USE OF ZmSBP12 GENE IN REGULATION OF DROUGHT RESISTANCE, PLANT HEIGHT, AND EAR HEIGHT OF ZEA MAYS L.

Abstract

A use of a ZmSBP12 gene in the regulation of drought resistance, plant height, and ear height of Zea mays L. is provided. After the ZmSBP12 gene is over-expressed in Zea mays L., the resulting Zea mays L. mutant plant exhibits increased drought resistance and decreased plant and ear heights. The overexpression of the ZmSBP12 gene leads to increased drought resistance and decreased plant and ear heights, indicating that the ZmSBP12 gene plays a crucial role in the drought resistance and plant type (plant height) of Zea mays L. The expression abundance of the ZmSBP12 gene is increased to improve the drought resistance of Zea mays L. and reduce the plant and ear heights of Zea mays L., which can be used for the assisted breeding of novel drought-resistant and lodging-resistant Zea mays L. varieties and the breeding of excellent inbred lines and hybrids of Zea mays L.

Claims

1. (canceled)

2. A use of a ZmSBP12 gene or a variant of the ZmSBP12 gene in a regulation of a plant height or an ear height, wherein the regulation of a plant height or the ear height refers to reducing the plant height or the ear height of the Zea mays L. by subjecting the ZmSBP12 gene or the variant of the ZmSBP12 gene to an overexpression in the Zea mays L.; the ZmSBP12 gene has a nucleotide sequence shown in SEQ ID No: 2, and a protein encoded by the ZmSBP12 gene has an amino acid sequence shown in SEQ ID No: 1; and the variant of the ZmSBP12 gene has a nucleotide sequence shown in SEQ ID No: 6.

3. (canceled)

4. (canceled)

5. (canceled)

6. A method for improving lodging resistance of a plant comprising: (1) constructing a recombinant plant expression vector carrying a ZmSBP12 gene; (2) transforming a constructed recombinant plant expression vector into a plant tissue or a plant cell; and (3) subjecting the ZmSBP12 gene to an overexpression in the plant tissue or the plant cell, wherein the plant is Zea mays L.; the ZmSBP12 gene has a nucleotide sequence shown in SEQ ID No: 2, and a protein encoded by the ZmSBP12 gene has an amino acid sequence shown in SEQ ID No: 1.

7. (canceled)

8. (canceled)

9. (canceled)

10. (canceled)

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0041] FIG. 1 is a schematic diagram of the ZmSBP12 gene overexpression vector Ubi::ZmSBP12-eGFP.

[0042] FIG. 2 shows the results of quantitative polymerase chain reaction (qPCR) detection of the ZmSBP12 gene in homozygous transgenic plants.

[0043] FIG. 3 shows the performance of WT and mutant ZmSBP12-OE after drought treatment. FIG. 4 shows the morphological characteristics of homozygous mutant ZmSBP12-OE, where the mutant ZmSBP12-OE is compared with the WT under natural sunlight conditions: At the 8 unfolded-leaf stages, the plant height is slightly low and leaf spacing is reduced in the mutant. When the WT SAM reaches the floret differentiation stage, the mutant has just reached the spikelet differentiation stage.

[0044] FIG. 5 shows the plant height statistics of mutant ZmSBP12-OE and WT under natural sunlight conditions, where it can be seen from the statistical data that the plant height of the mutant ZmSBP12-OE is significantly lower than the plant height of the WT. YW784-785 represents OE-1, YW786-788 represents OE-2, YW789-790 represents OE-3, and YW791-792 represents OE-3. Based on a sample size N≥30, P≤0.005 is regarded as reaching an extremely-significant level.

[0045] FIG. 6 shows the length statistics of aboveground nodes of mutant ZmSBP12-OE and WT under natural sunlight conditions.

[0046] FIG. 7 shows the changes in lengths of aboveground nodes of mutant ZmSBP12-OE compared with WT under natural sunlight conditions (it can be seen that the first 1 to 3 aboveground nodes are most significantly reduced, indicating that this phenotype is closely related to lodging resistance).

