Enhancing Photosynthesis

Abstract

Certain embodiments of the present invention relate to methods and products for enhancing the rate of photosynthesis in a plant. In addition, certain embodiments relate to transgenic plants and progeny thereof which comprise an exogenous Rieske Iron Sulphur protein.

Claims

1-48. (canceled)

49. A genetically modified plant or part thereof that overexpresses a Rieske iron sulphur protein comprising a nucleic acid molecule encoding the Rieske iron sulphur protein that is operably linked to a promoter operable in a plant cell, wherein the Rieske iron sulphur protein has at least 95% sequence identity to SEQ ID NO: 1 or a plant PetC protein, and wherein the genetic modification comprises or is to the promoter, the nucleic acid molecule or both.

50. The genetically modified plant or part thereof according to claim 49, wherein: (i) the genetically modified plant has an increased photosynthesis rate as compared to a control plant; (ii) the genetically modified plant has a greater size, greater biomass and/or faster growth rate as compared to a control plant; or (iii) the genetically modified plant has an enhanced yield as compared to a control plant; wherein the control plant is a wild-type plant of the same variety as the genetically modified plant.

51. The genetically modified plant or part thereof according to claim 49, wherein overexpression of the Rieske iron sulphur protein increases expression of a cytochrome b6f complex protein in at least one plant cell of the genetically modified plant or part thereof.

52. The genetically modified plant or part thereof according to claim 51, wherein: (i) the cytochrome b6f complex protein is selected from PetA, PetB and a combination of PetA and PetB; and/or (ii) the cytochrome b6f complex protein is an endogenous cytochrome b6f complex protein.

53. The genetically modified plant or part thereof according to claim 49, wherein the Rieske iron sulphur protein comprises the amino acid sequence as set forth in SEQ ID NO: 1.

54. The genetically modified plant or part thereof according to claim 49, wherein the plant is a monocotyledonous plant.

55. The genetically modified plant or part thereof according to claim 49, wherein the plant is selected from wheat, barley, rice and canola.

56. The genetically modified plant or part thereof according to claim 49, wherein the plant is wheat.

57. The genetically modified plant or part thereof according to claim 49, wherein the promoter is a 35s tobacco mosaic virus promoter.

58. The genetically modified plant or part thereof according to claim 49, wherein the genetically modified plant or part thereof is a plant seed.

60. A method of cultivating a genetically modified plant, comprising planting the seed of claim 58 under conditions promoting plant growth and development to grow the genetically modified plant.

61. The method according to claim 60, wherein the genetically modified plant 45. Use according to claim 44, wherein the plant has one or more of the following characteristics: a) enhanced yield; b) increased photosynthesis rate; and/or c) increased expression of a cytochrome bf6 complex protein, in each case as compared to a control plant.

62. The method according to claim 61, wherein the cytochrome b6f complex protein is an endogenous cytochrome b6f complex proteins

63. The method according to claim 62, wherein the enhanced yield comprises one or more of: a) greater biomass; b) greater size; and/or c) greater growth rate, in each case as compared to a control plant.

Description

DETAILED DESCRIPTION OF EMBODIMENTS OF THE INVENTION

[0153] Certain embodiments of the present invention will now be described hereinafter, by way of example only, with reference to the following figures:

[0154] FIGS. 1A and B is an image of Western blot gels:

[0155] Western blot analysis in fully expanded leaves from three expressing lines. Protein extracts from leaf discs taken from two independent leaves per plant. PetA and PetB are subunits of the cytochrome b6f complex. Lhca amd PsaA are PSI proteins and PsbD/D2 and PsbA/D1 are PSII proteins. AtpD is ATP synthase protein. Controls for protein loading including the calvin cycle enzyeme FBP aldolase (FBPA), the photorespiration protein glycine decarboxylase H-subunit (GDC-H) and Rubisco small subunit (Rubisco). B) Wild type proteins were loaded in a range from 0.63 μg to 10 μg and then compared to protein fractions loaded from lines 9, 10 and 11.

[0156] FIG. 1C) The level of each protein in each plant line was statistically analysed against wild type grown plants and is shown as a relative percentage of wild type levels.

[0157] FIG. 2: Determination of photosynthetic capacity and leaf area in transgenic seedlings using fluorescence imaging. WT and transgenic plants were grown in controlled environment conditions with a light intensity of 130 m.sup.−2 s.sup.−1, 8 h light/16 h dark cycle for 14 days and fluorescence imaging used to determine F.sub.q′/F.sub.m′ (maximum PSII operating efficiency) at two light intensities. Fluorescence F.sub.q′/F.sub.m′ images taken at (a) 310 μmol m.sup.−2 s.sup.−1 and (b) 450 μmol m.sup.−2 s.sup.−1. (c) A significant decrease in non-photochemical quenching (NPQ) was also observed in these plants (d) leaf area at time of analysis and e) is a fluorescence image of the leaves of WT and transgenic plants.

[0158] The data was obtained using 4-6 individual plants from each line compared to 6 WT. Significant differences (p<0.05) are represented as capital letters indicating if each specific line is significantly different from another. Lower case italic lettering indicates lines are just below significance (>0.05-<0.1).

[0159] FIG. 3: Determination of photosynthetic capacity in transgenic plants at 21% O.sub.2. WT and transgenic plants were grown in controlled environment conditions with a light intensity 130 μmol m.sup.−2 s.sup.−1, 8 h light/16 h dark cycle for four weeks and Light Response curves were carried out at 2% O.sub.2. (a) is a light Response Curves for each individual rieskeFeS and (b) is a light response curve for all lines combined compared to wild type (WT). (c) is a graph showing average F.sub.q′/F.sub.m′ data, (d) is a graph showing Amax, (e) is a graph showing average stomatal conductance over the evaluating period. The data was obtained using 4 individual plants per line compared to 4 WT. (ALL: combined data set of all over-expressing lines). Significant differences (p<0.05) are represented as capital letters indicating if each specific line is significantly different from another.

