PEGYLATED TISSUE KALLIKREIN, AND PREPARATION METHOD THEREFOR AND USES THEREOF

Abstract

The present invention relates to polyethylene glycol (PEG) modified protein drugs, and a PEGylated tissue kallikrein, a preparation method and use thereof are disclosed. The tissue kallikrein has a sequence as shown in SEQ ID No. 1 or SEQ ID No. 2, and the tissue kallikrein may be natural or recombinant. The PEG has a molecular weight of 20 to 40 kDa, and is conjugated to the N-terminal primary amino of the tissue kallikrein. In addition to the advantages of significantly extended half-life, significantly reduced immunogenicity and stable and uniform structure, the biological activity of the PEGylated KLK1 provided in the present invention is improved to a higher extent, which is more significant in the treatment of cerebral apoplexy and diabetic nephropathy in particular.

Claims

1. A PEGylated tissue kallikrein, wherein the polyethylene glycol has a molecular weight of 20 to 40 kDa, and is conjugated to the-N-terminal primary amino of the tissue kallikrein.

2. The PEGylated tissue kallikrein according to claim 1, wherein the polyethylene glycol is conjugated to the N-terminal primary amino of the tissue kallikrein through a proplonaideiiyde group.

3. The PEGylated tissue kallikrein according to claim 1, wherein the polyethylene glycol molecule is linear or branched.

4. The PEGylated tissue kallikrein according to claim 3, wherein the polyethylene glycol is a branched polyethylene glycol derivative, wherein the active group is propionaldehyde, butyraldehyde, acetaldehyde or valeraldehyde.

5. The PEGylated tissue kallikrein according to claim 1, wherein the PEGylated tissue kallikrein has a general structural formula shown below: ##STR00003## wherein R is H or C1-C4 alkyl; n is an integer from 10 to 1150, p is an integer from 1to 3; AA is an N-terminal L-amino acid residue, and m is an integer from 0 to 5.

6. The PEGylated tissue kallikrein according to claim 5, wherein the alkyl is methyl, n is an integer between 57 and 455, p is 2, m is 0, and the KLK1has a sequence as shown in SEQ ID No. 1 or SEQ ID No. 2.

7. The PEGylated tissue kallikrein according to claim 6, wherein n is an integer between 227 and 455.

8. A method for preparing a PEGylated tissue kallikrein, comprising: step 1: formulating a 0.1-30 mg/ml, tissue kallikrein solution with a 10-50 mM sodium acetate buffer pH 4-6; step 2: reacting for 0.1 to 24 h at 4 to 37 C. at a molar ratio of tissue kallikrein ; PEG:reductant=1:(2-25):(20-1000); and step 3; purifying by chromatography after reaction, to finally obtain a mono-PEGylated tissue kallikrein; wherein, the reductant is preferably sodium cyanoborohydride.

9. A method comprising treating cerebral apoplexy or diabetic nephropathy in a patient in need thereof by administering a drug comprising PEGylated tissue kallikrein according to claim 1.

10. A drug for treating cerebral apoplexy or diabetic nephropathy, comprising the PEGylated tissue kallikrein according to claim 1, or a pharmaceutically acceptable salt thereof or a complex thereof as the active ingredient.

Description

DESCRIPTION OF THE DRAWINGS

[0029] FIG. 1 shows purity analysis of different PEG-KLK1 conjugates by HPLC-SEC.

[0030] As can be seen from the results of analysis by high performance gel filtration, the conjugate prepared has no considerable impurities, and the purities are all higher than 98%, thus meeting the standards in Chinese Pharmacopoeia.

[0031] FIG. 2 shows in vitro biological activity of different PEG-KLK1 conjugates.

[0032] As can be known from the in vitro activity detection results, the conjugates 1 to 4retain 81%, 83%, 90%, and 86% of the activity of the original protein respectively, and thus it can be seen that among the PEGylated products, the conjugate 3 has the best biological activity, and the conjugate 1 has the worst activity.

[0033] FIG. 3 shows the thermostability of different PEG-KLK1 conjugates.

[0034] It can be known that the activity of the unmodified kallikrein is substantially lost after standing for 10 min at 65 C., and the conjugates 1 and 3 both have increased thermostability at a high temperature, where the conjugate 3 still has a certain activity-after standing for 20 min at 65 C., indicating that the kallikrein has increased thermostability after PEG modification, and the thermostability of the conjugate 3 is significantly better than that of the conjugate 1.

[0035] FIG. 4a shows scores of neurologic deficit symptoms in experimental animals from different groups. It can be known from the experimental results that the positive control 1 group (urinary kallikrein), conjugate 2 group and conjugate 3 group all have significant differences from the model group, and the experimental animals in the conjugate 2 and 3 groups after administration have scores of neurologic deficit symptoms that are apparently higher than that of the positive control 1 group.

