SCREENING ASSAY FOR GIBBERELLIN INHIBITORS OR ANALOGS

Abstract

The present invention relates to methods of identifying substances that modulate GA action through targeting its receptor or acting as a GA functional analog, sensor peptides especially designed for that methods as well as a strain of the species Saccharomyces cerevisiae expressing such a sensor peptide.

Claims

1. Method of identifying substances that modulate GA action through targeting its receptor or acting as a GA functional analog comprising the following steps: a) providing a candidate substance to be tested, b) providing a sensor peptide, c) bringing the candidate substance into contact with the sensor peptide, d) providing conditions sufficient to allow the candidate substance to bind to the sensor peptide, e) determining whether the candidate substance binds to the sensor peptide, wherein the sensor peptide encompasses at its N-terminus a first inactive fragment of a bioluminescent reporter or of a fluorescent reporter followed by a first linker, a GA receptor of the GID1 family, a second linker and at its C-terminus a second inactive fragment of the bioluminescent reporter or of the fluorescent reporter and wherein the first and the second inactive fragment of the bioluminescent reporter or of the fluorescent reporter are together suitable to restore functionality of the bioluminescent reporter or of the fluorescent reporter.

2. Method according to claim 1, wherein the sensor peptide encompasses at its N-terminus a sequence that is at least 90% identical with amino acids 397-550 of the firefly luciferase according to SEQ ID No. 1 followed by a first linker, a GA receptor of the GID1 family, a second linker and at its C-terminus a sequence that is at least 90% identical with amino acids 1-416 of the firefly luciferase according to SEQ ID No. 1

3. Method according to claim 1, wherein the sensor peptide has at least 80% identity to SEQ ID No. 2 or to SEQ ID No. 13.

4. Method according to claim 1, wherein the method is an in vitro assay.

5. Method according to claim 4, wherein step c) comprises forming a reaction mixture comprising the candidate substance and the sensor peptide.

6. Method according to claim 5, wherein step d) comprises incubating the reaction mixture under conditions sufficient to allow the candidate substance to bind the sensor peptide, in case the candidate substance is able to bind the sensor peptide.

7. Method according to claim 4, wherein step c) comprises producing a cell extract from a host cell able to produce the sensor peptide.

8. Method according to claim 7, wherein step d) comprises incubating the cell extract with the candidate substance under conditions sufficient to allow the candidate substance to bind the sensor peptide, in case the candidate substance is able to bind the sensor peptide.

9. Method according to claim 1, wherein the method is an in vivo assay.

10. Method according to claim 9, wherein step c) comprises transforming or transfecting a host cell or an organism with a nucleic acid coding for the sensor peptide.

11. Method according to claim 10, wherein step c) further comprises transforming or transfecting a host cell or an organism with a nucleic acid coding for the candidate substance or incubating the host cell or an organism with the candidate substance.

12. Method according to claim 1, comprising the following steps: a) providing a candidate substance to be tested, b) providing a sensor peptide, b) providing a GA or a GA derivative, c) bringing the candidate substance into contact with the sensor peptide and the GA or the GA derivative, d) providing conditions sufficient to allow the candidate substance to bind to the sensor peptide, the GA or to the GA derivative, e) determining whether the candidate substance inhibits the GA or the GA derivative binding to a GA receptor, wherein the sensor is a protein encompassing at its N-terminus a sequence that is at least 90% identical with the amino acids 397-550 of the firefly luciferase according to SEQ ID No. 1 followed by a first linker, a GA receptor of the GID1 family, a second linker and at its C-terminus a sequence that is at least 90% identical with amino acids 1-416 of the firefly luciferase according to SEQ ID No. 1 and wherein the luciferase activity of the sensor is indicative for the inhibition of the GA or the GA derivative binding by the test substance.

