APPLICATION OF DIMETHYL BERBAMINE COMPOUND IN INHIBITION OF SARS-COV-2
20230119764 · 2023-04-20
Inventors
- Wu Zhong (Beijing, CN)
- Chengfeng Qin (BEIJING, CN)
- Xinbo Zhou (Beijing, CN)
- Yongqiang Deng (BEIJING, CN)
- Jiqiang Hu (BEIJING, CN)
- Qingping Jin (BEIJING, CN)
- Bin Yu (Beijing, CN)
- Ruiyuan Cao (BEIJING, CN)
- Manli Wang (BEIJING, CN)
- Xiaofeng Li (BEIJING, CN)
- Nana Zhang (BEIJING, CN)
- Shiyong Fan (BEIJING, CN)
- Zhihong Hu (BEIJING, CN)
- Song Li (Beijing, CN)
Cpc classification
International classification
Abstract
A compound represented by the general Formula I, a geometric isomer thereof, or a pharmaceutically acceptable salt thereof, and/or a solvate thereof, and/or a hydrate thereof for preventing and/or treating a pulmonary disease or symptom associated with SARS-CoV-2 or an asymptomatic or symptomatic SARS-CoV-2 infection, and an application of the compound represented by the general Formula I, the geometric isomer thereof, or the pharmaceutically acceptable salt thereof, and/or the solvate thereof, and/or the hydrate thereof in preparation of a product for preventing and/or treating a pulmonary disease or symptom associated with SARS-CoV-2 or asymptomatic or symptomatic SARS-CoV-2 infection,
##STR00001##
Claims
1.-19. (canceled)
20. A method for preventing and/or treating a disease or infection caused by a SARS-CoV-2 or a disease or infection caused by a SARS-CoV-2 and accompanied with hypertension, comprising administering to a host in need thereof a prophylactically and/or therapeutically effective amount of a compound represented by Formula I, a geometric isomer thereof or a pharmaceutically acceptable salt and/or solvate and/or hydrate thereof, or a pharmaceutical composition comprising a compound represented by Formula I, a geometric isomer thereof or a pharmaceutically acceptable salt and/or solvate and/or hydrate thereof.
21. A method of preventing and/or treating a pulmonary disease or symptom associated with a SARS-CoV-2 or a pulmonary disease or symptom associated with a SARS-CoV-2 and accompanied with hypertension, comprising administering to a host in need thereof a prophylactically and/or therapeutically effective amount of a compound represented by Formula I, a geometric isomer thereof or a pharmaceutically acceptable salt and/or solvate and/or hydrate thereof, or a pharmaceutical composition comprising a compound represented by Formula I, a geometric isomer thereof or a pharmaceutically acceptable salt and/or solvate and/or hydrate thereof.
22. A method for inhibiting the replication or reproduction of a SARS-CoV-2 in a host in need thereof, comprising administering to the host in need thereof a prophylactically and/or therapeutically effective amount of a compound represented by Formula I, a geometric isomer thereof or a pharmaceutically acceptable salt and/or solvate and/or hydrate thereof, or a pharmaceutical composition comprising a compound represented by Formula I, a geometric isomer thereof or a pharmaceutically acceptable salt and/or solvate and/or hydrate thereof.
23. (canceled)
24. The method according to claim 20, wherein the disease caused by the SARS-CoV-2 is a COVID-19.
25. The method according to claim 20, wherein the disease caused by the SARS-CoV-2 and accompanied with hypertension is a COVID-19 accompanied with hypertension.
26.-27. (canceled)
28. The method according to claim 20, wherein the infection caused by the SARS-CoV-2 is an asymptomatic or symptomatic SARS-CoV-2 infection.
29. The method according to claim 20, wherein the infection caused by the SARS-CoV-2 and accompanied with hypertension is an asymptomatic or symptomatic SARS-CoV-2 infection accompanied with hypertension.
30. The method according to claim 20, wherein the host is a mammal.
31. The method according to claim 30, wherein the mammal comprises bovine, equine, caprinae, suidae, canine, feline, rodent, or primate.
32. The method according to claim 31, wherein the mammal is a human, dog or pig.
33. The method according to claim 20, wherein the pharmaceutical composition further comprises a pharmaceutically acceptable carrier or excipient.