[0036] FIG. 4b shows areas of cerebral infarction in experimental animals from different groups. It can be known from the experimental results that the positive control 1 group (urinary kallikrein), the conjugate 2 group and the conjugate 3 group all have significant differences from the model group and the experimental animals in the conjugate 2 and 3groups after administration have an area of cerebral infarction that is lower than that of the positive control 1 group. It can be seen that all of the conjugate 4, the positive control 2 (tPA) and kallikrein have no apparent amelioration on the cerebral infarction status of the model animals; the conjugate 1 can slightly ameliorate the cerebral infarction status of the experimental animals; and the conjugates 2 and 3 have a better therapeutic effect on acute thrombotic cerebral infarction as compared with the positive control 1 (urinary kallikrein), the positive control 2 (tPA) and kallikrein.

[0037] FIGS. 4a and 4b compare the efficacy of different PEG-KLK1 conjugates in the treatment of cerebral apoplexy.

[0038] FIG. 5a shows variations in the urine volume of the experimental animals before and after administration. It can be known from the results that the original protein group and the conjugate 3 group have significantly reduced 24-h urine volume after administration as compared with the model group.

[0039] FIG. 5b shows variations in 24-h urine protein amount of the experimental animals before and after administration. It can be known from the results that, the original protein group and the conjugate 3 group have significantly reduced 24-h urine protein after administration, as compared with the model group, and the reduction in the conjugate 3 group is more significant.

[0040] FIG. 5c shows variations in 24-h urine creatinine amount of the experimental animals before and after administration. It can be known from the results that the original protein group and the conjugate 3 group have significantly reduced 24-h urine creatinine after administration, as compared with the model group, and the reduction in the conjugate 3 group is more significant.

[0041] FIG. 5d shows variations in 24-h urea nitrogen amount of the experimental animals before and after administration. It can be known from the results that the original protein group and the conjugate 3 group have significantly reduced 24-h urea nitrogen after administration, as compared with the model group, and the reduction in the conjugate 3 group is more significant. It can be seen that, both the kallikreinogen protein and PEG modified kallikrein conjugate can effectively ameliorate the renal injury caused by diabetic nephropathy of experimental animals. Also, it can be known from the fact that the dosing interval of the Pegylated kallikrein is 1-fold longer than that of the kallikreinogen protein that, the half-life in vivo of kallikrein after PEG modification is apparently extended, and the efficacy is significantly improved.

[0042] FIGS. 5a to 5d show the therapeutic effect of the PEG-KLK1 conjugate on diabetic nephropathy.

[0043] FIG. 6 shows immunogenicity of different PEG-KLK1 conjugates.

[0044] Experimental results show that after various PEG-KLK1 conjugates are injected into the mice, the antibody titers generated in experimental animals of the conjugate groups 2 and 3 are far lower than those in the experimental animals of the positive control 1 group (urinary kallikrein) and the non-PEGylated kallikrein group, indicating that the PEGylated conjugates 2 and 3 have a immunogenicity that is far lower than that of the positive control 1 (urinary kallikrein) and non-PEGylated kallikrein, and the conjugate 3has a relatively slightly lower immunogenicity for mice than the conjugate 2.

[0045] FIG. 7 shows variations in blood drug concentration in rats after intravenous administration with various PEG-KLK1 conjugates.

[0046] Pharmacokinetics of various PEG-KLK1 conjugates is detected by isotopic tracing. Experimental results show that the reduction in the blood drug concentration of the conjugate 3 is slow, the half-life is obviously extended, the AUG is greatly increased, and plasma clearance rate is considerably decreased, as compared with the positive control 1 group (urinary kallikrein) and kallikrein.

[0047] FIG. 8a compares far ultraviolet circular dichroism spectra of various PEG-KLK1 conjugates and the original protein.

[0048] FIG. 8b compares near ultraviolet circular dichroism spectra of various PEG-KLK1 conjugates and the original protein.

[0049] FIGS. 8b and 8b compares circular dichroism spectra of various PEG-KLK1 conjugates and the original protein. As can be seen from the circular dichroism spectra, KLK1 has essentially no change in the near and far ultraviolet circular dichroism spectra after PEG modification, indicating that no change occurs to the secondary and tertiary structure of the modified KLK1.

[0050] FIG. 9 compares peptide mapping by enzymolysis of the conjugate 3 and the original protein.

[0051] As can be seen from the peptide mapping by enzymolysis of the conjugate 3 and the original protein, the conjugate 3 is modified by PEG at the N terminus of the protein.

[0052] FIG. 10 identifies the expression of a recombinant hK1 protein in Pichia pastoris X-33 engineered bacterium.

[0053] In FIG. 10, lane 1 is a recombinant hK1 protein with a greater relative molecular weight, lane 2 is a recombinant hK1 protein with a lower relative molecular weight, and lane 3 is a prestained protein loading Marker with a molecular weight ranging from 10 to 250 KD. The physicochemical properties and biological activity of the two recombinant hK1 proteins with different molecular weights have no difference, except that the glycosylation modifications are different.

