Finite fully addressable nucleic acid nanostructures as nanocarriers for delivery of pharmaceuticals
09579396 ยท 2017-02-28
Assignee
Inventors
- Chris Dwyer (Durham, NC, US)
- Hong Zhong (Huntington, WV, US)
- Michael Norton (Huntington, WV, US)
- Steven Armentrout (Reston, VA, US)
Cpc classification
A61K31/7088
HUMAN NECESSITIES
A61K47/549
HUMAN NECESSITIES
A61K31/7052
HUMAN NECESSITIES
Y10T428/2982
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
A61K48/00
HUMAN NECESSITIES
A61K47/6929
HUMAN NECESSITIES
A61P35/00
HUMAN NECESSITIES
International classification
A61K48/00
HUMAN NECESSITIES
A61K31/7052
HUMAN NECESSITIES
A61K38/16
HUMAN NECESSITIES
Abstract
The present invention provides nanostructures that are particularly well suited for delivery of bioactive agents to organs, tissues, and cells of interest in vivo, and for diagnostic purposes. In exemplary embodiments, the nanostructures are complexes of DNA strands having fully defined nucleotide sequences that hybridize to each other in such a way as to provide a pre-designed three dimensional structure with binding sites for targeting molecules and bioactive agents. The nanostructures are of a pre-designed finite length and have a pre-defined three dimensional structure.
Claims
1. A nanostructure complex comprising: at least one nucleic acid molecule, the linear sequences of bases of each molecule being known and artificially and deliberately assigned to cause pre-determined inter- and/or intra-molecule binding to form a pre-determined, finite, two-dimensional or three-dimensional structure, wherein the nanostructure complex is of a predetermined finite size, and wherein the nanostructure complex has one or more pre-defined sequences engineered to control in vivo degradation by use of one unbound helical domain, or two or more bound helical domains, and one or more pre-defined sequences engineered to bond with one or more pre-selected cell-binding moieties, the collection of which forms a pattern designed to effect cell binding, with selectivity coefficient greater than 1 and dissociation constant less than 10.sup.3, for targeting the nanostructure complex to designated target cell types, and causing internalization of the nanostructure complex in the target cell types, wherein the nanostructure complex has one or more pre-defined sequences engineered to bond with one or more pre-selected substances of interest, wherein the nanostructure complex is capable of delivering the substance(s) of interest to the target cell types, and wherein the nanostructure complex is internalized by the target cell types.
2. The nanostructure complex of claim 1, wherein the one or more pre-selected substances of interest are selected from among: therapeutic effectors, binding effectors, immunogenic effectors, immunostimulators, molecular sensors, or bioactive agents.
3. The nanostructure complex of claim 1, wherein the substance(s) is covalently bonded to the nucleic acid(s).
4. The nanostructure complex of claim 2, wherein the therapeutic effector comprises siRNA, protein, organic molecule/complex, and inorganic molecule/complex.
5. The nanostructure complex of claim 2, wherein the binding effector comprises a nucleic acid aptamer, a protein, a polypeptide, a polysaccharide, a cholesterol, or other organic/inorganic molecules and/or complexes.
6. The nanostructure complex of claim 1, wherein all of the moieties can be the same, all can be different, or some the same and others different.
7. The nanostructure complex of claim 1, wherein the identity and positioning of the nucleotide bases, nucleic acid strands, or moieties are selected to achieve one or more desired physical properties.
8. The nanostructure complex of claim 7, wherein the physical properties are selected from among size, conformation, overall charge, charge distribution, hydrophobicity, and hydrophilicity.
9. The nanostructure complex of claim 1, wherein the pre-defined portion(s) of the nucleic acid(s) are engineered to control the orientation, conformation, and/or relative positions of the pre-selected substance(s).
10. The nanostructure complex of claim 2, wherein the complex has an upper and a lower surface, and wherein the complex has at least one pre-selected substance on each of said upper and lower surfaces.
11. The nanostructure complex of claim 1, wherein the complex has a pre-defined three-dimensional structure having a longest dimension of from 2 nm to 1000 nm.
12. A method of treating a subject, comprising administering the nanostructure complex of claim 2 to the subject in an amount sufficient to provide a treatment effect.
13. The method of claim 12, wherein the treatment effect is a prophylactic effect or a therapeutic effect.
14. The method of claim 12, wherein the nanostructure complex is administered as an immunogen, a vaccine, an immunostimulator, or as a vaccine adjuvant.
15. The method of claim 12, wherein the method is a method of treating cancer.
16. The method of claim 15, wherein the cancer is a glioma, breast cancer, prostate cancer, or lung cancer.
17. The method of claim 12, wherein at least one surface of the nanostructure complex is bound by a substance that binds red blood cells and at least one other surface is bound by a substance that binds cancer cells.
18. The method of claim 17, wherein the nanostructure complex further is bound to a cytotoxic agent on one or more of its surfaces.
19. The method of claim 14, wherein the nanostructure complex, by virtue of a highly ordered arrangement of immunogenic effectors, promotes a rapid and effective antigen-specific immunogenic response.
20. The method of claim 15, wherein the nanostructure complex comprises nucleic acid strands that are completely complementary with one another, having no unbound nucleotides at either end, which increases the circulation half-life as compared to nanostructures with one or more ends with unbound nucleotides.
21. The method of claim 15, wherein the nanostructure complex comprises two or more different substances that are specific for the same target.
22. The method of claim 15, wherein the nanostructure complex comprises a generally tubular shape defined by an outer surface and an inner surface, wherein the pre-selected substance is bound to the inner surface by disulfide linkages that are reduced upon entry of the nanostructure complex into a cell of the subject.
23. The nanostructure of claim 1, wherein the cell binding moieties are low affinity binding molecules that are specific for a tumor cell.
24. The nanostructure of claim 23, wherein the tumor cell is a glioma cell.
25. The nanostructure of claim 1, wherein the nanostructure has a half life in vivo of at least 2.7 hours.
26. A method of synthesizing a nanostructure complex of claim 1 having up to 7,000 pre-selected substances bound to the polymer(s), said method comprising reacting amino groups of the polymer(s) of the complex with succinimidyl hemidithiodiglycolyl polyethyleneimine (SHDT-PEI) at an approximate ratio <1:5 in HEPES buffer, pH 8.0, to form a polymer-PEI; covalently bonding the pre-selected substances to the PEI moiety of the polymer-PEI at an approximate ratio >5:1.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1) The accompanying drawings, which are incorporated in and constitute a part of this specification, illustrate embodiments and features of embodiments of the invention, and together with the written description, serve to explain certain principles of the invention.
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
DETAILED DESCRIPTION OF EXEMPLARY VARIOUS EMBODIMENTS OF THE INVENTION
(13) Reference will now be made in detail to various exemplary embodiments of the invention. It is to be understood that the following discussion of exemplary embodiments is not intended as a limitation on the invention, as broadly disclosed herein. Rather, the following discussion is provided to give the reader a more detailed understanding of certain aspects and features of the invention.
(14) Before embodiments of the present invention are described in detail, it is to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting. Further, where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit, unless the context clearly dictates otherwise, between the upper and lower limits of that range is also contemplated and disclosed without the need to specifically recite each value individually in this text. Each smaller range between any stated value or intervening value in a stated range and any other stated or intervening value in that stated range is encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included or excluded in the range, and each range where either, neither, or both limits are included in the smaller ranges is also encompassed within the invention, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the invention.
(15) Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the term belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred methods and materials are now described. All publications mentioned herein are incorporated herein by reference to disclose and describe the methods and/or materials in connection with which the publications are cited. The present disclosure is controlling to the extent it conflicts with any incorporated publication.
(16) As used herein and in the appended claims, the singular forms a, an, and the include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to a polymer includes a plurality of such polymers and reference to the nanostructure includes reference to one or more nanostructures and equivalents thereof known to those skilled in the art, and so forth. Furthermore, the use of terms that can be described using equivalent terms include the use of those equivalent terms. Thus, for example, the use of the term subject is to be understood to include the terms patient, animal, human, and other terms used in the art to indicate one who is subject to a medical treatment. As another example, the use of the term neoplastic is to be understood to include the terms tumor, cancer, aberrant growth, and other terms used in the art to indicate cells that are replicating, proliferating, or remaining alive in an abnormal way. The term animal includes humans unless otherwise indicated.
(17) As used herein, a substance bonded, bound, or attached to a nanostructure means at least one atom in the substance associates and/or is constrained with the nanostructure via one chemical bond, multiple chemical bonds, or other types of interactions, including but not limited to polar bonding, covalent bonding, ionic bonding, hydrogen bond, and van der Waals interactions.
(18) The present invention provides nanostructures that can be used, among other things, as physical platforms for delivery of substances to targets. While the invention is described in detail with regard to delivery of biologically active agents (also known in the art as bioactive agents) to target cells, tissues, and organs of subjects, it is to be understood that the nanostructures can be used to deliver any small substance to any target, the only restriction being that the substance to be delivered must be of a sufficiently small size to be capable of binding to the nanostructures of the invention. The substances are thus typically on the order of one micrometer or less in length/diameter. Non-exclusive examples of substances that do not necessarily have biological activity include: metals, metal alloys, and metal containing complexes; minerals and mineral containing complexes; polymeric elastomers; thermosetting resins; natural and synthetic rubbers; and the like.