34. The method according to claim 33, wherein the pharmaceutical composition is a solid preparation, injection, inhalation preparation, spray, liquid preparation, or compound preparation.
35. The method according to claim 21, wherein the host is a mammal.
36. The method according to claim 35, wherein the mammal comprises bovine, equine, caprinae, suidae, canine, feline, rodent, or primate.
37. The method according to claim 36, wherein the mammal is a human, dog or pig.
38. The method according to claim 21, wherein the pharmaceutical composition further comprises a pharmaceutically acceptable carrier or excipient.
39. The method according to claim 38, wherein the pharmaceutical composition is a solid preparation, injection, inhalation preparation, spray, liquid preparation, or compound preparation.
40. The method according to claim 22, wherein the host is a mammal.
41. The method according to claim 40, wherein the mammal comprises bovine, equine, caprinae, suidae, canine, feline, rodent, or primate.
42. The method according to claim 41, wherein the mammal is a human, dog or pig.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0056]
[0057]
[0058]
SPECIFIC MODELS FOR CARRYING OUT THE PRESENT INVENTION
[0059] The substantive contents of the present application will be further described below with reference to the specific examples of the present application. It should be understood that the following examples are only used to illustrate the present application, but are not intended to limit the protection scope of the present application. If the specific conditions are not indicated in the following examples, they are carried out according to the conventional conditions or the manufacturer's suggestion. The medicines or reagents used without the manufacturer's indication are conventional products that can be obtained from the market.
[0060] While many of the materials and operation methods used in the following examples are known in the art, they are still described in the present application as much detail as possible. It is clear to those skilled in the art that the materials and operating methods used in the following examples are well known in the art unless otherwise specified.
EXAMPLE 1
Pharmacodynamic Study 1 of Tetrandrine on SARS-CoV-2
[0061] 1. Materials and Methods
[0062] 1.1 Drugs: Tetrandrine was obtained from Zhejiang Jinhua CONBA Pharmaceutical Co., Ltd., the batch number of which is YG1910005, the content of which is 99.3%. The reference drug, chloroquine phosphate, was purchased from Sigma company, Cat. No. C6628; Remdesivir was purchased from MedChemExpresss company, Cat. No. HY-104077. Tetrandrine was prepared into 10 mM stock solution with DMSO, remdesivir was prepared into 100 mM stock solution with DMSO, and chloroquine phosphate was prepared into 100 mM stock solution with PBS. During the experiment, they were diluted with MEM medium containing 2% fetal bovine serum to the concentrations required for the experiment.
[0063] 1.2 Cells: Vero-E6 cells, purchased from ATCC, Cat. No. 1586.
[0064] 1.3 Virus: SARS-CoV-2 virus (nCoV-2019BetaCoV/Wuhan/WIV04/2019 isolate, the GISAID accession number was EPI_ISL_402124) was isolated and subcultured by Wuhan Institute of Virology, Chinese Academy of Sciences. During the experiment, the virus was diluted to the concentration required for the experiment with MEM medium containing 2% fetal bovine serum.
[0065] 1.4. Reagents, Laboratory Supplies and Instruments:
[0066] 1.4.1 Reagents: MEM dry powder, purchased from GIBCO, USA, Cat. No. 10370021; fetal bovine serum (FBS), purchased from GIBCO, USA, Cat. No. 16000044; sodium bicarbonate, purchased from Sinopharm; penicillin, streptomycin and kanamycin: all were purchased from North China Pharmaceutical Company Ltd.; PBS, purchased from GIBCO, Cat. No. C10010500BT.
[0067] 1.4.2 Experimental supplies and instruments: culture flask, purchased from Corning Company, USA; 96-well culture plate, purchased from Corning Company, USA; carbon dioxide incubator, purchased from Thermo Company, USA;
[0068] 1.4.3 Preparation of Cell Culture Medium and Reagents:
[0069] The cell culture medium was MEM medium, per 100 ml of which contained 10% fetal bovine serum, penicillin, streptomycin and kanamycin each 100 U/ml, and 5% NaHCO.sub.3.
[0070] Cell digestion solution: 0.25% trypsin, prepared with Hanks solution, 0.02% EDTA.