[0160] FIG. 4: Determination of photosynthetic capacity and rate of electron transport (rETR) in transgenic plants at 2% O.sub.2. WT and transgenic plants were grown in controlled environment conditions with a light intensity 130 μmol m.sup.−2 s.sup.−1, 8 h light/16 h dark cycle for four weeks and Light Response curves were carried out at 2% O.sub.2. A) is a graph showing light Response Curves for each individual RieskeFeS ox, B) is a graph showing rETR for individual plant lines compared to wild type and C) is a graph showing light response curves for all plant lines combined compared to wild type (WT). D) is a graph showing average F.sub.q′/F.sub.m′ data, E) is a graph showing Amax F) is a graph showing average stomatal conductance over the evaluating period. The data was obtained using 4 individual plants per line compared to 4 WT. (ALL: combined data set of all over-expressing lines). Significant differences (p<0.05) are represented as capital letters indicating if each specific line is significantly different from another.

[0161] FIG. 5: Determination of the efficiency of electron transport in the leaves of young Rieske Fes ox plants (27 days after planting). WT and Rieske FeS ox plants were grown in controlled environment conditions with a light intensity of 130 mmol m.sup.−2 s.sup.−1, 8 h light/16 h dark cycle and the redox state was determined using a Dual-PAM at a light intensity of 220 mmol m.sup.−2 s.sup.−1. The data was obtained using four individual plants from Rieske FeS ox line 11 and compared to WT (five plants). Significant differences are indicated (*p<0.05). Bars represent standard errors. The quantum efficiency of PSI (FIG. 5A), quantum efficiency of PSII (FIG. 5B), level of Q.sub.A reduction (1-qp) (5C), fraction of open PSII centres (FIG. 5D), NPQ (FIG. 5E) and reduction in stress induced limitation of NPQ (qN) (FIG. 5F) are all shown.

[0162] FIG. 6: Photosynthetic responses of WT and transgenic plants grown in greenhouse under square wave isolights. Photosynthetic carbon fixation rates were determined as a function of increasing CO.sub.2 concentrations (A/Ci) at saturating-light levels in developing leaves. WT and transgenic plants were grown in controlled environment conditions with a light intensity 280 μmol m.sup.−2 s.sup.−1, 12 h light/12 h dark cycle for four weeks. (a) is a graph showing A/Ci Curves for each individual rieskeFeS and (b) is a graph showing all lines combined compared to wild type (WT). (c) A.sub.max/A.sub.sat, (d) is a graph showing Rubisco activity and (e) is a graph showing J.sub.max derived from A/Ci response curves using the equations published by von Caemmerer and Farquhar (1981). Significant differences (<0.05) are represented by capital letters. Lower case italic lettering indicates lines are just below significance (>0.05-<0.1).

[0163] FIG. 7: Final leaf area and biomass of WT and transgenic plants were grown in controlled environment conditions with a light intensity 280 μmol m.sup.−2 s.sup.−1, 12 h light/12 h dark cycle for four weeks. (a) Total leaf area (b) dry weight (d) area of leaves of all lines. FIG. 7C is a photograph of the WT and transgenic leaves. Significant differences (p<0.05) are represented by capital letters within the histogram.

[0164] FIG. 8: Growth analysis of wild type (WT) and transgenic lines grown in low light. Plants were grown at 130 μmol m.sup.−2 s.sup.−1 light intensity in long days (8 h/16 h days). (a) is a photograph showing the appearance of plants at 10 and 18 days after planting. (b) is a graph illustrating plant growth rate evaluated over the first 20 days. (c) is a graph illustrating final biomass at 25 days post planting. % increase over wild type are indicated as numbers within the histogram. Results are representative of 6 to 9 plants from each line. Significant differences * (p<0.01), ** (p<0.001), are indicated.

[0165] FIG. 9: Schematic representation of the RieskeFeS over-expression vector pGWRi. RB, T-DNA right border; Pnos, nopaline synthase promoter; NTP II, neomycin phosphotransferase gene; Tnos, nopaline synthase terminator; P35S, rbcS2B promoter (1150bp; At5g38420). Constructs were used to transform wild Arabidopsis (Col-0).

[0166] FIG. 10: Molecular and Biochemical Analysis of the transgenic plants over-expressing the RieskeFeS protein from tobacco. Western blot analysis in fully expanded leaves from 27 primary lines. Protein levels were compared to PCR negative lines (AZ). Lines 9, 10 and 11 were selected for study and line 19 was used as a negative control in some studies. FIG. 10B is a photograph of the plant leaves.

[0167] FIG. 11: Determination of photosynthetic capacity and leaf area in transgenic seedlings using fluorescence imaging. WT and transgenic plants were grown in controlled environment conditions with a light intensity of 110 m.sup.−2 s.sup.−1, 8 h light/16 h dark cycle for 14 days and fluorescence imaging used to determine F.sub.q′/F.sub.m′ (maximum PSII operating efficiency) at alight intensitiy of (a) 600 μmol m.sup.−2 (b) Shows Fv/Fm of dark adapted plants. (The data was obtained using 4-6 individual plants from each line compared to 6 WT). Significant differences (p<0.05) are represented as capital letters indicating if each specific line is significantly different from another.

[0168] FIG. 12: illustrates the amino acid sequence of N.tabacum Rieske iron sulphur protein (SEQ. ID. No. 1).

[0169] FIG. 13: illustrates the cDNA sequence of N. tabacum petC gene (SEQ. ID. No. 2); and

[0170] FIG. 14: illustrate the DNA sequence of N. tabacum petC gene (SEQ. ID. No. 3).

[0171] FIG. 15: shows the maximum PSII efficiency (F.sub.q′/F.sub.m′). (a) F.sub.q′/F.sub.m′ for each individual rieskeFeS and (b) all lines combined compared to wild type (WT).

[0172] FIG. 16: non-photochemical quenching (NPQ). (a) NPQ for each individual rieskeFeS and (b) all lines combined compared to wild type (WT).

[0173] FIG. 17: maximum potential operating efficiency of PSII in the light (F.sub.v′/F.sub.m′). (a) F.sub.v′/F.sub.m′ for each individual rieskeFeS and (b) all lines combined compared to wild type (WT).

[0174] FIG. 18: Comparative analysis of Wild type and null segragants used in this study. WT—wild type plants grown from seed batch. AZY—null segragants recovered from segragating lines verified by PCR for non-integration of the transgene. (a) F.sub.q′/F.sub.m′ at 200, (b) F.sub.q′/F.sub.m′ at 600, (c) leaf area at the time of analysis.