(19) In general, the nanostructures of the invention can be considered to have two physical and functional portions: 1) a core structure comprised of one or more polymers, which form into core structure subunits, where the core structure or core structure subunit has a three dimensional shape that is engineered by way of deliberate arrangement of the sequence of the monomeric units that make up the polymers; and 2) one or more substances bonded to the core structure. Bonding of the substance(s) to the core structure can be by any suitable means, including, but not necessarily limited to, chemical bonding (e.g., covalent bonding, ionic bonding, hydrogen bonding). The association between the core structure and the substances can be by way of direct bonding of the two to each other or by way of one or more intermediary molecules, such as linker molecules comprising nucleic acids, polypeptides, or carbohydrates.
(20) For example, a DNA nanostructure can be constructed with a biotin and a pair of thrombin aptamers, where the distance between the biotin and the aptamer pair is pre-determined by design. When the concentrations of streptavidin and thrombin are low, the nanostructure displays the streptavidin at the pre-designed site with low occupancy of thrombin in its binding site. When the concentration of thrombin is increased, the chance to find the nanostructure displaying both streptavidin and thrombin on it at the pre-designed sites increases as well.
(21) The core structure can be comprised of any suitable polymer. In exemplary embodiments, it is comprised of nucleic acids, including both single-stranded and double-stranded DNA and RNA. It has been surprisingly found that DNA nanostructures according to the invention are not only stable in vivo, but are also stable enough to deliver a substance of interest (also referred to herein as a cargo or payload) to a target within a living subject in an amount sufficient to treat the subject.
(22) The core structure is designed using computer software and one or more computing devices. Numerous computer programs and software suites are known and used in the art, and the practitioner is free to choose the appropriate programs or suites according to any number of considerations. An exemplary suitable program suite is the inSquio Sequence Design Studio (Parabon NanoLabs, Inc., Reston, Va.). In general, the program or suite of programs must be capable of using known physical and chemical properties of a particular polymer, and specifically the monomeric units making up that polymer within the overall context of the polymer sequence, and determining the types and strengths of interactions between and among the various possible permutations of interacting sequences. By arranging the order of bases within a set of nucleic acid strands, the strands can be programmed to assemble into complex designs by way of known complementarity rules. For example, the computer program can design two nucleic acid sequences that provide complementary and non-complementary regions such that a desired shape can be formed.
(23) Although the core structure can comprise a single polymer, it is typically fabricated from multiple polymers, which typically, but not necessarily, form multiple subunits that are ultimately combined to create a final core structure. In an exemplary embodiment of the invention, multiple DNA strands are designed in conjunction with each other such that they interact in a specifically defined way via normal base pairing to form a pre-defined shape, such as a tile having fixed junctions. Each of the tile subunits has four possible ends that can serve as binding points for other tiles. Each end has a sequence that is designed to interact (e.g., hybridize) with only one other end of a designated designed tile. If a particular end is destined to be a terminal edge of the nanostructure, the end is designed such that it cannot bind to any end of another tile. In such a way, binding of tiles is completely controlled and the overall structure of the nanostructure can be designed by selection of the various sequences of the DNA strands making up the nanostructure.
(24) Precisely addressable multiple binding effectors or substances allowing for detection of the location of the nanostructures or portions thereof (also referred to herein at times as substances or moieties) can be attached to the nanostructure. Where the moieties act as binding effectors, they can achieve better specificity for their target cells via a multivalent, low affinity approach instead of the usual monovalent, high affinity approach. Nanostructures having such an array of effectors have now been tested and found to accumulate effectively in target cells in vivo and have been found to have biological activity in vitro (see, e.g.,
(25) Using a DNA nanostructure as an example representing the full scope of the invention, the DNA core structure is designed to have high stability and high yield at different buffer conditions and ionic strengths, including but not limited to physiological buffer conditions and ionic strength. Also, for in vivo applications, the DNA core structure is typically optimized to be stable over a relatively large temperature range, including but not limited to 4 C. to 50 C., such as, for example, ambient temperature (about 20 C. to about 22 C.) to 37 C. For exemplary embodiments relating to in vitro applications, the core structure can be designed to have high stability over a broader range of temperatures, such as from 4 C. to 80 C. In embodiments relating to medical or diagnostic applications, the nucleic acid sequences of the core structure are specifically assigned to fulfill medical and diagnostic tasks. In the following examples, the core DNA structures have been shown to retain their functionality and activity in vitro and in vivo.
(26) The core structure can be functionalized with different functional groups, including different organic and inorganic molecules, at one or multiple sites, with precisely controlled positions within the polymers making up the core structure. In some cases, however, attempts to functionalize a DNA nanostructure can poorly affect its self-assembly. The functional RGD peptides used for cell targeting in the nanostructure exemplified below have been optimized to be compatible with the assembly of the DNA core structure while ensuring the functionality of the functional group. Each motif or subunit of the core structure is designed to have an identical structure with the other subunits, and DNA sequences at the central part, except the sticky ends. This design ensures all the motifs have identical stability at different buffer conditions and temperatures. The sticky ends are designed with unique sequences that have minimum chance to form undesired base pairings, i.e., non-specific binding with the bases in the nanostructure to ensure the high yield of the nanostructure during self-assembly. Moreover, the two parallel sticky ends on the tip of each arm of the exemplary nanostructure were designed to form 10 base pairs (and longer pairing sticky ends are possible), which provides a strong binding force that helps stabilize the whole construct. The skilled artisan will recognize that the exemplified 10 base pairing scheme is not a limiting feature of the invention, but instead is a bonding length that is generally suitable for stable bonding under physiological conditions.
(27) The GC content for all the sticky ends in a nucleic acid-containing nanostructure is carefully normalized so that the stability of each connection is similar to others and maximized to provide the greatest possible binding strength. This approach ensures that there is no possible weaker connection in the nanostructure that could affect the integrity of the whole construct in different buffer conditions and temperatures.
(28) One or more substances are bound to the core structure. While not so limited, in exemplary embodiments, the substances generally fall into two categories: 1) targeting substances; and 2) bioactive agents. A targeting substance is a substance that has an intrinsic ability to bind to a general class, and more preferably a particular species, of a biological substance, molecule, etc. It thus can be, for example, a ligand for a cell-surface receptor found on a particular type of cell (e.g., neuron, neutrophil, T-cell, muscle cell, tumor cell). Likewise, it could be an antibody that specifically binds to a viral coat protein, an outer membrane protein of Gram negative bacteria, or any other protein expressed on the outer surface of a virus, prokaryote, or eukaryote. In preferred embodiments, the targeting substance specifically binds to a molecule that is present on only one type of cell, such as a particular type of tumor cell.
(29) More specifically, in embodiments, the core structure can be designed and produced with one or more cage-like structures. Bioactive agents can be included and limited in the cage-like structure(s) by the stereo hindrance of the wall of one or more cage-like structures and/or other interactions. The release of the bioactive agents can thus be precisely controlled. For example, the wall of cage-like structure can contain one or more disulfide bonds. A reducing environment, e.g., the cytosol, can induce the breakdown of the disulfide linkage(s), disrupt the wall of the cage-like structure in one or multiple sites, and, therefore, release the bioactive agents from the cage-like structure.
(30) The targeting substance is provided as part of the nanostructure to target the nanostructure to a particular cell, tissue, or organ of interest, such as one involved in a disease or disorder state. In embodiments, the nanostructure comprises two, or more than two, different targeting substances, one that is specific for a certain cell or cell type and another that is specific for a different cell or cell type. For example, the nanostructure can be a generally planar structure having a targeting molecule on one surface (the first surface) that is specific for macrophages, and having a targeting molecule on the other surface (the second surface) that is specific for a Gram negative bacterium. Such a nanostructure can also have a cytotoxic agent on the second surface, which is toxic to Gram negative bacteria. Targeting of the nanostructure to the macrophage assists the nanostructure in localizing to the area of the body in which the Gram negative bacteria has set up an infection, and improves targeting of the Gram negative bacterium for delivery of the cytotoxic agent.
(31) The substance can also be one that allows detection of the nanostructure or a substance that was bound to it during production of the nanostructure. In in vivo settings, detection is typically assayed in terms of the location of the nanostructure or substance within the body of the animal being studied. In in vitro settings, detection can be a simple matter of determining if the nanostructure is bound to the target cell. For example, the substance can be a fluorescent compound, an electron-dense, proton-dense, or other molecule that is preferentially detectable using a scan of wavelengths in the electromagnetic spectrum and/or sonic spectrum, or other methods, where the appropriate scan detects the presence and, preferably for in vivo applications, location of the substance.
(32) The nanostructure of the present invention has wide applicability in the medical treatment field, but also has wide applicability in the clinical diagnostic field as well as in all fields in which detection of a cell surface target substance is desired. That is, because the nanostructures of the present invention can include moieties that are specific for any number of substances, they can be used in detection assays for detection of any number of substances. They thus can be used to detect, in vivo, the size of a tumor by way of specific binding to target tumor cells and production of a detectable signal showing the location of the (bound) nanostructure. Furthermore, because the precise sequence of monomers that make up the polymers that make up the core structure of the nanostructures is known prior to fabrication of the nanostructures, means for detecting the nanostructures, apart from detecting the bound moieties, will be known, and can be used to isolate or detect the nanostructures, when bound to a target substance.
