USE OF SARAF INHIBITORS FOR TREATING HEPATITIS B VIRUS INFECTION
20230120063 · 2023-04-20
Inventors
- Lykke Pedersen (Horsholm, DK)
- Souphalone Luangsay (Basel, CH)
- Johanna Marie Walther (Basel, CH)
- Alan James Mueller-Breckenridge (Basel, CH)
Cpc classification
A61K31/7125
HUMAN NECESSITIES
C12N2310/3231
CHEMISTRY; METALLURGY
C12N15/113
CHEMISTRY; METALLURGY
C12N15/1138
CHEMISTRY; METALLURGY
C12N2310/3231
CHEMISTRY; METALLURGY
A61K31/7105
HUMAN NECESSITIES
A61K31/711
HUMAN NECESSITIES
International classification
C12N15/113
CHEMISTRY; METALLURGY
Abstract
The present invention relates to a SARAF inhibitor for use in treatment of an HBV infection, in particular a chronic HBV infection. The invention in particular relates to the use of SARAF inhibitors for destabilizing cccDNA, such as HBV cccDNA. The invention also relates to nucleic acid molecules which are complementary to SARAF and capable of reducing the level of a SARAF mRNA. Also comprised in the present invention is a pharmaceutical composition and its use in the treatment of a HBV infection.
Claims
1. A method of treating or preventing a Hepatitis B virus (HBV) infection in a subject in need thereof, the method comprising administering to the subject a therapeutically or prophylactically effective amount of a SARAF (Store-operated calcium entry-associated regulatory factor) inhibitor.
2. The method according to claim 1, wherein the HBV infection is a chronic infection.
3. The method according to claim 1, wherein the SARAF inhibitor is capable of reducing cccDNA (covalently closed circular DNA) in an HBV infected cell.
4. The method according to claim 1, wherein said inhibitor is an nucleic acid molecule of 12 to 60 nucleotides in length comprising a contiguous nucleotide sequence of at least 12 nucleotides in length which is at least 95% complementary to a mammalian SARAF target sequence and is capable of reducing SARAF mRNA.
5. The method according to claim 1, wherein said inhibitor is selected from the group consisting of single stranded antisense oligonucleotide, siRNA and shRNA molecule.
6. The method according to claim 4, wherein the mammalian SARAF target sequence is selected from the group consisting of SEQ ID NOs: 1, 4, 5, 6, 7, 8, 9 and 10.
7. The method according to claim 4, wherein the contiguous nucleotide sequence is at least 98% complementary to the target sequence of SEQ ID NO: 1 and SEQ ID NO: 2.
8. The method according to claim 3, wherein the cccDNA in an HBV infected cell is reduced by at least 60% when compared to a control.
9. The method according to claim 4, wherein the SARAF mRNA is reduced by at least 60% when compared to a control.
10. A nucleic acid molecule of 12 to 30 nucleotides in length comprising a contiguous nucleotide sequence of at least 12 nucleotides which is 90% complementary to a mammalian SARAF target sequence, wherein the nucleic acid molecule is capable of inhibiting the expression of SARAF.
11. The nucleic acid molecule according to claim 10, wherein the contiguous nucleotide sequence is fully complementary to a sequence selected from the group consisting of SEQ ID NOs: 1, 4, 5, 6, 7, 8, 9 and 10.
12. The nucleic acid molecule according to claim 10, wherein the nucleic acid molecule comprises a contiguous nucleotide sequence of 12 to 25.
13. The nucleic acid molecule of claim 10, wherein the nucleic acid molecule is a RNAi molecule.
14. The nucleic acid molecule of claim 10, wherein the nucleic acid molecule is a single stranded antisense oligonucleotide.
15. The nucleic acid molecule according to claim 14, wherein the single stranded antisense oligonucleotide is capable of recruiting RNase H.
16. The nucleic acid molecule according to claim 10, wherein the nucleic acid molecule comprises one or more 2′ sugar modified nucleosides.
17. The nucleic acid molecule according to claim 16, wherein the one or more 2′ sugar modified nucleosides are independently selected from the group consisting of 2′-O-alkyl-RNA, 2′-O-methyl-RNA, 2′-alkoxy-RNA, 2′-O-methoxyethyl-RNA, 2′-amino-DNA, 2′-fluoro-DNA, arabino nucleic acid (ANA), 2′-fluoro-ANA and LNA nucleosides.
18. The nucleic acid molecule according to claim 16, wherein the one or more 2′ sugar modified nucleosides are LNA nucleosides.
19. The nucleic acid molecule according to claim 10, wherein the contiguous nucleotide sequence comprises at least one phosphorothioate internucleoside linkage.
20. The nucleic acid molecule according to claim 19, wherein all the internucleoside linkages within the contiguous nucleotide sequence are phosphorothioate internucleoside linkages.
21. (canceled)
22. The nucleic acid molecule according to claim 10, wherein the nucleic acid molecule, or contiguous nucleotide sequence thereof, comprises a gapmer of formula 5′-F-G-F′-3′, wherein regions F and F′ independently comprise 1 to 4 2′ sugar modified nucleosides and G is a region between 6 and 18 nucleosides which are capable of recruiting RNase H
23. A conjugate compound comprising a nucleic acid molecule according to claim 10 and at least one conjugate moiety covalently attached to said nucleic acid molecule.
24. The conjugate compound of claim 23, wherein the conjugate moiety is selected from one of the trivalent GalNAc moieties in
25. The conjugate compound of claim 23, wherein the conjugate compound comprises a physiologically labile linker composed of 2 to 5 linked nucleosides comprising at least two consecutive phosphodiester linkages, wherein the physiologically labile linker is covalently bound at the 5′ or 3′ terminal of the nucleic acid molecule.
26. A pharmaceutically acceptable salt of a nucleic acid molecule according to claim 10.
27. A pharmaceutical composition comprising a nucleic acid molecule according to claim 10 and a pharmaceutically acceptable excipient.
28. An in vivo or in vitro method for modulating SARAF expression in a target cell which is expressing SARAF, said method comprising administering a nucleic acid molecule according to claim 10 in an effective amount to said cell.
29. A method for treating or preventing a disease in a subject suffering from or susceptible to the disease, the method comprising administering to the subject a therapeutically or prophylactically effective amount of a nucleic acid molecule according to claim 10.
30. (canceled)
31. (canceled)
32. (canceled)
33. (canceled)
Description
BRIEF DESCRIPTION OF FIGURES
[0019]
[0020]
[0021]
[0022]
[0023]
[0024] The compounds in
[0025] The compound in
[0026] The two different diastereoisomers shown in each of
Definitions
[0027] HBV Infection
[0028] The term “hepatitis B virus infection” or “HBV infection” is commonly known in the art and refers to an infectious disease that is caused by the hepatitis B virus (HBV) and affects the liver. A HBV infection can be an acute or a chronic infection. Chronic hepatitis B virus (CHB) infection is a global disease burden affecting 248 million individuals worldwide. Approximately 686,000 deaths annually are attributed to HBV-related end-stage liver diseases and hepatocellular carcinoma (HCC) (GBD 2013; Schweitzer et al., Lancet. 2015 Oct. 17; 386(10003):1546-55). WHO projected that without expanded intervention, the number of people living with CHB infection will remain at the current high levels for the next 40-50 years, with a cumulative 20 million deaths occurring between 2015 and 2030 (WHO 2016). CHB infection is not a homogenous disease with singular clinical presentation. Infected individuals have progressed through several phases of CHB-associated liver disease in their life; these phases of disease are also the basis for treatment with standard of care (SOC). Current guidelines recommend treating only selected CHB-infected individuals based on three criteria—serum ALT level, HBV DNA level, and severity of liver disease (EASL, 2017). This recommendation was due to the fact that SOC i.e. nucleos(t)ide analogs (NAs) and pegylated interferon-alpha (PEG-IFN), are not curative and must be administered for long periods of time thereby increasing their safety risks. NAs effectively suppress HBV DNA replication; however, they have very limited/no effect on other viral markers. Two hallmarks of HBV infection, hepatitis B surface antigen (HBsAg) and covalently closed circular DNA (cccDNA), are the main targets of novel drugs aiming for HBV cure. In the plasma of CHB individuals, HBsAg subviral (empty) particles outnumber HBV virions by a factor of 103 to 105 (Ganem & Prince, N Engl J Med. 2004 Mar. 11; 350(11):1118-29); its excess is believed to contribute to immunopathogenesis of the disease, including inability of individuals to develop neutralizing anti-HBs antibody, the serological marker observed following resolution of acute HBV infection.
[0029] In some embodiments, the term “HBV infection” refers to “chronic HBV infection”.
[0030] Further, the term encompasses infection with any HBV genotype.
[0031] In some embodiments, the patient to be treated is infected with HBV genotype A.
[0032] In some embodiments, the patient to be treated is infected with HBV genotype B.
[0033] In some embodiments, the patient to be treated is infected with HBV genotype C.
[0034] In some embodiments, the patient to be treated is infected with HBV genotype D.
[0035] In some embodiments, the patient to be treated is infected with HBV genotype E.
[0036] In some embodiments, the patient to be treated is infected with HBV genotype F.
[0037] In some embodiments, the patient to be treated is infected with HBV genotype G.
[0038] In some embodiments, the patient to be treated is infected with HBV genotype H.
[0039] In some embodiments, the patient to be treated is infected with HBV genotype I.
[0040] In some embodiments, the patient to be treated is infected with HBV genotype J.
[0041] cccDNA (Covalently Closed Circular DNA)
[0042] cccDNA is the viral genetic template of HBV that resides in the nucleus of infected hepatocytes, where it gives rise to all HBV RNA transcripts needed for productive infection and is responsible for viral persistence during natural course of chronic HBV infection (Locarnini & Zoulim, Antivir Ther. 2010; 15 Suppl 3:3-14. doi: 10.3851/IMP1619). Acting as a viral reservoir, cccDNA is the source of viral rebound after cessation of treatment, necessitating long term, often lifetime treatment. PEG-IFN can only be administered to a small subset of CHB due to its various side effects.
[0043] Consequently, novel therapies that can deliver a complete cure, defined by degradation or elimination of HBV cccDNA, to the majority of CHB patients are highly needed.
[0044] Compound
[0045] Herein, the term “compound” means any molecule capable of inhibition SARAF expression or activity. Particular compounds of the invention are nucleic acid molecules, such as RNAi molecules or antisense oligonucleotides according to the invention or any conjugate comprising such a nucleic acid molecule. For example, herein the compound may be a nucleic acid molecule targeting SARAF, in particular an antisense oligonucleotide or a siRNA.
[0046] Oligonucleotide
[0047] The term “oligonucleotide” as used herein is defined as it is generally understood by the skilled person as a molecule comprising two or more covalently linked nucleosides. Such covalently bound nucleosides may also be referred to as nucleic acid molecules or oligomers.
[0048] The oligonucleotides referred to in the description and claims are generally therapeutic oligonucleotides below 70 nucleotides in length. The oligonucleotide may be or comprise a single stranded antisense oligonucleotide, or may be another nucleic acid molecule, such as a CRISPR RNA, a siRNA, shRNA, an aptamer, or a ribozyme. Therapeutic oligonucleotide molecules are commonly made in the laboratory by solid-phase chemical synthesis followed by purification and isolation. shRNA's are however often delivered to cells using lentiviral vectors from which they are then transcribed to produce the single stranded RNA that will form a stem loop (hairpin) RNA structure that is capable of interacting with the RNA interference machinery (including the RNA-induced silencing complex (RISC)). In an embodiment of the present invention the shRNA is chemically produced shRNA molecules (not relying on cell based expression from plasmids or viruses). When referring to a sequence of the oligonucleotide, reference is made to the sequence or order of nucleobase moieties, or modifications thereof, of the covalently linked nucleotides or nucleosides. Generally, the oligonucleotide of the invention is man-made, and is chemically synthesized, and is typically purified or isolated. Although in some embodiments the oligonucleotide of the invention is a shRNA transcribed from a vector upon entry into the target cell. The oligonucleotide of the invention may comprise one or more modified nucleosides or nucleotides.
[0049] In some embodiments, the oligonucleotide of the invention comprises or consists of 10 to 70 nucleotides in length, such as from 12 to 60, such as from 13 to 50, such as from 14 to 40, such as from 15 to 30, such as from 16 to 25, such as from 16 to 22, such as from 16 to 20 contiguous nucleotides in length. Accordingly, the oligonucleotide of the present invention, in some embodiments, may have a length of 12 to 25 nucleotides. Alternatively, the oligonucleotide of the present invention, in some embodiments, may have a length of 15 to 22 nucleotides.
[0050] In some embodiments, the oligonucleotide or contiguous nucleotide sequence thereof comprises or consists of 24 or less nucleotides, such as 22, such as 20 or less nucleotides, such as 18 or less nucleotides, such as 14, 15, 16 or 17 nucleotides. It is to be understood that any range given herein includes the range endpoints. Accordingly, if a nucleic acid molecule is said to include from 12 to 25 nucleotides, both 12 and 25 nucleotides are included.
[0051] In some embodiments, the contiguous nucleotide sequence comprises or consists of 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 or 22 contiguous nucleotides in length
[0052] The oligonucleotide(s) are for modulating the expression of a target nucleic acid in a mammal. In some embodiments, the nucleic acid molecules, such as for siRNAs, shRNAs and antisense oligonucleotides, are typically for inhibiting the expression of a target nucleic acid(s).
[0053] In one embodiment of the invention, the oligonucleotide is selected from a RNAi agent, such as a siRNA or shRNA. In another embodiment, the oligonucleotide is a single stranded antisense oligonucleotide, such as a high affinity modified antisense oligonucleotide interacting with RNase H.
[0054] In some embodiments, the oligonucleotide of the invention may comprise one or more modified nucleosides or nucleotides, such as 2′ sugar modified nucleosides.
[0055] In some embodiments, the oligonucleotide comprises phosphorothioate internucleoside linkages.
[0056] In some embodiments, the oligonucleotide may be conjugated to non-nucleosidic moieties (conjugate moieties).
[0057] A library of oligonucleotides is to be understood as a collection of variant oligonucleotides. The purpose of the library of oligonucleotides can vary. In some embodiments, the library of oligonucleotides is composed of oligonucleotides with overlapping nucleobase sequence targeting one or more mammalian SARAF target nucleic acids with the purpose of identifying the most potent sequence within the library of oligonucleotides. In some embodiments, the library of oligonucleotides is a library of oligonucleotide design variants (child nucleic acid molecules) of a parent or ancestral oligonucleotide, wherein the oligonucleotide design variants retaining the core nucleobase sequence of the parent nucleic acid molecule.
[0058] Antisense Oligonucleotides
[0059] The term “antisense oligonucleotide” or “ASO” as used herein is defined as oligonucleotides capable of modulating expression of a target gene by hybridizing to a target nucleic acid, in particular to a contiguous sequence on a target nucleic acid. The antisense oligonucleotides are not essentially double stranded and are therefore not siRNAs or shRNAs. Preferably, the antisense oligonucleotides of the present invention are single stranded. It is understood that single stranded oligonucleotides of the present invention can form hairpins or intermolecular duplex structures (duplex between two molecules of the same oligonucleotide), as long as the degree of intra or inter self complementarity is less than 50% across of the full length of the oligonucleotide.
[0060] Advantageously, the single stranded antisense oligonucleotide of the invention does not contain RNA nucleosides, since this will decrease nuclease resistance.
[0061] Advantageously, the oligonucleotide of the invention comprises one or more modified nucleosides or nucleotides, such as 2′ sugar modified nucleosides. Furthermore, it is advantageous that the nucleosides which are not modified are DNA nucleosides.
[0062] RNAi Molecules
[0063] Herein, the term “RNA interference (RNAi) molecule” refers to short double-stranded oligonucleotide containing RNA nucleosides and which mediates targeted cleavage of an RNA transcript via the RNA-induced silencing complex (RISC), where they interact with the catalytic RISC component argonaute. The RNAi molecule modulates, e g., inhibits, the expression of the target nucleic acid in a cell, e.g. a cell within a subject. such as a mammalian subject. RNAi molecules includes single stranded RNAi molecules (Lima at al 2012 Cell 150: 883) and double stranded siRNAs, as well as short hairpin RNAs (shRNAs). In some embodiments of the invention, the oligonucleotide of the invention or contiguous nucleotide sequence thereof is a RNAi agent, such as a siRNA.
[0064] siRNA
[0065] The term “small interfering ribonucleic acid” or “siRNA” refers to a small interfering ribonucleic acid RNAi molecule. It is a class of double-stranded RNA molecules, also known in the art as short interfering RNA or silencing RNA. siRNAs typically comprise a sense strand (also referred to as a passenger strand) and an antisense strand (also referred to as the guide strand), wherein each strand are of 17 to 30 nucleotides in length, typically 19 to 25 nucleosides in length, wherein the antisense strand is complementary, such as at least 95% complementary, such as fully complementary, to the target nucleic acid (suitably a mature mRNA sequence), and the sense strand is complementary to the antisense strand so that the sense strand and antisense strand form a duplex or duplex region. siRNA strands may form a blunt ended duplex, or advantageously the sense and antisense strand 3′ ends may form a 3′ overhang of e.g. 1, 2 or 3 nucleosides to resemble the product produced by Dicer, which forms the RISC substrate in vivo. Effective extended forms of Dicer substrates have been described in U.S. Pat. Nos. 8,349,809 and 8,513,207, hereby incorporated by reference. In some embodiments, both the sense strand and antisense strand have a 2nt 3′ overhang. The duplex region may therefore be, for example 17 to 25 nucleotides in length, such as 21 to 23 nucleotides in length.
[0066] Once inside a cell the antisense strand is incorporated into the RISC complex which mediate target degradation or target inhibition of the target nucleic acid. siRNAs typically comprise modified nucleosides in addition to RNA nucleosides. In one embodiment, the siRNA molecule may be chemically modified using modified internucleotide linkages and 2′ sugar modified nucleosides, such as 2′-4′ bicyclic ribose modified nucleosides, including LNA and cET or 2′ substituted modifications like of 2′-O-alkyl-RNA, 2′-O-methyl-RNA, 2′-alkoxy-RNA, 2′-O-methoxyethyl-RNA (MOE), 2′-amino-DNA, 2′-fluoro-DNA, arabino nucleic acid (ANA), 2′-fluoro-ANA. In particular 2′fluoro, 2′-O-methyl or 2′-O-methoxyethyl may be incorporated into siRNAs.