EXAMPLES

[0175] Materials and Methods

[0176] Rieske Iron Sulphur Protein of the Cytochrome b6f (Cyt b6f)

[0177] The full-length coding sequence of the Rieske iron sulphur protein of the cytochrome b6f (Cyt b6f: X64353) was amplified by RT-PCR using primers NtRieskeFeSF (5′caccATGGCTTCTTCTACTCTTTCTCCAG′3 (SEQ ID. No. 4) and NtRieskeFeSR (5′CTAAGCCCACCATGGATCTTCACC′3 (SEQ ID. No. 5). The resulting amplified product was cloned into pENTR/D (Invitrogen, UK) to make pENTR-NtRieskeFeS and the sequence was verified and found to be identical. The full-length cDNA was introduced into the pGWB2 gateway vector (Nakagawa et al., 2007: AB289765) by recombination from the pENTR/D vector to make pGW-NtRieske (B2-NtRi). cDNA are under transcriptional control of the 35s tobacco mosaic virus promoter, which directs constitutive high-level transcription of the transgene, and followed by the nos 3′ terminator. Construct maps are shown in FIG. 9.

[0178] Generation of Transgenic Plants

[0179] The recombinant plasmid B2-NtRi was introduced into wild type Arabidopsis by floral dipping (Clough and Bent, 1998) using Agrobacterium tumefaciens GV3101. Positive transformants were regenerated on MS medium containing kanamycin (50 mg L.sup.−1), hygromycin (20 mg L.sup.−1). Kanamycin/hygromycin resistant primary transformants (T1 generation) with established root systems were transferred to soil and allowed to self fertilize.

[0180] Plant Growth Conditions

[0181] Wild-type T2 Arabidopsis plants resulting from self-fertilization of transgenic plants were germinated in sterile agar medium containing Murashige and Skoog salts (plus kanamycin 100 mg for the transformants) and grown to seed in soil (Levington F2, Fisons, Ipswich, UK) and lines of interest were identified by western blot and qPCR. For experimental study, T3 progeny seeds from selected lines were germinated on soil in controlled environment chambers at an irradiance of 130 μmol photons m.sup.−2 s.sup.−1, 22° C., relative humidity of 60%, in an 8h/16 h square-wave photoperiod. Plants were sown randomly and trays rotated daily under the light. Leaf areas were calculated using standard photography and ImageJ software (imagej.nih.gov/ij).

[0182] Wild type plants used in this study were a combined group of WT and null segregants from the transgenic lines verified by PCR for non-integration of the transgene. No significant differences in growth parameters were seen between these groups (see FIG. 18).

[0183] Protein Extraction and Western Blotting

[0184] Four leaf discs (0.6-cm diameter) from two individual leaves, for western blot, were taken and immediately plunged into liquid N.sup.2, and stored at −80° C. Samples were ground in liquid nitrogen and protein quantification determined (Harrison et al., 1998). Samples were loaded on an equal protein basis, separated using 12% (w/v) SDS-PAGE, transferred to polyvinylidene difluoride membrane, and probed using antibodies raised against the cytochrome b6 complex proteins PetA (AS08306), PetB (AS03034), and PetC (RieskeFeS: AS08330), PsbA (AS01016), PsaA (AS06172), Lhca1 (AS01005) and against the Glycine decarboxylase H-subunit (AS05074), all purchased from Newmarket Scientific (UK). FBPA antibodies were raised against a peptide from a conserved region of the protein [C]—ASIGLENTEANRQAYR-amide, Cambridge Research Biochemicals, Cleveland, UK (Simkin et al. 2015). Proteins were detected using horseradish peroxidase conjugated to the secondary antibody and ECL chemiluminescence detection reagent (Amersham, Buckinghamshire, UK). Proteins were quantified using a Fusion FX Vilber Lourmat Imager (Peqlab, Lutterworth, UK).

[0185] Chlorophyll Fluorescence Imaging

[0186] Chlorophyll fluorescence measurements were performed on 10-day-old Arabidopsis seedlings that had been grown in a controlled environment chamber providing 130 μmol mol.sup.−2s.sup.−1 photosynthetic photon flux density (PPFD) and ambient CO.sub.2at 22° C. Chlorophyll fluorescence parameters were obtained using a chlorophyll fluorescence (CF) imaging system (Technologica, Colchester, UK; Barbagallo et al., 2003; Baker and Rosenqvist, 2004). The operating efficiency of photosystem two (PSII) photochemistry, F.sub.q′/F.sub.m′, was calculated from measurements of steady state fluorescence in the light (F′) and maximum fluorescence in the light (F.sub.m′) was obtained after a saturating 800 ms pulse of 6200 μmol m.sup.−2 s.sup.−1 PPFD using the following equation F.sub.q′/F.sub.m′=(F.sub.m′-F)/F.sub.m′. Images of F.sub.q/F.sub.m′ were taken under stable PPFD of 310, 450 and 600 μmol m.sup.−2 s.sup.−1 PPFD (Baker et al., 2001; Oxborough and Baker, 1997).

[0187] A/C.sub.i Response Curves

[0188] The response of net photosynthesis (A) to intracellular CO.sub.2 (C.sub.i) was measured using a portable gas exchange system (CIRAS-1, PP Systems Ltd, Ayrshire, UK). Leaves were illuminated using a red-blue light source attached to the gas-exchange system, and light levels were maintained at saturating photosynthetic photon flux density (PPFD) of 1000 μmol m.sup.−2 s.sup.−1 with an integral LED light source (PP Systems Ltd, Ayrshire, UK) for the duration of the A/C.sub.i response curve. Measurements of A were made at ambient CO.sub.2 concentration (C.sub.a) of 400 μmol mol.sup.−1, before C.sub.a was decreased in a stepwise manner to 300, 200, 150, 100, 50 μmol mol.sup.−1 before returning to the initial value and increased to 500, 600, 700, 800, 900, 1000, 1100, 1200 μmol mol.sup.−1. Leaf temperature and vapour pressure deficit (VPD) were maintained at 22° C. and 1±0.2 kPa respectively. The maximum rates of Rubisco- (Vc.sub.max) and the maximum rate of electron transport for RuBP regeneration (J.sub.max) were determined and standardized to a leaf temperature of 25° C. based on equations from Bernacchi et al. (2001), and McMurtrie & Wang (1993) respectively.