[0071] 1.5. Experimental Method:
[0072] 1.5.1 Vero E6 cell culture: 0.1 ml of 0.25% trypsin, 5 ml of 0.02% EDTA were added to a culture flask full of cells, the digestion was carried out at 37° C. for 5 minutes, then the digestion solution was discarded, the cell culture solution was added and then mixed by pipetting up-down. The cells were subcultured at 1:3, reached confluence within 3 days, formulated into 100,000 cells per ml, inoculated to a 96-well cell culture plate, 0.1 ml per well, and cultured at 37° C., 5% CO.sub.2 for 24 hours, and the cells grew into monolayer was used for experiment.
[0073] 1.5.2 Experiment of Drug Cytotoxicity on Cells:
[0074] The detection of drug cytotoxicity was determined using CellTiter-Glo kit (Promega). Specific steps were as follows:
[0075] {circle around (1)} 1×10.sup.4 Vero-E6 cells were inoculated in a 96-well plate and cultured at 37° C. for 8 hours.
[0076] {circle around (2)} The stock solution of drug was diluted with MEM medium containing 2% FBS to the desired concentration, the original medium in the 96-well plate was discarded, and 100 μL of the drug-containing MEM medium was taken and added to the corresponding wells, so that the final concentrations of drug in the wells were those shown in Tables 1 to 3, respectively, and three replicate wells were made for each concentration. At the same time, a vehicle control (adding DMSO or PBS, and 2% FBS-containing MEM medium without drug to the cell wells) and a blank control (adding DMSO and 2% FBS-containing MEM medium to the wells without cells) were set. After the addition of drug, the cells were incubated at 37° C. for 24 hours.
[0077] {circle around (3)} 100 μL of CellTiter-Glo solution (Promega) was added to the wells to be tested, and mixed by shaking for 2 min to fully lyse the cells, incubated at room temperature for 10 minutes, and readings of chemiluminescence signals OD450 were obtained on a microplate reader (purchased from Molecular Devices, model: SpectraMax M5). The cell viability was calculated by taking the readings into the following formula:
Cell viability (%)=(A.sub.(drug treatment group)−A.sub.(blank control))/(A.sub.(vehicle control)−A.sub.(blank control))×100%
[0078] where A represented the reading on the microplate reader.
[0079] 1.5.3 Antivirus Experiment:
[0080] {circle around (1)} Drug Treatment
[0081] Vero E6 cells were inoculated into a 48-well plate, about 1×10.sup.5 cells per well, and the experiment was performed on the next day. Firstly, 100 μL of MEM medium (containing 2% FBS) containing the corresponding concentration of drug was added to the plate, the cells were pretreated for 1 hour, then 20 μL of diluted virus (the amount of virus was 1000 TCID.sub.50, that was, MOI=0.01, and the amount of virus was 5000 TCID.sub.50, that was, MOI=0.05) was added, and then the cells were placed in an incubator and incubated for 1 hour. Then the virus culture medium was discarded, the uninfected residual virus was washed away with PBS, and then MEM culture media (containing 2% FBS) that contained the corresponding concentrations of tetrandrine, remdesivir and chloroquine phosphate were added, respectively, so that the final concentrations of drug in the wells were those shown in Table 4 to Table 6, respectively, and then the cells was placed into a 37° C., 5% CO.sub.2 incubator and subsequently cultured for 48 h. To the cell control group, a final concentration of 0.3% DMSO in MEM culture medium containing 2% FBS or 0.5% PBS in MEM medium containing 2% FBS was added.
[0082] {circle around (2)} RNA Extraction
[0083] RNA extraction was performed using a kit produced by TaKaRa company (TaKaRa MiniBEST Viral RNA/DNA Extraction Kit, Cat. No. 9766). Unless otherwise specified, the consumables and reagents involved in the following RNA extraction steps were parts of the kit. The following extraction steps were all recommended in the kit instruction.