(33) Functionalization of nucleic acid core structures allows for placement of targeting substances, bioactive agents, and the like at predefined sites on the structure. It thus provides for a wide variety of different permutations, which allows for great diversity in design of the nanostructures. For example, three dimensional placement of targeting and bioactive substances can advantageously be used to deliver the bioactive substances to sites of interest in active form. For example, a spherical or tubular nanostructure can be formed in which targeting substances are on the outside of the structure, while the bioactive agent is on the inside, protected from the potentially harsh environment of the body. Delivery of the nanostructure to a target cell, and uptake of the nanostructure into the target cell allows intracellular delivery of the bioactive agent in an intact form. Once inside the cell, the nanostructure can be degraded, for example by exonucleases and endonucleases, thus releasing the bioactive agent within the cell. Those of skill in the art will immediately recognize the advantage of this type of delivery vehicle for delivery of nucleic acids (e.g., siRNA, DNA vaccines, antisense molecules), polypeptides, and even small molecule drugs.
(34) An exemplary embodiment of the invention includes the use of multiple, low affinity targeting molecules on the surface of the nanostructure. The targeting molecules can be all of the same type (e.g., a single antibody) or a mixture of two or more different types of targeting molecules. Preferably, two or more different types of low affinity targeting molecules that are specific for the same target are used. In such a way, very high specificity can be achieved, thus providing a therapeutic treatment with high effectiveness and low side effects. Furthermore, lower toxicity to non-target cells can be achieved.
(35) Of course, multiple different bioactive agents can be bound to the nanostructure surface to provide a high biological response. For example, two bioactive agents that have different modes of actions against a tumor cell can be included in a nanostructure. Complementary cell killing activities can be provided to limit the tumor cell's ability to avoid cell death through development of resistance to the mode of action of one of the agents.
(36) A particular advantage provided by the present invention is use of nanostructures for delivery of pharmaceuticals to target organs, tissues, or cells. The type of pharmaceutical delivered is not particularly limited, although it will be evident that its size must be appropriate for the size of the nanostructures of the invention. As such, the pharmaceutical can be any small molecule drug, a biological (e.g., DNA, RNA, protein), or the like. Non-limiting examples of pharmaceuticals according to the invention include cytotoxic agents, such as chemotherapeutic agents, small interfering RNAs (siRNA), single or double stranded DNA, antibodies, and DNA vaccines. Delivery of siRNA with these nanostructures has been tested and shown to successfully knock down bioluminescence in glioma cells engineered with luciferase (U87MG-luc2 cell line).
(37) In a similar manner, the type of targeting molecule is not particularly limited. It thus can be any molecule that provides specific binding to a target of interest, typically a cell of interest. Non-limiting examples of targeting molecules are antibodies, ligands for known cell-surface receptors, hormones, and specific binding partners for non-receptor cell-surface proteins.
(38) In summary, in embodiments the invention provides a nanostructure complex comprising at least one nucleic acid strand, the linear sequences of bases of each being known and artificially and deliberately assigned to cause pre-determined inter- or intra-strand binding to form a pre-determined, finite, two-dimensional or three-dimensional scaffold structure, wherein each strand is of a pre-determined finite length, and wherein each strand may have one or more pre-defined sequences engineered to bond, directly or indirectly by one or more linking substances, possibly affixed to strand terminal modifications, with one or more pre-selected, low-affinity, cell-binding moieties, the collection of which forms a pattern designed to effect highly specific cell binding for targeting the nanostructure complex to designated cell types. In some embodiments, the nanostructure complex includes one or more additional pre-selected substances attached as therapeutic effectors (including, but not limited to siRNA, protein, and small drug molecule), binding effectors (including, but not limited to nucleic acid aptamers, peptides, and organic molecules), immunogenic effectors (including, but not limited to nucleic acids, peptides, and polysaccharides), immunostimulators (including, but not limited to unmethylated DNA CpG motifs, duplex RNA, and lipo-polysaccharides), molecular sensors (including, but not limited to nucleic acid aptamers and antibodies), or bioactive agents (including, but not limited to peptides, nucleic acids, and proteins). The substance(s) can be covalently bonded to the nucleic acid(s). The therapeutic effector includes, but not limited to, siRNA, protein, organic molecule/complex, and inorganic molecule/complex. The binding effector includes, but is not limited to, a nucleic acid aptamer, a protein, a polypeptide, a polysaccharide, a cholesterol, or other organic/inorganic molecules and/or complexes. In embodiments of the nanostructure complex, all of the substances can be the same, all can be different, or some the same and others different. Further, the identity and positioning of the nucleic acid bases, strands, or attachments can be selected to achieve one or more desired physical properties, such as size, conformation, overall charge, charge distribution, hydrophobicity, and hydrophilicity. The pre-defined portion(s) of the nucleic acid(s) can be engineered to control the orientation, conformation, and/or relative positions of the pre-selected substance(s). In some embodiments, the complex has an upper and a lower surface, wherein the complex has at least one pre-selected substance on each of the upper and lower surfaces. In general, the complex has a pre-defined three-dimensional structure having a longest dimension of from 2 nm to 1000 nm.
(39) Yet further, in embodiments the invention provides a method of treating a subject in need thereof, where the method comprises: administering a nanostructure complex of the invention to the subject in an amount sufficient to provide a treatment effect. The treatment effect can be a prophylactic effect or a therapeutic effect. The nanostructure complex can be administered as an immunogen, a vaccine, an immunostimulator, or as a vaccine adjuvant. In embodiments, the method is a method of treating cancer, such as a glioma, breast cancer, prostate cancer, or lung cancer. In some methods of treating, at least one surface of the nanostructure complex is bound by a substance that binds red blood cells and at least one other surface is bound by a substance that binds cancer cells. Alternatively or in addition, the nanostructure complex further can be bound to a cytotoxic agent on one or more of its surfaces. In some embodiments, by virtue of a highly ordered arrangement of immunogenic effectors, the complex promotes a rapid and effective antigen-specific immunogenic response. According to the method of the invention as practiced with nucleic acid complexes, the nanostructure complex comprises nucleic acid strands that are completely complementary with one another, having no unbound nucleotides at either end, which increases the circulation half-life as compared to nanostructures with one or more ends with unbound nucleotides. In exemplary embodiments, the nanostructure complex comprises two or more different substances that are specific for the same target. In some embodiments, the method is practiced using a nanostructure complex that comprises a generally tubular shape defined by an outer surface and an inner surface, wherein the pre-selected substance is bound to the inner surface by disulfide linkages that are reduced upon entry of the nanostructure complex into a cell of the subject.
(40) Yet again, the invention provides a nanostructure comprising: i) a core structure comprising at least two strands of DNA such that each comprising strand has at least one region of at least ten nucleotides which is complementary with at least one other comprising strand (i.e., there are no isolated strands that lack complementarity to the core structure), wherein one or more of the DNA strands is functionalized such that the combination of all strands contains at least one binding site for each of at least one targeting molecule and at least one bioactive agent, ii) at least one targeting effector, and iii) at least one bioactive agent; wherein the targeting effector(s) and bioactive agent(s) are bound to the core structure. The targeting molecules can be low affinity binding molecules that are specific for a tumor cell, such as a glioma cell. The nanostructure can have a half life in vivo of at least 2.7 hours.
(41) The invention further provides a method of synthesizing a nanostructure complex having up to 7,000 pre-selected substances bound to the polymer(s). The method comprises reacting amino groups of the polymer(s) of the complex with succinimidyl hemidithiodiglycolyl polyethyleneimine (SHDT-PEI) at an approximate ratio <1:5 in HEPES buffer, pH 8.0, to form a polymer-PEI; covalently bonding the pre-selected substances to the PEI moiety of the polymer-PEI an approximate ratio >5:1 (substance:polymer-PEI); and optionally purifying the complex.
EXAMPLES
(42) The invention will be further explained by the following Examples, which are intended to be purely exemplary of the invention, and should not be considered as limiting the invention in any way.
Example 1
Construction of a Class of PNL24 DNA Nanostructures
(43) The oligonucleotides (elsewhere abbreviated as oligomers or oligos) for PNL24 complexes were synthesized using conventional phosphoramidite chemistry on controlled-pore glass (CPG) solid support at a synthesis scale of 1 micromole. After synthesis, the raw oligomers were reverse-phase purified and desalted by HPLC. Two functionalized variants of PNL24, described below, were used for in vitro and in vivo testing. PNL24-D is a PNL24 molecule functionalized with fluorescent dyes (D) to enable FRET imaging (FRET imaging usually involves sets of two or more fluorescent dyes or dye and dye quencher sets which enable both localization through determination of the location of the fluorescence signal and enable distance between dyes to be determined, here designed to be used as both a location indicator and as an indicator of structural integrity). PNL24-RD is equivalent to PNL24-D, except it is further functionalized with RGD peptide (R), a known targeting agent for glioma tumor cells. Hereafter, the term PNL24 is used as shorthand to describe both of these variants without distinction. To produce PNL24-R, an additional amine group was added at the functionalization site of those oligos designated to localize RGD targeting peptide. Conjugation was performed in aqueous buffer (pH 6.0) against excess NHS-ester functionalized moieties. Different conjugation methods and conditions can be used to attach the targeting moieties to the nanostructures. For example, click chemistry between azide and hexynyl has been used to conjugate RGD peptide to Core DNA.