[0189] Photosynthetic Capacity

[0190] Photosynthesis as a function of PPFD (A/Q response curves) was measured using a Li-Cor 6400XT portable gas exchange system (Li-Cor, Lincoln, Nebr., USA). Cuvette conditions were maintained at a leaf temperature of 22° C., relative humidity of 50-60%, and ambient growth CO.sub.2 concentration (400 mmol mol.sup.−1 for plants grown in ambient conditions). Leaves were initially stabilized at saturating irradiance 1000 μmol m.sup.−2 s.sup.−1, after which A and g.sub.s was measured at the following PPFD levels; 0, 50, 100, 150, 200, 250, 300, 350, 400, 500, 600, 800, 1000 μmol m.sup.−2 s.sup.−1. Measurements were recorded after A reached a new steady state (1-2 min) and before stomatal conductance (g.sub.s) changed to the new light levels. A/Q analyses were performed at 21% and 2% O.sub.2.

[0191] Gas Exchange Measurements

[0192] The response of net photosynthesis (A) to intracellular CO.sub.2 (C.sub.i) was measured using a portable gas exchange system (cirus 1). The gas exchange system was zeroed daily using silica gel to remove water and soda lime (sofnolime, Morgan Medical, Kent, UK) to remove CO.sub.2 from the air entering the cuvette. Leaves were illuminated using a red-blue light source attached to the gas-exchange system, and light levels were maintained at saturating photosynthetic photon flux density (PPFD) of 1000 μmol m.sup.−2 s.sup.−1 with an integral LED light source (PP systems) for the duration of the A/Ci response curve. Measurements of A were made at ambient CO.sub.2 concentration (C.sub.a) at 400 μmol mol.sup.−1, before C.sub.a was decreased to 300, 200, 150, 100, 50 μmol mol.sup.−1 before returning to the initial value and increased to 500, 600, 700, 800, 900, 1000, 1100, 1200 μmol mol.sup.−1. Leaf temperature and vapour pressure deficit (VPD) were maintained at 22° C. and 1±0.2 kPa respectively. The maximum rates of Rubisco-(Vc.sub.max) and the maximum rate of electron transport for RuBP regeneration (J.sub.max) were determined and standardized to a leaf temperature of 25° C. based on equations from Bernacchi et al. (2001), and McMurtrie & Wang (1993), respectively.

[0193] PSI and PSII Quantum Efficiency

[0194] The photochemical quantum efficiency of PSII and PSI in transgenic and WT plants was measured following a dark-light induction transition using a Dual-PAM-100 instrument (Walz, Effeltrich, Germany) with a DUAL-DR measuring head. Plants were dark adapted for 20 min before placing in the instrument. Following a dark adapted measurement, plants were illuminated with 220 μmol m.sup.−2 s.sup.−1 PPFD. The maximum quantum yield of PSII was measured following a saturating pulse of light for 600 ms saturating pulse of light at an intensity of 6200 μpmol m.sup.−2 s.sup.−1. The PSII operating efficiency was determined as described by the routines above. PSI quantum efficiency was measured as an absorption change of P700 before and after a saturating pulse of 6200 μmol m.sup.−2 s.sup.−1 for 300 ms (which fully oxidizes P700) in the presence of far-red light with a FR pre-illumination of 10s. Both measurements were recorded every minute for 5 min). q.sub.p or (F.sub.v′/F.sub.m′), was calculated from measurements of steady state fluorescence in the light (F′) and maximum fluorescence in the light (F.sub.m′) whilst minimal fluorescence in the light (F.sub.o′) was calculated following the equation of Oxborough and Baker (1997b). The fraction of open PSII centres (q.sub.L) was calculated from q.sub.p×F.sub.o′/F (Baker 2008).

[0195] Pigment Extraction and HPLC Analysis

[0196] Chlorophylls and carotenoids were extracted using n,n-dimethylformamide (DMF) (Inskeep and Bloom 1985) which was subsequently shown to suppressed chlorophyllide formation in Arabidopsis leaves (Hu et al., 2013). Briefly, leaf discs collected from two different leaves were immersed in DMF at 4° C. for 48 hours and separated by UPLC as described by Zapata et al., (2000).

[0197] Determination of Sucrose and Starch

[0198] Carbohydrates and starch were extracted from 20 mg leaf tissue and samples were collected at 2 time points, 1 hour before dawn (15 h into the dark period) and 1 hour before sunset (7 h into the light period). Four leaf discs collected from two different leaves were ground in liquid nitrogen and 20 mg/FW of tissue was incubated in 80% (v/v) ethanol for 20 min at 80° C. and then repeated 3 times with ethanol 80% (v/v) at 80° C. The solid pellet and pooled ethanol samples and freeze dried. Sugars were measured from the extracts in ethanol using an enzyme-based protocol (Stitt et al., 1989), and the starch contents were estimated from the ethanol-insoluble pellet according to Stitt et al. (1978), with the exception that the samples were boiled for 1 h and not autoclaved.

[0199] Statistical Analysis

[0200] All statistical analyses were done by comparing ANOVA, using Sys-stat, University of Essex, UK. The differences between means were tested using the Post hoc Tukey test (SPSS, Chicago).

[0201] Results

[0202] Production and Selection of Arabidopsis Transformants

[0203] The full-length tobacco Rieske iron sulphur coding sequence of the cytochrome b6f complex (Cyt b6f: X64353) was used to generate an over-expression construct B2-NtRi (FIG. 9). Following floral dipping, Arabidopsis plants were regenerated on kanamycin/hygromycin containing medium and plants expressing the integrated transgenes were screened using RT-PCR (data not shown).