[0067] In some embodiments, all of the nucleotides of an siRNA sense (passenger) strand may be modified with 2′ sugar modified nucleosides such as LNA (see WO2004/083430, WO2007/085485 for example). In some embodiments, the passenger stand of the siRNA may be discontinuous (see WO2007/107162 for example). The incorporation of thermally destabilizing nucleotides occurring at a seed region of the antisense strand of siRNAs have been reported as useful in reducing off-target activity of siRNAs (see WO2018/098328 for example). Suitably the siRNA comprises a 5′ phosphate group or a 5′-phosphate mimic at the 5′ end of the antisense strand. In some embodiments, the 5′ end of the antisense strand is a RNA nucleoside.
[0068] In one embodiment, the siRNA molecule further comprises at least one phosphorothioate or methylphosphonate internucleoside linkage. The phosphorothioaie or methylphosphonate internucleoside linkage may be at the 3′-terminus one or both strand (e.g., the antisense strand; or the sense strand); or the phosphorothioate or methylphosphonate internucleoside linkage may be at the 5′-terminus of one or both strands (e.g., the antisense strand; or the sense strand); or the phosphorothioate or methylphosphonate internucleoside linkage may be at the both the 5′- and 3′-terminus of one or both strands (e.g., the antisense strand; or the sense strand). In some embodiments, the remaining internucleoside linkages are phosphodiester linkages. In some embodiments, siRNA molecules comprise one or more phosphorothioate internucleoside linkages. In siRNA molecules phosphorothioate internucleoside linkages may reduce or the nuclease cleavage in RICS, it is therefore advantageous that not all internucleoside linkages in the antisense strand are modified.
[0069] The siRNA molecule may further comprise a ligand. In some embodiments, the ligand is conjugated to the 3′ end of the sense strand.
[0070] For biological distribution, siRNAs may be conjugated to a targeting ligand, and/or be formulated into lipid nanoparticles.
[0071] Other aspects of the invention relate to pharmaceutical compositions comprising these dsRNA, such as siRNA molecules suitable for therapeutic use, and methods of inhibiting the expression of the target gene by administering the dsRNA molecules such as siRNAs of the invention, e.g., for the treatment of various disease conditions as disclosed herein.
[0072] shRNA
[0073] The term “short hairpin RNA” or “shRNA” refers to molecules that are generally between 40 and 70 nucleotides in length, such as between 45 and 65 nucleotides in length, such as 50 and 60 nucleotides in length and form a stem loop (hairpin) RNA structure which interacts with the endonuclease known as Dicer which is believed to processes dsRNA into 19-23 base pair short interfering RNAs with characteristic two base 3′ overhangs which are then incorporated into an RNA-induced silencing complex (RISC). Upon binding to the appropriate target mRNA, one or more endonucleases within the RISC cleave the target to induce silencing. shRNA oligonucleotides may be chemically modified using modified internucleotide linkages and 2′ sugar modified nucleosides, such as 2′-4′ bicyclic ribose modified nucleosides, including LNA and cET or 2′ substituted modifications like of 2′-O-alkyl-RNA, 2′-O-methyl-RNA, 2′-alkoxy-RNA, 2′-O-methoxyethyl-RNA (MOE), 2′-amino-DNA, 2′-fluoro-DNA, arabino nucleic acid (ANA), 2′-fluoro-ANA.
[0074] In some embodiments, shRNA molecule comprises one or more phosphorothioate internucleoside linkages. In RNAi molecules phosphorothioate internucleoside linkages may reduce or the nuclease cleavage in RICS it is therefore advantageous that not al internucleoside linkages in the stem loop of the shRNA molecule are modified. Phosphorothioate internucleoside linkages can advantageously be placed in the 3′ and/or 5′ end of the stem loop of the shRNA molecule, in particular in the part of the molecule that is not complementary to the target nucleic acid. The region of the shRNA molecule that is complementary to the target nucleic acid may however also be modified in the first 2 to 3 internucleoside linkages in the part that is predicted to become the 3′ and/or 5′ terminal following cleavage by Dicer.
[0075] Contiguous Nucleotide Sequence
[0076] The term “contiguous nucleotide sequence” refers to the region of the nucleic acid molecule which is complementary to the target nucleic acid. The term is used interchangeably herein with the term “contiguous nucleobase sequence” and the term “oligonucleotide motif sequence”. In some embodiments, all the nucleotides of the oligonucleotide constitute the contiguous nucleotide sequence. In some embodiments, the contiguous nucleotide sequence is included in the guide strand of an siRNA molecule. In some embodiments, the contiguous nucleotide sequence is the part of an shRNA molecule which is 100% complementary to the target nucleic acid. In some embodiments, the oligonucleotide comprises the contiguous nucleotide sequence, such as a F-G-F′ gapmer region, and may optionally comprise further nucleotide(s), for example a nucleotide linker region which may be used to attach a functional group (e.g. a conjugate group for targeting) to the contiguous nucleotide sequence. The nucleotide linker region may or may not be complementary to the target nucleic acid. In some embodiments, the nucleobase sequence of the antisense oligonucleotide is the contiguous nucleotide sequence. In some embodiments, the contiguous nucleotide sequence is 100% complementary to the target nucleic acid.
[0077] Nucleotides and Nucleosides
[0078] Nucleotides and nucleosides are the building blocks of oligonucleotides and polynucleotides, and for the purposes of the present invention include both naturally occurring and non-naturally occurring nucleotides and nucleosides. In nature, nucleotides, such as DNA and RNA nucleotides comprise a ribose sugar moiety, a nucleobase moiety and one or more phosphate groups (which is absent in nucleosides). Nucleosides and nucleotides may also interchangeably be referred to as “units” or “monomers”.
[0079] Modified Nucleoside
[0080] The term “modified nucleoside” or “nucleoside modification” as used herein refers to nucleosides modified as compared to the equivalent DNA or RNA nucleoside by the introduction of one or more modifications of the sugar moiety or the (nucleo)base moiety. Advantageously, one or more of the modified nucleoside comprises a modified sugar moiety. The term modified nucleoside may also be used herein interchangeably with the term “nucleoside analogue” or modified “units” or modified “monomers”. Nucleosides with an unmodified DNA or RNA sugar moiety are termed DNA or RNA nucleosides herein. Nucleosides with modifications in the base region of the DNA or RNA nucleoside are still generally termed DNA or RNA if they allow Watson Crick base pairing.
[0081] Modified Internucleoside Linkage
[0082] The term “modified internucleoside linkage” is defined as generally understood by the skilled person as linkages other than phosphodiester (PO) linkages, that covalently couples two nucleosides together. The oligonucleotides of the invention may therefore comprise one or more modified internucleoside linkages, such as a one or more phosphorothioate internucleoside linkages, or one or more phosphorodithioate internucleoside linkages.
[0083] With the oligonucleotide of the invention it is advantageous to use phosphorothioate internucleoside linkages.
[0084] Phosphorothioate internucleoside linkages are particularly useful due to nuclease resistance, beneficial pharmacokinetics and ease of manufacture. In some embodiments, at least 50% of the internucleoside linkages in the oligonucleotide, or contiguous nucleotide sequence thereof, are phosphorothioate, such as at least 60%, such as at least 70%, such as at least 75%, such as at least 80% or such as at least 90% of the internucleoside linkages in the oligonucleotide, or contiguous nucleotide sequence thereof, are phosphorothioate. In some embodiments, all of the internucleoside linkages of the oligonucleotide, or contiguous nucleotide sequence thereof, are phosphorothioate.
[0085] In some advantageous embodiments, all the internucleoside linkages of the contiguous nucleotide sequence of the oligonucleotide are phosphorothioate, or all the internucleoside linkages of the oligonucleotide are phosphorothioate linkages.
[0086] It is recognized that, as disclosed in EP 2 742 135, antisense oligonucleotides may comprise other internucleoside linkages (other than phosphodiester and phosphorothioate), for example alkyl phosphonate/methyl phosphonate internucleoside linkages, which according to EP 2 742 135 may for example be tolerated in an otherwise DNA phosphorothioate gap region.
[0087] Nucleobase
[0088] The term “nucleobase” includes the purine (e.g. adenine and guanine) and pyrimidine (e.g. uracil, thymine and cytosine) moiety present in nucleosides and nucleotides which form hydrogen bonds in nucleic acid hybridization. In the context of the present invention the term nucleobase also encompasses modified nucleobases which may differ from naturally occurring nucleobases, but are functional during nucleic acid hybridization. In this context “nucleobase” refers to both naturally occurring nucleobases such as adenine, guanine, cytosine, thymidine, uracil, xanthine and hypoxanthine, as well as non-naturally occurring variants. Such variants are for example described in Hirao et al (2012) Accounts of Chemical Research vol 45 page 2055 and Bergstrom (2009) Current Protocols in Nucleic Acid Chemistry Suppl. 37 1.4.1.
[0089] In some embodiments, the nucleobase moiety is modified by changing the purine or pyrimidine into a modified purine or pyrimidine, such as substituted purine or substituted pyrimidine, such as a nucleobased selected from isocytosine, pseudoisocytosine, 5-methyl cytosine, 5-thiozolo-cytosine, 5-propynyl-cytosine, 5-propynyl-uracil, 5-bromouracil 5-thiazolo-uracil, 2-thio-uracil, 2′thio-thymine, inosine, diaminopurine, 6-aminopurine, 2-aminopurine, 2,6-diaminopurine and 2-chloro aminopurine.
[0090] The nucleobase moieties may be indicated by the letter code for each corresponding nucleobase, e.g. A, T, G, C or U, wherein each letter may optionally include modified nucleobases of equivalent function. For example, in the exemplified oligonucleotides, the nucleobase moieties are selected from A, T, G, C, and 5-methyl cytosine. Optionally, for LNA gapmers, 5-methyl cytosine LNA nucleosides may be used.
[0091] Modified Oligonucleotide
[0092] The term “modified oligonucleotide” describes an oligonucleotide comprising one or more sugar-modified nucleosides and/or modified internucleoside linkages. The term chimeric” oligonucleotide is a term that has been used in the literature to describe oligonucleotides comprising modified nucleosides and DNA nucleosides. The antisense oligonucleotide of the invention is advantageously a chimeric oligonucleotide.
[0093] Complementarity
[0094] The term “complementarity” or “complementary” describes the capacity for Watson-Crick base-pairing of nucleosides/nucleotides. Watson-Crick base pairs are guanine (G)-cytosine (C) and adenine (A)-thymine (T)/uracil (U). It will be understood that oligonucleotides may comprise nucleosides with modified nucleobases, for example 5-methyl cytosine is often used in place of cytosine, and as such the term complementarity encompasses Watson Crick base-paring between non-modified and modified nucleobases (see for example Hirao et al (2012) Accounts of Chemical Research vol 45 page 2055 and Bergstrom (2009) Current Protocols in Nucleic Acid Chemistry Suppl. 37 1.4.1).
[0095] The term “% complementary” as used herein, refers to the proportion of nucleotides (in percent) of a contiguous nucleotide sequence in a nucleic acid molecule (e.g. oligonucleotide) which across the contiguous nucleotide sequence, are complementary to a reference sequence (e.g. a target sequence or sequence motif). The percentage of complementarity is thus calculated by counting the number of aligned nucleobases that are complementary (from Watson Crick base pair) between the two sequences (when aligned with the target sequence 5′-3′ and the oligonucleotide sequence from 3′-5′), dividing that number by the total number of nucleotides in the oligonucleotide and multiplying by 100. In such a comparison a nucleobase/nucleotide which does not align (form a base pair) is termed a mismatch. Insertions and deletions are not allowed in the calculation of % complementarity of a contiguous nucleotide sequence. It will be understood that in determining complementarity, chemical modifications of the nucleobases are disregarded as long as the functional capacity of the nucleobase to form Watson Crick base pairing is retained (e.g. 5′-methyl cytosine is considered identical to a cytosine for the purpose of calculating % identity).
[0096] The term “fully complementary”, refers to 100% complementarity.
[0097] Identity
[0098] The term “Identity” as used herein, refers to the proportion of nucleotides (expressed in percent) of a contiguous nucleotide sequence in a nucleic acid molecule (e.g. oligonucleotide) which across the contiguous nucleotide sequence, are identical to a reference sequence (e.g. a sequence motif). The percentage of identity is thus calculated by counting the number of aligned nucleobases that are identical (a Match) between two sequences (in the contiguous nucleotide sequence of the compound of the invention and in the reference sequence), dividing that number by the total number of nucleotides in the oligonucleotide and multiplying by 100. Therefore, Percentage of Identity=(Matches×100)/Length of aligned region (e.g. the contiguous nucleotide sequence). Insertions and deletions are not allowed in the calculation the percentage of identity of a contiguous nucleotide sequence. It will be understood that in determining identity, chemical modifications of the nucleobases are disregarded as long as the functional capacity of the nucleobase to form Watson Crick base pairing is retained (e.g. 5-methyl cytosine is considered identical to a cytosine for the purpose of calculating % identity).
[0099] Hybridization
[0100] The term “hybridizing” or “hybridizes” as used herein is to be understood as two nucleic acid strands (e.g. an oligonucleotide and a target nucleic acid) forming hydrogen bonds between base pairs on opposite strands thereby forming a duplex. The affinity of the binding between two nucleic acid strands is the strength of the hybridization. It is often described in terms of the melting temperature (T.sub.m) defined as the temperature at which half of the oligonucleotides are duplexed with the target nucleic acid. At physiological conditions T.sub.m is not strictly proportional to the affinity (Mergny and Lacroix, 2003, Oligonucleotides 13:515-537). The standard state Gibbs free energy ΔG° is a more accurate representation of binding affinity and is related to the dissociation constant (K.sub.d) of the reaction by ΔG°=−RTIn(K.sub.d), where R is the gas constant and T is the absolute temperature. Therefore, a very low ΔG° of the reaction between an oligonucleotide and the target nucleic acid reflects a strong hybridization between the oligonucleotide and target nucleic acid. ΔG° is the energy associated with a reaction where aqueous concentrations are 1 M, the pH is 7, and the temperature is 37° C. The hybridization of oligonucleotides to a target nucleic acid is a spontaneous reaction and for spontaneous reactions ΔG° is less than zero. ΔG° can be measured experimentally, for example, by use of the isothermal titration calorimetry (ITC) method as described in Hansen et al., 1965, Chem. Comm, 36-38 and Holdgate et al., 2005, Drug Discov Today. The skilled person will know that commercial equipment is available for ΔG° measurements. ΔG° can also be estimated numerically by using the nearest neighbor model as described by SantaLucia, 1998, Proc Natl Acad Sci USA. 95: 1460-1465 using appropriately derived thermodynamic parameters described by Sugimoto et al., 1995, Biochemistry 34:11211-11216 and McTigue et al., 2004, Biochemistry 43:5388-5405. In order to have the possibility of modulating its intended nucleic acid target by hybridization, oligonucleotides of the present invention hybridize to a target nucleic acid with estimated ΔG° values below −10 kcal for oligonucleotides that are 10 to 30 nucleotides in length. In some embodiments, the degree or strength of hybridization is measured by the standard state Gibbs free energy ΔG°. The oligonucleotides may hybridize to a target nucleic acid with estimated ΔG° values below −10 kcal, such as below −15 kcal, such as below −20 kcal and such as below −25 kcal for oligonucleotides that are 8 to 30 nucleotides in length. In some embodiments, the oligonucleotides hybridize to a target nucleic acid with an estimated ΔG° value of in the range of −10 to −60 kcal, such as −12 to −40, such as from −15 to −30 kcal or −16 to −27 kcal such as −18 to −25 kcal.
[0101] Target Nucleic Acid
[0102] According to the present invention, the target nucleic acid is a nucleic acid which encodes mammalian SARAF and may for example be a gene, a RNA, a mRNA, and pre-mRNA, a mature mRNA or a cDNA sequence. The target may therefore be referred to as SARAF target nucleic acid.
[0103] Suitably, the target nucleic acid encodes a SARAF protein, in particular mammalian SARAF, such as the human SARAF gene encoding pre-mRNA or mRNA sequences provided herein as SEQ ID NO: 1, 4, 5, 6, 7, 8, 9 and/or 10.
[0104] The therapeutic oligonucleotide of the invention may for example target exon regions of a mammalian SARAF (in particular siRNA and shRNA, but also antisense oligonucleotides), or may for example target any intron region in the SARAF pre-mRNA (in particular antisense oligonucleotides). The human SARAF gene encodes 14 transcripts, seven of which are protein coding and therefore potential nucleic acid targets. The protein coding transcripts are variants 1 to 7 in Table 3.
[0105] Table 1 lists predicted exon and intron regions of SEQ ID NO: 1, i.e. of the human SARAF pre-mRNA sequence.
TABLE-US-00001 TABLE 1 Exon and intron regions in the human SARAF pre-mRNA. Exonic regions in the Intronic regions in the human SARAF premRNA human SARAF premRNA (SEQ ID NO: 1) (SEQ ID NO: 1) ID start end ID start end E1 2 362 I1 363 9153 E2 9154 9332 I2 9333 13149 E3 13150 13567 I3 13568 16290 E4 16291 16432 I4 16433 17069 E5 17070 17221 I5 17222 19295 E6 19296 20197
[0106] Suitably, the target nucleic acid encodes a SARAF protein, in particular mammalian SARAF, such as human SARAF (See for example Table 2 and Table 3) which provides an overview on the genomic sequences of human, cyno monkey and mouse SARAF (Table 2) and on pre-mRNA sequences for human, monkey and mouse SARAF and for the mature mRNAs for human SARAF (Table 3).
[0107] In some embodiments, the target nucleic acid is selected from the group consisting of SEQ ID NO: 1, 2, 3, 4, 6, 7, 8, 9 and/or 10, or naturally occurring variants thereof (e.g. sequences encoding a mammalian SARAF).
TABLE-US-00002 TABLE 2 Genome and assembly information for SARAF across species. Genomic coordinates ensembl Species Chr. Strand Start End Assembly gene_id Human 8 Rv 30063012 30083208 GRCh38: CM000670.2 ENSG00000133872 Cyno 8 Rv 30610159 30630048 Macaca_fascicularis_5.0 ENSMFAG00000046215 monkey Mouse 8 Fwd 34154575 34170821 GRCm38: CM001001.2 ENSMUSG00000031532 Fwd = forward strand. Rv = reverse strand. The genome coordinates provide the pre-mRNA sequence (genomic sequence).
[0108] If employing the nucleic acid molecule of the invention in research or diagnostics the target nucleic acid may be a cDNA or a synthetic nucleic acid derived from DNA or RNA.