[0084] 1) 100 μL of the supernatant was taken from the test plate, added to a nuclease-free EP tube (purchased from Axygen, Cat. No. mct-150-c), then 321 μL of lysis solution (100 μL PBS, 200 μL buffer VGB, 2 μL proteinase K, 1 μL carrier RNA) was added to per well, mixed well, and then digestion was carried out at 56° C. for 15 min;
[0085] 2) 200 μL of absolute ethanol was added to the mixture obtained in step 1), and mixed well;
[0086] 3) the mixture obtained in step 2) was transferred into an RNase-free spin column, centrifuged at 12,000 rpm for 15 s, and the waste liquid was discarded;
[0087] 4) 500 μL of Buffer RW1 was added, centrifuged at 12,000 rpm for 15 s to wash the spin column, and the waste liquid was discarded;
[0088] 5) 650 μL of Buffer RW2 was added, centrifuged at 12000 rpm for 15 s to wash the spin column, and the waste liquid was discarded;
[0089] 6) 650 μL of Buffer RW2 was added, centrifuged at 12,000 rpm for 2 min to wash the spin column, the waste liquid was discarded, and then the entire spin column was transferred to a new RNase-free 2 ml collection tube in step 7);
[0090] 7) a new RNase-free 2 ml collection tube was used for exchange, centrifugation was carried out at 12,000 rpm for 1 min, the spin column was dried, and then the entire spin column was transferred to a 1.5 ml collection tube in step 8);
[0091] 8) a new 1.5 ml collection tube was used for exchange, the dried spin column in step 7) was placed therein, 30 μL of RNase-free water was added to each spin column, centrifugation was carried out at 12,000 rpm for 2 min, and the resultant eluate contained the corresponding RNA.
[0092] {circle around (3)} RNA Reverse Transcription
[0093] A reverse transcription kit (PrimeScript™ RT reagent Kit with gDNA Eraser, Cat. No. RR047Q) produced by TaKaRa company was used for RNA reverse transcription. The steps were as follows:
[0094] 1) Removal of gDNA: RNA samples were collected from each experimental group, and 3 μL of RNA was taken for reverse transcription. First, 2 μL of 5×gDNA Eraser Buffer was added to the RNA sample of each experimental group, the reaction system was supplemented to 10 μL with RNase-free water, mixed well, and subjected to water bath at 42° C. for 2 min to remove the gDNA that might be present in the sample;
[0095] 2) Reverse transcription: Appropriate amounts of enzyme, primer Mix and reaction buffer were added to the sample obtained in step 1), RNase-free water was added to supplement to a volume of 20 μL, the reaction was performed in a 37° C. water bath for 15 minutes, and then in a 85° C. water bath for 5 sec, to obtain cDNA by transcription.
[0096] {circle around (4)} Real-Time PCR.
[0097] Fluorescence quantitative PCR was used to detect the copy number per milliliter of the original virus solution.
[0098] The reaction system was mixed with TB Green Premix (Takara, Cat #RR820A), and the amplification reaction and reading were performed with a StepOne Plus Real-time PCR instrument (brand: ABI). The copy number per milliliter of the original virus solution was calculated. The steps were as follows:
[0099] 1) First, standard product were established. Plasmid pMT-RBD was diluted into 5×10.sup.8 copies/μL, 5×10.sup.7 copies/μL, 5×10.sup.6 copies/μL, 5×10.sup.5 copies/μL, 5×10.sup.4 copies/μL, 5×10.sup.3 copies/μL, 5×10.sup.2 copies/μL, respectively. 2 μL of standard product or cDNA template was taken for qPCR reaction;
[0100] 2) The primer sequences used in the experiment were as follows (all were indicated in the 5′-3′ direction):
TABLE-US-00001 RBD-qF: CAATGGTTTAACAGGCACAGG RBD-qR: CTCAAGTGTCTGTGGATCACG
[0101] 3) The reaction procedure was as follows:
[0102] Pre-denaturation: 95° C. for 5 minutes;
[0103] Cycling parameters: 95° C. for 15 seconds, 54° C. for 15 seconds, 72° C. for 30 seconds. 40 cycles in total.
[0104] 2. Results
[0105] 2.1. Toxicity of Tetrandrine, Chloroquine Phosphate and Remdesivir on Vero E6 Cells
[0106] The cytotoxicity results showed that the treatment of the test compounds did not change the cell viability at all the tested concentrations, that was, the test compounds had no toxic effect on the cells at all concentrations (Tables 1 to 3).