13. A sensor peptide having at least 80% identity with SEQ ID No. 2 or with SEQ ID No. 13.

14. Nucleic acid molecule that encodes a sensor peptide having at least 80% identity with SEQ ID No. 2 or SEQ ID No. 13.

15. Strain AH109 of the species Saccharomyces cerevisiae expressing the GID1B based sensor peptide according to SEQ ID No. 2 deposited at the German Collection of Microorganisms and Cell Cultures with deposit number 28095.

Description

DESCRIPTION OF THE FIGURES

[0187] FIG. 1: shows a diagram of the GA sensor principle and its design: Binding of GA or an analog thereof to GID1 triggers a conformational change which results in the reconstitution of the luciferase enzymatic activity providing a visible and quantitative readout of the presence of binding and activity of GA or its analog. N-t-LUC and C-t-Luc stand for the amino- and carboxy-terminal domains of the firefly luciferase protein. -t means terminal.

[0188] FIG. 2: shows results of the assay performed in Saccharomyces cerevisiae using an Arabidopsis thaliana GID1B based sensor. [0189] Shown is the luciferase intensity over time as a measure of binding with increasing concentrations of 4 different GA isoforms (GA.sub.1, GA.sub.3, GA.sub.4 and the biologically inactive GA.sub.4-methyl ester (GA.sub.4Mees)) to the sensor peptide

[0190] FIG. 3: shows a comparison of the sensitivity of Arabidopsis thaliana GID1B (panels A and B) and Arabidopsis thaliana GID1C (panels C and D) based sensors in S. cerevisiae. Thereby GA.sub.4Mees means GA.sub.4-methyl ester.

[0191] FIG. 4: shows activity of an inventive sensor peptide (based on Arabidopsis thaliana GID1C) in plants with impaired GA production (ga1-3 mutants). The image was taken 15 minutes after spraying the plants with either mock or GA.sub.3 containing solution.

[0192] FIG. 5: shows that activity of an inventive sensor peptide (based on GID1C) in plants (background line) matches the expression patterns of two of the main GA biosynthetic enzymes.

[0193] FIG. 6: shows results of an inventive assay performed in Saccharomyces cerevisiae using an Arabidopsis thaliana GID1B based sensor and GID1C based sensor. [0194] Shown is the luciferase intensity over time as a measure of binding with increasing concentrations of 4 different GA isoforms (GA.sub.1, GA.sub.3, GA.sub.4 and the biologically inactive GA.sub.4-methyl ester (GA.sub.4Me)) to the GID1B based sensor peptide with (B) or without (A) co-expression of a DELLA protein (GAI), or to the GID1C based sensor peptide with (D) or without (C) co-expression of a DELLA protein (GAI).

[0195] FIG. 7: shows a comparison of sensor peptides based on Arabidopsis thaliana GID1B flanked with overlapping (left row on each plate) and non-overlapping (right row on each plate) fragments of firefly luciferase. 4 yeast colonies were each incubated in presence of Mock (left plate) or 100 M GA.sub.3 (right plate).

[0196] FIG. 8: shows a comparison of the sensitivity of Arabidopsis thaliana GID1B (panel A) and Arabidopsis thaliana GID1B.5 (having mutation V53A; panel B) based sensors in S. cerevisiae.