(44) The structure of PNL24 is illustrated in detail in
(45) The names and sequences of the DNA oligonucleotides used to produce the PNL24 complexes are as follows (written from 5 to 3):
(46) TABLE-US-00001 CORE: (SEQIDNO:2) aggcaccatcgtaggttttcgttgcgatcaccaacggagtttttt ctgccgtacaccagtgaagtttttcgatcctagcacctctggagt ttttcttgcc. CORE-RGD: (SEQIDNO:3) aggcaccatcgtaggtt(GRGDSP-) ttcgttgcgatcaccaacggagttttttctgccgtacaccagtgaag tttttcgatcctagcacctctggagtttttcttgcc. SHELL1: (SEQIDNO:4) atgcaacctgcctggcaagactccagaggactactcatccgt. SHELL2: (SEQIDNO:5) tccgactgagccctgctaggatcgacttcactggaccgttctaccga. SHELL3: (SEQIDNO:6) accggaggcttcctgtacggcagaactccgttggacgaacag. SHELL4: (SEQIDNO:7) atagcgcctgatcgcaacgcctacgatggacacgccg. SHELL1-Cy7: (SEQIDNO:8) (Cy7-)atgcaacctgcctggcaagactccagaggactactcatccgt. SHELL2-Cy55: (SEQIDNO:9) tccgactgagccctgctaggatcgacttcactggaccgttcta ccga(-Cy55). SHELL3-Cy55: (SEQIDNO:9) (Cy55-)accggaggcttcctgtacggcagaactccgttggacgaacag. SHELL4-Cy7: (SEQIDNO:10) atagcgcctgatcgcaacgcctacgatggacacgccg(-Cy7). ARM1: (SEQIDNO:11) gttatcggcgtgtggttgcataatac. ARM2: (SEQIDNO:12) caatcacggatgagtagtgggctcagtcggacattc. ARM3: (SEQIDNO:13) cctcgtcggtagaacggtggaagcctccggtcgtgc. ARM4: (SEQIDNO:14) ttcaactgttcgtggcgctatattgt. ARM5: (SEQIDNO:15) caagccggcgtgtggttgcatacgac. ARM6: (SEQIDNO:16) aagtgacggatgagtagtgggctcagtcggatactg. ARM7: (SEQIDNO:17) ttgattcggtagaacggtggaagcctccggtttaca. ARM8: (SEQIDNO:18) gattgctgttcgtggcgctatgaatg. ARM9: (SEQIDNO:19) cgaggcggcgtgtggttgcatgcacg. ARM10: (SEQIDNO:20) ttaagacggatgagtagtgggctcagtcggattgta. ARM11: (SEQIDNO:21) tcatgtcggtagaacggtggaagcctccggtttgct. ARM12: (SEQIDNO:22) tgtagctgttcgtggcgctattacgt. ARM13: (SEQIDNO:23) tctgacggcgtgtggttgcattcaac. ARM14: (SEQIDNO:24) ctacaacggatgagtagtgggctcagtcggaacgta. ARM15: (SEQIDNO:25) gcttgtcggtagaacggtggaagcctccggtgtcgt. ARM16: (SEQIDNO:26) taacgctgttcgtggcgctatcattg. ARM17: (SEQIDNO:27) catgacggcgtgtggttgcatagcaa. ARM18: (SEQIDNO:28) aacgtacggatgagtagtgggctcagtcggactaac. ARM19: (SEQIDNO:29) tgctgtcggtagaacggtggaagcctccggttgcag. ARM20: (SEQIDNO:30) tcattctgttcgtggcgctattcaat. ARM21: (SEQIDNO:31) ctgtgcggcgtgtggttgcattgcac. ARM22: (SEQIDNO:32) atgctacggatgagtagtgggctcagtcggaatgac. ARM23: (SEQIDNO:33) tcagatcggtagaacggtggaagcctccggtgttga. ARM24: (SEQIDNO:34) acgttctgttcgtggcgctatgttag. ARM25: (SEQIDNO:35) cagcacggcgtgtggttgcatctgca. ARM26: (SEQIDNO:36) ttagaacggatgagtagtgggctcagtcggattagt. ARM27: (SEQIDNO:37) aatagtcggtagaacggtggaagcctccggttagat. ARM28: (SEQIDNO:38) agtacctgttcgtggcgctattcaca. ARM29: (SEQIDNO:39) taactcggcgtgtggttgcattgtat. ARM30: (SEQIDNO:40) gtactacggatgagtagtgggctcagtcggatgtga. ARM31: (SEQIDNO:41) cacagtcggtagaacggtggaagcctccggtgtgca. ARM32: (SEQIDNO:42) tctagctgttcgtggcgctattagct.
(47) The PNL24 molecules (grids) are assembled from eight + shaped motifs. One motif has one core DNA strand, four shell DNA strands and four arm DNA strands. All experiments are under sterile conditions. Each motif is annealed separately at first. The core strand, shell strands, and arm strands of each motif are mixed stoichiometrically to reach 1 uM concentration in aqueous buffer with 40 mM Tris, 20 mM Acetic Acid, 1 mM EDTA, 11 mM Magnesium Acetate, and 108 mM Sodium Chloride (1TAE/Mg.sup.2+ buffer, 108 mM NaCl, pH=8.0). The mixture is then heated to 95 C., then cooled down to 4 C. slowly over 24 hours and kept at 4 C. for 12 hours to stabilize the motif structure. After separately assembling the eight types of motifs, they are mixed in stoichiometric quantities and annealed from 30 C. to 22 C. over 4 hours. Then, the sample is incubated at 4 C. for 12 hours to further stabilize the 24 grids. The assembly of PNL24 compounds and other nanostructures in the invention can be achieved in a wide range of different conditions. For example, the pH can typically be between 7 and 10. The Mg.sup.2+ concentration can be at least between 10 mM and 100 mM. The buffer can use hepes to replace Tris.
Example 2
In Vitro Toxicity Testing
(48) For each in vitro toxicity test, U87MG cells were divided into two groups: a control group and a treated group. Each group had six wells. Each well contained 300 uL medium. After the multi-well plate with medium was incubated in a CO.sub.2 incubator at 37 C. in 5% CO.sub.2 and 100% humidity for two hours to reach equilibrium with the environment, 510.sup.4 U87MG cells were seeded in each well and incubated for 24 hours to allow the cells to adhere to the bottom of the wells. Thereafter, the media in the treated group was replaced with a 300 uL mixture of fresh media and PNL24 complex. The media in the control group wells was changed to a 300 uL mixture of fresh media and buffer. After a 24-hour incubation, the media in both groups was changed to a mixture of 250 uL fresh media and 50 uL of CellTiter 96 AQueous One Solution (Promega, Cat. #: G3582) in each well. A no-cell control with 300 uL of the mixture was also added in an empty well. The multiwell plate was further incubated for 4 hours at 37 C. in 5% CO.sub.2.
(49) The absorbance at 490 nm of the samples from each well was measured with a ND-1000 uv-vis spectrometer. The background of the no-cell control solution was blanked out before the measurements.
(50) More specifically, an MTS assay (Promega Cat. #: G3582) was conducted to examine the toxicity of PNL24-R (=PNL24 scaffold+RGD targeting ligand) and PNL24-RD (=PNL24-R+FRET Dyes) against U-87 MG glioma cells. Both compounds were shown to be completely benign. The charts in
Example 3
Imaging Studies Demonstrating Accumulation in Tumor
(51) The oligonucleotides for PNL24 were synthesized using conventional phosphoramidite chemistry on controlled-pore glass (CPG) solid support at a synthesis scale of 1 micromole. After synthesis, the raw oligomers were reverse-phase purified and desalted by HPLC. To produce PNL24-D and PNL24-RD an additional primary amine group was added at the functionalization site of those oligos designated to localize either a fluorescent probe or RGD targeting peptide (GRGDSP). Conjugation was performed in aqueous buffer (pH 6.0) against excess NHS-ester functionalized moeties. Two fluorescent probes (donor and acceptor) were used to create FRET pairs (Cy5.5/Cy7) at each PNL24 motif intersection and a 6-mer linear RGD peptide was used as a targeting molecule attached to the center of each motif in PNL24-RD.
(52) The names and sequences of the DNA oligonucleotides used to produce PNL24 complexes are the same as the sequences in Example 1.
(53) The target grid molecules are assembled from eight + shaped motifs. One motif has one core DNA strand, four shell DNA strands and four arm DNA strands. All experiments are under sterile condition. There are two groups of 24 grids. In the first group, RGD peptide is attached to the core DNA strands to produce PNL24-RD grids. The core strand in the second group is only regular DNA to assemble PNL24-D. Each motif is annealed separately at first. The core strand, shell strands, and arm strands of each motif are mixed stoichiometrically to reach 1 uM concentration in aqueous buffer with 40 mM Tris, 20 mM Acetic Acid, 2 mM EDTA and 12.5 mM Magnesium Acetate (1TAE/Mg.sup.2+ buffer, pH=8.0). The mixture is then heated to 95 C., then cooled down to 4 C. slowly over 24 hours and kept at 4 C. for 12 hours to stabilize the motif structure. After separately assembling the eight types of motifs they are mixed in stoichiometric quantity and annealed at from 30 C. to 22 C. over 4 hours. Then, the sample is incubated at 4 C. for 12 hours to stabilize the 24 grids.
(54) The in vivo study was conducted to assess the tumor targeting capability of PNL24-RD versus a control variant, PNL24-D, which lacks RGD targeting ligands. A group of seven (7) matched nude mice were selected on Day 0 of the study. Six (6) of these mice were injected subcutaneously, in the back, with 510.sup.6 U87 MG Luc2 cells, which have been modified to produce luciferase for bioluminescence imaging. The mice were divided into four groups. In group 1, a mouse without tumor was dosed with 400 ul PNL24-D (250 nmole/L). In group 2, a mouse bearing tumor was used as a control without any treatment. In group 3, the mice bearing tumor were treated with 400 ul PNL24-RD (250 nmole/L). In group 4, the mice with tumors were treated with 400 ul PNL24-D (250 nmole/L).