[0047] FIGS. 8A-8B show the plant height and ear height statistics of F1 populations obtained from the combination of WT and ZmSBP12-OE with backbone parents (WL1, WL2, WL3, WL4, and WL5) (it can be seen that ZmSBP12-OE can also significantly reduce the plant height and ear height of a hybrid).

DETAILED DESCRIPTION OF THE EMBODIMENTS

[0048] The present disclosure will be further described below in conjunction with specific examples, and the advantages and features of the present disclosure will become clearer from the description. However, these examples are only exemplary and do not constitute any limitation to the scope of the present disclosure. Those skilled in the art should appreciate that modifications and substitutions can be made to the details and forms of the present disclosure without departing from the spirit and scope of the present disclosure, but these modifications and substitutions fall within the protection scope of the present disclosure.

[0049] Unless otherwise specified, the experimental methods used in the examples are conventional methods.

[0050] The materials, reagents, and the like used in the examples are all commercially available unless otherwise specified.

[0051] The Zea mays L. inbred line “Xiang249” in the examples is publicly available from the Biotechnology Research Institute (BRI), Chinese Academy of Agricultural Sciences (CAAS).

EXAMPLE 1

Acquisition of a ZmSBP12 Gene and Construction of a Mutant ZmSBP12-OE

[0052] I. Acquisition and Modification of the ZmSBP12 Gene

[0053] The total RNA of a plant of a B73 inbred line at a V2 stage was extracted by the Trizol method, and reverse-transcribed with reference to the instruction of a reverse transcription kit. Since the ZmSBP12 gene was a Zea mays L. SQUAMOSA-PROMOTER BINDING PROTEIN-LIKE (SPL) transcription factor regulated by miR156, a miR156 regulatory site (CATGCTCTCTCTCTTCTGTCA) needed to be modified such that miR156 failed to recognize and cleave ZmSBP12.

[0054] A modification method was as follows: The primers 6827-F1/R1: GTTTGGTGTTACTTCTGCAGATGGAGTGGACGGCCCCGAA/GCTGAGCAGGCTCAGG GCATGCTGAAGATCCGCTGCTC (as shown in SEQ ID NO: 8) were used to conduct the first round of PCR amplification with cDNA obtained from the reverse transcription as a template to obtain a fragment 1. The primers 6827-F2/R2: GCCCTGAGCCTGCTCAGCGCCGGCGCTTGTGGACTGCCTGATT/TGCCACCACCGGAT CCATTTATCTGGTTTACACCAAAGAAA (as shown in SEQ ID NO: 9) were used to conduct the second round of PCR amplification with cDNA obtained from the reverse transcription as a template to obtain a fragment 2. The primers 6827-F1/R2: GTTTGGTGTTACTTCTGCAGATGGAGTGGACGGCCCCGAA/TGCCACCACCGGATCC ATTTATCTGGTTTACACCAAAGAAA (as shown in SEQ ID NO: 10) were used to conduct the third round of PCR-overlap PCR with a mixture of the fragment 1 and fragment 2 as a template to obtain a coding sequence (SEQ ID No: 6) of a site-modified ZmSPL12 gene.

[0055] II. Creation and Biological Characteristics of a Mutant ZmSBP12-OE

[0056] 1. Construction of a ZmSBP12 Overexpression Vector pCAMBIA-Ubi::ZmSBP/2-eGFP

[0057] A DNA molecule shown in SEQ ID No: 2 in the Sequence Listing was inserted between PstI and BamHI restriction sites of the modified pCAMBIA vector through homologous recombination to obtain a ZmSBP12 overexpression vector pCAMBIA-Ubi::ZmSBP12-eGFP. The vector was sequenced. Sequencing results showed that the vector pCAMBIA-Ubi::ZmSBP12-eGFP was obtained by inserting a DNA molecule shown in SEQ ID No: 2 in the Sequence Listing between the Pstl and BamHI restriction sites of the modified pCAMBIA without changing the remaining part of the modified pCAMBIA vector.

[0058] 2. Acquisition of a Recombinant Bacterial Strain

[0059] The ZmSBP12 overexpression vector pCAMBIA-Ubi::ZmSBP12-eGFP obtained in step 1 was transformed into A. tumefaciens EHA105 through electric shock on a clean bench to obtain a recombinant strain pCAMBIA-Ubi::ZmSBP12-eGFP/EHA105, which could be transformed into a Xiang249 WT immature embryo callus.