EXAMPLES

Example 1

Generation of Plasmids Coding for the Sensor Peptides

[0197] Arabidopsis thaliana GID1B and GID1C cDNA sequences flanked by two partially overlapping fragments of the firefly luciferase coding sequence and separated by two linkers encoding seven glycines each were combined into a single expression vector. To obtain GID1B and GID1C sequences, total RNA was isolated from inflorescences of 30 day old Arabidopsis thaliana plants. cDNA synthesis was carried out using 1 g RNA that had been treated with RNAse-free DNAse I (Fermentas) following the manufacturers instructions. The GID1B (At3g63010) coding sequence was amplified by polymerase chain reaction (PCR) using that cDNA as template and primers G-16509 and G-16511 (see Table 1), GID1C (At5g27320) coding sequence was amplified by PCR using that cDNA as template and primers G-16512 and G-16514 (see Table 1), Val 53 was replaced by Ala in GID1B sequence following a two-steps point mutation strategy. To that end, two fragments were generated by PCR using the primer pair G-16509 and G-36467 and the primer pair G-36466 and G-16511 (see table 1). Both overlapping PCR products were combined in a single PCR reaction and amplified using the primers G-16509 and G-16511 to originate a GID1B-based construct named GID1B.5. The obtained PCR products were used by the inventors as template for a second PCR with the primers G-25723 and G-25724 (GID1b and GID1b.5) and G-25728 and G-25729 (GID1c) to add part of the linker sequences. Overlapping parts of firefly luciferase coding sequences, encoding the N- and C-terminal domains were amplified by PCR from a firefly luciferase coding sequence containing plasmid with the primers G-25721, G-25722 (for GID1b and GlID1b.5 containing constructs) or G-25727 (for GID1c containing constructs), G-25725 (for GID1b and GID1b.5 containing constructs) or G-25730 (for GID1c containing constructs), and G-25750 (see table 1). In order to join the three parts of the sensors (C-LUC, GID1 and N-LUC), 0.5 l of each of the previous PCR reactions were mixed and another PCR with primers G-25721 and G-25750 (see table 1) was performed. In order to generate firefly non-overlapping N- and C-terminal domains the inventors followed the same procedure described before using the primer G-25726 instead of G-25750 (see table 1). The PCR products were isolated and the ends were A tailed by incubating in a thermocycler 7.8 l of the PCR product with 0.2 l of Taq polymerase in the presence of 1 L of dATP and 1 L of Taq polymerase buffer for 30 minutes at 72 C. The DNA fragments were then introduced into the PCR8/GW/TOPO cloning vector (Invitrogen, Life Technologies) using the TOPO cloning method by overnight room temperature incubation, to generate the plasmids IR202 (GID1B sensor), IR237 (GID1B.5 sensor), IR240 (GID1B.5 sensor with non overlapping firefly fragments) and IR213 (GID1C sensor).

[0198] Plasmids IR202, IR237 and IR213 were digested with Nhel and Miul restriction enzymes and the C-LUC-GID1-N-LUC fragments were introduced by Gateway LR Clonase mediated recombination into two destination vectors: the yeast pDEST22 plasmid (Invitrogen, Life Technologies) and the plant binary plasmid pFK210, generating the plasmids IR206 (GID1BLUC-pDest22), IR238 (GID1B.5LUC-pDEST22), IR241 (GID1B.5LUCnon-overlapping-pDEST22) and 214 (GID1CLUC-pDest22) or IR208 (35S::GID1BLUC), IR239 (35S::GID1B.5LUC) and 216 (353::GID1CLUC).