(55) Bioluminescent and fluorescent images were acquired in vivo at time points of 1, 3, 7, and 24 hours post injection. The relative size of the tumor was quantitatively determined from these images based on the proportion of luciferase-bearing cells in the tumor. At 30 hours after injection, the tumors, brains, lungs, livers, hearts, spleens, kidneys, and intestines of the animals were excised into solution and these organs were imaged ex vivo. The tumors were imaged both using bioluminescence and fluorescence so that fluorescence of the tumors could be normalized against the bioluminescence of the tumors.
(56) The results are shown in image form in
(57) The results obtained in this study are consistent with (a) targeting of the constructs to the site of the tumor, (b) maintenance of intact FRET capability, and (c) stabilization of the relative locations of grid components at the tumor site, for at least 24 hours. This long term structure stability, in a biologically relevant environment, suggests a mechanism of application for these structures that is unique in that programmable structures can be activated after the majority of them have been cleared from sensitive tissues. This is not a property of small drugs or most drug carriers.
(58) As described above, the tumors and major organs were excised into solution and imaged. The tumor was imaged using bioluminescence and fluorescence (Table 1). Because the tumor sizes were not equal in all animals, fluorescence of the tumors was normalized against the tumor's bioluminescence. The tumor receiving PNL24-RD was the only tumor to display a fluorescent signal above background. For comparison purposes, the uncorrected fluorescence signal was used in generating the final fluorescence signal normalized to the tumor bioluminescence. The targeted compound displayed 20 the normalized fluorescent signal.
(59) TABLE-US-00002 TABLE 1 Fluorescent and Bioluminescent Levels of Tumors at 30 Hours No PNL24- Treatment PNL24-D RD PNL24-D (background) (no tumor) (tumor) (tumor) Fluorescence 1.2E+07 9.5E+06 2.0E+07 1.1E+07 Fluorescence w/o 0 below 8.3E+06 below background background background Bioluminescence 7.1E+07 N/A 5.1E+07 6.7E+08 Bioluminescence/ 0.17 N/A 0.4 0.02 Fluorescence
(60) Together, these data provide the first evidence that DNA nanostructures can serve as the basis for creating multi-functional nano-pharmaceuticals.
Example 4
A Nanostructure Delivery Vehicle for Diphtheria Toxin
(61) Diphtheria toxin (DT) is an exotoxin of diphtheria, an acute infectious disease caused by the bacteria Corynebacterium diphtheriae. When fused with interleukin-2 protein, DT subcomponents have been approved by the FDA as an antineoplastic agent for the treatment of cutaneous T-cell lymphoma under the name denileukin diftitox (Ontak). DT is a protein with 535 amino acid residues consisting of two subunits, A and B, that are bound covalently with a disulfide bond. The A subunit, DTA, is highly cytotoxic intracellularlya single DTA molecule is often sufficient to effect mammalian cell deathhowever, it is non-endocytotic and harmless extracellularly. The B subunit, DTB, is responsible for effecting cell entry in naturally occurring DT.
(62) DTB has two major domains: 1) receptor binding domain and 2) transmembrane domain. The receptor domain recognizes and binds to heparin-binding epidermal growth factor on the surface of DT-sensitive cells, which in turn leads to the endocytosis of the DT complex. Translocation of DTA into the cytosol is effected by low-pH-triggered insertion of the transmembrane domain into the endosomal membrane. After release, DTA halts the RNA translation step of cellular protein synthesis by catalytically removing the ADP-ribose unit from eukaryotic elongation factor-2 (eEF2) protein via NAD+-diphthamide ADP-ribosyltransferase activity and thereby destroys the cell. In summary, DTA is non-endocytotic, harmless until cell entry and potent thereafter. Moreover, it is highly stable, remaining intact at 100 C. or in a solution with a pH range from 2-12. Importantly, in an alternative formulation, it has been approved by the FDA as a cancer treatment. Accordingly, by attaching DTA to a tumor selective nano-carrier that can effect endocytosis (replacing the role of DTB in natural DT function), DTA can potentially be used as a safe yet highly effective anti-cancer cytotoxic payload.
(63) DTA is attached to a P25 theranostic molecule, a PNL24 variant designed to target glioma cells with high specificity, deliver a cytotoxic payload and carry a contrast-enhancing tracer to facilitate MRI tracking of tumor extent and treatment response. DTA is attached to the PNL24 scaffold via a disulfide bond (SS), a covalent conjugation of two sulfhydryl groups (SH) via oxidation. 5 aminated SHELL4 DNA can first react with the NHS ester on sulfo-LC-SPDP and then react with the sulhydryl group of cysteine to form disulfide bond. The conjugate is purified with gel electrophoresis. The disulfide bond can be broken into two sulfhydryl groups reversibly when a reductive agent is available. Because the human bloodstream is oxidative and most human intracellular environments are reducing, a disulfide bond can serve as a convenient linker for a drug delivery system that is able to release a therapeutic payload after cell entry. In fact, several natural toxins (e.g., DT and ricin toxin) and FDA approved drugs (e.g., Ontak and Myobloc) take advantage of the disulfide linkage for such purpose. Intracellular breakdown of disulfide bonds can occur on the cell surface, in the early endosome, in the cytosol, and in the late endosome or lysosome hybrid. Although the endocytic mechanism of P25 molecules is not yet deeply studied, previous in vivo and ex vivo studies have shown that P25 molecules bearing no targeting RGD peptide had little accumulation in tumors while P25+RGD had significant accumulation in tumors. Based on these experimental results, the binding and internalization of P25 to tumor cells can be highly regulated based on the targeting moieties used, e.g., RGD peptides. Because targeting moieties can also control the endocytic pathway, it is reasonable to believe that the endocytosis of P25DTA into tumor cells can also be controlled by the RGD peptides via cell-adhesion-molecule-mediated pathways.
(64) There is further evidence that linear RGD peptides enter tumor cells and accumulate in the lysosome of tumor cells. This evidence suggests that P25, targeted by linear RGD peptides, can also transfer to the lysosome to deliver disulfide linked DTA. The acidic conditions maintained in the late endosomal compartment ensure that the DTA will be cleaved from P25 and delivered as a native toxin, once the lysosome disassembly process is complete, inducing apoptosis.
(65) The names and sequences of the DNA oligonucleotides used to produce P25DTA complex are listed as following (written from 5 to 3):
(66) TABLE-US-00003 CORE-RGD: (SEQIDNO:43) aggcaccatcgtaggtt(GRGDSP-) tcgttgcgatcaccaacggagttttttctgccgtacaccagtgaagtttt tcgatcctagcacctctggagtttttcttgcc. SHELL1: (SEQIDNO:44) atgcaacctgcctggcaagactccagaggactactcatccgt. SHELL2: (SEQIDNO:45) tccgactgagccctgctaggatcgacttcactggaccgttctaccga. SHELL3: (SEQIDNO:46) accggaggcttcctgtacggcagaactccgttggacgaacag. SHELL4: (SEQIDNO:47) atagcgcctgatcgcaacgcctacgatggacacgccg. SHELL4DTA: (SEQIDNO:48) (DTA-)atagcgcctgatcgcaacgcctacgatggacacgccg. ARM1: (SEQIDNO:49) gttatcggcgtgtggttgcataatac. ARM2: (SEQIDNO:50) caatcacggatgagtagtgggctcagtcggacattc. ARM3: (SEQIDNO:51) cctcgtcggtagaacggtggaagcctccggtcgtgc. ARM4: (SEQIDNO:52) ttcaactgttcgtggcgctatattgt. ARM5: (SEQIDNO:53) caagccggcgtgtggttgcatacgac. ARM6: (SEQIDNO:54) aagtgacggatgagtagtgggctcagtcggatactg. ARM7: (SEQIDNO:55) ttgattcggtagaacggtggaagcctccggtttaca. ARM8: (SEQIDNO:56) gattgctgttcgtggcgctatgaatg. ARM9: (SEQIDNO:57) cgaggcggcgtgtggttgcatgcacg. ARM10: (SEQIDNO:58) ttaagacggatgagtagtgggctcagtcggattgta. ARM11: (SEQIDNO:59) tcatgtcggtagaacggtggaagcctccggtttgct. ARM12: (SEQIDNO:60) tgtagctgttcgtggcgctattacgt. ARM13: (SEQIDNO:61) tctgacggcgtgtggttgcattcaac. ARM14: (SEQIDNO:61) ctacaacggatgagtagtgggctcagtcggaacgta. ARM15: (SEQIDNO:62) gcttgtcggtagaacggtggaagcctccggtgtcgt. ARM16: (SEQIDNO:63) taacgctgttcgtggcgctatcattg. ARM17: (SEQIDNO:64) catgacggcgtgtggttgcatagcaa. ARM18: (SEQIDNO:65) aacgtacggatgagtagtgggctcagtcggactaac. ARM19: (SEQIDNO:66) tgctgtcggtagaacggtggaagcctccggttgcag. ARM20: (SEQIDNO:67) tcattctgttcgtggcgctattcaat. ARM21: (SEQIDNO:68) ctgtgcggcgtgtggttgcattgcac. ARM22: (SEQIDNO:69) atgctacggatgagtagtgggctcagtcggaatgac. ARM23: (SEQIDNO:70) tcagatcggtagaacggtggaagcctccggtgttga. ARM24: (SEQIDNO:71) acgttctgttcgtggcgctatgttag. ARM25: (SEQIDNO:72) cagcacggcgtgtggttgcatctgca. ARM26: (SEQIDNO:73) ttagaacggatgagtagtgggctcagtcggattagt. ARM27: (SEQIDNO:74) aatagtcggtagaacggtggaagcctccggttagat. ARM28: (SEQIDNO:75) agtacctgttcgtggcgctattcaca. ARM29: (SEQIDNO:76) taactcggcgtgtggttgcattgtat. ARM30: (SEQIDNO:77) gtactacggatgagtagtgggctcagtcggatgtga. ARM31: (SEQIDNO:78) cacagtcggtagaacggtggaagcctccggtgtgca. ARM32: (SEQIDNO:79) tctagctgttcgtggcgctattagct.