[0060] 3. Construction of a Mutant ZmSBP12-OE

[0061] A genetic transformation method of infecting an immature Zea mays L. embryo with A. tumefaciens includes: (1) preparation of an A. tumefaciens infection solution; (2) infection and co-cultivation, where the immature Zea mays L. embryo was infected with the infection solution, and after the infection was completed, the immature Zea mays L. embryo was cultivated in a co-cultivation medium in the dark with a scutellum facing upward; (3) screening, subcultivation, and plant regeneration; (4) induction; (5) differentiation; (6) rooting; and (7) seedlings were exercised, and then transferred to and planted in a field to obtain To-generation transgenic Zea mays L.

[0062] With reference to the above method, the mutant Ubi::ZmSBP12-eGFP was obtained with the DNA molecule shown in SEQ ID No: 6 in the Sequence Listing.

[0063] 4. Identification of the Transgenic Mutant ZmSBP12-OE

[0064] Plants were sprayed with a 1/1,000 (V/V) Basta solution for screening and identification. If a plant is a negative plant (without transgenic ingredients), leaves on the plant will wither on day 3 after the Basta solution is sprayed. If a plant is a positive plant, the leaves on the plant (with transgenic ingredients) do not change.

[0065] 5. Identification of Drought Resistance of the Mutant ZmSBP12-OE

[0066] The mutant ZmSBP12-OE and WT were cultivated in a light incubator (14 h light and 10 h dark; 28° C. in the light and 22° C. in the dark) until two true leaves and one apical bud grew, then subjected to drought treatment until all leaves of the WT withered, then rehydrated and further cultivated for 2 d, and the survival rate was counted. Results showed that the mutant ZmSBP12-OE exhibited drought resistance significantly higher than the drought resistance of the WT (FIG. 3).

[0067] 6. Morphological Characteristics of the Mutant ZmSBP12-OE

[0068] Under natural sunlight conditions, at the 8 unfolded-leaf stage, the plant height of the mutant ZmSBP12-OE was slightly lower than the plant height of the WT, and leaf spacing was reduced (FIG. 4). The growth of plants was delayed. When the WT SAM reached the floret differentiation stage, the mutant had just reached the spikelet differentiation stage (FIG. 4), and the plant height of the mature plant was decreased. Under the same growth conditions, the lengths of aboveground nodes of the mutant ZmSBP12-OE and WT were counted, and it was found that most of the internodal lengths of the mutant were decreased compared with the WT, but internodal lengths of some nodes were slightly larger than that of the WT. In addition, the changes in lengths of aboveground nodes of the mutant ZmSBP12-OE compared with the WT were counted, and it was found that the first 1 to 3 aboveground nodes of the mutant were most significantly decreased. Production practice and research have shown that the stalk breaking of Zea mays L. occurs at the first 1 to 3 aboveground nodes, and the stalk breaking can cause a reduction in corn output or even no harvest, which is closely related to lodging resistance.

[0069] 7. The Overexpression of ZmSBP12 Can Reduce a Hybrid's Plant Height and Ear Height.

[0070] The WT and mutant ZmSBP12-OE were each combined with each of the backbone parents (WL1, WL2, WL3, WL4, and WL5) to obtain F1 populations. A phenotype was observed in Langfang, where the planting density was 6,000 plants/mu and the management mode was the same as the general Zea mays L. field management mode. After the plant type remained unchanged (30 d after pollination), a phenotype was determined. Statistical results are shown in FIGS. 8A-8B. The results show that the overexpression of the ZmSBP12 gene can reduce a hybrid's plant height and ear height, indicating that the increased expression of the ZmSBP12 gene can improve the lodging resistance.

[0071] In summary, after the ZmSBP12 gene is over-expressed in Zea mays L., the drought resistance is increased and the plant and ear heights are decreased in the Zea mays L. mutant, indicating that the ZmSBP12 gene plays a crucial role in the drought resistance and plant type (plant height) of Zea mays L. and has a high breeding application value.