[0109] For in vivo or in vitro application, the therapeutic nucleic acid molecule of the invention is typically capable of inhibiting the expression of the SARAF target nucleic acid in a cell which is expressing the SARAF target nucleic acid. In some embodiments, said cell comprises HBV cccDNA. The contiguous sequence of nucleobases of the nucleic acid molecule of the invention is typically complementary to a conserved region of the SARAF target nucleic acid, as measured across the length of the nucleic acid molecule, optionally with the exception of one or two mismatches, and optionally excluding nucleotide based linker regions which may link the oligonucleotide to an optional functional group such as a conjugate, or other non-complementary terminal nucleotides. The target nucleic acid is a messenger RNA, such as a pre-mRNA which encodes mammalian SARAF protein, such as human SARAF, e.g. the human SARAF pre-mRNA sequence, such as that disclosed as SEQ ID NO: 1, the monkey SARAF pre-mRNA sequence, such as that disclosed as SEQ ID NO: 2, or the mouse SARAF pre-mRNA sequence, such as that disclosed as SEQ ID NO: 3, or a mature SARAF mRNA, such as that a human mature mRNA disclosed as SEQ ID NO: 4, 5, 6, 7, 8, 9 or 10. SEQ ID NOs: 1-10 are DNA sequences—it will be understood that target RNA sequences have uracil (U) bases in place of the thymidine bases (T).
[0110] Further information on exemplary target nucleic acids is provided in Tables 2 and 3.
TABLE-US-00003 TABLE 3 Overview on target nucleic acids. Target Nucleic Acid, Species, Reference Sequence ID SARAF Homo sapiens pre-mRNA SEQ ID NO: 1 SARAF Macaca fascicularis pre-mRNA SEQ ID NO: 2 SARAF Mus musculus pre-mRNA SEQ ID NO: 3 SARAF Homo sapiens mature mRNA, SEQ ID NO: 4 variant 1 (ENST00000256255.10) SARAF Homo sapiens mature mRNA, SEQ ID NO: 5 variant 2 (ENST00000521265.5) SARAF Homo sapiens mature mRNA, SEQ ID NO: 6 variant 3 (ENST00000518296.5) SARAF Homo sapiens mature mRNA, SEQ ID NO: 7 variant 4 (ENST00000523127.5) SARAF Homo sapiens mature mRNA, SEQ ID NO: 8 variant 5 (ENST00000522794.1) SARAF Homo sapiens mature mRNA, SEQ ID NO: 9 variant 6 (ENST00000545648.2) SARAF Homo sapiens mature mRNA, SEQ ID NO: 10 variant 7 (ENST00000523761.1)
[0111] In some embodiments, the target nucleic acid is SEQ ID NO: 1.
[0112] In some embodiments, the target nucleic acid is SEQ ID NO: 2.
[0113] In some embodiments, the target nucleic acid is SEQ ID NO: 3.
[0114] In some embodiments, the target nucleic acid is SEQ ID NO: 4.
[0115] In some embodiments, the target nucleic acid is SEQ ID NO: 5.
[0116] In some embodiments, the target nucleic acid is SEQ ID NO: 6.
[0117] In some embodiments, the target nucleic acid is SEQ ID NO: 7.
[0118] In some embodiments, the target nucleic acid is SEQ ID NO: 8.
[0119] In some embodiments, the target nucleic acid is SEQ ID NO: 9.
[0120] In some embodiments, the target nucleic acid is SEQ ID NO: 10.
[0121] In some embodiments, the target nucleic acid is SEQ ID NO: 1, 4, 5, 6, 7, 8, 9 and/or 10.
[0122] In some embodiments, the target nucleic acid is SEQ ID NO: 1, 4 and/or 5.
[0123] In some embodiments, the target nucleic acid is SEQ ID NO: 1 and/or 4.
[0124] Target Sequence
[0125] The term “target sequence” as used herein refers to a sequence of nucleotides present in the target nucleic acid which comprises the nucleobase sequence which is complementary to the oligonucleotide or nucleic acid molecule of the invention. In some embodiments, the target sequence consists of a region on the target nucleic acid with a nucleobase sequence that is complementary to the contiguous nucleotide sequence of the oligonucleotide of the invention. This region of the target nucleic acid may interchangeably be referred to as the target nucleotide sequence, target sequence or target region. In some embodiments, the target sequence is longer than the complementary sequence of a nucleic acid molecule of the invention, and may, for example represent a preferred region of the target nucleic acid which may be targeted by several nucleic acid molecules of the invention.
[0126] In some embodiments, the target sequence is a sequence selected from the group consisting of a human SARAF mRNA exon, such as a human SARAF mRNA exon selected from the group consisting of E1, E2, E3, E4, E5 and E6 (see for example Table 1 above).
[0127] Accordingly, the invention provides for an oligonucleotide, wherein said oligonucleotide comprises a contiguous sequence which is at least 90% complementary, such as fully complementary to an exon region of SEQ ID NO: 1, selected from the group consisting of E1-E6 (see Table 1).
[0128] In some embodiments, the target sequence is a sequence selected from the group consisting of a human SARAF mRNA intron, such as a human SARAF mRNA intron selected from the group consisting of I1, I2, I3, I4 and I5 (see for example Table 1 above).
[0129] Accordingly, the invention provides for an oligonucleotide, wherein said oligonucleotide comprises a contiguous sequence which is at least 90% complementary, such as fully complementary to an intron region of SEQ ID NO: 1, selected from the group consisting of I1-I5 (see Table 1).
[0130] In some embodiments, the target sequence is selected from the group consisting of SEQ ID NOs: 11, 12, 13 and 14. In some embodiments, the contiguous nucleotide sequence as referred to herein is at least 90% complementary, such as at least 95% complementary to a target sequence selected from the group consisting of SEQ ID NOs: 11, 12, 13 and 14. In some embodiments, the contiguous nucleotide sequence is fully complementary to a target sequence selected from the group consisting of SEQ ID NOs: 11, 12, 13 and 14.
[0131] The oligonucleotide of the invention comprises a contiguous nucleotide sequence which is complementary to or hybridizes to a region on the target nucleic acid, such as a target sequence described herein.
[0132] The target nucleic acid sequence to which the therapeutic oligonucleotide is complementary or hybridizes to generally comprises a stretch of contiguous nucleobases of at least 10 nucleotides. The contiguous nucleotide sequence is between 12 to 70 nucleotides, such as 12 to 50, such as 13 to 30, such as 14 to 25, such as 15 to 20, such as 16 to 18 contiguous nucleotides.
[0133] In some embodiments, the oligonucleotide of the present invention targets a region shown in Table 4 or 5.
TABLE-US-00004 TABLE 4 Exemplary target regions Target start SEQ end SEQ region ID NO: 1 ID NO: 1 1A 149 164 2A 185 199 3A 239 266 4A 268 292 5A 312 327 6A 329 374 7A 395 429 8A 431 464 9A 466 488 10A 522 539 11A 560 587 12A 599 638 13A 666 706 14A 713 732 15A 734 768 16A 784 798 17A 806 887 18A 857 871 19A 857 874 20A 917 938 21A 926 955 22A 1021 1050 23A 1023 1043 24A 1055 1076 25A 1078 1095 26A 1083 1103 27A 1083 1098 28A 1088 1103 29A 1107 1147 30A 1118 1145 31A 1120 1134 32A 1195 1258 33A 1301 1323 34A 1325 1384 35A 1386 1421 36A 1427 1449 37A 1460 1477 38A 1506 1607 39A 1604 1620 40A 1626 1666 41A 1690 1704 42A 1707 1725 43A 1727 1747 44A 1757 1785 45A 1788 1806 46A 1822 1848 47A 1850 1868 48A 1874 1894 49A 1916 1935 50A 1938 1983 51A 1985 2025 52A 2027 2053 53A 2036 2052 54A 2048 2064 55A 2093 2107 56A 2130 2155 57A 2161 2196 58A 2180 2196 59A 2184 2200 60A 2202 2216 61A 2220 2240 62A 2233 2247 63A 2288 2302 64A 2298 2328 65A 2300 2322 66A 2316 2343 67A 2318 2332 68A 2351 2367 69A 2426 2460 70A 2477 2501 71A 2515 2532 72A 2534 2561 73A 2596 2648 74A 2660 2684 75A 2686 2721 76A 2757 2826 77A 2828 2864 78A 2878 2902 79A 2904 2930 80A 2932 2955 81A 2957 3005 82A 3030 3097 83A 3099 3128 84A 3132 3161 85A 3184 3216 86A 3218 3252 87A 3255 3307 88A 3313 3414 89A 3423 3446 90A 3462 3477 91A 3479 3511 92A 3514 3530 93A 3532 3557 94A 3559 3575 95A 3577 3600 96A 3602 3714 97A 3728 3762 98A 3783 3798 99A 3801 3818 100A 3820 3839 101A 3841 3878 102A 3882 3933 103A 3960 4028 104A 4028 4045 105A 4029 4043 106A 4033 4051 107A 4036 4064 108A 4039 4067 109A 4073 4093 110A 4102 4120 111A 4122 4148 112A 4131 4148 113A 4139 4159 114A 4147 4161 115A 4149 4165 116A 4153 4175 117A 4154 4171 118A 4183 4209 119A 4194 4209 120A 4197 4211 121A 4213 4236 122A 4216 4230 123A 4225 4240 124A 4242 4267 125A 4269 4287 126A 4283 4305 127A 4316 4333 128A 4339 4373 129A 4375 4389 130A 4405 4434 131A 4447 4479 132A 4485 4503 133A 4501 4529 134A 4531 4577 135A 4602 4663 136A 4665 4699 137A 4701 4744 138A 4746 4764 139A 4766 4784 140A 4818 4844 141A 4846 4892 142A 4895 4935 143A 4959 5009 144A 5011 5026 145A 5014 5028 146A 5052 5067 147A 5055 5069 148A 5055 5072 149A 5060 5081 150A 5084 5110 151A 5098 5114 152A 5127 5143 153A 5173 5188 154A 5177 5207 155A 5179 5195 156A 5183 5197 157A 5195 5211 158A 5208 5239 159A 5209 5232 160A 5214 5228 161A 5214 5238 162A 5220 5240 163A 5227 5250 164A 5238 5256 165A 5258 5273 166A 5264 5291 167A 5299 5326 168A 5347 5366 169A 5368 5383 170A 5383 5398 171A 5400 5426 172A 5414 5429 173A 5428 5452 174A 5436 5452 175A 5454 5474 176A 5462 5487 177A 5465 5481 178A 5489 5512 179A 5512 5534 180A 5522 5536 181A 5549 5564 182A 5552 5566 183A 5552 5576 184A 5564 5578 185A 5596 5630 186A 5618 5633 187A 5637 5655 188A 5643 5677 189A 5688 5703 190A 5699 5719 191A 5734 5751 192A 5765 5807 193A 5802 5817 194A 5828 5843 195A 5860 5889 196A 5891 5915 197A 5910 5950 198A 5917 5931 199A 5952 5967 200A 5982 6028 201A 5984 6006 202A 6002 6018 203A 6040 6055 204A 6057 6100 205A 6106 6131 206A 6133 6149 207A 6151 6176 208A 6178 6193 209A 6207 6236 210A 6252 6331 211A 6334 6350 212A 6366 6382 213A 6384 6414 214A 6432 6467 215A 6469 6501 216A 6502 6519 217A 6522 6549 218A 6561 6576 219A 6578 6594 220A 6606 6633 221A 6654 6681 222A 6691 6729 223A 6738 6784 224A 6779 6804 225A 6806 6871 226A 6873 6898 227A 6910 6930 228A 6932 6978 229A 6991 7020 230A 7022 7051 231A 7053 7105 232A 7131 7162 233A 7175 7196 234A 7229 7270 235A 7291 7310 236A 7330 7366 237A 7368 7397 238A 7399 7457 239A 7459 7497 240A 7507 7528 241A 7560 7603 242A 7608 7626 243A 7628 7647 244A 7649 7672 245A 7685 7726 246A 7728 7742 247A 7741 7771 248A 7797 7856 249A 7883 7906 250A 7894 7922 251A 7910 7933 252A 7936 7951 253A 7943 7994 254A 7954 7976 255A 7956 7976 256A 7979 7993 257A 8011 8028 258A 8017 8031 259A 8019 8035 260A 8023 8039 261A 8068 8087 262A 8072 8086 263A 8100 8120 264A 8140 8158 265A 8140 8169 266A 8157 8171 267A 8161 8179 268A 8209 8324 269A 8334 8363 270A 8414 8465 271A 8493 8507 272A 8539 8553 273A 8555 8582 274A 8598 8623 275A 8625 8672 276A 8680 8701 277A 8725 8742 278A 8760 8785 279A 8787 8813 280A 8842 8875 281A 8877 8982 282A 8984 9010 283A 9065 9083 284A 9096 9111 285A 9119 9146 286A 9148 9172 287A 9174 9239 288A 9241 9349 289A 9351 9368 290A 9369 9407 291A 9428 9464 292A 9466 9504 293A 9509 9530 294A 9550 9567 295A 9569 9614 296A 9625 9643 297A 9645 9679 298A 9684 9762 299A 9770 9792 300A 9840 9882 301A 9906 9936 302A 9938 9970 303A 9987 10006 304A 10016 10065 305A 10069 10160 306A 10210 10255 307A 10258 10284 308A 10286 10303 309A 10336 10377 310A 10415 10460 311A 10458 10529 312A 10521 10537 313A 10531 10555 314A 10557 10612 315A 10616 10660 316A 10666 10691 317A 10703 10752 318A 10743 10766 319A 10795 10826 320A 10828 10852 321A 10882 10908 322A 10927 10941 323A 10943 10959 324A 11022 11055 325A 11057 11072 326A 11077 11111 327A 11130 11150 328A 11152 11181 329A 11183 11199 330A 11213 11241 331A 11245 11283 332A 11298 11362 333A 11386 11402 334A 11441 11531 335A 11533 11570 336A 11582 11606 337A 11613 11656 338A 11659 11684 339A 11681 11737 340A 11766 11781 341A 11783 11809 342A 11825 11839 343A 11851 11871 344A 11859 11879 345A 11881 11895 346A 11908 11930 347A 11910 11930 348A 11918 11948 349A 11950 11990 350A 11976 11990 351A 11978 11994 352A 11982 11996 353A 12014 12030 354A 12032 12046 355A 12040 12069 356A 12071 12093 357A 12099 12121 358A 12099 12142 359A 12148 12193 360A 12213 12232 361A 12242 12270 362A 12283 12299 363A 12301 12319 364A 12334 12349 365A 12391 12428 366A 12431 12458 367A 12462 12477 368A 12503 12544 369A 12557 12605 370A 12635 12694 371A 12739 12767 372A 12769 12800 373A 12844 12869 374A 12851 12869 375A 12871 12885 376A 12880 12897 377A 12888 12916 378A 12910 12928 379A 12941 12964 380A 12946 12960 381A 12952 12967 382A 12969 13002 383A 13017 13032 384A 13042 13110 385A 13052 13070 386A 13112 13134 387A 13136 13163 388A 13165 13250 389A 13252 13268 390A 13270 13363 391A 13365 13386 392A 13388 13403 393A 13426 13454 394A 13456 13478 395A 13480 13597 396A 13601 13701 397A 13703 13722 398A 13729 13747 399A 13759 13773 400A 13770 13816 401A 13790 13804 402A 13804 13840 403A 13886 13902 404A 13890 13908 405A 13910 13930 406A 13932 13973 407A 13961 13975 408A 13994 14015 409A 14022 14050 410A 14052 14074 411A 14053 14069 412A 14054 14070 413A 14055 14071 414A 14056 14072 415A 14057 14073 416A 14058 14074 417A 14076 14092 418A 14109 14146 419A 14151 14186 420A 14210 14266 421A 14271 14302 422A 14304 14395 423A 14397 14416 424A 14423 14440 425A 14437 14453 426A 14482 14504 427A 14506 14528 428A 14530 14594 429A 14619 14635 430A 14655 14672 431A 14686 14704 432A 14706 14750 433A 14751 14796 434A 14802 14823 435A 14834 14865 436A 14879 14906 437A 14908 14924 438A 14926 14952 439A 14954 14982 440A 14999 15013 441A 15028 15046 442A 15048 15063 443A 15075 15094 444A 15118 15141 445A 15145 15205 446A 15245 15260 447A 15288 15310 448A 15337 15353 449A 15355 15384 450A 15386 15401 451A 16043 16069 452A 16071 16113 453A 16115 16191 454A 16193 16216 455A 16245 16294 456A 16296 16333 457A 16335 16384 458A 16389 16448 459A 16456 16475 460A 16484 16510 461A 16513 16528 462A 16542 16585 463A 16606 16622 464A 16662 16698 465A 16700 16715 466A 16733 16760 467A 16762 16802 468A 16804 16821 469A 16848 16878 470A 16889 16917 471A 16919 16936 472A 16938 16978 473A 16982 17006 474A 17014 17049 475A 17061 17087 476A 17089 17105 477A 17107 17132 478A 17143 17158 479A 17184 17201 480A 17203 17244 481A 17250 17269 482A 17310 17329 483A 17326 17347 484A 17356 17373 485A 17375 17396 486A 17412 17449 487A 17475 17535 488A 17537 17553 489A 17555 17578 490A 17584 17601 491A 17632 17654 492A 17665 17683 493A 17698 17734 494A 17778 17807 495A 17809 17851 496A 17865 17884 497A 17886 17922 498A 17936 17958 499A 17963 17982 500A 17984 18009 501A 18011 18029 502A 18031 18054 503A 18056 18132 504A 18143 18193 505A 18195 18222 506A 18224 18259 507A 18271 18287 508A 18302 18354 509A 18400 18425 51OA 18461 18491 511A 18502 18516 512A 18529 18543 513A 18565 18585 514A 18587 18615 515A 18623 18643 516A 18630 18646 517A 18631 18647 518A 18635 18660 519A 18661 18699 520A 18709 18732 521A 18749 18800 522A 18843 18865 523A 18913 18951 524A 18953 19030 525A 19032 19047 526A 19050 19090 527A 19108 19150 528A 19152 19172 529A 19174 19208 530A 19210 19343 531A 19345 19369 532A 19371 19390 533A 19396 19417 534A 19419 19437 535A 19456 19492 536A 19494 19618 537A 19620 19676 538A 19678 19700 539A 19702 19718 540A 19735 19778 541A 19780 19832
[0134] In some embodiments, the target sequence is selected from the group consisting of target regions 1A to 541A as shown in Table 4 above.