(67) The oligonucleotides for the P25DTA complex are synthesized using conventional phosphoramidite chemistry as described above. The P25DTA molecules are assembled as described above.
Example 5
A Nanostructure as an MRI Contrast Agent
(68) Nuclear magnetic resonance imaging or magnetic resonance imaging (MRI) is one of the most effective medical technologies for tumor imaging, including brain tumor imaging. The lack of radiation burden strongly recommends MRI as a radiological technique. The resolving power of MRI in some systems can be about 100 microns, roughly the length of a single GBM cell. In different tissues and circumstances, several differences among protons can be detected using an MRI instrument. For example, the spin density, T1 and T2 relaxation times and flow and spectral shifts of protons in different tissues can be used to construct images in different tissues. However, in many cases, the differences are too small to provide useful information. In these cases, contrast agents are used to improve differentiation within MRI image. Based on the mechanism of function, MRI contrast agents can be generally categorized into two broad types: 1) contrast agents with the ability to shorten the T1 relaxation time of surrounding protons; and 2) contrast agents with the ability to shorten the T2 relaxation time of nearby protons. T1 is the spin-lattice relaxation time of the flipped nuclei, while T2 is the spin-spin relaxation time. They are important time constants in MRI. Gadolinium based paramagnetic MRI contrast agents, such as Gd-DTPA, belong to type 1. Gadolinium(III) has seven unpaired electrons, which facilitates the rapid longitudinal relaxation of surrounding excited protons. The rapid relaxation results in a T1 hypersignal. Tissue accumulation of Gadolinium(III) leads to brighter images in T1 weighted MRI.
(69) Gadolinium based MRI contrast agents are the most widely used MRI contrast agents. In fact, Gd-DTPA is FDA approved as an MRI contrast agent and marketed with brand name Magnevist. Gd-DTPA has also been conjugated with other molecules as a tracer for MRI. Seeing that Gadolinium(III) enhances the contrast of MRI by accelerating longitudinal 1H relaxation, mostly in the nuclei of nearby water, there are generally two approaches to improving contrast: 1) increase the number of exchangeable water molecules in the inner-coordination sphere; and 2) increase the local concentration of Gd(III). Approach 1) generally results in decreasing the stability of the chelated Gd(III) complex. One Gd(III) can bind up to nine ligands. In the contrast agent GD-DTPA, eight ligands are from the chelating compound (DTPA). Only one position is available for the binding of a water molecule. Increasing the number of water ligands would reduce the number of ligands from the chelating molecule binding with the Gd(III), lowering the binding of the chelating agent, and potentially freeing the Gd(III) from the complex. Free Gd(III) ion is a heavy metal ion that is toxic. Therefore, for safety reasons and in order to maximize contrast through maintaining complex integrity, it is difficult to identify a Gd-based contrast agent superior to Gd-DTPA using the first approach.
(70) The nano-theranostic P25 nanostructure complex can enhance contrast of MRI tumor images via the increase of local Gd(III) concentration. Each P25 complex can carry 30 Gd-DTPA molecules. More importantly, the PNL24 platform bearing targeting moieties has been able to reach a 20:1 accumulation on in vivo tumors versus the complex without a targeting system (see above) and this specificity increases the contrast of tumor cells dramatically. Not only can P25 trace primary tumors, but also metastases. Incorporation of DTPA into the design will enable Gadolinium to be replaced by alternative metals, for example europium (Eu), in the cases where Gd toxicity is an issue.
(71) The names and sequences of the DNA oligonucleotides used to produce P25DTPA complexes are the same as the sequences in Example 1, with the following exceptions:
(72) TABLE-US-00004 SHELL1Gd: (SEQIDNO:80) (Gd-DTPA-)atgcaacctgcctggcaagactccagaggactac tcatccgt. SHELL2Gd: (SEQIDNO:81) (Gd-DTPA-)tccgactgagccctgctaggatcgacttcactgg accgttctaccga. SHELL3Gd: (SEQIDNO:82) (Gd-DTPA-)accggaggcttcctgtacggcagaactccgttgg acgaacag. SHELL4Gd: (SEQIDNO:83) (Gd-DTPA-)atagcgcctgatcgcaacgcctacgatggacacgccg.
(73) The oligonucleotides for P25DTPA complex are synthesized as described above. Aminated shell DNA strands can react with extra DTPA in the present of EDC. The DNA-DTPA conjugates can be purified with gel electrophoresis. The DNA-DTPA can form stable complex with Gd(III) at 1:1 ratio. The P25Gd molecules are assembled in accordance with the description above. One motif has one core DNA strand, four shell DNA strands with Gd-DTPA and four arm DNA strands.
Example 6
A Nanostructure for RNA Interference In Vitro and In Vivo
(74) The PNL24-R grid complexes used in the Examples disclosed in this document were designed using the inSquio CAD software from Parabon Nanolabs (Reston, Va.). The complex for this Example contains four shell DNA strands, four arm DNA strands, and a core DNA strand in each + motif (see, for example,
(75) For this Example, control grids were created (PNL24) without RGD targeting. When siRNA is attached, these controls are referred to as PNL24-siRNA whereas the experimental compound is called PNL24-R-siRNA. The present Example shows that nucleic acid nanostructures of the present invention, which contain siRNA molecules, can be used to specifically reduce expression of a luciferase gene within a cell.
(76) The sequence of the pGL4 vector used to establish the U87 mg Luc2 cell line is from Caliper Life Sciences. The sequences of anti-Luc siRNA strands used in the in vitro experiments are:
(77) TABLE-US-00005 sense: (SEQIDNO:84) 5-rGrGrArCrGrArGrGrArCrGrArGrCrA rCrUrUrCrUrU-3. anti-sense: (SEQIDNO:85) 5-rArArGrArArGrUrGrCrUrCrGrUrCrC rUrCrGrUrCrC-3.
(78) In the PNL24-R-siRNA design, anti-luc siRNA is connect to the PNL24-R grid via a disulfide bond, which is reduced by reduction agents in the cell to effect intracellular release of the siRNA.
(79) The names and sequences of the DNA oligonucleotides used to produce PNL24 complexes are the same as the sequences in Example 1 with the following exception:
(80) TABLE-US-00006 SHELL4siRNA: (SEQIDNO:86) atagcgcctgatcgcaacgcctacgatggacacgccg (-anti-lucsiRNA).
(81) The oligonucleotides for the PNL24-R-siRNA complex are synthesized using conventional phosphoramidite chemistry on controlled-pore glass (CPG) solid support at a synthesis scale of 10 micromole. After synthesis, the raw oligomers are reverse-phase purified and desalted by HPLC into conjugation or hybridization buffer. To produce the Core-RGD DNA strand, an additional amine group is added at the functionalization site of those oligonucleotides designated to localize RGD targeting peptide. Conjugation is performed in aqueous buffer (pH 6.0) against excess NHS-ester functionalized moieties.
(82) 5 aminated RNA was mixed with Sulfo-LC-SPDP crosslinker at a molar ratio of 1:100 in PBS buffer at pH 7.4 for 12 hours. The primary amine group on the 5 aminated RNA reacted with the Sulfo-NHS ester to get the amide. The RNA was purified with a Dextran Desalting Column to remove unreacted small molecules.
(83) 3 thiolated DNA was first treated with TCEP-HCl at a molar ratio of 1:100 for 12 hours to cleave the disulfide bonds. The DNA was purified with a Dextran Desalting Column to remove unreacted TCEP.
(84) The purified DNA and RNA products were mixed 1:3.44 at 75 C. for 1 hour and 4 C. for 12 hours to allow the pyridinyldisulfide on the 3 end of the DNA to react with the sulhydryls on the 5 end of the RNA to form the DNA-RNA conjugate linked with disulfide bond. The DNA-RNA conjugate was purified with a Dextran Desalting Column. The yield of RNA attachment is tested with Quant-i RNA Assay Kit (Invitrogen Cat. #: Q10213).
(85) The eight + shaped motifs are assembled first. One motif has one core DNA strand, four shell DNA strands and four arm DNA strands. All experiments are under sterile conditions. For all + shape motifs, the shell 4-siRNA conjugate replaces the shell-4 DNA. The complementary RNA is also added in stoichiometrically. The core strand, shell strands and arm strands of each motif are mixed stoichiometrically to reach 1 uM concentration in aqueous buffer with 40 mM Tris, 20 mM Acetic Acid, 2 mM EDTA, 12.5 mM Magnesium Acetate, and 105 mM Sodium Chloride (1TAE/Mg.sup.2+ buffer, pH=8.0). The mixture is heated to 95 C., then cooled down to 4 C. slowly over 24 hours and kept at 4 C. for 12 hours to stabilize the motif structure.