[0204] Total extractable protein from leaves of the T1 progeny was analysed and three lines identified showing a significant over-expression of the RieskeFeS protein (PetC) (FIG. 10A). Immunoblot analysis of T3 progeny from selected lines for Arabidopsis expressing RieskeFeS carried out using WT as controls. Immunoblot analysis revealed that all three plants lines selected in the T1 generation showed an accumulation of the RieskeFeS protein (FIG. 1A). Interestingly, the over-expression of RieskeFeS (referred to as Rieske FeS ox) resulted in a concomitant increase in cyt f (PetA) and cyt b.sub.6 (PetB), two proteins found within the cytochrome b6f complex (FIG. 1A).

[0205] An increase in the level of the PSI type I chlorophyll a/b-binding protein (Lhca1) and an increase in the core protein of PSI (PsaA) was also observed. Furthermore, the DI (PsbA) and D2 (PsbD) proteins which form the reaction centre of PSII were shown to be elevated in Rieske FeS ox lines. Finally, an increase in the ATP synthase delta subunit (AtpD) was also observed in Rieske FeS ox lines (FIG. 1A). As a control for protein loading and expression level (FIG. 1 A), the samples were probed with antibodies to the plastidial Calvin-Benson Cycle enzyme

[0206] FBP aldolase (FBPA) and the mitochondrial photo-respiration enzyme glycine decarboxylase H-subunit (GDCH). No significant differences in protein levels for either FBPA or GDCH were observed. Furthermore, no significant differences in the levels of Rubisco were observed between transgenic and WT plants (FIG. 1A). A quantitative estimate of the changes in protein levels was determined from the immunoblots of samples collected from two to three independent plants per lines. An example is shown in FIG. 1B. These results showed a 2-2.5 fold increase in the Rieske FeS protein relative to WT plants and a similar increase was also observed for cyt f, cyt b.sub.6, Lhca1, D2 and PsaA (FIG. 1C). No increase in the stromal FBPA protein was evident.

[0207] Chlorophyll Fluorescence Imaging Reveals Increased Photosynthetic Efficiency in Young Transgenic Seedlings

[0208] In order to screen for photosynthetic changes in seedlings (T3 progeny) grown at either 130 μmol m.sup.−2 s.sup.−1 chlorophyll a fluorescence imaging was used to examine the quantum efficiency of PSII photochemistry (F.sub.q′/F.sub.m′) (Baker, 2008; Murchie and Lawson, 2013). Analysis of plants over-expressing the cytochrome b6f complex grown at 130 μmol m.sup.−2 s.sup.−1, showed a small increase in F.sub.q′/F.sub.m′ at an irradiance of 310 μmol m.sup.−2 s.sup.−1 (FIGS. 2a) and 450 μmol m.sup.−2 s.sup.−1 (FIG. 2b) when compared to WT. At higher light level (600 μmol m.sup.−2s.sup.−1), significant increase in F.sub.q′/F.sub.m′ were still observed (FIG. 11a). Furthermore, no significant differences in Fv/Fm were observed between transgenic and WT (FIG. 11b). From images taken at the time of fluorescence analysis of the seedlings it was shown that the leaf area for all transgenic lines was significantly larger than WT (FIG. 2d). Wild type plants used in this study were a combined group of WT and null segregants verified by PCR. Interestingly, line 11, which showed the largest increase in F.sub.q′/F.sub.m′, also showed the biggest increase in leaf area in all experiments. Furthermore, a more detailed analysis of photosynthetic parameters by fluorescence imaging demonstrated a consistent increase in the operating efficiency of PSII (F.sub.q′/F.sub.m′; FIG. 15), a decrease in non-photochemical quenching (NPQ; FIG. 2c; FIG. 16) and a significant increase in the maximum potential operating efficiency of PSII in the light (F′/F.sub.m′; FIG. 17). Wild-type plants used in this study were a combined group of WT and null segregants from the rieskeFeS over-expressing lines verified by PCR. A comparison of wild type plants and null-segregants clearly showed that no significant differences were observed in either photosynthetic efficiency (F.sub.q′/F.sub.m′) or in leaf area between the two groups (FIG. 18).

[0209] Evaluation of the Relationship Between Carbon Assimilation and Fluorescence at 21% O.sub.2

[0210] Light response curves conducted to assess the relationship between the photosynthetic operating efficiency (F.sub.q′/F.sub.m′) and CO.sub.2 fixation corrected for leaf fractional light absorbance (CO.sub.2). This provides a measure of the efficiency of light utilization for CO.sub.2 fixation. FIG. 3 shows the light response curves carried for each lines independently (FIG. 3a) and all lines combined (FIG. 3b) compared to wild type. The relationship between the photosynthetic operating efficiency and yield of CO.sub.2 assimilation enables an assessment of possible alternative electron sinks to Rubisco activity.

[0211] Both the operating efficiency of PSII (F.sub.q′/F.sub.m′ CO.sub.2) (FIG. 3c) and the maximum quantum efficiency of CO.sub.2 fixation (CO.sub.2) (FIG. 3d) were shown to be elevated compared to wild type when analysed at 21% O.sub.2. However, these differences were only significant in line 11 and when all lines were combined into a single group (ALL). Additionally, no significant differences in average stomatal conductance were observed in transgenic lines compared to wild type (FIG. 3e).

[0212] Evaluation of the Relationship Between Carbon Assimilation and Fluorescence at 2% O.sub.2

[0213] In addition to light response curves evaluated at 21% O.sub.2, non-photorespiratory conditions (20 mmol mol.sup.−1 O.sub.2) were used for the light response curves to further assess the relationship between the photosynthetic operating efficiency (F.sub.q′/F.sub.m′) and CO.sub.2 fixation corrected for leaf fractional light absorbance (CO.sub.2). This provides a measure of the efficiency of light utilization for CO.sub.2 fixation.

[0214] FIG. 4 shows the light response curves carried out under non-photorespiratory conditions for each lines independently (FIG. 4a) and all lines combined (FIG. 4c) compared to wild type. The rate of electron transport (rETR) for each line independently compared to wild type is also shown (FIG. 4b). The rETR was shown to be increased in comparison to wild type. The relationship between the photosynthetic operating efficiency and yield of CO.sub.2 assimilation enables an assessment of possible alternative electron sinks to Rubisco activity. Both the operating efficiency of PSII (F.sub.q′/F.sub.m′ CO.sub.2) (FIG. 4d) and the maximum quantum efficiency of CO.sub.2 fixation (CO.sub.2) (FIG. 4e) were shown to be significantly elevated compared to wild type. Additionally, only minor differences in stomatal conductance were observed in one of the transgenic lines (11) compared to wild type (FIG. 4f).