TABLE-US-00005 TABLE 5 Exemplary target regions Target start SEQ end SEQ region ID NO: 1 ID NO: 1 1C 344 370 2C 564 577 3C 735 760 4C 857 870 5C 858 872 6C 858 871 7C 859 872 8C 1463 1477 9C 1579 1592 10C 1957 1970 11C 3268 3282 12C 3559 3575 13C 3907 3920 14C 4029 4042 15C 4030 4044 16C 4030 4043 17C 4031 4045 18C 4031 4044 19C 4032 4046 20C 4032 4045 21C 4033 4047 22C 4033 4046 23C 4034 4048 24C 4034 4047 25C 4035 4049 26C 4035 4048 27C 4036 4050 28C 4036 4051 29C 4036 4049 30C 4037 4051 31C 4037 4050 32C 4038 4051 33C 5014 5027 34C 5015 5028 35C 5055 5068 36C 5056 5070 37C 5056 5069 38C 5057 5070 39C 5765 5780 40C 7205 7218 41C 7891 7907 42C 7893 7907 43C 7893 7906 44C 7894 7908 45C 7894 7909 46C 7894 7907 47C 7895 7909 48C 7895 7908 49C 7896 7909 50C 9177 9191 51C 9246 9259 52C 9300 9319 53C 9324 9338 54C 12787 12800 55C 13143 13163 56C 13171 13190 57C 13192 13217 58C 13219 13241 59C 13298 13322 60C 13339 13353 61C 13558 13579 62C 13795 13808 63C 14052 14071 64C 14052 14070 65C 14053 14067 66C 14053 14068 67C 14054 14068 680 14054 14069 69C 14055 14069 70C 14055 14070 71C 14056 14070 72C 14056 14071 73C 14057 14071 74C 14057 14072 75C 14058 14072 76C 14058 14073 77C 14059 14073 78C 14059 14074 79C 14060 14074 80C 16413 16429 81C 18629 18647 82C 18630 18644 83C 18630 18645 84C 18631 18645 85C 18631 18646 86C 18632 18646 87C 18632 18647 88C 18633 18647 89C 18990 19007 90C 19292 19305 91C 19750 19774
[0135] In some embodiments, the target sequence is selected from the group consisting of target regions 1C to 91C as shown in Table 5 above.
[0136] Target Cell
[0137] The term a “target cell” as used herein refers to a cell which is expressing the target nucleic acid. For the therapeutic use of the present invention it is advantageous if the target cell is infected with HBV. In some embodiments, the target cell may be in vivo or in vitro. In some embodiments, the target cell is a mammalian cell such as a rodent cell, such as a mouse cell or a rat cell, or a woodchuck cell or a primate cell such as a monkey cell (e.g. a cynomolgus monkey cell) or a human cell.
[0138] In preferred embodiments, the target cell expresses SARAF mRNA, such as the SARAF pre-mRNA or SARAF mature mRNA. The poly A tail of SARAF mRNA is typically disregarded for antisense oligonucleotide targeting.
[0139] Further, the target cell may be a hepatocyte. In one embodiment, the target cell is HBV infected primary human hepatocytes, either derived from HBV infected individuals or from a HBV infected mouse with a humanized liver (PhoenixBio, PXB-mouse).
[0140] In accordance with the present invention, the target cell may be infected with HBV. Further, the target cell may comprise HBV cccDNA. Thus, the target cell preferably comprises SARAF mRNA, such as the SARAF pre-mRNA or SARAF mature mRNA, and HBV cccDNA.
[0141] Naturally Occurring Variant
[0142] The term “naturally occurring variant” refers to variants of SARAF gene or transcripts which originate from the same genetic loci as the target nucleic acid, but may differ for example, by virtue of degeneracy of the genetic code causing a multiplicity of codons encoding the same amino acid, or due to alternative splicing of pre-mRNA, or the presence of polymorphisms, such as single nucleotide polymorphisms (SNPs), and allelic variants. Based on the presence of the sufficient complementary sequence to the oligonucleotide, the oligonucleotide of the invention may therefore target the target nucleic acid and naturally occurring variants thereof.
[0143] In some embodiments, the naturally occurring variants have at least 95% such as at least 98% or at least 99% homology to a mammalian SARAF target nucleic acid, such as a target nucleic acid of SEQ ID NO: 1 and/or SEQ ID NO: 2. In some embodiments, the naturally occurring variants have at least 99% homology to the human SARAF target nucleic acid of SEQ ID NO: 1. In some embodiments, the naturally occurring variants are known polymorphisms.
[0144] Inhibition of Expression
[0145] The term “inhibition of expression” as used herein is to be understood as an overall term for an SARAF (Store-operated calcium entry-associated regulatory factor) inhibitor's ability to inhibit, i.e. to reduce, the amount or the activity of SARAF in a target cell. Inhibition of expression or activity may be determined by measuring the level of SARAF pre-mRNA or SARAF mRNA, or by measuring the level of SARAF protein or activity in a cell. Inhibition of expression may be determined in vitro or in vivo. Advantageously, the inhibition is assessed in relation to the amount of SARAF before administration of the SARAF inhibitor. Alternatively, inhibition is determined by reference to a control. It is generally understood that the control is an individual or target cell treated with a saline composition or an individual or target cell treated with a non-targeting oligonucleotide (mock).
[0146] The term “inhibition” or “inhibit” may also be referred to as down-regulate, reduce, suppress, lessen, lower, decrease the expression or activity of SARAF.
[0147] The inhibition of expression of SARAF may occur e.g. by degradation of pre-mRNA or mRNA e.g. using RNase H recruiting oligonucleotides, such as gapmers, or nucleic acid molecules that function via the RNA interference pathway, such as siRNA or shRNA. Alternatively, the inhibitor of the present invention may bind to SARAF polypeptide and inhibit the activity of SARAF or prevent its binding to other molecules.
[0148] In some embodiments, the inhibition of expression of the SARAF target nucleic acid or the activity of SARAF protein results in a decreased amount of HBV cccDNA in the target cell. Preferably, the amount of HBV cccDNA is decreased as compared to a control. In some embodiments, the decrease in amount of HBV cccDNA is at least 20%, at least 30%, as compared to a control. In some embodiments, the amount of cccDNA in an HBV infected cell is reduced by at least 50%, such as 60%, when compared to a control.
[0149] In some embodiments, the inhibition of expression of the SARAF target nucleic acid or the activity of SARAF protein results in a decreased amount of HBV pgRNA in the target cell. Preferably, the amount of HBV pgRNA is decreased as compared to a control. In some embodiments, the decrease in amount of HBV pgRNA is at least 20%, at least 30%, as compared to a control. In some embodiments, the amount of pgRNA in an HBV infected cell is reduced by at least 50%, such as 60%, when compared to a control.
[0150] Sugar Modifications
[0151] The oligonucleotide of the invention may comprise one or more nucleosides which have a modified sugar moiety, i.e. a modification of the sugar moiety when compared to the ribose sugar moiety found in DNA and RNA.
[0152] Numerous nucleosides with modification of the ribose sugar moiety have been made, primarily with the aim of improving certain properties of oligonucleotides, such as affinity and/or nuclease resistance.
[0153] Such modifications include those where the ribose ring structure is modified, e.g. by replacement with a hexose ring (HNA), or a bicyclic ring, which typically have a biradical bridge between the C2 and C4 carbons on the ribose ring (LNA), or an unlinked ribose ring which typically lacks a bond between the C2 and C3 carbons (e.g. UNA). Other sugar modified nucleosides include, for example, bicyclohexose nucleic acids (WO2011/017521) or tricyclic nucleic acids (WO2013/154798). Modified nucleosides also include nucleosides where the sugar moiety is replaced with a non-sugar moiety, for example in the case of peptide nucleic acids (PNA), or morpholino nucleic acids.
[0154] Sugar modifications also include modifications made via altering the substituent groups on the ribose ring to groups other than hydrogen, or the 2′-OH group naturally found in DNA and RNA nucleosides. Substituents may, for example be introduced at the 2′, 3′, 4′ or 5′ positions.
[0155] High Affinity Modified Nucleosides
[0156] A high affinity modified nucleoside is a modified nucleotide which, when incorporated into the oligonucleotide enhances the affinity of the oligonucleotide for its complementary target, for example as measured by the melting temperature (T.sup.m). A high affinity modified nucleoside of the present invention preferably result in an increase in melting temperature in the range of +0.5 to +12° C., more preferably in the range of +1.5 to +10° C. and most preferably in the range of +3 to +8° C. per modified nucleoside. Numerous high affinity modified nucleosides are known in the art and include for example, many 2′ substituted nucleosides as well as locked nucleic acids (LNA) (see e.g. Freier & Altmann; Nucl. Acid Res., 1997, 25, 4429-4443 and Uhlmann; Curr. Opinion in Drug Development, 2000, 3(2), 293-213).
[0157] 2′ Sugar Modified Nucleosides
[0158] A 2′ sugar modified nucleoside is a nucleoside which has a substituent other than H or —OH at the 2′ position (2′ substituted nucleoside) or comprises a 2′ linked biradical capable of forming a bridge between the 2′ carbon and a second carbon in the ribose ring, such as LNA (2′-4′ biradical bridged) nucleosides.
[0159] Indeed, much focus has been spent on developing 2′ sugar substituted nucleosides, and numerous 2′ substituted nucleosides have been found to have beneficial properties when incorporated into oligonucleotides. For example, the 2′ modified sugar may provide enhanced binding affinity and/or increased nuclease resistance to the oligonucleotide. Examples of 2′ substituted modified nucleosides are 2′-O-alkyl-RNA, 2′-O-methyl-RNA, 2′-alkoxy-RNA, 2′-O-methoxyethyl-RNA (MOE), 2′-amino-DNA, 2′-Fluoro-RNA, and 2′-F-ANA nucleoside. For further examples, please see e.g. Freier & Altmann; Nucl. Acid Res., 1997, 25, 4429-4443 and Uhlmann; Curr. Opinion in Drug Development, 2000, 3(2), 293-213, and Deleavey and Damha, Chemistry and Biology 2012, 19, 937. Below are illustrations of some 2′ substituted modified nucleosides.
##STR00001##
[0160] In relation to the present invention 2′ substituted sugar modified nucleosides does not include 2′ bridged nucleosides like LNA.
[0161] Locked Nucleic Acid Nucleosides (LNA Nucleoside)
[0162] A “LNA nucleoside” is a 2′-sugar modified nucleoside which comprises a biradical linking the C2′ and C4′ of the ribose sugar ring of said nucleoside (also referred to as a “2′-4′ bridge”), which restricts or locks the conformation of the ribose ring. These nucleosides are also termed bridged nucleic acid or bicyclic nucleic acid (BNA) in the literature. The locking of the conformation of the ribose is associated with an enhanced affinity of hybridization (duplex stabilization) when the LNA is incorporated into an oligonucleotide for a complementary RNA or DNA molecule. This can be routinely determined by measuring the melting temperature of the oligonucleotide/complement duplex.
[0163] Non limiting, exemplary LNA nucleosides are disclosed in WO 99/014226, WO 00/66604, WO 98/039352, WO 2004/046160, WO 00/047599, WO 2007/134181, WO 2010/077578, WO 2010/036698, WO 2007/090071, WO 2009/006478, WO 2011/156202, WO 2008/154401, WO 2009/067647, WO 2008/150729, Morita et al., Bioorganic & Med. Chem. Lett. 12, 73-76, Seth et al. J. Org. Chem. 2010, Vol 75(5) pp. 1569-81, Mitsuoka et al., Nucleic Acids Research 2009, 37(4), 1225-1238, and Wan and Seth, J. Medical Chemistry 2016, 59, 9645-9667.
[0164] Particular examples of LNA nucleosides of the invention are presented in Scheme 1 (wherein B is as defined above).
##STR00002##
[0165] RNase H Activity and Recruitment
[0166] The RNase H activity of an antisense oligonucleotide refers to its ability to recruit RNase H when in a duplex with a complementary RNA molecule. WO01/23613 provides in vitro methods for determining RNase H activity, which may be used to determine the ability to recruit RNase H. Typically an oligonucleotide is deemed capable of recruiting RNase H if it, when provided with a complementary target nucleic acid sequence, has an initial rate, as measured in pmol/l/min, of at least 5%, such as at least 10% or more than 20% of the of the initial rate determined when using a oligonucleotide having the same base sequence as the modified oligonucleotide being tested, but containing only DNA monomers with phosphorothioate linkages between all monomers in the oligonucleotide, and using the methodology provided by Example 91-95 of WO 01/23613 (hereby incorporated by reference). For use in determining RNase H activity, recombinant human RNase H1 is available from Creative Biomart® (Recombinant Human RNase H1 fused with His tag expressed in E. coli).
[0167] Gapmer
[0168] The antisense oligonucleotide of the invention, or contiguous nucleotide sequence thereof, may be a gapmer, also termed gapmer oligonucleotide or gapmer designs. The antisense gapmers are commonly used to inhibit a target nucleic acid via RNase H mediated degradation. A gapmer oligonucleotide comprises at least three distinct structural regions a 5′-flank, a gap and a 3′-flank, F-G-F′ in the ‘5->3’ orientation. The “gap” region (G) comprises a stretch of contiguous DNA nucleotides which enable the oligonucleotide to recruit RNase H. The gap region is flanked by a 5′ flanking region (F) comprising one or more sugar modified nucleosides, advantageously high affinity sugar modified nucleosides, and by a 3′ flanking region (F′) comprising one or more sugar modified nucleosides, advantageously high affinity sugar modified nucleosides. The one or more sugar modified nucleosides in region F and F′ enhance the affinity of the oligonucleotide for the target nucleic acid (i.e. are affinity enhancing sugar modified nucleosides). In some embodiments, the one or more sugar modified nucleosides in region F and F′ are 2′ sugar modified nucleosides, such as high affinity 2′ sugar modifications, such as independently selected from LNA and 2′-MOE.
[0169] In a gapmer design, the 5′ and 3′ most nucleosides of the gap region are DNA nucleosides, and are positioned adjacent to a sugar modified nucleoside of the 5′ (F) or 3′ (F′) region respectively. The flanks may further be defined by having at least one sugar modified nucleoside at the end most distant from the gap region, i.e. at the 5′ end of the 5′ flank and at the 3′ end of the 3′ flank.
[0170] Regions F-G-F′ form a contiguous nucleotide sequence. Antisense oligonucleotides of the invention, or the contiguous nucleotide sequence thereof, may comprise a gapmer region of formula F-G-F′.
[0171] The overall length of the gapmer design F-G-F′ may be, for example 12 to 32 nucleosides, such as 13 to 24, such as 14 to 22 nucleosides, such as from 15 to 20, such as 16 to 18 nucleosides.
[0172] By way of example, the gapmer oligonucleotide of the present invention can be represented by the following formulae:
F.sub.1-8-G.sub.5-18-F′.sub.1-8,such as
F.sub.1-8-G.sub.7-18-F′.sub.2-8
with the proviso that the overall length of the gapmer regions F-G-F′ is at least 12, such as at least 14 nucleotides in length.
[0173] In an aspect of the invention, the antisense oligonucleotide or contiguous nucleotide sequence thereof consists of or comprises a gapmer of formula 5′-F-G-F′-3′, where region F and F′ independently comprise or consist of 1-8 nucleosides, of which 1-4 are 2′ sugar modified and defines the 5′ and 3′ end of the F and F′ region, and G is a region between 6 and 18 nucleosides which are capable of recruiting RNase H. In some embodiments, the G region consists of DNA nucleosides.
[0174] In some embodiments, region F and F′ independently consists of or comprises a contiguous sequence of sugar modified nucleosides. In some embodiments, the sugar modified nucleosides of region F may be independently selected from 2′-O-alkyl-RNA units, 2′-O-methyl-RNA, 2′-amino-DNA units, 2′-fluoro-DNA units, 2′-alkoxy-RNA, MOE units, LNA units, arabino nucleic acid (ANA) units and 2′-fluoro-ANA units.
[0175] In some embodiments, region F and F′ independently comprises both LNA and a 2′-substituted sugar modified nucleotide (mixed wing design). In some embodiments, the 2′-substituted sugar modified nucleotide is independently selected from the group consisting of 2′-O-alkyl-RNA units, 2′-O-methyl-RNA, 2′-amino-DNA units, 2′-fluoro-DNA units, 2′-alkoxy-RNA, MOE units, arabino nucleic acid (ANA) units and 2′-fluoro-ANA units.
[0176] In some embodiments, all the modified nucleosides of region F and F′ are LNA nucleosides, such as independently selected from beta-D-oxy LNA, ENA or ScET nucleosides, wherein region F or F′, or F and F′ may optionally comprise DNA nucleosides. In some embodiments, all the modified nucleosides of region F and F′ are beta-D-oxy LNA nucleosides, wherein region F or F′, or F and F′ may optionally comprise DNA nucleosides. In such embodiments, the flanking region F or F′, or both F and F′ comprise at least three nucleosides, wherein the 5′ and 3′ most nucleosides of the F and/or F′ region are LNA nucleosides.
[0177] LNA Gapmer
[0178] An LNA gapmer is a gapmer wherein either one or both of region F and F′ comprises or consists of LNA nucleosides. A beta-D-oxy gapmer is a gapmer wherein either one or both of region F and F′ comprises or consists of beta-D-oxy LNA nucleosides.
[0179] In some embodiments, the LNA gapmer is of formula: [LNA].sub.1-5-[region G].sub.6-18-[LNA].sub.1-5, wherein region G is as defined in the Gapmer region G definition.
[0180] MOE Gapmers
[0181] A MOE gapmers is a gapmer wherein regions F and F′ consist of MOE nucleosides. In some embodiments, the MOE gapmer is of design [MOE].sub.1-8-[Region G].sub.5-16-[MOE].sub.1-8, such as [MOE].sub.2-7-[Region G].sub.6-14-[MOE].sub.2-7, such as [MOE].sub.3-6-[Region G].sub.8-12-[MOE].sub.3-6, such as [MOE].sub.5-[Region G].sub.10-[MOE].sub.5 wherein region G is as defined in the Gapmer definition. MOE gapmers with a 5-10-5 design (MOE-DNA-MOE) have been widely used in the art.
[0182] Region D′ or D″ in an Oligonucleotide
[0183] The oligonucleotide of the invention may in some embodiments comprise or consist of the contiguous nucleotide sequence of the oligonucleotide which is complementary to the target nucleic acid, such as a gapmer region F-G-F′, and further 5′ and/or 3′ nucleosides. The further 5′ and/or 3′ nucleosides may or may not be fully complementary to the target nucleic acid. Such further 5′ and/or 3′ nucleosides may be referred to as region D′ and D″ herein.
[0184] The addition of region D′ or D″ may be used for the purpose of joining the contiguous nucleotide sequence, such as the gapmer, to a conjugate moiety or another functional group. When used for joining the contiguous nucleotide sequence with a conjugate moiety is can serve as a biocleavable linker. Alternatively, it may be used to provide exonuclease protection or for ease of synthesis or manufacture.
[0185] Region D′ and D″ can be attached to the 5′ end of region F or the 3′ end of region F′, respectively to generate designs of the following formulas D′-F-G-F′, F-G-F′-D″ or D′-F-G-F′-D″. In this instance the F-G-F′ is the gapmer portion of the oligonucleotide and region D′ or D″ constitute a separate part of the oligonucleotide.