TABLE-US-00001 TABLE1 Oligonuclectideprimersusedforgenerationofrecombinantplasmids PrimerID Purpose Sequence G-16509 GID1bcDNAPCR ATGGCTGGTGGTAACGAAGTC (SEQIDNo.4) amplification G-16511 GID1bcDNAPCR CTAAGGAGTAAGAAGCACAG (SEQIDNo.5) amplification G-16512 GID1ccDNAPCR ATGGCTGGAAGTGAAGAAGTTAAT (SEQIDNo.14) amplification CT G-16514 GID1ccDNAPCR TCATTGGCATTCTGCGTTTAC (SEQIDNo.15) amplification G-25721 C-terminaldomainof Atgtccggttatgtaaacaatcc (SEQIDNo.6) fireflyluciferasePCR amplification G-25722 C-terminaldomainof GACTTCGTTACCACCAGCtcctccgcca (SEQIDNo.7) fireflyluciferasewith cccccgccacccacggcgatctttc linkerPCRamplification forGID1b G-25723 Additionoflinkerto gcggaggaGCTGGTGGTAACGAAGTC (SEQIDNo.8) GID1bcDNAduring PCRamplification G-25724 Additionoflinkerto gcctccaccAGGAGTAAGGCACAG (SEQIDNo.9) GID1bcDNAduring PCRamplification G-25725 AdditionoflinkertoN- CTGTGCTTCTTACTCCTggtggaggcgg (SEQIDNo.10) terminaldomainof aggcggaggcgaagacgccaaaaacataaag fireflyluciferaseduring PCRamplificationfor GID1b G-25727 AdditionoflinkertoC- GATTAACTTCTTCACTTCCAGCtcctc (SEQIDNo.16) terminaldomainoffirefly cgccacccccgccacccacggcgatctttc luciferaseduringPCR amplificationforGID1c G-25728 Additionoflinkerto ggcggaggaGCTGGAAGTGAAGAAGT (SEQIDNo.17) GID1ccDNA TAATC G-25729 Additionoflinkerto gcctccaccTTGGCATTCTGCGTTTAC (SEQIDNo.18) GID1ccDNAduring PCRamplification G-25730 AdditionoflinkertoN- GTAAACGCAGAATGCCAAggtggaggc (SEQIDNo.19) terminaldomainoffirefly ggaggcggaggcgaagacgccaaaaac luciferaseduringPCR amplificationforGID1c G-25750 N-terminaldomainof Ttatccatcttgtcaatc (SEQIDNo.11) fireflyluciferaseduring PCRamplification G-25726 PCRamplificationofN- TtaaAtcataggaccctcac (SEQIDNo.20) terminaldomainoffirefly luciferasenon-overlapping G-36466 IntroductionofV53A CCGTAAAgccCCCGCCAACTC (SEQIDNo.21) mutationintoGID1bby PCRamplification G-36467 IntroductionofV53A GGCGGGgcTTTACGGTAAGGAA (SEQIDNo.22) mutationintoGID1bby C PCRamplification G-26500 DELLAproteinGAI AAGAGAGATCATCATCATC (SEQIDNo.23) genePCRamplification, withoutATG G-23313 DELLAproteinGAI ctaattggtggagagtttccaag (SEQIDNo.24) genePCRamplification

Example 2

Method of the Invention Carried Out in Yeast

[0199] In order to assess and quantify the sensitivity of the inventive sensor peptide to increasing concentrations of different GA isoforms, the inventors introduced different sensor peptides in a heterologous system devoid of GA, namely baker yeast cells (Saccharomyces cerevisiae). The sensor peptides according to SEQ ID No. 2 and to SEQ ID No. 26, based on Arabidopsis thaliana GID1B as receptor and the sensor peptide according to SEQ ID No. 13, based on Arabidopsis thaliana GID1C as receptor were tested. Yeast cells bearing the sensor peptides according to the invention were assayed in solid media in the presence/absence of two different concentrations of two GA isoforms with different biological activities, GA.sub.3 and GA.sub.4 as described below in all cases the inventors found a correlation between luciferase intensity and the concentration and activity of the different concentrations and hormone forms (data not shown). The inventors then performed a quantitative liquid assay on a larger scale. This time the inventors extended the study to increasing concentrations of other GA isoforms with different biological activities. Among these GA isoforms, GA.sub.4 has been described as the most biologically active in in planta assay, while GA.sub.3 and GA.sub.1 showed less activity and GA.sub.4-methylester was barely active. GA sensors based on Arabidopsis thaliana GID1B as well as based on Arabidopsis thaliana GID1C were able to differentially report the presence of different isoforms and concentrations according to their predicted biological activity (see FIGS. 2 and 3). Nevertheless, the Arabidopsis thaliana GID1B based vector performed in a more sensitive manner in these assays (FIG. 3). Furthermore, the sensor according to SEQ ID No. 26 having the mutation V53A keeps also ability to report presence of bioactive GAs in yeast assays (see FIG. 8).