[0215] Increased Quantum Efficiency of PSI and PSII in Comparison to Wild Type

[0216] To further explore the influence of increases in the Rieske FeS protein on PSII and PSI photochemistry dark-light induction responses were determined in WT and Rieske FeS ox transgenic plants using simultaneous measurements of P700 oxidation state and PSII efficiency.

[0217] FIG. 5 shows that the quantum efficiency of both PSI and PSII were increased in the Rieske FeS ox plants compared to wild type and that the fraction of PSII centres that were open (q.sub.L) was also increased whilst the level of Qa reduction (1-qP) was lower in leaves of 27 day old plants. NPQ level was also lower in the Rieske FeS ox plants relative to wild type (FIG. 5A). Furthermore, a reduction in stress induced limitation of NPQ (q.sub.N) was also observed.

[0218] Increased Cytochrome b6f Protein Levels Stimulates Growth in Low Light

[0219] The same group of plants used for fluorescence analysis described above were assembled and photographed (FIG. 7C). Their growth rate was determined by evaluating leaf area over 26 days from planting until such a time that aerial observation became complex due to overlapping leaf areas obscuring evaluated differences. From image analysis of the seedlings it was shown that the leaf area for all lines was significantly greater than WT as early as 3 days after planting onto soil (FIGS. 7A and D). By 16 days, plants over-expressing the Rieske FeS protein were shown to be between 40-114% larger than corresponding wild type plants. Furthermore, line 11 was shown to be significant larger than lines 9 and 10. After 25 days post-planting the plants were destructively harvested and dry weight were determined. Lines 9 to 11 respectively showed a 29%, 46% and 72% increase in biomass compared to WT.

[0220] Photosynthetic CO.sub.2 Assimilation Rates are Increased in Mature Plants.

[0221] The rate of CO.sub.2 assimilation (A) was determined in plants grown at 130 μmol m.sup.−2s.sup.−1 as a function of internal CO.sub.2 concentration (C.sub.i) in young expanding leaves. Under these experimental growth conditions, as previously used for light response curves, no significant differences in CO.sub.2 assimilation, J.sub.max or Vc.sub.max were observed (data not shown). A second group of plants growing at 280 μmol m.sup.−2s.sup.−lin the green house maintained in square wave light under isolights with a 12 h/12 h day night cycle were also examined (FIG. 6). Under these higher light conditions, in all transgenic plants the rate of A in developing leaves was greater at C.sub.i concentrations above ca. 300 μmol mol.sup.−1 when compared to WT plants (FIG. 6A-B) resulting in a greater light saturated rate of photosynthesis (A.sub.sat) in lines 9 and 11 compared with the WT control (FIG. 6 C). A.sub.sat was clearly elevated in lines ALL compared to WT. Further analysis of the A/C.sub.i curves illustrated that significant enhancements of the maximum rate of Rubisco carboxylation (Vc.sub.max: FIG. 6D) and electron transport (J.sub.max: FIG. 6E) were evident in some lines and significantly elevated in ALL. Further analysis of the A/C.sub.i curves illustrated that the light—and CO.sub.2− saturated rate of photosynthesis (A.sub.max) was also significantly greater in 2 of the 3 transgenic lines (FIG. 6C). An analysis of final leaf area and final dry eight (biomass) of the plants used here showed an overall significant increase in both leaf area (FIG. 7A) and final biomass (FIG. 7B)

[0222] Increased cytochrome b6f protein levels stimulates growth in low light. The same group of plants used for fluorescence analysis described above were assembled and photographed (FIG. 8A). Their growth rate was determined by evaluating rosette area over 26 days from planting until such a time that aerial observation became complex due to overlapping leaf areas obscuring evaluated differences. From image analysis of the seedlings it was shown that the leaf area for all lines was significantly greater than WT as early as 8 days after planting onto soil (FIG. 8 B). By 16 days, plants over-expressing the RieskeFeS protein were shown to be between 40-114% larger than corresponding wild type plants. Furthermore, line 11 was shown to be significant larger than lines 9 and 10.

[0223] After 25 days post-planting the plants were destructively harvested and dry weight were determined. Lines 9 to 11 respectively showed a 29%, 46% and 72% increase in biomass compared to WT (FIG. 8C).

[0224] Over-Expression of the RieskeFeS Protein Results in Changes to the Pigment Content of Transgenic Lines.

[0225] Four leaf discs from two different leaves from selected lines were collected and the pigments were extracted using DMF and pigments were separated by UPLC as described by Zapata et al., (2000). An average 26% increase in chlorophyll content was observed in transgenic lines. These increases were accompanied by an increase in neoxanthin (+38%), violaxanthin (+59%), lutein (+75%) and β-carotene (+169%). Chlorophyll ratios of approx 3.05-3.10 in both WT and transgenic lines is similar to the 3.11 previously reported in coffee leaves and 2.94 in green coffee cherries (Simkin et al., 2008; 2010). Interestingly, line 11 (previously shown to have an overall higher increase in PSII efficiency (FIG. 2), higher average increases in A.sub.max (FIGS. 3, 4 and 6) and a faster growth rate (FIG. 8) was shown to have the highest increase in both chlorophyll and carotenoids compared to WT (see Table 1).