[0186] Region D′ or D″ may independently comprise or consist of 1, 2, 3, 4 or 5 additional nucleotides, which may be complementary or non-complementary to the target nucleic acid. The nucleotide adjacent to the F or F′ region is not a sugar-modified nucleotide, such as a DNA or RNA or base modified versions of these. The D′ or D″ region may serve as a nuclease susceptible biocleavable linker (see definition of linkers). In some embodiments, the additional 5′ and/or 3′ end nucleotides are linked with phosphodiester linkages, and are DNA or RNA. Nucleotide based biocleavable linkers suitable for use as region D′ or D″ are disclosed in WO2014/076195, which include by way of example a phosphodiester linked DNA dinucleotide. The use of biocleavable linkers in poly-oligonucleotide constructs is disclosed in WO2015/113922, where they are used to link multiple antisense constructs (e.g. gapmer regions) within a single oligonucleotide.
[0187] In one embodiment, the oligonucleotide of the invention comprises a region D′ and/or D″ in addition to the contiguous nucleotide sequence which constitutes the gapmer.
[0188] In some embodiments, the oligonucleotide of the present invention can be represented by the following formulae:
F-G-F′; in particular F.sub.1-8-G.sub.5-18-F′.sub.2-8
D′-F-G-F′, in particular D′.sub.1-3-F.sub.1-8-G.sub.5-18-F′.sub.2-8
F-G-F′-D″, in particular F.sub.1-8-G.sub.5-18-F′.sub.2-8-D″.sub.1-3
D′-F-G-F′-D″, in particular D′.sub.1-3-F.sub.1-8-G.sub.5-18-F′.sub.2-8-D″.sub.1-3
[0189] In some embodiments, the internucleoside linkage positioned between region D′ and region F is a phosphodiester linkage. In some embodiments, the internucleoside linkage positioned between region F′ and region D″ is a phosphodiester linkage.
[0190] Conjugate
[0191] The term conjugate as used herein refers to an oligonucleotide which is covalently linked to a non-nucleotide moiety (conjugate moiety or region C or third region). The conjugate moiety may be covalently linked to the antisense oligonucleotide, optionally via a linker group, such as region D′ or D″.
[0192] Oligonucleotide conjugates and their synthesis have been reported in comprehensive reviews by Manoharan in Antisense Drug Technology, Principles, Strategies, and Applications, S. T. Crooke, ed., Ch. 16, Marcel Dekker, Inc., 2001 and Manoharan, Antisense and Nucleic Acid Drug Development, 2002, 12, 103, each of which is incorporated herein by reference in its entirety.
[0193] In some embodiments, the non-nucleotide moiety (conjugate moiety) is selected from the group consisting of carbohydrates (e.g. galactose or N-acetylgalactosamine (GalNAc)), cell surface receptor ligands, drug substances, hormones, lipophilic substances, polymers, proteins (e.g. antibodies), peptides, toxins (e.g. bacterial toxins), vitamins, viral proteins (e.g. capsids) or combinations thereof.
[0194] Exemplary conjugate moieties are those capable of binding to the asialoglycoprotein receptor (ASGPR). In particular, tri-valent N-acetylgalactosamine conjugate moieties are suitable for binding to the ASGPR, see for example WO 2014/076196, WO 2014/207232 and WO 2014/179620 (hereby incorporated by reference). Such conjugates serve to enhance uptake of the oligonucleotide to the liver.
[0195] Linkers
[0196] A linkage or linker is a connection between two atoms that links one chemical group or segment of interest to another chemical group or segment of interest via one or more covalent bonds. Conjugate moieties can be attached to the oligonucleotide directly or through a linking moiety (e.g. linker or tether). Linkers serve to covalently connect a third region, e.g. a conjugate moiety (region C), to a first region, e.g. an oligonucleotide or contiguous nucleotide sequence complementary to the target nucleic acid (region A).
[0197] In some embodiments of the invention the conjugate or oligonucleotide conjugate of the invention may optionally, comprise a linker region (second region or region B and/or region Y) which is positioned between the oligonucleotide or contiguous nucleotide sequence complementary to the target nucleic acid (region A or first region) and the conjugate moiety (region C or third region).
[0198] Region B refers to biocleavable linkers comprising or consisting of a physiologically labile bond that is cleavable under conditions normally encountered or analogous to those encountered within a mammalian body. Conditions under which physiologically labile linkers undergo chemical transformation (e.g., cleavage) include chemical conditions such as pH, temperature, oxidative or reductive conditions or agents, and salt concentration found in or analogous to those encountered in mammalian cells. Mammalian intracellular conditions also include the presence of enzymatic activity normally present in a mammalian cell such as from proteolytic enzymes or hydrolytic enzymes or nucleases. In one embodiment, the biocleavable linker is susceptible to S1 nuclease cleavage. In a preferred embodiment the nuclease susceptible linker comprises between 1 and 5 nucleosides, such as 1, 2, 3, 4 or 5 nucleosides, more preferably between 2 and 4 nucleosides and most preferably 2 or 3 linked nucleosides comprising at least two consecutive phosphodiester linkages, such as at least 3 or 4 or 5 consecutive phosphodiester linkages. Preferably the nucleosides are DNA or RNA. Phosphodiester containing biocleavable linkers are described in more detail in WO 2014/076195 (hereby incorporated by reference).
[0199] Region Y refers to linkers that are not necessarily biocleavable but primarily serve to covalently connect a conjugate moiety (region C or third region), to an oligonucleotide (region A or first region). The region Y linkers may comprise a chain structure or an oligomer of repeating units such as ethylene glycol, amino acid units or amino alkyl groups The oligonucleotide conjugates of the present invention can be constructed of the following regional elements A-C, A-B-C, A-B-Y-C, A-Y-B-C or A-Y-C. In some embodiments, the linker (region Y) is an amino alkyl, such as a C2-C36 amino alkyl group, including, for example C6 to C12 amino alkyl groups. some embodiments the linker (region Y) is a C6 amino alkyl group.
[0200] Treatment
[0201] The term “treatment” as used herein refers to both treatment of an existing disease (e.g. a disease or disorder as herein referred to), or prevention of a disease, i.e. prophylaxis. It will therefore be recognized that treatment as referred to herein may, in some embodiments, be prophylactic. Prophylactic can be understood as preventing an HBV infection from turning into a chronic HBV infection or the prevention of severe liver diseases such as liver cirrhosis and hepatocellular carcinoma caused by a chronic HBV infection.
[0202] Patient
[0203] For the purposes of the present invention the “subject” (or “patient”) may be a vertebrate. In context of the present invention, the term “subject” includes both humans and other animals, particularly mammals, and other organisms. Thus, the herein provided means and methods are applicable to both human therapy and veterinary applications. Preferably, the subject is a mammal. More preferably the subject is human.
[0204] As described elsewhere herein, the patient to be treated may suffers from HBV infection, such as chronic HBV infection. In some embodiments, the patient suffering from HBV infection may suffer from hepatocellular carcinoma (HCC). In some embodiments, the patient suffering from HBV infection does not suffer from hepatocellular carcinoma.
DETAILED DESCRIPTION OF THE INVENTION
[0205] HBV cccDNA in infected hepatocytes is responsible for persistent chronic infection and reactivation, being the template for all viral subgenomic transcripts and pre-genomic RNA (pgRNA) to ensure both newly synthesized viral progeny and cccDNA pool replenishment via intracellular nucleocapsid recycling. In the context of the present invention it was for the first time shown that SARAF is associated with cccDNA stability. This knowledge allows for the opportunity to destabilize cccDNA in HBV infected subjects which in turn opens the opportunity for a complete cure of chronically infected HBV patients.
[0206] One aspect of the present invention is a SARAF inhibitor for use in the treatment and/or prevention of Hepatitis B virus (HBV) infection, in particular a chronic HBV infection.
[0207] The SARAF inhibitor can for example be a small molecule that specifically binds to SARAF protein, wherein said inhibitor prevents or reduces binding of SARAF protein to cccDNA.
[0208] An embodiment of the invention is a SARAF inhibitor which is capable of reducing cccDNA and/or pgRNA in an infected cell, such as an HBV infected cell.
[0209] In a further embodiment, the SARAF inhibitor is capable of reducing HBsAg and/or HBeAg in vivo in an HBV infected individual.
[0210] SARAF Inhibitors for Use in Treatment of HBV
[0211] Without being bound by theory, it is believed that SARAF is involved in the stabilization of the cccDNA in the cell nucleus, either via direct or indirect binding to the cccDNA, and by preventing the binding/association of SARAF with cccDNA, the cccDNA is destabilized and becomes prone to degradation. One embodiment of the invention is therefore a SARAF inhibitor which interacts with the SARAF protein, and prevents or reduces its binding/association to cccDNA.
[0212] In some embodiments of the present invention, the inhibitor is an antibody, antibody fragment or a small molecule compound. In some embodiments, the inhibitor may be an antibody, antibody fragment or a small molecule that specifically binds to the SARAF protein, such as the SARAF protein encoded by SEQ ID NO: 1, 4, 5, 6, 7, 8, 9 or 10.
[0213] Nucleic Acid Molecules of the Invention
[0214] Therapeutic nucleic acid molecules are potentially excellent SARAF inhibitors since they can target the SARAF transcript and promote its degradation either via the RNA interference pathway or via RNase H cleavage. Alternatively, oligonucleotides such as aptamers can also act as inhibitors of SARAF protein interactions.
[0215] One aspect of the present invention is a SARAF targeting nucleic acid molecule for use in treatment and/or prevention of Hepatitis B virus (HBV) infection. Such a nucleic acid molecule can be selected from the group consisting of single stranded antisense oligonucleotide, siRNA molecule, and shRNA molecule.
[0216] The present section describes novel nucleic acid molecule suitable for use in treatment and/or prevention of Hepatitis B virus (HBV) infection.
[0217] The nucleic acid molecule of the present invention is capable of inhibiting expression of SARAF in vitro and in vivo. The inhibition is achieved by hybridizing an oligonucleotide to a target nucleic acid encoding SARAF or which is involved in the regulation of SARAF. The target nucleic acid may be a mammalian SARAF sequence. In some embodiments, the target nucleic acid may be a human SARAF pre-mRNA sequence, such as the sequence of SEQ ID NO: 1 or a human SARAF mRNA sequence selected from SEQ ID NO: 4 to 10 (such as SEQ ID NO: 4). In some embodiments, the target nucleic acid may be a cynomolgus monkey SARAF sequence such as the sequence of SEQ ID NO: 2.
[0218] In some embodiments, the nucleic acid molecule of the invention is capable of modulating the expression of the target by inhibiting or down-regulating it. Preferably, such modulation produces an inhibition of expression of at least 20% compared to the normal expression level of the target, more preferably at least 30%, at least 40%, at least 50% or at least 60% inhibition compared to the normal expression level of the target. In some embodiments, the nucleic acid molecule of the invention may be capable of inhibiting expression levels of SARAF mRNA by at least 50% or 60% in vitro by transfecting 25 nM nucleic acid molecule into PXB-PHH cells, this range of target reduction is advantageous in terms of selecting nucleic acid molecules with good correlation to the cccDNA reduction. Suitably, the examples provide assays which may be used to measure SARAF RNA or protein inhibition (e.g. example 1 and the “Materials and Methods” section). The target inhibition is triggered by the hybridization between a contiguous nucleotide sequence of the oligonucleotide, such as the guide strand of a siRNA or gapmer region of an antisense oligonucleotide, and the target nucleic acid. In some embodiments, the nucleic acid molecule of the invention comprises mismatches between the oligonucleotide and the target nucleic acid. Despite mismatches hybridization to the target nucleic acid may still be sufficient to show a desired inhibition of SARAF expression. Reduced binding affinity resulting from mismatches may advantageously be compensated by increased number of nucleotides in the oligonucleotide complementary to the target nucleic acid and/or an increased number of modified nucleosides capable of increasing the binding affinity to the target, such as 2′ sugar modified nucleosides, including LNA, present within the oligonucleotide sequence.
[0219] An aspect of the present invention relates to a nucleic acid molecules of 12 to 60 nucleotides in length, which comprises a contiguous nucleotide sequence of at least 12 nucleotides in length, such as at least 12 to 30 nucleotides in length, which is at least 95% complementary, such as fully complementary, to a mammalian SARAF target nucleic acid, in particular a human SARAF nucleic acid. These nucleic acid molecules are capable of inhibiting the expression of SARAF.
[0220] An aspect of the invention relates to a nucleic acid molecule of 12 to 30 nucleotides in length, comprising a contiguous nucleotide sequence of at least 12 nucleotides, such as 12 to 30 nucleotides in length which is at least 90% complementary, such as fully complementary, to a mammalian SARAF target sequence.
[0221] A further aspect of the present invention relates to a nucleic acid molecule according to the invention comprising a contiguous nucleotide sequence of 12 to 20 nucleotides in length with at least 90% complementary, such as fully complementary, to the target sequence of SEQ ID NO: 1.
[0222] In some embodiments, the nucleic acid molecule comprises a contiguous sequence of 12 to 30 nucleotides in length, which is at least 90% complementary, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, or 100% complementary with a region of the target nucleic acid or a target sequence.
[0223] It is advantageous if the nucleic acid molecule, or contiguous nucleotide sequence thereof is fully complementary (100% complementary) to a region of the target sequence, or in some embodiments may comprise one or two mismatches between the oligonucleotide and the target sequence.
[0224] In some embodiments, the oligonucleotide sequence is 100% complementary to a region of the target sequence of SEQ ID NO: 1 and/or SEQ ID NO: 4, 5, 6, 7, 8, 9 and/or 10.
[0225] In some embodiments, the nucleic acid molecule or the contiguous nucleotide sequence of the invention is at least 90% or 95% complementary, such as fully (or 100%) complementary, to the target nucleic acid of SEQ ID NO: 1 and 2.
[0226] In some embodiments, the oligonucleotide or the contiguous nucleotide sequence of the invention is at least 90% or 95% complementary, such as fully (or 100%) complementary, to the target nucleic acid of SEQ ID NO: 2 and SEQ ID NO: 4, 5, 6, 7, 8, 9 or 10.
[0227] In some embodiments, the oligonucleotide or the contiguous nucleotide sequence of the invention is at least 90% or 95% complementary, such as fully (or 100%) complementary, to the target nucleic acid of SEQ ID NO: 1 and SEQ ID NO: 2 and SEQ ID NO: 3.
[0228] In some embodiments, the contiguous sequence of the nucleic acid molecule of the present invention is least 90% complementary, such as fully complementary to a region of SEQ ID NO: 1, selected from the group consisting of target regions 1A to 541A as shown in Table 4.
[0229] In some embodiments, the contiguous sequence of the nucleic acid molecule of the present invention is least 90% complementary, such as fully complementary to a region of SEQ ID NO: 1, selected from the group consisting of target regions 10 to 91C as shown in Table 5.
[0230] In some embodiments, the nucleic acid molecule of the invention comprises or consists of 12 to 60 nucleotides in length, such as from 13 to 50, such as from 14 to 35, such as 15 to 30, such as from 16 to 22 contiguous nucleotides in length. In a preferred embodiment, the nucleic acid molecule comprises or consists of 15, 16, 17, 18, 19, 20, 21 or 22 nucleotides in length.
[0231] In some embodiments, the contiguous nucleotide sequence of the nucleic acid molecule which is complementary to the target nucleic acids comprises or consists of 12 to 30, such as from 13 to 25, such as from 15 to 23, such as from 16 to 22, contiguous nucleotides in length.
[0232] In some embodiments, the oligonucleotide is selected from the group consisting of an antisense oligonucleotide, siRNA and shRNA.
[0233] In some embodiments, the contiguous nucleotide sequence of the siRNA or shRNA which is complementary to the target sequence comprises or consists of 18 to 28, such as from 19 to 26, such as from 20 to 24, such as from 21 to 23, contiguous nucleotides in length.
[0234] In some embodiments, the contiguous nucleotide sequence of the antisense oligonucleotide which is complementary to the target nucleic acids comprises or consists of 12 to 22, such as from 14 to 20, such as from 16 to 20, such as from 15 to 18, such as from 16 to 18, such as from 16, 17, 18, 19 or 20 contiguous nucleotides in length.
[0235] It is understood that the contiguous oligonucleotide sequence (motif sequence) can be modified to, for example, increase nuclease resistance and/or binding affinity to the target nucleic acid.
[0236] The pattern in which the modified nucleosides (such as high affinity modified nucleosides) are incorporated into the oligonucleotide sequence is generally termed oligonucleotide design.
[0237] The nucleic acid molecule of the invention may be designed with modified nucleosides and RNA nucleosides (in particular for siRNA and shRNA molecules) or DNA nucleosides (in particular for single stranded antisense oligonucleotides). Advantageously, high affinity modified nucleosides are used.
[0238] In advantageous embodiments, the nucleic acid molecule or contiguous nucleotide sequence comprises one or more sugar modified nucleosides, such as 2′ sugar modified nucleosides, such as comprise one or more 2′ sugar modified nucleoside independently selected from the group consisting of 2′-O-alkyl-RNA, 2′-O-methyl-RNA, 2′-alkoxy-RNA, 2′-O-methoxyethyl-RNA, 2′-amino-DNA, 2′-fluoro-DNA, arabino nucleic acid (ANA), 2′-fluoro-ANA and LNA nucleosides. It is advantageous if one or more of the modified nucleoside(s) is a locked nucleic acid (LNA).
[0239] In some embodiments, the contiguous nucleotide sequence comprises LNA nucleosides.
[0240] In some embodiments, the contiguous nucleotide sequence comprises LNA nucleosides and DNA nucleosides.
[0241] In some embodiments, the contiguous nucleotide sequence comprises 2′-O-methoxyethyl (2′MOE) nucleosides.
[0242] In some embodiments, the contiguous nucleotide sequence comprises 2′-O-methoxyethyl (2′MOE) nucleosides and DNA nucleosides.
[0243] Advantageously, the 3′ most nucleoside of the antisense oligonucleotide, or contiguous nucleotide sequence thereof is a 2′sugar modified nucleoside.
[0244] In a further embodiment the nucleic acid molecule comprises at least one modified internucleoside linkage. Suitable internucleoside modifications are described in the “Definitions” section under “Modified internucleoside linkage”.
[0245] Advantageously, the oligonucleotide comprises at least one modified internucleoside linkage, such as phosphorothioate or phosphorodithioate.
[0246] In some embodiments, at least one internucleoside linkage in the contiguous nucleotide sequence is a phosphodiester internucleoside linkages.
[0247] It is advantageous if at least 2 to 3 internucleoside linkages at the 5′ or 3′ end of the oligonucleotide are phosphorothioate internucleoside linkages.