[0200] The plasmids IR206 and IR214 were introduced into the Saccharomyces cerevisiae strain AH109 (Clontech). The inventors deposited the IR206 containing yeast strain at the DSMZ (reference P37913, entry number 28095). For solid assays, 5 colonies were diluted in 100 L of distilled water and 10 L were spotted onto two separate Nylon membranes. The membranes were incubated in a Petri dish containing solid selective media (YNB, MPBlo, supplemented with CSM Trp.sup., Bio 101) and grown at 30 C. for 3 days. Membranes were subsequently transferred to a new dish of selective media supplemented with 1.25 mM of firefly substrate for 4 hours in the dark and at room temperature. Later on, membranes were transferred to plates with selective media and firefly substrate in the presence or absence of GA.sub.3 100 M. Luciferase activity was recorded using default time-laps settings in a CCD camera device (Hamamatsu).

[0201] Two representative colonies were selected and plated onto Nylon membranes as described before. After 3 days at 30 C. the membranes were incubated in selective media containing luciferase substrate for 4 hours in dark at room temperature. Each replicate was subsequently transferred to plates containing 10 and 100 M of two forms of active GAs, GA.sub.3 and GA.sub.4. Luciferase activity was recorded as indicated before. For liquid assays, the inventors inoculated one representative colony for each version of the sensor in 5 ml of selective media (YNB, MPBlo, supplemented with CSM Trp.sup., Bio 101) containing luciferase substrate and grown under shaking at 28 C. for 18 hours. The yeast culture was adjusted to a density of OD.sub.500=0.6 and 50 L were placed in each well of a 96 well microtiter plate together with 50 L of selective media containing luciferase substrate and supplemented with increasing concentrations of 4 different GA isoforms (GA.sub.1, GA.sub.3, GA.sub.4 and GA.sub.4-methyl ester). Plates were incubated for 16 hours at 28 C. in a cabinet and luciferase activity was recorded during the entire period of the experiment using a Topcount device (Perkin Elmer).

Example 3

Method of the Invention Carried Out as In Planta Assay

[0202] To validate in planta the results obtained in yeast, the inventors introduced the GA sensors under the control of the constitutive viral promoter 35S into Arabidopsis thaliana plants. The constructs IR208 and IR216 were independently introduced using the floral dip method of Agrobacterium-mediated transformation into the Arabidopsis thaliana Ler-1 (Landsberg erecta) wild-type strain and its isogenic ga1-3 mutant strain (containing a deletion in the gene for the enzyme that catalyzes an early step in the synthesis of GA: Sun et al., The Plant Cell February 1992 vol. 4 No. 2 119-128). Plants were grown in soil under Basta selection and in short days (8 h light/16 h dark).

[0203] GA3ox1-GUS and GA3ox2-GUS Arabidopsis reporter lines were described in Hua et al., The Plant Cell February 2008 vol. 20 No. 2 320-336. GA3 oxidase catalyzes consecutive reactions that convert GA intermediates to the bioactive forms. Because GA3 oxidase catalyzes the last step of the synthesis of bioactive GA, the temporal and spatial expression patterns of the encoding GA3ox genes are likely to reflect when and where bioactive GA isoforms are being made in plants.

[0204] Transformed ga1-3 plants containing the sensor were grown and sprayed either with a negative control solution (mock) or with a 100 M GA.sub.3 solution. The inventors found that upon luciferase substrate application, only the GA-treated plants showed bioluminescence and reported the presence of the hormone (FIG. 4). In this case, the Arabidopsis thaliana GID1C based sensor produced a faster and stronger signal than the Arabidopsis thaliana GID1B based sensor. To ascertain whether the reporter system according to the invention could quantitatively report the presence of endogenous bioactive GA isoforms, the inventors grew the Arabidopsis thaliana Ler-1 wild-type plants containing the Arabidopsis thaliana GID1C based sensor along with Arabidopsis thaliana GA3ox1-GUS and GA3ox2-GUS reporter lines. The GA sensor was active in a pattern that indicated the presence of active forms of GA in emerging leaves and at the base and vasculature of older leaves. Noticeably, intensity and location of the signal correlated with the activity of both GA biosynthetic enzymes (see FIG. 5). It can be concluded that the Arabidopsis thaliana GID1B based sensor is more suitable for in vitro assays and microorganism based assays, while the Arabidopsis thaliana GID1C based sensor is more suitable for in planta experiments.