TABLE-US-00001 TABLE 1 shows pigment content in WT and transgenic lines. Results are represented as units of β-carotene in WT (where β-carotene in WT = 1). WT 9 10 11 ALL Neoxanthin 0.90 +/− 0.08 1.22 +/− 0.08 *  1.17 +/− 0.08 * 1.33 +/− 0.10 ** 1.24 +/− 0.05 ** Violaxanthin 0.92 +/− 0.08  1.42 +/− 0.08 ***  1.39 +/− 0.10 ***  1.58 +/− 0.10 ***  1.46 +/− 0.05 *** Violaxanthin +54% +51% +71% +55% Lutein 3.09 +/− 0.25  5.36 +/− 0.40 ***  5.05 +/− 0.31 ***  5.84 +/− 0.28 ***  5.42 +/− 0.20 *** Lutein +73% +63% +89% +75% β-carotene 1.00 +/− 0.10  2.71 +/− 0.19 ***  2.45 +/− 0.18 ***  2.92 +/− 0.08 ***  2.69 +/− 0.10 *** β-carotene +171%  +145%  +192%  +169%  total car 5.91 +/− 0.44 10.06 +/− 0.64 ***  10.71 +/− 0.55 *** 11.67 +/− 0.42 *** 10.81 +/− 0.35 *** chl/a 15.56 +/− 0.50  19.82 +/− 1.01 *** 18.31 +/− 0.95   20.83 +/− 0.79 *** 19.65 +/− 0.56 *** chl/b 5.11 +/− 0.17 6.41 +/− 0.27 ** 5.87 +/− 0.27 *  6.73 +/− 0.32 ***  6.34 +/− 0.18 *** chl total 20.67 +/− 0.61  26.23 +/− 1.26 *** 24.18 +/− 1.21 ** 27.55 +/− 1.10 *** 27.55 +/− 1.10 *** Chlorophyll +27% +17% +33% +26% ratio chl a/b 3.05 3.09 3.12 3.10 3.10 chl/βC 20.67  9.68 9.87 9.43 9.65 chl/Lutien 6.68 4.89 4.79 4.72 4.8  Statistical differences are shown in bold (* <0.1; ** <0.05; *** <0.001).

[0226] Discussion

[0227] The primary determinant of plant productivity is associated directly with photosynthetic efficiency and any improvements, through genetic manipulation or otherwise, can greatly influence biomass and yield.

[0228] Certain embodiments of the present invention illustrate that increasing the level of the RieskeFeS protein component of the cyt 6bf complex results in a co-committant increase in other components of the complex, PetA and PetB. Certain embodiments of the present invention may also result in a co-committant increase in the PSI type I chlorophyll a/b-binding protein (Lhcal) and the core protein of PSI (PsaA) and PsbA, PsbD of the PS II reaction centre and the ATP synthase delta subunit (AtpD). The combined increase of the cyt b6f complex and other identified proteins results in a substantial and significant impact on photosynthesis and biomass of Arabidopsis grown under standard growth room conditions.

[0229] Chlorophyll fluorescence imaging used to analyse plants at 14 days post-planting demonstrated that the positive effect of the manipulation on the cyt b6f complex is evident at an early stage of development. Interestingly, lines 11, which showed the largest overall increases in photosynthetic efficiency (F.sub.a′/F.sub.m′ and A.sub.max) also showed the largest increase in leaf area and biomass when compared to WT.

[0230] Conclusion

[0231] As demonstrated herein, over-expression of RieskeFeS protein, a key component of the cytobrome b6f complex, resulted in a co-commitant increase in the protein levels of several other components of the complex as well as other proteins involved electron transport and plant growth.

[0232] Throughout the description and claims of this specification, the words “comprise” and “contain” and variations of them mean “including but not limited to” and they are not intended to (and do not) exclude other moieties, additives, components, integers or steps. Throughout the description and claims of this specification, the singular encompasses the plural unless the context otherwise requires. In particular, where the indefinite article is used, the specification is to be understood as contemplating plurality as well as singularity, unless the context requires otherwise.

[0233] Features, integers, characteristics or groups described in conjunction with a particular aspect, embodiment or example of the invention are to be understood to be applicable to any other aspect, embodiment or example described herein unless incompatible therewith. All of the features disclosed in this specification (including any accompanying claims, abstract and drawings), and/or all of the steps of any method or process so disclosed, may be combined in any combination, except combinations where at least some of the features and/or steps are mutually exclusive. The invention is not restricted to any details of any foregoing embodiments. The invention extends to any novel one, or novel combination, of the features disclosed in this specification (including any accompanying claims, abstract and drawings), or to any novel one, or any novel combination, of the steps of any method or process so disclosed.

[0234] The reader's attention is directed to all papers and documents which are filed concurrently with or previous to this specification in connection with this application and which are open to public inspection with this specification, and the contents of all such papers and documents are incorporated herein by reference.

REFERENCES

[0235] Anderson, J. M.(1992). Cytochrome b6f complex: dynamic molecular organization, function and acclimation. Photosynth. Res. 34, 341-357.doi:10.1007/BF00029810

[0236] Anderson, J. M., Price, G. D., Chow, W. S., Hope, A. B., and Badger, M. R. (1997). Reduced levels of cytochrome bf complex in transgenic tobacco leads to marked photochemical reduction of the plastoquinone pool, without significant change in acclimation to irradiance. Photosynth. Res. 53, 215-227.doi: 10.1023/A:1005856615915

[0237] Baker N R (2008). Chlorophyll fluorescence: a probe of photosynthesis in vivo. 2008. Annual Review of Plant Biology 59, 89-113.

[0238] Baker N R, Oxborough K, Lawson T, Morison J I (2001) High resolution imaging of photosynthetic activities of tissues, cells and chloroplasts in leaves. Journal of Experimental Botany 52: 615-621

[0239] Baker N R, Rosenqvist E (2004) Applications of chlorophyll fluorescence can improve crop production strategies: an examination of future possibilities. Journal of Experimental Botany 55, 1607-1621.

[0240] Barbagallo R P, Oxborough K, Pallett K E, Baker N R (2003) Rapid, non-invasive screening for perturbations of metabolism and plant growth using chlorophyll fluorescence imaging. Plant Physiology 132, 485-493.

[0241] Bernacchi C. J., Singsaas E. L., Pimentel C., Portis Jr A. R. & Long S. P. (2001) Improved temperature response functions for models of Rubisco-limited photosynthesis. Plant, Cell and Environment 24, 253-260.

[0242] Clough S J, Bent A F. 1998. Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant Journal 16, 735-743.

[0243] Farquhar G D, von Caemmerer S, Berry J A. 1980. A biochemical model of photosynthetic CO.sub.2 assimilation in leaves of C3 species. Planta 149, 78-90.

[0244] Fischer R A, Edmeades G O. 2010. Breading and crop Yield Progress. Crop Science Society of America 677 S. Segoe Rd., Madison, Wis. 53711 USA 50, S85-S98.