[0248] For single stranded antisense oligonucleotides it is advantageous if at least 75%, such as all, the internucleoside linkages within the contiguous nucleotide sequence are phosphorothioate internucleoside linkages. In some embodiments, all the internucleotide linkages in the contiguous sequence of the single stranded antisense oligonucleotide are phosphorothioate linkages.
[0249] In an advantageous embodiment of the invention the antisense oligonucleotide of the invention is capable of recruiting RNase H, such as RNase H1. An advantageous structural design is a gapmer design as described in the “Definitions” section under for example “Gapmer”, “LNA Gapmer” and “MOE gapmer”. In the present invention it is advantageous if the antisense oligonucleotide of the invention is a gapmer with an F-G-F′ design.
[0250] In all instances the F-G-F′ design may further include region D′ and/or D″ as described in the “Definitions” section under “Region D′ or D″ in an oligonucleotide”.
[0251] The invention provides antisense oligonucleotides according to the invention, such as antisense oligonucleotides 12-24, such as 12-18 in length, nucleosides in length wherein the antisense oligonucleotide comprises a contiguous nucleotide sequence comprising at least 14, such as at least 15, such as 16 contiguous nucleotides present in SEQ ID NO 24.
[0252] The invention provides antisense oligonucleotides according to the invention, such as antisense oligonucleotides 12-24, such as 12-18 in length, nucleosides in length wherein the antisense oligonucleotide comprises a contiguous nucleotide sequence comprising at least 14, such as at least 15, such as 16 contiguous nucleotides present in SEQ ID NO 25.
[0253] The invention provides antisense oligonucleotides according to the invention, such as antisense oligonucleotides 12-24, such as 12-18 in length, nucleosides in length wherein the antisense oligonucleotide comprises a contiguous nucleotide sequence comprising at least 14, such as at least 15, such as 16 contiguous nucleotides present in SEQ ID NO 26.
[0254] The invention provides LNA gapmers according to the invention comprising or consisting of a contiguous nucleotide sequence shown in SEQ ID NO 24, 25 or 26. In some embodiments, the LNA gapmer is a LNA gapmer with CMP ID NO: 24_1, 25_1 or 26_1 in Table 7.
[0255] In a further aspect, of the invention the nucleic acid molecules, such as the antisense oligonucleotide, siRNA or shRNA, of the invention can be targeted directly to the liver by covalently attaching them to a conjugate moiety capable of binding to the asialoglycoprotein receptor (ASGPr), such as divalent or trivalent GalNAc cluster.
[0256] Conjugates
[0257] Since HBV infection primarily affects the hepatocytes in the liver it is advantageous to conjugate the SARAF inhibitor to a conjugate moiety that will increase the delivery of the inhibitor to the liver compared to the unconjugated inhibitor. In one embodiment, liver targeting moieties are selected from moieties comprising cholesterol or other lipids or conjugate moieties capable of binding to the asialoglycoprotein receptor (ASGPR).
[0258] In some embodiments, the invention provides a conjugate comprising a nucleic acid molecule of the invention covalently attached to a conjugate moiety.
[0259] The asialoglycoprotein receptor (ASGPR) conjugate moiety comprises one or more carbohydrate moieties capable of binding to the asialoglycoprotein receptor (ASPGR targeting moieties) with affinity equal to or greater than that of galactose. The affinities of numerous galactose derivatives for the asialoglycoprotein receptor have been studied (see for example: Jobst, S. T. and Drickamer, K. J B. C. 1996, 271, 6686) or are readily determined using methods typical in the art.
[0260] In one embodiment, the conjugate moiety comprises at least one asialoglycoprotein receptor targeting moiety selected from group consisting of galactose, galactosamine, N-formyl-galactosamine, N-acetylgalactosamine, N-propionyl-galactosamine, N-n-butanoyl-galactosamine and N-isobutanoylgalactosamine. Advantageously, the asialoglycoprotein receptor targeting moiety is N-acetylgalactosamine (GalNAc).
[0261] To generate the ASGPR conjugate moiety the ASPGR targeting moieties (preferably GalNAc) can be attached to a conjugate scaffold. Generally, the ASPGR targeting moieties can be at the same end of the scaffold. In one embodiment, the conjugate moiety consists of two to four terminal GalNAc moieties linked to a spacer which links each GalNAc moiety to a brancher molecule that can be conjugated to the antisense oligonucleotide.
[0262] In a further embodiment, the conjugate moiety is mono-valent, di-valent, tri-valent or tetra-valent with respect to asialoglycoprotein receptor targeting moieties. Advantageously, the asialoglycoprotein receptor targeting moiety comprises N-acetylgalactosamine (GalNAc) moieties.
[0263] GalNAc conjugate moieties can include, for example, those described in WO 2014/179620 and WO 2016/055601 and PCT/EP2017/059080 (hereby incorporated by reference), as well as small peptides with GalNAc moieties attached such as Tyr-Glu-Glu-(aminohexyl GalNAc)3 (YEE(ahGalNAc)3; a glycotripeptide that binds to asialoglycoprotein receptor on hepatocytes, see, e.g., Duff, et al., Methods Enzymol, 2000, 313, 297); lysine-based galactose clusters (e.g., L3G4; Biessen, et al., Cardovasc. Med., 1999, 214); and cholane-based galactose clusters (e.g., carbohydrate recognition motif for asialoglycoprotein receptor).
[0264] The ASGPR conjugate moiety, in particular a trivalent GalNAc conjugate moiety, may be attached to the 3′- or 5′-end of the oligonucleotide using methods known in the art. In one embodiment, the ASGPR conjugate moiety is linked to the 5′-end of the oligonucleotide.
[0265] In one embodiment, the conjugate moiety is a tri-valent N-acetylgalactosamine (GalNAc), such as those shown in
[0266] Method of Manufacture
[0267] In a further aspect, the invention provides methods for manufacturing the oligonucleotides of the invention comprising reacting nucleotide units and thereby forming covalently linked contiguous nucleotide units comprised in the oligonucleotide. Preferably, the method uses phophoramidites chemistry (see for example Caruthers et al, 1987, Methods in Enzymology vol. 154, pages 287-313). In a further embodiment the method further comprises reacting the contiguous nucleotide sequence with a conjugating moiety (ligand) to covalently attach the conjugate moiety to the oligonucleotide. In a further aspect, a method is provided for manufacturing the composition of the invention, comprising mixing the oligonucleotide or conjugated oligonucleotide of the invention with a pharmaceutically acceptable diluent, solvent, carrier, salt and/or adjuvant.
[0268] Pharmaceutical Salt
[0269] The compounds according to the present invention may exist in the form of their pharmaceutically acceptable salts. The term “pharmaceutically acceptable salt” refers to conventional acid-addition salts or base-addition salts that retain the biological effectiveness and properties of the compounds of the present invention.
[0270] In a further aspect, the invention provides a pharmaceutically acceptable salt of the nucleic acid molecules or a conjugate thereof, such as a pharmaceutically acceptable sodium salt, ammonium salt or potassium salt.
[0271] Pharmaceutical Composition
[0272] In a further aspect, the invention provides pharmaceutical compositions comprising any of the compounds of the invention, in particular the aforementioned nucleic acid molecules and/or nucleic acid molecule conjugates or salts thereof and a pharmaceutically acceptable diluent, carrier, salt and/or adjuvant. A pharmaceutically acceptable diluent includes phosphate-buffered saline (PBS) and pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts. In some embodiments, the pharmaceutically acceptable diluent is sterile phosphate buffered saline. In some embodiments, the nucleic acid molecule is used in the pharmaceutically acceptable diluent at a concentration of 50 to 300 μM solution.
[0273] Suitable formulations for use in the present invention are found in Remington's Pharmaceutical Sciences, Mack Publishing Company, Philadelphia, Pa., 17th ed., 1985. For a brief review of methods for drug delivery, see, e.g., Langer (Science 249:1527-1533, 1990). WO 2007/031091 provides further suitable and preferred examples of pharmaceutically acceptable diluents, carriers and adjuvants (hereby incorporated by reference). Suitable dosages, formulations, administration routes, compositions, dosage forms, combinations with other therapeutic agents, pro-drug formulations are also provided in WO2007/031091.
[0274] In some embodiments, the nucleic acid molecule or the nucleic acid molecule conjugates of the invention, or pharmaceutically acceptable salt thereof is in a solid form, such as a powder, such as a lyophilized powder.
[0275] Compounds, nucleic acid molecules or nucleic acid molecule conjugates of the invention may be mixed with pharmaceutically acceptable active or inert substances for the preparation of pharmaceutical compositions or formulations. Compositions and methods for the formulation of pharmaceutical compositions are dependent upon a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.
[0276] These compositions may be sterilized by conventional sterilization techniques, or may be sterile filtered. The resulting aqueous solutions may be packaged for use as is, or lyophilized, the lyophilized preparation being combined with a sterile aqueous carrier prior to administration. The pH of the preparations typically will be between 3 and 11, more preferably between 5 and 9 or between 6 and 8, and most preferably between 7 and 8, such as 7 to 7.5. The resulting compositions in solid form may be packaged in multiple single dose units, each containing a fixed amount of the above-mentioned agent or agents, such as in a sealed package of tablets or capsules. The composition in solid form can also be packaged in a container for a flexible quantity, such as in a squeezable tube designed for a topically applicable cream or ointment.
[0277] In some embodiments, the nucleic acid molecule or nucleic acid molecule conjugate of the invention is a prodrug. In particular with respect to nucleic acid molecule conjugates the conjugate moiety is cleaved off the nucleic acid molecule once the prodrug is delivered to the site of action, e.g. the target cell.
[0278] Administration
[0279] The compounds, nucleic acid molecules or nucleic acid molecule conjugates or pharmaceutical compositions of the present invention may be administered topical (such as, to the skin, inhalation, ophthalmic or otic) or enteral (such as, orally or through the gastrointestinal tract) or parenteral (such as, intravenous, subcutaneous, intra-muscular, intracerebral, intracerebroventricular or intrathecal).
[0280] In a preferred embodiment the oligonucleotide or pharmaceutical compositions of the present invention are administered by a parenteral route including intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion. In one embodiment, the active nucleic acid molecule or nucleic acid molecule conjugate is administered intravenously. In another embodiment, the active nucleic acid molecule or nucleic acid molecule conjugate is administered subcutaneously.
[0281] In some embodiments, the nucleic acid molecule, nucleic acid molecule conjugate or pharmaceutical composition of the invention is administered at a dose of 0.1-15 mg/kg, such as from 0.2-10 mg/kg, such as from 0.25-5 mg/kg. The administration can be once a week, every second week, every third week or even once a month.
[0282] The invention also provides for the use of the SARAF inhibitor, such as the nucleic acid molecule or nucleic acid molecule conjugate of the invention as described for the manufacture of a medicament wherein the medicament is in a dosage form for subcutaneous administration.
[0283] Combination Therapies
[0284] In some embodiments, the inhibitor of the present invention such as the nucleic acid molecule, nucleic acid molecule conjugate or pharmaceutical composition of the invention is for use in a combination treatment with another therapeutic agent. The therapeutic agent can for example be the standard of care for the diseases or disorders described above.
[0285] By way of example, the SARAF inhibitor, such as the nucleic acid molecule or the nucleic acid molecule conjugate of the present invention may be used in combination with other actives, such as oligonucleotide-based antivirals—such as sequence specific oligonucleotide-based antivirals—acting either through antisense (including other LNA oligomers), siRNAs (such as ARC520), aptamers, morpholinos or any other antiviral, nucleotide sequence-dependent mode of action.
[0286] By way of further example, the SARAF inhibitor, such as the nucleic acid molecule or the nucleic acid molecule conjugate of the present invention may be used in combination with other actives, such as immune stimulatory antiviral compounds, such as interferon (e.g. pegylated interferon alpha), TLR7 agonists (e.g. GS-9620), or therapeutic vaccines.
[0287] By way of further example, the SARAF inhibitor, such as the nucleic acid molecule or the nucleic acid molecule conjugate of the present invention may be used in combination with other actives, such as small molecules, with antiviral activity. These other actives could be, for example, nucleoside/nucleotide inhibitors (e.g. entecavir or tenofovir disoproxil fumarate), encapsidation inhibitors, entry inhibitors (e.g. Myrcludex B).
[0288] In certain embodiments, the additional therapeutic agent may be an HBV agent, an Hepatitis C virus (HCV) agent, a chemotherapeutic agent, an antibiotic, an analgesic, a nonsteroidal anti-inflammatory (NSAID) agent, an antifungal agent, an antiparasitic agent, an anti-nausea agent, an anti-diarrheal agent, or an immunosuppressant agent.
[0289] In particular related embodiments, the additional HBV agent may be interferon alpha-2b, interferon alpha-2a, and interferon alphacon-1 (pegylated and unpegylated), ribavirin; an HBV RNA replication inhibitor; a second antisense oligomer; an HBV therapeutic vaccine; an HBV prophylactic vaccine; lamivudine (3TC); entecavir (ETV); tenofovir diisoproxil fumarate (TDF); telbivudine (LdT); adefovir; or an HBV antibody therapy (monoclonal or polyclonal).
[0290] In other particular related embodiments, the additional HCV agent may be interferon alpha-2b, interferon alpha-2a, and interferon alphacon-1 (pegylated and unpegylated); ribavirin; pegasys; an HCV RNA replication inhibitor (e.g., ViroPharma's VP50406 series); an HCV antisense agent; an HCV therapeutic vaccine; an HCV protease inhibitor; an HCV helicase inhibitor; or an HCV monoclonal or polyclonal antibody therapy.
[0291] Applications
[0292] The nucleic acid molecules of the invention may be utilized as research reagents for, for example, diagnostics, therapeutics and prophylaxis.
[0293] In research, such nucleic acid molecules may be used to specifically modulate the synthesis of SARAF protein in cells (e.g. in vitro cell cultures) and experimental animals thereby facilitating functional analysis of the target or an appraisal of its usefulness as a target for therapeutic intervention. Typically, the target modulation is achieved by degrading or inhibiting the mRNA producing the protein, thereby prevent protein formation or by degrading or inhibiting a modulator of the gene or mRNA producing the protein.
[0294] If employing the nucleic acid molecules of the invention in research or diagnostics the target nucleic acid may be a cDNA or a synthetic nucleic acid derived from DNA or RNA.
[0295] Also encompassed by the present invention is an in vivo or in vitro method for modulating SARAF expression in a target cell which is expressing SARAF, said method comprising administering a nucleic acid molecule, conjugate compound or pharmaceutical composition of the invention in an effective amount to said cell.
[0296] In some embodiments, the target cell, is a mammalian cell in particular a human cell. The target cell may be an in vitro cell culture or an in vivo cell forming part of a tissue in a mammal. In preferred embodiments, the target cell is present in in the liver. The target cell may be a hepatocyte.
[0297] One aspect of the present invention is related the SARAF inhibitor, such as the nucleic acid molecules, conjugate compounds or pharmaceutical compositions of the invention for use as a medicament.
[0298] In an aspect of the invention, the SARAF inhibitor, such as the nucleic acid molecules, conjugate compound or pharmaceutical composition of the invention is capable of reducing the cccDNA level in the infected cells and therefore inhibiting HBV infection. In particular, the nucleic acid molecule is capable of affecting one or more of the following parameters i) reducing cccDNA and/or ii) reducing pgRNA and/or iii) reducing HBV DNA and/or iv) reducing HBV viral antigens in an infected cell.
[0299] For example, nucleic acid molecule that inhibits HBV infection may reduce i) the cccDNA levels in an infected cell by at least 40% such as 50% or 60%, reduction compared to controls; or ii) the level of pgRNA by at least 40% such as 50% or 60%, reduction compared to controls. The controls may be untreated cells or animals, or cells or animals treated with an appropriate negative control.
[0300] Inhibition of HBV infection may be measured in vitro using HBV infected primary human hepatocytes or in vivo using humanized hepatocytes PXB mouse model (available at PhoenixBio, see also Kakuni et al 2014 Int. J. Mol. Sci. 15:58-74). Inhibition of secretion of HBsAg and/or HBeAg may be measured by ELISA, e.g. by using the CLIA ELISA Kit (Autobio Diagnostic) according to the manufacturers' instructions. Reduction of intracellular cccDNA or HBV mRNA and pgRNA may be measured by qPCR, e.g. as described in the Materials and Methods section. Further methods for evaluating whether a test compound inhibits HBV infection are measuring secretion of HBV DNA by qPCR e.g. as described in WO 2015/173208 or using Northern Blot; in-situ hybridization, or immuno-fluorescence.
[0301] Due to the reduction of SARAF levels the nucleic acid molecules, conjugate compounds or pharmaceutical compositions of the present invention can be used to inhibit development of or in the treatment of HBV infection. In particular, through the destabilization and reduction of the cccDNA, the SARAF inhibitor, such as the nucleic acid molecules, conjugate compounds or pharmaceutical compositions of the present invention more efficiently inhibits development of or treats a chronic HBV infection as compared to a compound that only reduces secretion of HBsAg.
[0302] Accordingly, one aspect of the present invention is related to use of the SARAF inhibitor, such as the nucleic acid molecule, conjugate compounds or pharmaceutical compositions of the invention to reduce cccDNA and/or pgRNA in an HBV infected individual.
[0303] A further aspect of the invention relates to the use of the SARAF inhibitor, such as the nucleic acid molecules, conjugate compounds or pharmaceutical compositions of the invention to inhibit development of or treat a chronic HBV infection.
[0304] A further aspect of the invention relates to the use of the SARAF inhibitor, such as the nucleic acid molecules, conjugate compounds or pharmaceutical compositions of the invention to reduce the infectiousness of a HBV infected person. In a particular aspect of the invention, the SARAF inhibitor, such as the nucleic acid molecules, conjugate compounds or pharmaceutical compositions of the invention inhibits development of a chronic HBV infection.
[0305] The subject to be treated with the SARAF inhibitor, such as the nucleic acid molecules, conjugate compounds or pharmaceutical compositions of the invention (or which prophylactically receives nucleic acid molecules, conjugate compounds or pharmaceutical compositions of the present invention) is preferably a human, more preferably a human patient who is HBsAg positive and/or HBeAg positive, even more preferably a human patient that is HBsAg positive and HBeAg positive.
[0306] Accordingly, the present invention relates to a method of treating a HBV infection, wherein the method comprises administering an effective amount of the SARAF inhibitor, such as the nucleic acid molecules, conjugate compounds or pharmaceutical compositions of the invention. The present invention further relates to a method of preventing liver cirrhosis and hepatocellular carcinoma caused by a chronic HBV infection. In one embodiment, the SARAF inhibitors of the present invention is not intended for the treatment of hepatocellular carcinoma, only its prevention.
[0307] The invention also provides for the use of a SARAF inhibitor, such as a nucleic acid molecule, a conjugate compound or a pharmaceutical composition of the invention for the manufacture of a medicament, in particular a medicament for use in the treatment of HBV infection or chronic HBV infection or reduction of the infectiousness of a HBV infected person. In preferred embodiments, the medicament is manufactured in a dosage form for subcutaneous administration.