TABLE-US-00002 TABLE 1 Cytotoxicity experiment of test compound tetrandrine Tetrandrine Concentration (μM) 100 50 25 12.5 6.25 3.13 1.56 Vehicle Cell viability 0.96 ± 0.28 ± 58.25 ± 78.14 ± 91.24 ± 97.38 ± 94.81 ± 100.00 ± (% of vehicle 0.14 0.32 2.25 1.98 1.55 1.04 2.84 4.36 control)
TABLE-US-00003 TABLE 2 Cytotoxicity experiment of test compound remdesivir Rcmdesivir Concentration (μM) 200 100 50 25 12.5 6.25 3.13 Vehicle Cell viability 40.05 ± 70.09 ± 90.20 ± 95.71 ± 99.62 ± 99.17 ± 97.16 ± 100.00 ± (% of vehicle 1.33 0.62 4.90 0.82 3.00 2.36 2.53 0.93 control)
TABLE-US-00004 TABLE 3 Cytotoxicity experiment of test compound chloroquine phosphate Chloroquine phosphate Concentration (μM) 300 200 100 66.67 33.33 11.11 3.70 Vehicle Cell viability 0.63 ± 41.01 ± 44.84 ± 68.35 ± 72.67 ± 90.60 ± 93.26 ± 100.00 ± (% of vehicle 0.30 1.95 1.79 1.16 2.95 3.49 2.52 1.64 control)
[0107] 2.2. Antiviral Activity of Tetrandrine, Chloroquine Phosphate and Remdesivir
[0108] The results of virus proliferation inhibition experiment showed that the test compounds at different concentrations could effectively inhibit the replication of viral genome in the infected cell supernatant by SARS-CoV-2 (Tables 4 to 6 and
TABLE-US-00005 TABLE 4 Antiviral experiment of test compound tetrandrine Tetrandrine Concentration (μM) 20 10 5 2.5 1.25 0.625 Vehicle Copy number 1323393 ± 1456943 ± 373861479 ± 1707286250 ± 3336005167 ± 3357508000 ± 4646163000 ± of viral genome 148300 42494 310383208 252757047 635129185 476420774 630749778 (MOI = 0.01) Copy number 4092752 ± 8161310 ± 2477488500 ± 7118504000 ± 7198143667 ± 10669558667 ± 10500189000 ± of viral genome 1707243 1970471 1234782636 1427562917 574130625 2124266671 906949593 (MOI = 0.05)
TABLE-US-00006 TABLE 5 Antiviral experiment of test compound remdesivir Remdesivir Concentration (μM) 30 10 3.33 1.11 0.37 0.12 Vehicle Copy number 975616 ± 563645 ± 243294 ± 19898611 ± 1901120292 ± 3900176000 ± 4646163000 ± of viral genome 267388 305066 396633 4384275 579712007 567399802 630749778 (MOI = 0.01) Copy number 2594526 ± 3230111 ± 13188656 ± 545157271 ± 9405568167 ± 11594175000 ± 10500189000 ± of viral genome 326599 1837657 214715 238234317 1937694233 2754638836 906949593 (MOI = 0.05)
TABLE-US-00007 TABLE 6 Antiviral experiment of test compound chloroquine phosphate Chloroquine phosphate Concentration (μM) 50 16.67 5.56 1.85 0.62 0.21 Vehicle Copy number 1019575 ± 11907226 ± 692991541 ± 1500455250 ± 2407772083 ± 3451032833 ± 3393134375 ± of viral genome 264173 3553865 155454354 191634910 85393605 662740949 303897692 (MOI = 0.01) Copy number 1914748 ± 52973263 ± 1814432458 ± 4521430250 5663562000 ± 5871676583 ± 5652325333 ± of viral genome 146170 25725143 127478253 ±566280195 672504403 157934682 1119313517 (MOI = 0.05)
[0109] After calculation, under the condition of virus multiplicity of infection (MOI) of 0.01:
[0110] Tetrandrine: EC.sub.50=1.71 μM, CC.sub.50=24.51 μM, SI=14.33
[0111] Remdesivir: EC.sub.50=0.30 μM, CC.sub.50=160.30 μM, SI=534.33
[0112] Chloroquine phosphate: EC.sub.50=1.54 μM, CC.sub.50=92.93 SI=60.34
[0113] Under the condition of virus multiplicity of infection (MOI) of 0.05:
[0114] Tetrandrine: EC.sub.50=2.88 μM, CC.sub.50=24.51 μM, SI=8.51
[0115] Remdesivir: EC.sub.50=0.59 μM, CC.sub.50=160.30 μM, SI=271.69
[0116] Chloroquine phosphate: EC.sub.50=3.77 μM, CC.sub.50=92.93 SI=24.49
[0117] 3. Conclusion