[0245] Harrison E P, Willingham N M, Lloyd J C, Raines C A. 1998. Reduced sedoheptulose-1,7-bisphosphatase levels in transgenic tobacco lead to decreased photosynthetic capacity and altered carbohydrate accumulation. Planta 204 27-36.

[0246] Haehnel, W.(1984).Photosynthetic electron transport in higher plants. Ann. Rev. PlantPhysiol. 35, 659-693.doi:10.1146/annurev.pp.35.060184.003303

[0247] Hope, A. B.(2000).Electron transfer amongst cytochrome f, plastocyanin, and photosystem I:kinetics and mechanisms. Biochim. Biophys. Acta 1456, 5-26.doi: 10.1016/S0005-2728(99)00101-2

[0248] Hu X, Tanaka A, Tanaka R. (2013). Simple extraction methods that prevent the artifactual conversion of chlorophyll to chlorophyllide during pigment isolation from leaf samples. Plant Methods. 9: 19

[0249] Inskeep W P, Bloom P R. 1985. Extinction coefficients of chlorophyll a and b in n,n-dimethylformamide and 80% acetone. Plant Physiol 1985, 77:483-485

[0250] Kirchhoff, H., Horstmann, S., and Weis, E. (2000). Control of photosynthetic elec tron transport by PQ diffusion microdomains in thylakoids of higher plants. Biochim. Biophys. Acta 1459, 148-168.doi:10.1016/S0005-2728(00)00143-2

[0251] Lefebvre S, Lawson T, Zakhleniuk O V, Lloyd J C, Raines C A. 2005. Increased sedoheptulose-1,7-bisphosphatase activity in transgenic tobacco plants stimulates photosynthesis and growth from an early stage in development. Plant Physiol 138: 451-460

[0252] Long S P, Zhu X G, Naidu S L, Ort D R. 2006. Can improvement in photosynthesis increase crop yields? Plant, Cell & Environment 29, 315-330.

[0253] Lopez-Juez E., Jarvis R. P., Takeuchi A., Page A. M., & Chory J. (1998) New Arabidopsis cue mutants suggest a close connection between plastid-and phytochrome regulation of nuclear gene expression. Plant Physiol 118, 803-815.

[0254] McMurtrie R. E. & Wang Y. P. (1993) Mathmatical models of the photosynthetic response of tree stands to rising CO.sub.2 concentrations and temperature Plant, Cell and Environment 16, 1-13.

[0255] Murchie E H, Lawson T. 2013 Chlorophyll fluorescence analysis: guide to good practice and understanding some new applications. Journal of Experimental Botany. 64, 3983-3998.

[0256] Nakagawa T, Kurose T, Hino T, Tanaka K, Kawamukai M, Niwa Y, Toyooka K, Matsuoka K, Jinbo T, Kimura T. (2007). Development of series of gateway binary vectors, pGWBs, for realizing efficient construction of fusion genes for plant transformation. J. Biosci. Bioeng. 104 (1), 34-41.

[0257] Oxborough K, Baker N R. 1997. An instrument capable of imaging chlorophyll a Fluorescence from intact leaves at very low irradiance and at cellular and subcellular levels. Plant Cell and Environment 20, 1473-1483.

[0258] Oxborough K. & Baker N. R. (1997b). Resolving chlorophyll a fluorescence images of photosynthetic efficiency into photochemical and nonphotochemical components—calculation of qP and Fv/Fm without measuring Fo. Photosynthesis. Research. 54,135-142.

[0259] Parry M A J, Reynolds M, Salvucci M E, Raines C, Andralojc P J, Zhu X G, Price G D, Condon A G, Furbank R T. 2011. Raising yield potential of wheat. II. Increasing photosynthetic capacity and efficiency. Journal of Experimental Botany 62, 453-467.

[0260] Price, G. D., von Caemmerer, S., Evans, J. R., Siebke, K., Anderson, J. M., and Badger, M. R. (1998). Photosynthesis is strongly reduced by antisense suppression of chloroplastic cytochrome bf complex in transgenic tobacco.Aust. J. Plant Physiol. 25, 445-452.doi:10.1071/PP97164

[0261] Price, G. D., Yu, J. W., vonCaemmerer, S., Evans, J. R., Chow, W. S., Anderson, J. M., et al. (1995). Chloroplast cytochromeb6/f and ATP synthase complexes in tobacco:transformation with antisense RNA against nuclear-encoded transcripts for the RieskeFeS and ATP polypeptides. Aust. J. Plant Physiol. 22, 285-297.doi: 10.1071/PP9950285

[0262] Raines C A. 2011. Increasing photosynthetic carbon assimilation in C3 plants to improve crop yield: current and future strategies. Plant Physiology 155, 36-42.

[0263] Sharkey T D, Bernacchi C J, Farquhar G D, Singsaas E L. 2007. Fitting photosynthetic carbon dioxide response curves for C-3 leaves. Plant, Cell & Environment 30, 1035-1040

[0264] Simkin A J, McAusland L, Headland L R, Lawson T, Raines C A (2015) Multigene manipulation of photosynthetic carbon assimilation increases CO2 fixation and biomass yield. Journal of Experimental Botany. 66(13):4075-4090.

[0265] Stitt M, Bulpin P V, ap Rees T. 1978. Pathway of starch breakdown in photosynthetic tissues of Pisum sativum. Biochimica et Biophysica Acta 544, 200-214.

[0266] Yamori, W., Takahashi, S., Makino, A., Price, G. D., Badger, M. R., andvonCaem merer, S. (2011). The roles of ATP synthase and the cytochromeb6/f complex in limiting chloroplast electron transport and determining photosynthetic capacity. Plant Physiology 155, 956-962. doi:10.1104/pp.110.168435

[0267] Zapata M, Rodriguez F, Garrido J L. 2000. Separation of chlorophylls and carotenoids from marine phytoplankton, a new HPLC method using a reversed phase C8 column and phridine-containing mobile phases. Mar Ecol Prog Ser, 195:29-45.

[0268] Zhu X G, Long S P, Ort D R. 2010. Improving photosynthetic efficiency for greater yield. Annual Review of Plant Biology 61, 235-226.