[0308] The invention also provides for the use of a nucleic acid molecule, a conjugate compound, the pharmaceutical composition of the invention for the manufacture of a medicament wherein the medicament is in a dosage form for intravenous administration.
[0309] The SARAF inhibitor, such as the nucleic acid molecule, conjugate or the pharmaceutical composition of the invention may be used in a combination therapy. For example, SARAF inhibitor, such as the nucleic acid molecule, conjugate or the pharmaceutical composition of the invention may be combined with other anti-HBV agents such as interferon alpha-2b, interferon alpha-2a, and interferon alphacon-1 (pegylated and unpegylated), ribavirin, lamivudine (3TC), entecavir, tenofovir, telbivudine (LdT), adefovir, or other emerging anti-HBV agents such as a HBV RNA replication inhibitor, a HBsAg secretion inhibitor, a HBV capsid inhibitor, an antisense oligomer (e.g. as described in WO2012/145697, WO 2014/179629 and WO2017/216390), a siRNA (e.g. described in WO 2005/014806, WO 2012/024170, WO 2012/2055362, WO 2013/003520, WO 2013/159109, WO 2017/027350 and WO2017/015175), a HBV therapeutic vaccine, a HBV prophylactic vaccine, a HBV antibody therapy (monoclonal or polyclonal), or TLR 2, 3, 7, 8 or 9 agonists for the treatment and/or prophylaxis of HBV.
Embodiments of the Invention
[0310] The following embodiments of the present invention may be used in combination with any other embodiments described herein. The definitions and explanations provided herein above, in particular in the sections “SUMMARY OF INVENTION”, “DEFINITIONS” and DETAILED DESCRIPTION OF THE INVENTION″ apply mutatis mutandis to the following. [0311] 1. A SARAF inhibitor for use in the in the treatment and/or prevention of Hepatitis B virus (HBV) infection. [0312] 2. The SARAF inhibitor for the use of embodiment 1, wherein the SARAF inhibitor is administered in an effective amount. [0313] 3. The SARAF inhibitor for the use of embodiment 1 or 2, wherein the HBV infection is a chronic infection. [0314] 4. The SARAF inhibitor for the use of embodiments 1 to 3, wherein the SARAF inhibitor is capable of reducing cccDNA and/or pgRNA in an infected cell. [0315] 5. The SARAF inhibitor for the use of any one of embodiments 1 to 4, wherein the SARAF inhibitor prevents or reduces the association of SARAF to cccDNA. [0316] 6. SARAF inhibitor for the use of embodiment 5, wherein said inhibitor is a small molecule that specifically binds to SARAF protein, wherein said inhibitor prevents or reduces association of SARAF protein to cccDNA. [0317] 7. SARAF inhibitor for the use of embodiment 6, wherein the SARAF protein is encoded by SEQ ID NO: 4, 5, 6, 7, 8, 9 or 10. [0318] 8. The SARAF inhibitor for the use of any one of embodiments 1 to 7, wherein said inhibitor is a nucleic acid molecule of 12-60 nucleotides in length comprising or consisting of a contiguous nucleotide sequence of at least 12 nucleotides in length which is at least 90% complementary to a mammalian SARAF target nucleic acid. [0319] 9. The SARAF inhibitor for the use of embodiment 8, which is capable of reducing the level of the mammalian SARAF target nucleic acid. [0320] 10. The SARAF inhibitor for the use of embodiment 8 or 9, wherein the mammalian SARAF target nucleic acid is RNA. [0321] 11. The SARAF inhibitor for the use of embodiment 10, wherein the RNA is pre-mRNA. [0322] 12. The SARAF inhibitor for the use of any one of embodiments 8 to 11, wherein the nucleic acid molecule is selected from the group consisting of antisense oligonucleotide, siRNA and shRNA. [0323] 13. The SARAF inhibitor for the use of embodiment 12, wherein the nucleic acid molecule is a single stranded antisense oligonucleotide or a double stranded siRNA. [0324] 14. The SARAF inhibitor for the use of any one of embodiments 8 to 13, wherein the mammalian SARAF target nucleic acid is selected from the group consisting of SEQ ID NO: 1, 4, 5, 6, 7, 8, 9 and 10. [0325] 15. The SARAF inhibitor for the use of any one of embodiments 8 to 13, wherein the contiguous nucleotide sequence of the nucleic acid molecule is at least 98% complementary to the target nucleic acid of SEQ ID NO: 1 and SEQ ID NO: 2. [0326] 16. The SARAF inhibitor for the use of any one of embodiments 8 to 13, wherein the contiguous nucleotide sequence of the nucleic acid molecule is at least 98% complementary to the target nucleic acid of SEQ ID NO: 1 and SEQ ID NO: 2 and SEQ ID NO: 3. [0327] 17. The SARAF inhibitor for the use of any one of embodiments 1 to 16, wherein the cccDNA in an HBV infected cell is reduced by at least 50%, such as 60%, when compared to a control. [0328] 18. The SARAF inhibitor for the use of any one of embodiments 1 to 16, wherein the pgRNA in an [0329] HBV infected cell is reduced by at least 50%, such as 60%, when compared to a control. [0330] 19. The SARAF inhibitor for the use of any one of embodiments 8 to 18, wherein the mammalian SARAF target nucleic acid is reduced by at least 50%, such as 60%, when compared to a control. [0331] 20. A nucleic acid molecule of 12 to 60 nucleotides in length which comprises or consists of a contiguous nucleotide sequence of 12 to 30 nucleotides in length wherein the contiguous nucleotide sequence is at least 90% complementary, such as 95%, such as 98%, such as fully complementary, to a mammalian SARAF target nucleic acid. [0332] 21. The nucleic acid molecule of embodiment 20, wherein the nucleic acid molecule is chemically produced. [0333] 22. The nucleic acid molecule of embodiment 20 or 21, wherein the mammalian SARAF target nucleic acid is selected from the group consisting of SEQ ID NO: 1, 4, 5, 6, 7, 8, 9 and 10. [0334] 23. The nucleic acid molecule of embodiment 20 or 21, wherein the contiguous nucleotide sequence is at least 98% complementary to the target nucleic acid of SEQ ID NO: 1 and SEQ ID NO: 2. [0335] 24. The nucleic acid molecule of embodiment 20 or 21, wherein the contiguous nucleotide sequence is at least 98% complementary to the target nucleic acid of SEQ ID NO: 1 and SEQ ID NO: 2 and SEQ ID NO: 3. [0336] 25. The nucleic acid molecule of any one of embodiments 20 to 23, wherein the nucleic acid molecule is 12 to 30 nucleotides in length. [0337] 26. The nucleic acid molecule of any one of embodiments 20 to 25, wherein the nucleic acid molecule is a RNAi molecule, such as a double stranded siRNA or shRNA [0338] 27. The nucleic acid molecule of any one of embodiments 20 to 25, wherein the nucleic acid molecule is a single stranded antisense oligonucleotide. [0339] 28. The nucleic acid molecule of any one of embodiments 20 to 27, wherein the contiguous nucleotide sequence is fully complementary to a target nucleic acid sequence selected from Table 4 or Table 5. [0340] 29. The nucleic acid molecule of any one of embodiments 20 to 28, which is capable of hybridizing to a target nucleic acid of SEQ ID NO: 1 and SEQ ID NO: 2 with a ΔG° below −15 kcal. [0341] 30. The nucleic acid molecule of any one of embodiments 20 to 29, wherein the contiguous nucleotide sequence comprises or consists of at least 14 contiguous nucleotides, particularly 15, 16, 17, 18, 19, 20, 21 or 22 contiguous nucleotides. [0342] 31. The nucleic acid molecule of any one of embodiments 20 to 29, wherein the contiguous nucleotide sequence comprises or consists of from 14 to 22 nucleotides. [0343] 32. The nucleic acid molecule of embodiment 31, wherein the contiguous nucleotide sequence comprises or consists of 16 to 20 nucleotides. [0344] 33. The nucleic acid molecule of any one of embodiments 20 to 32, wherein the nucleic acid molecule comprises or consists of 14 to 25 nucleotides in length. [0345] 34. The nucleic acid molecule of embodiment 33, wherein the nucleic acid molecule comprises or consists of at least one oligonucleotide strand of 16 to 22 nucleotides in length. [0346] 35. The nucleic acid molecule of any one of embodiments 20 to 34, wherein the contiguous nucleotide sequence is fully complementary to a target sequence selected from the group consisting of SEQ ID NOs: 11, 12, 13 and 14. [0347] 36. The nucleic acid molecule of any one of embodiments 20 to 35, wherein the contiguous nucleotide sequence has zero to three mismatches compared to the mammalian SARAF target nucleic acid it is complementary to. [0348] 37. The nucleic acid molecule of embodiment 36, wherein the contiguous nucleotide sequence has one mismatch compared to the mammalian SARAF target nucleic acid. [0349] 38. The nucleic acid molecule of embodiment 36, wherein the contiguous nucleotide sequence has two mismatches compared to the mammalian SARAF target nucleic acid. [0350] 39. The nucleic acid molecule of embodiment 36, wherein the contiguous nucleotide sequence is fully complementary to the mammalian SARAF target nucleic acid. [0351] 40. The nucleic acid molecule of any one of embodiments 20 to 39, comprising one or more modified nucleosides. [0352] 41. The nucleic acid molecule of embodiment 40, wherein the one or more modified nucleosides are high-affinity modified nucleosides. [0353] 42. The nucleic acid molecule of embodiment 40 or 41, wherein the one or more modified nucleosides are a 2′ sugar modified nucleosides. [0354] 43. The nucleic acid molecule of embodiment 42, wherein the one or more 2′ sugar modified nucleosides are independently selected from the group consisting of 2′-O-alkyl-RNA, 2′-O-methyl-RNA, 2′-alkoxy-RNA, 2′-O-methoxyethyl-RNA, 2′-amino-DNA, 2′-fluoro-DNA, 2′-fluoro-ANA and LNA nucleosides. [0355] 44. The nucleic acid molecule of any one of embodiment 40 to 43, wherein the one or more modified nucleosides are LNA nucleosides. [0356] 45. The nucleic acid molecule of embodiment 44, wherein the modified LNA nucleosides are selected from the group consisting of oxy-LNA, amino-LNA, thio-LNA, cET, and ENA. [0357] 46. The nucleic acid molecule of embodiment 44 or 45, wherein the modified LNA nucleosides are oxy-LNA with the following 2′-4′ bridge —O—CH.sub.2—. [0358] 47. The nucleic acid molecule of embodiment 46, wherein the oxy-LNA is beta-D-oxy-LNA. [0359] 48. The nucleic acid molecule of embodiment 44 or 45, wherein the modified LNA nucleosides are cET with the following 2′-4′ bridge —O—CH(CH.sub.3)—. [0360] 49. The nucleic acid molecule of embodiment 48, wherein the cET is (S)cET, i.e. 6′(S)methyl-beta-D-oxy-LNA. [0361] 50. The nucleic acid molecule of embodiment 44 or 45, wherein the LNA is ENA, with the following 2′-4′ bridge —O—CH.sub.2—CH.sub.2—. [0362] 51. The nucleic acid molecule of any one of embodiments 20 to 50, wherein the nucleic acid molecule comprises at least one modified internucleoside linkage. [0363] 52. The nucleic acid molecule of embodiment 51, wherein the at least one modified internucleoside linkage is a phosphorothioate internucleoside linkage. [0364] 53. The nucleic acid molecule of any one of embodiments 20 to 52, wherein the nucleic acid molecule is an antisense oligonucleotide capable of recruiting RNase H. [0365] 54. The nucleic acid molecule of embodiment 53, wherein the antisense oligonucleotide or the contiguous nucleotide sequence is a gapmer. [0366] 55. The nucleic acid molecule of embodiment 54, wherein the antisense oligonucleotide or contiguous nucleotide sequence thereof consists of or comprises a gapmer of formula 5′-F-G-F′-3′, where region F and F′ independently comprise or consist of 1-4 2′ sugar modified nucleosides and G is a region between 6 and 18 nucleosides which are capable of recruiting RNase H. [0367] 56. The nucleic acid molecule of embodiment 55, wherein the 1-4 2′ sugar modified nucleosides are independently selected from the group consisting of 2′-O-alkyl-RNA, 2′-O-methyl-RNA, 2′-alkoxy-RNA, 2′-O-methoxyethyl-RNA, 2′-amino-DNA, 2′-fluoro-DNA, arabino nucleic acid (ANA), 2′-fluoro-ANA and LNA nucleosides. [0368] 57. The nucleic acid molecule of embodiment 55 or 56, wherein one or more of the 1-4 2′ sugar modified nucleosides in region F and F′ are LNA nucleosides. [0369] 58. The nucleic acid molecule of embodiment 57, wherein all the 2′ sugar modified nucleosides in region F and F′ are LNA nucleosides. [0370] 59. The nucleic acid molecule of any one of embodiments 56 to 58, wherein the LNA nucleosides are selected from beta-D-oxy-LNA, alpha-L-oxy-LNA, beta-D-amino-LNA, alpha-L-amino-LNA, beta-D-thio-LNA, alpha-L-thio-LNA, (S)cET, (R)cET beta-D-ENA and alpha-L-ENA. [0371] 60. The nucleic acid molecule of any one of embodiments 56 to 59, wherein region F and F′ consist of identical LNA nucleosides. [0372] 61. The nucleic acid molecule of any one of embodiments 56 to 60, wherein all the 2′ sugar modified nucleosides in region F and F′ are oxy-LNA nucleosides. [0373] 62. The nucleic acid molecule of any one of embodiments 55 to 61, wherein the nucleosides in region G are DNA nucleosides. [0374] 63. The nucleic acid molecule of embodiment 62, wherein region G consists of at least 75% DNA nucleosides. [0375] 64. The nucleic acid molecule of embodiment 63, where all the nucleosides in region G are DNA nucleosides. [0376] 65. A conjugate compound comprising a nucleic acid molecule according to any one of embodiments 20 to 64, and at least one conjugate moiety covalently attached to said nucleic acid molecule. [0377] 66. The conjugate compound of embodiment 65, wherein the nucleic acid molecule is a double stranded siRNA and the conjugate moiety is covalently attached to the sense strand of the siRNA. [0378] 67. The conjugate compound of embodiment 65 or 66, wherein the conjugate moiety is selected from carbohydrates, cell surface receptor ligands, drug substances, hormones, lipophilic substances, polymers, proteins, peptides, toxins, vitamins, viral proteins or combinations thereof. [0379] 68. The conjugate compound of any one of embodiments 65 to 67, wherein the conjugate moiety is capable of binding to the asialoglycoprotein receptor. [0380] 69. The conjugate compound of embodiment 68, wherein the conjugate moiety comprises at least one asialoglycoprotein receptor targeting moiety selected from group consisting of galactose, galactosamine, N-formyl-galactosamine, N-acetylgalactosamine, N-propionyl-galactosamine, N-n-butanoyl-galactosamine and N-isobutanoylgalactosamine. [0381] 70. The conjugate compound of embodiment 69, wherein the asialoglycoprotein receptor targeting moiety is N-acetylgalactosamine (GalNAc). [0382] 71. The conjugate compound of embodiment 69 or 70, wherein the conjugate moiety is mono-valent, di-valent, tri-valent or tetra-valent with respect to asialoglycoprotein receptor targeting moieties. [0383] 72. The conjugate compound of embodiment 71, wherein the conjugate moiety consists of two to four terminal GalNAc moieties and a spacer linking each GalNAc moiety to a brancher molecule that can be conjugated to the antisense compound. [0384] 73. The conjugate compound of embodiment 72, wherein the spacer is a PEG spacer. [0385] 74. The conjugate compound of any one of embodiments 68 to 73, wherein the conjugate moiety is a tri-valent N-acetylgalactosamine (GalNAc) moiety. [0386] 75. The conjugate compound of any one of embodiments 68 to 74, wherein the conjugate moiety is selected from one of the trivalent GalNAc moieties in
[0410] The invention will now be illustrated by the following examples which have no limiting character.
EXAMPLES
[0411] Materials and Methods
[0412] siRNA Sequences and Compounds
TABLE-US-00006 TABLE 6A Human SARAF sequences targeted by the individual components of the siRNA pool SEQ SARAF Position ID target on SEQ ID NO: sequence NO: 1 Exon 11 GGUACCAGGAGACGAUAAA 19304-19322 6 12 AGUACUACCUGUUAACAAU 19392-19410 6 13 ACAGAAUGUUGCUGCGGGA 9154-9172 2 14 UGGGAAUGUAAGACGGACU 13150-13168 3
[0413] The pool of siRNA (ON-TARGETplus SMART pool siRNA Cat. No. LU-015281-02-0005, Dharmacon) contains four individual siRNA molecules targeting the sequences listed in the above table.
TABLE-US-00007 TABLE 6B Control compounds Sequence 5′ to 3′ SEQ Order sense ID Name Supplier number strand NO Non- Dharmacon #D-001810- UGGUUUACA 15 targeting 01-05 UGUCGACUA negative A control siRNA#1 Hbx GA life Custom GCACUUCGC 16 positive science made UUCACCUCU control G
[0414] Oligonucleotide Synthesis
[0415] Oligonucleotide synthesis is generally known in the art. Below is a protocol which may be applied. The oligonucleotides of the present invention may have been produced by slightly varying methods in terms of apparatus, support and concentrations used.
[0416] Oligonucleotides are synthesized on uridine universal supports using the phosphoramidite approach on an Oligomaker 48 at 1 μmol scale. At the end of the synthesis, the oligonucleotides are cleaved from the solid support using aqueous ammonia for 5-16 hours at 60° C. The oligonucleotides are purified by reverse phase HPLC (RP-HPLC) or by solid phase extractions and characterized by UPLC, and the molecular mass is further confirmed by ESI-MS.
[0417] Elongation of the Oligonucleotide:
[0418] The coupling of β-cyanoethyl-phosphoramidites (DNA-A(Bz), DNA-G(ibu), DNA-C(Bz), DNA-T, LNA-5-methyl-C(Bz), LNA-A(Bz), LNA-G(dmf), or LNA-T) is performed by using a solution of 0.1 M of the 5′-O-DMT-protected amidite in acetonitrile and DCI (4,5-dicyanoimidazole) in acetonitrile (0.25 M) as activator. For the final cycle a phosphoramidite with desired modifications can be used, e.g. a C6 linker for attaching a conjugate group or a conjugate group as such. Thiolation for introduction of phosphorthioate linkages is carried out by using xanthane hydride (0.01 M in acetonitrile/pyridine 9:1). Phosphordiester linkages can be introduced using 0.02 M iodine in THF/Pyridine/water 7:2:1. The rest of the reagents are the ones typically used for oligonucleotide synthesis.