[0118] Tetrandrine (the reference substances are chloroquine phosphate and remdesivir) had good safety for the test cells in vitro at different test concentrations. Tetrandrine, remdesivir and chloroquine phosphate had obvious inhibitory effects against the SARS-CoV-2 virus isolate nCoV-2019BetaCoV/Wuhan/WIV04/2019, and when the MOI of virus infection was 0.01, the EC.sub.50 values of which were 1.71 μM, 0.30 μM and 1.54 μM, respectively, and the corresponding selectivity index of which were 14.33, 534.33 and 60.34, respectively, when the MOI of virus infection was 0.05, the EC.sub.50 values of which were 2.88 μM, 0.59 μM and 3.77 μM, respectively, and the corresponding selectivity index of which were 8.51, 271.69 and 24.49, respectively.
[0119] Tetrandrine, chloroquine phosphate and remdesivir had inhibitory activity against SARS-CoV-2 virus in vitro.
EXAMPLE 2
Pharmacodynamic Study 2 of Tetrandrine on SARS-CoV-2
[0120] The experimental materials and methods were the same as those in Example 1. The specific difference was that in the antiviral experiment, the drug treatment step in Example 1 comprised first adding 100 μL of MEM culture medium (containing 2% FBS) containing the corresponding concentration of drug to the plate, and the cells were pretreated for 1 hour, while in this example, the drug treatment step did not comprise pretreating cells with drug, and the specific steps were as follows:
[0121] Vero E6 cells were inoculated into a 48-well plate, about 1 ×10.sup.5 cells per well, and then 20 μL of diluted virus was added (the amount of virus was 1000 TCID.sub.50, that was, MOI=0.01, and the amount of virus was 5000 TCID.sub.50, that was, MOI=0.05), and then the cells were placed in an incubator and incubated for 1 hour. After 1 h, the virus culture medium was discarded, the uninfected residual virus was washed away with PBS, and MEM culture media (containing 2% FBS) containing the corresponding concentrations of tetrandrine, remdesivir and chloroquine phosphate were added, respectively, so that the final concentrations of drug in the cells were the same as those drug concentrations shown in Tables 4, 5 and 6 of Example 1, then the cells was placed into a 37° C., 5% CO.sub.2 incubator and subsequently cultured for 48 h. To the cell control group, a final concentration of 0.3% DMSO in cell culture medium containing 2% FBS or 0.5% PBS in cell medium containing 2% FBS was added.
[0122] The methods of the subsequent RNA extraction, RNA reverse transcription and Real-time PCR were the same as in Example 1.
[0123] After calculation, under the condition of virus multiplicity of infection (MOI) of 0.01:
[0124] Tetrandrine: EC.sub.50=1.61 μM, CC.sub.50=24.51 μM, SI=15.22
[0125] Remdesivir: EC.sub.50=0.23 μM, CC.sub.50=160.30 μM, SI=696.96
[0126] Chloroquine phosphate: EC.sub.50=4.52 μM, CC.sub.50=92.93 SI=20.56
[0127] Under the condition of virus multiplicity of infection (MOI) of 0.05:
[0128] Tetrandrine: EC.sub.50=1.95 μM, CC.sub.50=24.51 μM, SI=12.51
[0129] Remdesivir: EC.sub.50=0.62 μM, CC.sub.50=160.30 μM, SI=258.55
[0130] Chloroquine phosphate: EC.sub.50=3.63 μM, CC.sub.50=92.93 SI=25.60
[0131] Conclusion:
[0132] The results of antiviral experiments showed that tetrandrine, remdesivir and chloroquine phosphate had obvious inhibitory effects against the SARS-Cov-2 virus isolate nCoV-2019BetaCoV/Wuhan/WIV04/2019, when the MOI of virus infection was 0.01, the EC.sub.50 values of which were 1.61 μM, 0.23 μM and 4.52 μM, respectively, and the corresponding selectivity index of which were 15.22, 696.96, and 20.56, respectively; when the MOI of virus infection was 0.05, the EC.sub.50 values of which were 1.95 μM, 0.62 μM and 3.63 μM, respectively, and the corresponding selectivity index of which were 12.51, 258.55 and 25.60, respectively. (See
[0133] Tetrandrine, chloroquine phosphate and remdesivir had inhibitory activity against SARS-Cov-2 virus after virus infection of cells.
