C. for 20 h. After cultivation, the culture solution was centrifuged at 4000 rpm for 20 min. The supernatant was discarded, and the bacterial cells were collected and stored at 20 C. for later use.

    [0110] The collected bacterial cells were resuspended in PBS (50 mM, pH 6.0) at a ratio of 1:10 (M/V, g/mL), and then homogenized using a high-pressure homogenizer (homogenization at 550 Mbar for 1.5 min). The homogenized enzyme solution was centrifuged at 12000 rpm for 2 min. The supernatant was collected, and the reaction enzyme solution was obtained.

    Example 5: Screening of Sucrose Synthase Mutant in the Second Round

    [0111] Using Reb A (content of 96%) as the substrate, 150 L of reaction enzyme solution of -1,2-glycosyltransferase was added into 1 mL reaction system, the final concentration of Reb A is 50 g/L, the final concentration of ADP is 0.1 g/L, and the final concentration of sucrose is 200 g/L. Then, 30 L of the sucrose synthase reaction enzyme solution was added. Finally, 50 mM (pH 6.0) phosphate buffer solution was added to a final volume of 1 mL. The prepared reaction system was placed in a metal bath and reacted at 60 C. and 600 rpm for 30 min. Afterwards, 10 L of the reaction solution was added into 190 L of hydrochloric acid (pH 2.0), the mixture was then vortexed, followed by 800 L of deionized water was added and mixed well. After the mixture was centrifuged at 13,000 rpm for 10 min, the supernatant was collected for HPLC to analyze the concentration of Reb D (RD %); the results are as shown in Table 7.

    TABLE-US-00008 TABLE 7 Enzyme Mutation site Codon RD % (30 min) Enz. 10 E36V CTA 25.049 Enz. 11 S43E GAA 35.652 Enz. 12 R179A GCC 23.447 Enz. 13 L395R CGG 33.283 Enz. 14 R447P CCT 34.315 Enz. 15 E455L CTA 22.093 Enz. 16 D654R CGT 35.113 Enz. 8 / / 31.212

    [0112] The results showed that within the first 30 min of the reaction, Enz.11 had the highest enzyme activity, which was increased by 10% compared to the parent enzyme, Enz.8, followed by Enz.16, Enz.14, and Enz.13, whose enzyme activities were increased by 5% to 10% compared to parent enzyme Enz.8.

    [0113] FIG. 5A presents the HPLC chromatogram of the parent enzyme Enz.8 catalyzing the synthesis of RD (with ADP as the substrate, 30 min) in the second round of screening as shown in Table 7, while FIG. 5B presents the peak information of FIG. 5A.

    [0114] FIG. 6A presents the HPLC chromatogram of the mutant Enz.11 catalyzing the synthesis of RD (with ADP as the substrate, 30 min) in the second round of screening as shown in Table 7, while FIG. 6B presents the peak information of FIG. 6A.

    Example 6: Preparation of -1,3-glycosyltransferase Enz.17

    [0115] According to the gene of -1,3-glycosyltransferase (enzyme number Enz.17, those skilled in the field can obtain the amino acid sequence of this enzyme based on the nucleotide sequence as shown in SEQ ID NO: 29) as the nucleotide sequence of SEQ ID NO: 29 shown, a set of genes of -1,3-glycosyltransferase was synthesized and then ligated to the pET28a plasmid vector to obtain the recombinant plasmid pET28a-Enz.17. Gene synthesis was conducted by Sangon Biotech (Shanghai) Co., Ltd.

    [0116] The plasmid pET28a-Enz.17 was transformed into host E. coli BL21 (DE3) competent cells to obtain an engineered bacterial strain containing the -1,3-glycosyltransferase gene.