[0419] For post solid phase synthesis conjugation a commercially available C6 aminolinker phorphoramidite can be used in the last cycle of the solid phase synthesis and after deprotection and cleavage from the solid support the aminolinked deprotected oligonucleotide is isolated. The conjugates are introduced via activation of the functional group using standard synthesis methods.
[0420] Purification by RP-HPLC:
[0421] The crude compounds are purified by preparative RP-HPLC on a Phenomenex Jupiter C18 10 μm 150×10 mm column. 0.1 M ammonium acetate pH 8 and acetonitrile is used as buffers at a flow rate of 5 mL/min. The collected fractions are lyophilized to give the purified compound typically as a white solid.
[0422] Abbreviations:
[0423] DCI: 4,5-Dicyanoimidazole
[0424] DCM: Dichloromethane
[0425] DMF: Dimethylformamide
[0426] DMT: 4,4′-Dimethoxytrityl
[0427] THF: Tetrahydrofurane
[0428] Bz: Benzoyl
[0429] Ibu: Isobutyryl
[0430] RP-HPLC: Reverse phase high performance liquid chromatography
[0431] T.sub.m Assay:
[0432] Oligonucleotide and RNA target (phosphate linked, PO) duplexes are diluted to 3 mM in 500 ml RNase-free water and mixed with 500 ml 2×T.sub.m-buffer (200 mM NaCl, 0.2 mM EDTA, 20 mM Naphosphate, pH 7.0). The solution is heated to 95° C. for 3 min and then allowed to anneal in room temperature for 30 min. The duplex melting temperatures (T.sub.m) are measured on a Lambda 40 UV/VIS Spectrophotometer equipped with a Peltier temperature programmer PTP6 using PE Templab software (Perkin Elmer). The temperature is ramped up from 20° C. to 95° C. and then down to 25° C., recording absorption at 260 nm. First derivative and the local maximums of both the melting and annealing are used to assess the duplex T.sub.m.
[0433] Clonal growth medium (dHCGM). dHCGM is a DMEM medium containing 100 U/ml Penicillin, 100 μg/ml Streptomycin, 20 mM Hepes, 44 mM NaHCO.sub.3, 15 μg/ml L-proline, 0.25 μg/ml insulin, 50 nM Dexamethazone, 5 ng/ml EGF, 0.1 mM Asc-2P, 2% DMSO and 10% FBS (Ishida et al., 2015). Cells were cultured at 37° C. incubator in a humidified atmosphere with 5% CO.sub.2. Culture medium was replaced 24 h post-plating and every 2 days until harvest.
[0434] ASOs Sequences and Compounds
TABLE-US-00008 TABLE 7 list of oligonucleotide motif sequences of the invention (indicated by SEQ ID NO), as well as specific oligonucleotide compounds of the invention (indicated by CMP ID NO) designed based on the motif sequence. SEQ CMP ID ID Oligonucleotide NO NO Compound 24 24_1 GCAatatctaagtcCG 25 25_1 AGtattccaccagtTC 26 26_1 GGtatgcatgtttgGG The heading “Oligonucleotide compound” in the table represents specific designs of a motif sequence. Capital letters are beta-D-oxy LNA nucleosides, lowercase letters are DNA nucleosides, all LNA C are 5- methyl cytosine, all internucleoside linkages are phosphorothioate internucleoside linkages (CMP ID NO = Compound ID NO)
[0435] HBV Infected PHH Cells
[0436] Fresh primary human hepatocytes (PHH) were provided by PhoenixBio, Higashi-Hiroshima City, Japan (PXB-cells also described in Ishida et al 2015 Am J Pathol. 185(5):1275-85) in 70,000 cells/well in 96-well plate format.
[0437] Upon arrival the PHH were infected with an MOI of 2GE using HepG2 2.2.15-derived HBV (batch Z12) by incubating the PHH cells with HBV in 4% (v/v) PEG in PHH medium for 16 hours. The cells were then washed three times with PBS and cultured a humidified atmosphere with 5% CO.sub.2 in fresh PHH medium consisting of DMEM (GIBCO, Cat #21885) supplemented with 10% (v/v) heat-inactivated fetal bovine serum (GIBCO, Cat #10082), 2% (v/v) DMSO, 1% (v/v) Penicillin/Streptomycin (GIBCO, Cat #15140-148), 20 mM HEPES (GIBCO, Cat #15630-080), 44 mM NaHCO.sub.3 (Wako, Cat #195-14515), 15 μg/ml L-proline (MP-Biomedicals, Cat #0219472825), 0.25 μg/ml Insulin (Sigma, Cat #11882), 50 nM Dexamethasone (Sigma, Cat #D8893), 5 ng/ml EGF (Sigma, Cat #E9644), and 0.1 mM L-Ascorbic acid 2-phosphate (Wako, Cat #013-12061). Cells were cultured at 37° C. incubator in a humidified atmosphere with 5% CO.sub.2. Culture medium was replaced 24 hours post-plating and three times a week until harvest.
[0438] siRNA Transfection
[0439] Four days post-infection the cells were transfected with the SARAF siRNA pool in triplicates. No drug controls (NDC), negative control siRNA and HBx siRNA were included as controls (see Table 7).
[0440] Per well a transfection mixture was prepared with 2 μl of either negative control siRNA (stock concentration 1 uM), SARAF siRNA pool (stock concentration 1 μM), HBx control siRNA (stock concentration 0.12 uM) or H.sub.2O (NDC) with 18.2 μl OptiMEM (Thermo Fisher Scientific Reduced Serum media) and 0.6 ul Lipofectamine® RNAiMAX Transfection Reagent (Thermofisher Scientific catalog No. 13778). The transfection mixture was mixed and incubated at room temperature 5 minutes prior to transfection. Prior to transfection the medium was removed from the PHH cells and replaced by 100 μl/well William's E Medium+GlutaMAX (Gibco, #32551) supplemented with HepaRG supplement without P/S (Biopredic International, #ADD711C). 20 μl of transfection mix was added to each well yielding a final concentration of 16 nM for the negative control siRNA or SARAF siRNA pool, or 1.92 nM for the HBx control siRNA and the plates gently rocked before placing into the incubator. The medium was replaced with PHH medium after 6 hours. The siRNA treatment was repeated on day 6 post-infection as described above. On day 8 post-infection the supernatants were harvested and stored at −20° C. HBsAg and HBeAg can be determined from the supernatants if desired.
[0441] LNA Treatment
[0442] Two LNA master mix plates from a 500 μM stock were prepared. For LNA treatment at a final concentration of 25 μM, 200 uL of a 500 μM stock LNA is prepared in the first master mix plate. A second master mix plate including SARAF LNAs at 100 μM was prepared for LNA treatment at a final concentration of 5 μM, mixing 40 μL of each SARAF LNA at 500 μM and 160 μL of PBS.
[0443] Four days post-infection the cells were treated with SARAF LNAs at final concentration of 25 μM (see Table 7) in either duplicate or triplicates or with PBS as no drug control (NDC). Prior to the LNA treatment, the old medium was removed from the cells and replaced by 114 μl/well of fresh PHH medium. Per well, 6 μL of each SARAF LNA either at 500 uM or PBS as NDC were added to the 114 μL PHH medium. The same treatment was repeated 3 times at day 4, 11 and 18 post-infection. Cell culture medium was changed with fresh one every three days at day 7, 14 and 21 post infection.
[0444] For the quantification of cccDNA, the infected cells were treated with entecavir (ETV) at 10 nM final concentration from day 7 to day 21 post infection. Fresh ETV treatment was repeated 5 times at day 7, 11, 14, 18 and 21 post infection. This ETV treatment was used to inhibit the synthesis of new viral DNA intermediates and to detect specifically HBV cccDNA sequences.
[0445] Measurement of HBV Antigen Expression
[0446] HBV antigen expression and secretion can be measured in the collected supernatants if desired. The HBV propagation parameters, HBsAg and HBeAg levels, are measured using CLIA ELISA Kits (Autobio Diagnostic #CL0310-2, #CL0312-2), according to the manufacturer's protocol. Briefly, 25 μL of supernatant per well is transferred to the respective antibody coated microtiter plate and 25 μL of enzyme conjugate reagent is added. The plate is incubated for 60 min on a shaker at room temperature before the wells are washed five times with washing buffer using an automatic washer. 25 μL of substrate A and B were added to each well. The plates are incubated on a shaker for 10 min at room temperature before luminescence is measured using an EnVision® luminescence reader (Perkin Elmer).
[0447] Cell Viability Measurements
[0448] The cell viability was measured on the supernatant free cells by the Cell Counting Kit—8 (CCK8 from Sigma Aldrich, #96992). For the measurement the CCK8 reagent was diluted 1:10 in normal culture medium and 100 μl/well added to the cells. After 1 h incubation in the incubator 80 μl of the supernatants were transferred to a clear flat bottom 96 well plate, and the absorbance at 450 nm was read using a microplate reader (Tecan). Absorbance values were normalized to the NDC which was set at 100% to calculate the relative cell viabilities.
[0449] Cell viability measurements are used to confirm that any reduction in the viral parameters is not the cause of cell death, the closer the value is to 100% the lower the toxicity. LNA treatment giving cellular viability values equal or below 20% to the NDC were excluded from further analysis.
[0450] Real-Time PCR for Measuring SARAF mRNA Expression and the Viral Parameters pgRNA, cccDNA and HBV DNA Quantification
[0451] Following cell viability determination the cells were washed with PBS once. For siRNA treatment cells were lysed with 50 μl/well lysis solution from the TaqMan® Gene Expression Cells-to-CT™ Kit (Thermo Fisher Scientific, #AM1729) and stored at −80° C. For cells treated with LNAs, total RNA was extracted using a MagNA Pure robot and the MagNA Pure 96 Cellular RNA Large Volume Kit (Roche, #05467535001) according to the manufacturer's protocol. For quantification of SARAF RNA and viral pgRNA levels and the normalization control, GUS B, the TaqMan® RNA-to-Ct™ 1-Step Kit (Life Technologies, #4392656) has been used. For each reaction 2 or 4 μl of cell lysate, 0.5 μl 20×SARAF Taqman primer/probe, 0.5 μl 20×GUS B Taqman primer/probe, 5 μl 2× TaqMan® RT-PCR Mix, 0.25 μl 40× TaqMan® RT Enzyme Mix, and 1.75 μl DEPC-treated water is used. Primers used for GUS B RNA and target mRNA quantification are listed in Table 8. Technical replicates are run for each sample and minus RT controls included to evaluate potential amplification due to DNA present.
[0452] The target mRNA expression levels, as well as the viral pgRNA, were quantified in technical duplicates by RT-qPCR using a QuantStudio 12K Flex (Applied Biosystems) with the following protocol, 48° C. for 15 min, 95° C. for 10 min, then 40 cycles with 95° C. for 15 seconds, and 60° C. for 60 seconds.
[0453] SARAF mRNA and pgRNA expression levels were analyzed using the comparative cycle threshold 2-ΔΔCt method normalized to the reference gene GUS B and non-transfected cells. The expression levels in siRNA-treated cells are presented as % of the average no-drug control samples (i.e. the lower the value the larger the inhibition/reduction). In LNA-treated cells, the expression levels are presented as inhibitory effect compared to non-treated cells (NDC) set as 100% and is expressed as a percentage of the mean+SD from two independent biological replicates are measured. For cccDNA quantification, total DNA was extracted from HBV infected Primary Human Hepatocytes treated with siRNA or with LNAs. Prior to the cccDNA qPCR analysis, a fraction of the siRNA treated cell lysate was digested with T5 enzyme (10 U/500 ng DNA; New England Biolabs, #M0363L) to remove viral DNA intermediates and to quantify the cccDNA molecule only. T5 digestion was done at 37° C. for 30 min. T5 digestion was not applied on LNA treated cell lysates to avoid qPCR interference in the assay To remove HBV DNA intermediates and quantify cccDNA level in LNA treated cells, cells were treated with entecavir (10 nM) for 3 weeks as described in LNA treatment section
[0454] For the quantification of cccDNA in siRNA-treated cells, each reaction mix per well contained 2 μl T5-digested cell lysate, 0.5 μl 20× cccDNA_DANDRI Taqman primer/probe (Life Technologies, custom #AI1RW7N, FAM-dye listed in the Table below), 5 μl TaqMan® Fast Advanced Master Mix (Applied Biosystems, #4444557) and 2.5 μl DEPC-treated water were used. Technical triplicates were run for each sample.
TABLE-US-00009 Primers for siRNA-treated ceils Primer name Sequence SEQ ID CCCDNA_DANDRL_F CCGTGTGCACTTCGCTTCA 17 CCCDNA_DANDRI_R GCACAGCTTGGAGGCTTGA 18 CCCDNA_DANDRI_M 5′-[6FAM]CATGGAGACCA 19 CCGTGAACGCCC[BHQ1]-3′ Primers for LNA-treated cells Primer name Sequence CCCDNA_Fwd 5′-CGTCTGTGCCTTCTC 20 ATCTGC-3′ CCCDNA Rev 5′-GCACAGCTTGGAGGC 21 TTGAA-3′ Mito_Fwd CCGTCTGAACTATCCTGCCC 22 Mito_Rev GCCGTAGTCGGTGTACTCGT 23
[0455] For the quantification of cccDNA in LNA-treated cells by qPCR, a master mix of 16 uL/well, with 10 ul 2× Fast SYBR™ Green Master Mix (Applied Biosystems, #4385614), 2 ul cccDNA Primer Mix (1 uM of each forward and reverse), and 4 ul nuclease-free water per well is prepared. A master mix with 10 ul 2× Fast SYBR™ Green Master Mix (Applied Biosystems, #4385614), 2 ul mitochondrial genome primer mix (1 uM of each forward and reverse), and 4 ul nuclease-free water per well is also prepared for normalization of the cccDNA.
[0456] For quantification of intracellular HBV DNA and the normalization control, human hemoglobin beta (HBB), each reaction mix contained 2 μl undigested cell lysate, 0.5 μl 20×HBV Taqman primer/probe (Life Technologies, #Pa03453406_s1, FAM-dye), 0.5 μl 20×HBB Taqman primer/probe (Life Technologies, #Hs00758889_s1, VIC-dye), 5 μl TaqMan® Fast Advanced Master Mix (Applied Biosystems, #4444557) and 2 μl DEPC-treated water were used. Technical triplicates were run for each sample.
[0457] The qPCR was run on the QuantStudio™ K12 Flex with standard settings for the fast heating block (95° C. for 20 seconds, then 40 cycles with 95° C. for 1 second and 60C for 20 seconds).
[0458] Any outliers were removed from the data set by excluding values with more than 0.9 difference to the median Ct of all the three biological replicates for each treatment condition. Fold changes of cccDNA (siRNA and LNA treated cells) and total HBV DNA (only siRNA treated cells) were determined from the Ct values via the 2.sup.−ddCT method and normalized to the HBB or mitochondrial DNA as housekeeping genes. For siRNA-treated cells, expression levels are presented as % of the average no drug control samples (i.e. the lower the value the larger the inhibition/reduction). For LNA treated cells, the inhibitory effect on cccDNA was expressed as a percentage of the mean+/−SD from three independent biological replicates compared to non-treated cells (NDC) set as 100%.
TABLE-US-00010 TABLE 8 GUS B and target mRNA qPCR primers (Thermo Fisher Scientific) SARAF (FAM): Hs00903199_m1 Housekeeping gene primers GUS B (VIC): Hs00939627_m1 pgRNA (FAM): AILIKX5
Example 1: Measurement of the Reduction of SARAF mRNA, HBV Intracellular DNA and cccDNA in HBV Infected PHH Cells Resulting from siRNA Treatment
[0459] In the following experiment, the effect of SARAF knock-down on the HBV parameters, HBV DNA and cccDNA, was tested.
[0460] HBV infected PHH cells were treated with the pool of siRNAs from Dharmacon (LU-015281-02-0005, see Table 6A) as described in the Materials and Methods section “siRNA transfection”.
[0461] Following the 4 days-treatment, SARAF mRNA, cccDNA and intracellular HBV DNA were measured by qPCR as described in the Materials and Methods section “Real-time PCR for measuring SARAF mRNA expression and the viral parameters pgRNA, cccDNA, and HBV DNA”.
[0462] The results are shown in Table 9 as % of the average no drug control samples (i.e. the lower the value the larger the inhibition/reduction)
TABLE-US-00011 TABLE 9 Effect on HBV parameters following knockdown of SARAF with pool of siRNA. Values are given as the average of biological and technical triplicates. HBV intracellular DNA cccDNA Treatment Mean SD Mean SD SARAF siRNA 36 15 16 12 HBx positive control 53 35 65 50 siRNA negative control 123 16 71 4
[0463] From this, it can be seen that the SARAF siRNA pool is capable of reducing cccDNA as well as HBV DNA quite efficiently. The positive control reduced intracellular HBV DNA to some extent but had no effect on cccDNA when compared to the negative control.
Example 2: Measurement of the Reduction of SARAF mRNA, HBV Intracellular pgRNA and cccDNA in HBV Infected PHH Cells Resulting from LNA Treatment
[0464] In the following experiment, the effect of SARAF knock-down on the HBV parameters, HBV DNA and cccDNA, was tested.
[0465] HBV infected PHH cells were treated with SARAF naked LNAs (see Table 7) as described in the Materials and Methods section “LNA treatment”.
[0466] Following 21 days-treatment, SARAF mRNA, cccDNA, and intracellular HBV pgRNA were measured by qPCR as described in the Materials and Methods section “Real-time PCR for measuring SARAF mRNA expression and the viral parameters pgRNA, cccDNA, and HBV DNA”. The results are shown in Table 10 as inhibitory effect compared to non-treated cells (NDC) set as 100% and are expressed as a percentage of the mean+SD from two independent biological replicates are measured.
TABLE-US-00012 TABLE 10 Effect on HBV parameters following knockdown of SARAF with naked LNAs. Values are given as the average of either two or three biological replicates. Data show the effect with LNA at a final concentration of 25 mM CMP SARAF mRNA pgRNA cccDNA ID Mean % SD Mean % SD Mean % SD 24_1 2.29% 0.59% 81.65% 1.41% 63.02% 5.27% 25_1 6.58% 0.20% 58.50% 2.09% 52.13% 5.99% 26_1 20.22% 0.97% 36.20% 1.23% 67.57% 5.66% NDC 100.00% 0.00% 100.00% 0.00% 98.66% 1.90% *Non-treated cells
[0467] From this, it can be seen that SARAF LNAs are capable of sensibly reducing SARAF mRNA expression resulting in a quite efficient reduction in expression level for both pgRNA and cccDNA.