EXAMPLE 3
Half-Maximal Effective Concentration (EC.SUB.50.) of Tetrandrine Against SARS-CoV-2
[0134] The EC.sub.50 of the drug was determined by nucleic acid quantification. Specifical steps were as follows: Vero cells were inoculated into a 48-well plate at a concentration of about 10,000 cells/well one day in advance. The drug tetrandrine was prepared to a final concentration of 20, 10, 5, 2.5, 1.25, 0.625 and 0.3125 μM with DMEM medium containing 2% FBS (purchased from Gibco, Cat. No. 16000044), and added to the cells, the cells were placed in a 37° C., 5% CO.sub.2 incubator to be pretreated for 1 hour. Then, SARS-CoV-2 virus (nCoV-2019BetaCoV/Wuhan/WIV04/2019 isolate, the GISAID accession number was EPI_ISL_402124, isolated and subcultured by Wuhan Institute of Virology, Chinese Academy of Sciences) was diluted with DMEM medium containing 2% FBS, and added to the corresponding wells to make the viral load as 100 TCID.sub.50, subjected to adsorption and culture at 37° C. for 2 hours, then the virus solution was discarded, and tetrandrine at different concentrations was added to each well (200 μL/well) so that the final concentrations of tetrandrine were 20, 10, 5, 2.5, 1.25, 0.625 and 0.3125 μM in the well, 3 duplicate wells were set for each drug concentration, and a virus control group and a normal cell control group were set up, the culture was performed in a 37° C., 5% CO.sub.2 incubator, and cytopathic effects (CPE) were observed daily. Two days after infection, 50 μL of cell supernatant was taken from each well to extract nucleic acid, and the viral load was detected by quantitative RT-PCR.
[0135] The methods of RNA extraction, RNA reverse transcription and RT-PCR were the same as in Example 1.
[0136] According to the conversion formula of viral RNA copy number and CT value: RNA Copies/mL=CT*(−0.3)+13.17, the viral load was calculated. The formula: (infection rate (%)=RNA copy number of drug group/RNA copy number of virus control group×100%) was used to calculate the infection rate (%) of virus at different concentrations of drug treatment, and Graphpad Prism 7 software was used to perform S-fitting analysis on the data, and the fitting results were shown in
[0137] The results showed that tetrandrine had an inhibitory effect against the SARS-CoV-2 virus at the cellular level with an EC.sub.50 of 8.99 μM (
[0138] Although the specific embodiments of the present application have been described in detail, those skilled in the art will understand that, based on all the teachings disclosed, various modifications and substitutions of those details may be made, and these changes are all within the protection scope of the present application. The full scope of the present application is given by the appended claims and any equivalents thereof.
REFERENCES
[0139] Zaki A M, van Boheemen S, Bestebroer T M, et al. Isolation of a novel coronavirus from a man with pneumonia in Saudi Arabia[J]. N Engl J Med, 2012, 367(19): 1814-1820.
[0140] Zhong N S, Zheng B J, Li Y M, et al. Epidemiology and cause of severe acute respiratory syndrome (SARS) in Guangdong, People's Republic of China, in February, 2003[J]. The Lancet, 2003, 362(9393): 1353-1358.
[0141] Cui J, Li F, Shi Z L. Origin and evolution of pathogenic coronaviruses[J]. Nat Rev Microbiol, 2019, 17(3): 181-192.
[0142] Wang M, Cao R, Zhang L, et al. Remdesivir and chloroquine effectively inhibit the recently emerged novel coronavirus (2019-nCoV) in vitro[J]. Cell Res, 2020, 0: 1-3.