    [0117] After activating the engineered strain containing the -1,3-glycosyltransferase gene by plate streaking, a single colony was selected and inoculated into 5 mL of LB liquid medium containing 50 g/mL kanamycin and incubated at 37 C. for 12 h with shaking. The culture was then transferred to 50 mL of fresh LB liquid medium containing 50 g/mL kanamycin with an inoculum volume of 2% (v/v), and then incubated at 37 C. with shaking until the OD.sub.600 reached 0.6-0.8. IPTG was added to a final concentration of 0.1 mM, and the culture was induced at 24 C. for 22 h. After cultivation, the culture solution was centrifuged at 10,000rpm for 10 min. The supernatant was discarded, and the bacterial cells were collected and stored in an ultra-low temperature refrigerator at 20 C. for later use.

    [0118] A 50 mM (pH 6.0) phosphate buffer solution (PBS) was prepared. The collected bacterial cells were suspended at a ratio of 1:10 (M/V, g/mL), and then high-pressure homogenization (550 Mbar for 1.5 min) was carried out. After centrifuging at 12,000 rpm for 2 min, the supernatant was collected, and the reaction enzyme solution of -1,3-glucosyltransferase was obtained.

    Example 7: RM Synthesis Reaction

    [0119] Using Reb A 60 (with a Reb A content of 60% and steviol glycosides content of approximately 30%, product specification TSG90/RA60 from ChenGuang Biotech Group) as the substrate, 120 L of reaction enzyme solution of -1,2-glucosyltransferase, 30 L of reaction enzyme solution of sucrose synthase, and 150 L of reaction enzyme solution of -1,3-glucosyltransferase were added into 1 mL reaction system, the final concentration of RA60 is 100 g/L, the final concentration of ADP is 0.1 g/L, and the final concentration of sucrose is 200 g/L. Finally, 50 mM (pH 6.0) phosphate buffer was added to a final volume of 1 mL. The prepared reaction system was placed in a metal bath and reacted at 60 C. and 600 rpm. 10 L of the reaction solution was taken at 4 h, 7 h, and overnight, respectively, and then was added into 190 L of hydrochloric acid with a pH of 2.0, the mixture was then vortexed, followed by 800 L of deionized water was added and mixed well. The mixture was then centrifuged at 13,000 rpm for 10 min, and the supernatant was collected for HPLC to analyze the concentrations of Reb A, the intermediate product Reb D, and the product Reb M (RA %, RD %, and RM %). The reaction results are shown in Table 8 (wherein RA %, RD %, and RM % refer to the concentration of the substrate, intermediate product, and product in the reaction solution after the reaction, respectively). The reaction route for this example is presented in FIG. 1.

    TABLE-US-00009 TABLE 8 Enzyme RD % RM % RA % Enz. 8 Reacted for 4 h 7.41 25.21 67.37 Reacted for 7 h 10.01 41.38 48.61 Reacted overnight 14.18 64.58 21.24 Enz. 11 Reacted for 4 h 7.49 31.55 60.95 Reacted for 7 h 9.62 46.86 43.52 Reacted overnight 14.36 66.85 18.80 Enz. 14 Reacted for 4 h 7.20 31.81 60.99 Reacted for 7 h 9.40 48.61 41.99 Reacted overnight 13.46 70.79 15.76 Enz. 16 Reacted for 4 h 7.92 29.87 62.21 Reacted for 7 h 10.19 44.59 45.23 Reacted overnight 15.71 56.70 27.59

    [0120] Results: from the reactions at 4 h, 7 h, and overnight, it was observed that Enz.14 had the best reaction effect (RM %), followed by Enz.11, and both were superior to Enz.8.

    [0121] FIG. 7A presents the HPLC chromatogram of the parent enzyme Enz.8 catalyzing the synthesis of RM (reaction 7 h) as listed in Table 8, while FIG. 7B presents the peak information of FIG. 7A.

    [0122] FIG. 8A presents the HPLC chromatogram of Enz.11 catalyzing the synthesis of RM (reaction 7 h) as listed in Table 8, while FIG. 8B presents the peak information of FIG. 8A.