[0205] For luciferase imaging, Arabidopsis thaliana plants expressing GA sensors (Ler-1 wild type and ga1-3 mutant) were sprayed 16 hours before imaging with a solution of luciferase substrate supplemented with 0.01% Triton X-100. After 16 hours and prior to imaging another spray of that solution was applied. Luminescence was recorded using a COD camera device (Hamamatsu). GUS (-glucuronidase) staining in GA3ox1-GUS and GA3ox2-GUS reporter lines was performed as described in M. A. Blzquez et al.; LEAFY expression and flower initiation in Arabidopsis. Development 124, 3835 (October, 1997).

Example 4

Impact of the Addition of the DELLA Protein GAI

[0206] In order to assess the sensitivity and specificity of the inventive sensor peptide to increasing concentrations of different GA isoforms in the presence or absence of the DELLA protein GAI, yeast two-hybrid (Y2H) assays were carried out.

[0207] First, the coding sequence of the DELLA protein GAI (At1g14920) was cloned into the yeast plasmid pDEST32 (Invitrogen) yielding the construct IR236. Subsequently, yeast cells were transformed with the plasmids IR206 or IR214 in combination with the empty pDEST32 vector or IR236. Following the same approach than described before in Example 3, we assayed 4 GA isoforms, the same four than in the former assay. The experimental setting was the same than in Example 3 with the difference that the selective media used was deficient in Trp and Leu (YNB, MPBlo, supplemented with CSM Trp.sup.Leu.sup., Bio 101) to select for the presence of both plasmids within the yeast cells. Selective media used in Y2H assays was supplemented with Adenine hemisulfate.

[0208] As can be seen in FIG. 6, the presence of GAI resulted in higher GA sensitivity of the reporter, which translated into higher levels of luciferase activity both for GID1B and GID1C based sensors. Nevertheless, GAI expression also led to more background, since the presence of non-biological GA.sub.4-methylester triggered luciferase signal (FIG. 6D). Thus, the result shows that GID1B is able to report differentially biological forms of GA without the presence of any partner protein. In case of GID1C the presence of an additional binding partner sensitizes the assay.

Example 5

Active Reconstitution of GID1B Based Sensor in Dependence of Overlapping Fragments

[0209] In order to assess the impact of the presence of overlapping parts of firefly luciferase on the GID1B based sensor (GID1B.5) at the split point, a GID1B based sensor with overlapping firefly luciferase fragments (plasmid IR235) was compared in a Y2H assay to a GID1B based sensor without overlapping firefly luciferase fragments (plasmid IR241).

[0210] Four representative colonies were selected and plated onto Nylon membranes as described before. After 3 days at 30 C. the membranes were incubated in selective media containing luciferase substrate for 4 hours in dark at room temperature. Each replicate was subsequently transferred to plates containing selective media supplemented with luciferase substrate. After 4 hours of incubation to minimize signal noise, both membranes were transferred to fresh plates with selective media, luciferase substrate and either mock solution (100% ethanol) or GA.sub.3 at a final concentration of 100 M. Luciferase activity was recorded as indicated before.

[0211] As it can be seen in FIG. 7, active reconstitution and thus a lumienscence signal was only reported when the GID1B based sensor included overlapping firefly fragments. Furthermore, luciferase signal is clearly higher when yeasts are incubated in presence of the bioactive GA.sub.3.