(86) After separately assembling the eight types of motifs they are mixed in stoichiometric quantity and annealed at from 30 C. to 22 C. over 4 hours. Then, the sample is incubated at 4 C. for 12 hours to stabilize the 24 grids. In this case, one single-stranded siRNA payload is covalently attached to the nanostructure. The complementary RNA is carried on the nanostructure by forming non-covalent base pairs with its complement covalently attached to the nanostructure.
(87) About 210.sup.4 U87MG Luc2 cells per well were seeded onto a 24-well plate. The cells were incubated for 48 hours at 37 C. with 5% CO.sub.2 in 300 uL culture media to allow the cells to attach to the wall of the wells. U87MG Luc2 cells were treated with a mixture of 250 uL PNL24-R-siRNA at 125 nM and 250 uL culture medium at 37 C. with 5% CO.sub.2 for 72 hours so that the siRNA could be taken up by the cells. Because the yield of DNA-RNA conjugation was not 100%, the siRNA was 6.5 mg/kg for PNL24-R-siRNA and PNL24-siRNA. The control cells were mixed with: a) 250 uL buffer, 250 uL siRNA (1 uM siRNA concentration=6.9 mg/kg), 250 uL PNL24-R (125 nM), or 250 uL PNL24-siRNA (125 nM); and b) 250 uL culture medium. All the samples were in triplicate. Thereafter, U87MG Luc2 cells are lysed with mammalian cell lysis buffer. The cell lysate is recovered for a luciferase activity assay. Light emission by luciferase molecules is measured by a luminometer. The total protein concentration in the cell lysate is determined using the BCA assay. Luciferase activity in each sample is normalized to relative light units (RLU) per mg of cell lysate proteins.
(88)
(89) The relative luciferase activity of all control groups was significantly higher than the normalized luminescence of PNL24-R-siRNA-treated group. The results demonstrate that PNL24-R-siRNA can effectively knockdown the expression of luciferase in U87 mg Luc2 cells in vitro. As a proof of principal, these results are highly significant. Even though the detailed mechanism of payload internalization is not yet clear, the results indicate an active siRNA payload can overcome all the barriers and be delivered intracellularly.
(90) The PNL24-R-siRNA compound was used to knock down the expression of luciferase in vivo in U87MG-Luc2 xenograft murine model. The mock compound (i.e., PNL24-R) and free anti-Luc siRNA were used as controls.
(91) Eleven (11) male nu/nu mice were implanted with intracranial xenograft tumors, specifically, 110.sup.6 U87MG-Luc2 cells were implanted by stereotaxic injection directly into the caudate/putamen. Mice were anesthetized by intraperitoneal injection of 3 ml/kg of a solution containing 25 mg/ml ketamine HCl, 2.5 mg/ml xylazine, and 14% ethanol in 0.85% NaCl. Surgical sites were prepared with alcohol and betadine. Animals were positioned using a stereotaxic frame with small animal adaptor, the calvarium was exposed and a 1.5 mm burr hole drilled 2 mm lateral and 1 mm anterior to the bregma. Surgery was performed with sterile tools on a sterile surface. Before the treatment phase of the experiment, the mice were housed for seven days to allow the tumors to be established.
(92) For conviction-enhanced delivery (CED) of PNL24-R-siRNA, free siRNA control and PNL24R control, a dosage was infused intracranially with CED one week after the tumor implantation. During the CED process, animals were given 2 ml of warm normal saline i/p and kept on a warming pad prepared immediately after anesthesia induction. CED was performed using 10 l total perfusate volume for each sample. The CED speed was 300 nl/min. The 33 G needle was initially inserted at 2 mm mark and 1 l was infused, then needle tip was advanced to 2.5, 3, 3.5, and 4 mm points and 2 ul solution was infused at each site. A hemostatic pause of 2-3 minutes was taken after each needle advancement.
(93) The mice were randomly distributed into three groups with four mice/group for the PNL24-R-siRNA treatment group and PNL24-R control group. Three mice were in the siRNA control group. Mice in the three treatment and control groups were dosed intracranially with 10 l PNL24R-siRNA (2.5 M), PNL24R control (2.5 M), and free siRNA control (20 M), respectively via CED.
(94) Each mouse was imaged with a IVIS 100 System (Xenogen Corporation) to record bioluminescent signal on day 6 after the administration of PNL24-R-siRNA, free siRNA control, or PNL24R control. Imaging followed intraperitoneal injection with D-luciferin (Xenogen Corp.) at a dose of 330 mg/g body weight, along with anesthesia with xylazine/ketamine. Emitted light from the tumor was acquired with the IVIS 100 cooled CCD camera systems. Following observation of sufficient depth of anesthesia, bioluminescent signals were collected for 5-25 minutes after substrate injection.
(95) In this example, all the mice intracranially administered with PNL24 compounds survived for 6 days (until sacrificed) with no observable abnormalities. This observation supports the safety of PNL24 compounds.
(96) The data in
Example 7
Nanostructures with Anti-GBM Efficacy In Vivo
(97) Two types of anti-GBM siRNAs were carried by PNL24 DNA nanostructures to construct four different types of PNL24 compounds. One siRNA is Notch-1 siRNA. The other siRNA is DGKa siRNA. The sequences of the anti-GBM siRNA strands are listed in Table 2.
(98) TABLE-US-00007 TABLE2 Thesequencesoftheanti-gliomasiRNAstrands usedintheinvivoefficacystudies StrandName Sequence(from5 to3) Notch-1 rUrGrGrCrGrGrGrArArGrUrGrUr siRNAsense GrArArGrCrGdTdT (SEQIDNO:86) Notch-1siRNA rCrGrCrUrUrCrArCrArCrUrUrCr anti-sense CrCrGrCrCrAdTdT (SEQIDNO:87) DGKAsiRNA rGrGrArUrUrGrArCrCrCrUrGrUr sense UrCrCrUrArAdTdT (SEQIDNO:88) DGKAsiRNA rUrUrArGrGrArArCrArGrGrGrUr anti-sense CrArArUrCrCdTdT (SEQIDNO:89)
(99) In this study, a PNL24 nanostructure carrying control RNA strands was constructed as a control. The sequences of the control RNA strands are listed in Table 3.
(100) TABLE-US-00008 TABLE3 ThesequencesofthecontrolRNAstrandsused intheinvivoefficacystudies StrandName Sequence(from5 to3) ControlRNA-1 rUrUrCrUrCrCrGrArArCrGrUrGrUr CrArCrGrUdTdT (SEQIDNO:90) ControlRNA-1 rArCrGrUrGrArCrArCrGrUrUrCrGr complement GrArGrArAdTdT (SEQIDNO:91)
(101) The names and sequences of the DNA oligonucleotides used to produce PNL24 compounds and control are the same as the sequences in Example 1 with the following exception:
(102) TABLE-US-00009 CORE-RGD: (SEQIDNO:92) (GRGDSP)aggcaccatcgtaggttttcgttgcgatcaccaacggagt tttttctgccgtacaccagtgaagtttttcgatcctagcacctctgga gtttttcttgcc. SHELL1-Notch-1siRNA: ((SEQIDNO:92)) atgcaacctgcctggcaagactccagaggactactcatccgt (-Notch-1siRNA). SHELL4-DGKasiRNA: ((SEQIDNO:93) atagcgcctgatcgcaacgcctacgatggacacgccg (-DGKasiRNA);. SHELL1-controlRNA: (SEQIDNO:94) atgcaacctgcctggcaagactccagaggactactcatccgt (-controlRNA);. SHELL4-controlRNA: (SEQIDNO:95) atagcgcctgatcgcaacgcctacgatggacacgccg (-controlRNA);.
(103) In this study, five PNL24 compounds were produced. The PNL24 compounds were designed with or without RGD targeting moieties and with different RNA payloads. To differentiate the five PNL24 compounds, the names and key components of the five compounds are listed in Table 4. In the PNL24RDN and PNL24DN compounds, the DGKa siRNA and Notch-1 siRNA are carried by the same nanostructure as two different types of anti-GBM payloads. In the PNL24RC compound, the same control RNA strands are conjugated to two different components of the nanostructure and, therefore, addressed at different positions in the nanostructure.
(104) TABLE-US-00010 TABLE 4 The names and key components of the five compounds produced in this study. A checkmark () indicates the presence of a particular component (listed by column) in a given compound (listed by row). Shell4- Shell1- Shell4- Name of Core-RGD DGKa Notch-1 control Shell1-control Compound conjugate siRNA siRNA RNA RNA PNL24RDN PNL24RD PNL24RN PNL24DN PNL24RC
(105) To attach different payloads to the nanostructures, at least two different methods were used. As a targeting moiety, the azide group at the C-terminal of the GRGDSP peptide was conjugated to the 5 hexynyl group in the Core DNA of the nanostructure with click chemistry. The aminated RNA species were covalently attached to the thiol-modified Shell DNA strands with sulfo-LC-SPDP crosslinker.
(106) The eight + shaped motifs comprising PNL24 were assembled first. Each motif in a compound has one RGD-core DNA conjugate, four shell strands, and four arm DNA strands. All experiments were performed under sterile conditions. The complementary RNA was added stoichiometrically. The RGD-core DNA conjugate, shell strands, and arm strands of each motif were mixed stoichiometrically and dried at room temperature in a vacuum centrifuge. The pellet of the mixture of oligonucleotides was re-suspended in aqueous buffer with 40 mM Tris, 20 mM Acetic Acid, 2 mM EDTA, 12.5 mM Magnesium Acetate (1TAE/Mg2+ buffer, pH=8.0) to reach 20 M concentration. The solution was heated to 95 C., then cooled to 4 C. slowly in 24 hours and kept at 4 C. for 12 hours to stabilize the motif structure. After separately assembling the eight types of motifs, they were mixed in stoichiometric quantity and annealed from 30 C. to 22 C. over 4 hours. Then, the sample was incubated at 4 C. for 12 hours to stabilize the 24 grids of PNL24R-siRNA. The PNL24 compounds were dialyzed against Hank's Balanced Salt Solution (HBSS) overnight at 4 C. All five PNL24 compounds were kept in a 80 C. freezer before use.
(107) For tumor implantation, forty (40) nu/nu mice were implanted with intracranial xenograft tumors, specifically, 110.sup.5 U87MG cells were implanted by stereotaxic injection directly into the caudate/putamen. Mice were anesthetized by intraperitoneal injection of 3 ml/kg of a solution containing 25 mg/ml ketamine HCl, 2.5 mg/ml xylazine, and 14% ethanol in 0.85% NaCl. Surgical sites were prepared with alcohol and betadine. Animals were positioned using a stereotaxic frame with small animal adaptor, the calvarium was exposed and a 1.5 mm burr hole drilled 2 mm lateral and 1 mm anterior to the bregma. Surgery was performed with sterile tools on a sterile surface. Before the treatment phase of the experiment, the mice were housed for eight days before dosing with the compounds to allow the tumors to be established.
(108) The compounds and control were administered intracranially with convection-enhanced delivery (CED) following the same protocol in Example 6. On each animal, 10 l compound was dosed with CED. The concentration of each compound or control was 2.5 M.
(109) Animals were checked daily and euthanized immediately if moribund conditions arose. Butorphanol tartrate 5.4 mg/kg s.c. was used in the rare circumstance that animals displayed evidence of post-surgical discomfort requiring analgesics. The body weight of all mice was measured twice per week. The size of tumor was measured on days 12-14 and 23-24 after treatment. The mice will be held for Tumor Growth Delay Endpoint and complete regression/partial regression/tumor free survivor determination up to 60 days.
(110) In this example, except for the loss of one mouse during surgery, all the mice intracranially administered with PNL24 compounds survived for at least 12 days before the first round of MRI measurement with no observable abnormalities. This observation supports the safety of PNL24 compounds.
(111)
(112)
(113) Mouse survival data is an important factor to evaluate the anti-GBM efficacy of different PNL24 compounds. All the mice bearing detectable tumors in the first round of MRI measurement were included in the mouse survival test.
Example 8
A Nanostructure Carrying Docetaxel and a Docetaxel Sensitizer
(114) In many cases, tumor cells can develop drug resistance to a chemo-therapy. For example, prostate cancer develops resistance to docetaxel by upregulating p38/p53/p21 signaling pathway. It has been demonstrated that p53 siRNA can be used as a sensitizer to promote the apoptosis of prostate cancer cells induced by docetaxel (Gan L, Wang J, Xu H, Yang X, Resistance to Docetaxel-Induced Apoptosis in Prostate Cancer Cells by p38/p53/p21 Signaling, The Prostate 71:1158-1166(2011).) A PNL24 compound was designed to target prostate cancer and deliver p53 siRNA and docetaxel payloads simultaneously to prostate cancer cells. Since Folate Receptor- is overexpressed on the surface of approximately 40% of human cancers and an isoform of Folate Receptor- is expressed on the surface of malignant cells of hematopoietic origin, folate groups were designed on the nanostructure to target the overexpressed folate receptors on prostate cancer cells. The p53 siRNA can work as a sensitizer to knockdown the expression of p53 in cancer cells and make the cancer cells more vulnerable to docetaxel.
(115) The names and sequences of the DNA oligonucleotides used to produce PNL24 complexes are the same as the sequences in Example 1, with the following exceptions:
(116) TABLE-US-00011 CORE-folate: (SEQIDNO:96) (folategroup-)aggcaccatcgtaggttttcgttgcgatcacc aacggagttttttctgccgtacaccagtgaagtttttcgatcctagc acctctggagtttttcttgcc. SHELL1-doctaxel: (SEQIDNO:97) atgcaacctgcctggcaagactccagaggactactcatccgt (-docetaxel). SHELL2-doctaxel: (SEQIDNO:98) tccgactgagccctgctaggatcgacttcactggaccgttctaccga (-docetaxel). SHELL3-doctaxel: (SEQIDNO:99) (Gd-DTPA-)accggaggcttcctgtacggcagaactccgttggacga acag(-docetaxel). SHELL4-p53siRNA: (SEQIDNO:100) atagcgcctgatcgcaacgcctacgatggacacgccg(-p53siRNA).
(117) The folate group can be conjugated to 5 aminated Core DNA with EDC. The aminated p53 siRNA can be attached to 3 thiolated Shell DNA with a sulfo-LC-SPDP crosslinker. Docetaxel can be covalently attached to thiolated Shell DNA with a SMCC crosslinker. The nanostructure can be assembled with the same method for PNL24.
Example 9
A Nanostructure Specific to GBM Cells Over Human Astrocytes In Vitro
(118) For cancer diagnosis, it is important to differentiate cancer cells from normal cells. In this example, a TYE665 (ex. 645 nm/em. 665 nm) fluorescent dye-labeled PNL24 compound with GRGDSP peptide as targeting moiety (i.e., PNL24-R-T) was designed and produced to selectively label U87MG cancer cells over human astrocytes (HA). PNL24-R-T was annealed with the same protocol in Example 1. The names and sequences of the DNA oligonucleotides used to produce PNL24-R-T complex are the same as the sequences in Example 1, with the following exceptions (written from 5 to 3):
(119) TABLE-US-00012 SHELL3-TYE665: (SEQIDNO:101) (TYE665-)accggaggcttcctgtacggcagaactccgttggacg aacag. SHELL4-TYE665: (SEQIDNO:102) (TYE665-)atagcgcctgatcgcaacgcctacgatggacacgccg.
(120) U87MG cells and HAs were cultured separately in the wells of a 24 well plate in a CO.sub.2 incubator at 37 C. in 5% CO.sub.2 with 100% humidity. Each well had about 110.sup.5 cells. U87MG cells in one well were treated with 12.5 nM PNL24-R-T for 24 hours. Untreated U87MG cells in another well were used as negative control. HA were treated with 12.5 nM PNL24-R-T in the same way with a untreated HA sample as negative control. After the PNL24-R-T treatment, the wells with cells were rinsed three times with 1 ml HBSS. Then, the cells were harvested with 0.25% trypsin for 5 min at RT and fixed with 70% ice cold ethanol. The cells were washed twice with 1 ml HBSS and resuspended in 300 ul HBSS for flow cytometry tests.
(121) Flow cytometry was performed with a BD Biosciences FACSAria fluorescence activated cell sorter with a 633 nm excitation laser and APC (660 nm/20 nm) filter. For each sample, more than 8000 cells were interrogated. The average fluorescent intensity is listed in Table 5.
(122) TABLE-US-00013 TABLE 5 The mean fluorescent intensity of U87MG and HA cell samples Mean fluorescent Mean fluorescent Mean intensity (PNL24- intensity fluorescent intensity R-T treated) (negative control) above background U87MG 721 161 560 HA 480 72 408
(123) The mean fluorescent intensity of U87MG cells above background is 37% higher than the data of HA. This results demonstrate the potential application of PNL24-R-T compound as a diagnostic agent to specifically label and differentiate cancer cells. from normal human cells. For example, the nanostructures can be used to stain tissue samples obtained from surgery to label, differentiate tumor cells from normal tissue cells and show the extent of tumor invasion into normal tissue. With binding effectors specific to certain target on tumor cell, the nanostructures can even be used to differentiate the type of tumor cells and provide important information about prognosis and therapeutic plan.
Example 10
A Nanostructure as a Vaccine Against Ricin Toxin
(124) A nanostructure, i.e., P-X-V, is designed as a vaccine against ricin toxin. In the ricin A chain, a 16mer peptide-TLARSFIICIQM (SEQ ID NO:103) has been identified as the immunodominant neutralizing epitope. The TLARSFIICIQM peptide (SEQ ID NO:104) is used as the major immunogen in the P-X-V vaccine. The TLARSFIICIQM peptide (SEQ ID NO:104) with a C-terminal azide modifier is conjugated with hexynyl modified DNA oligos to form DNA-peptide conjugates. In total, eighty (80) such DNA-peptide conjugates are self-assembled into the P-X-V vaccine complex with forty (40) of them on each surface of the nanostructure. The TLARSFIICIQM (SEQ ID NO:103) peptide molecules are aligned as four pentameric patterns as shown in
(125) It will be apparent to those skilled in the art that various modifications and variations can be made in the practice of the present invention without departing from the scope or spirit of the invention. Other embodiments of the invention will be apparent to those skilled in the art from consideration of the specification and practice of the invention. It is intended that the specification and examples be considered as exemplary only, with a true scope and spirit of the invention being indicated by the following claims.