[0054] FIG. 11 shows protein electrophoretic analysis of PEGylated recombinant human kallikrein expressed in yeasts.

[0055] In FIG. 11, lane 1 is a prestained protein loading Marker with a molecular weight ranging from 10 to 250 KD, and lane 2 is a recombinant hK1 protein modified with Y-PALD-30K. As can be seen from the results of protein electrophoresis, the conjugate prepared has no apparent impurities, and has significantly increased molecular weight and higher purity as compared with the original protein.

[0056] FIG. 12 shows immunoblot of a culture supernatant of a recombinant hK1 protein stably expressed in CHOS cell line.

[0057] In FIG. 12, Lane 1 is a prestained protein loading Marker with a molecular weight ranging from 10 to 250 KD, and lane 2 is the culture supernatant on day 13 of CHO-S host cells producing the recombinant hK1 protein.

[0058] FIG. 13 shows analysis by HPLC of PEGylated recombinant human kallikrein expressed in CHO cells.

[0059] The purity of the prepared PEGylated products is analyzed by HPLC. As can be seen from the results from HPLC analysis, the conjugate prepared has a high purity of up to more than 98%.

DETAILED DESCRIPTION OF THE INVENTION

Definitions:

[0060] The following abbreviations are used herein:

[0061] PEG: polyethylene glycol;

[0062] Y-PALD-20K: branched PEG propionaldehyde comprising two straight chains of methoxy polyethylene glycol, with a molecular weight of 20 KDa, and a Y-shaped structure;

[0063] Y-PALD-30K: branched PEG propionaldehyde comprising two straight chains of methoxy polyethylene glycol, with a molecular weight of 30 KDa, and a Y-shaped structure;

[0064] Y-PALD-40K: branched PEG propionaldehyde comprising two straight chains of methoxy polyethylene glycols, with a molecular weight of 40 KDa, and a Y-shaped structure;

[0065] KLK1: tissue kallikrein extracted from porcine pancreas, and kallikrein extracted from human urine.

[0066] hK1: recombinant human kallikrein.

[0067] mPEG-SC5000: linear monomethoxy PEG, with a molecular weight of 5000, and an active group of succinimide carbonate.

[0068] The term conjugate as used herein refers to a mono-PEGylated product of KLK1.

[0069] Several mono-PEGylated products of KLK1 referred to as SC-PEG5000-KLK1, Y-PALD-20K-KLK1, Y-PALD-30K-KLK1, Y-PALD-40K-KLK1 herein may be collectively referred to as PEG-KLK1 or the conjugate.

[0070] Polyethylene glycol is a polymer of ethylene oxide and water, which may be branched or linear. Polyethylene glycol or PEG plus a figure suffix denotes its average molecular weight. For example, PEG-20000 refers to polyethylene glycol with a molecular weight of around 20000; alternatively, PEG may be omitted, for example, Y-PALD-20K denotes Y-shaped PEG propionaldehyde with a molecular weight of around 20000, and a structural formula shown as below:

##STR00002##

[0071] In the formula, R is H or C1-C4 alkyl, and preferably methyl; n is an integer from 10 to 1000, preferably an integer between 57 and 455, and more preferably an integer between 227 and 455; and p is an integer from 1 to 3, and preferably 2. Polyethylene glycol has advantageously a molecular weight ranging from about 20000 Da to about 40000 Da. More particularly, polyethylene glycol has a molecular weight selected from the group consisting of: 20000 Da, 30000 Da, and 40000 Da. In a particular embodiment, the molecular weight of polyethylene glycol is 30000 Da.

[0072] In the present invention, KLK1 may be derived, cloned or generated, from any sources, including animals, or by recombinant DNA technologies or a combination thereof. For example, KLK1 may be extracted from animal tissues or urine, including, but not limited to, porcine pancreas, and human urine. In a particular embodiment of the conjugate according to the present invention, KLK1 has at least about 60% sequence identity to the protein comprising the sequence of SEQ ID NO: 1 or SEQ ID NO: 2.

[0073] In a particular embodiment, the protein is a tissue-type KLK1 derived from porcine pancreas, which has a sequence as shown in SEQ ID NO: 1. In another embodiment, KLK1 is derived from recombinant humanized KLK1, which has a sequence as shown in SEQ ID NO: 2.

[0074] Fragments of the protein shown in SEQ ID NO: 1 or SEQ ID NO: 2 are also encompassed in the definition of the protein used in the conjugate according to the present invention. The fragments of the protein shown in SEQ ID NO: 1 or SEQ ID NO: 2 means that the polypeptide sequence may include less amino acids than SEQ ID NO: 1or SEQ ID NO: 2, but still includes adequate amino acids to impart activity of catalyzing the release of biological active peptide from the macromolecular precursor (kininogen).

[0075] It is well known in the art that the polypeptide may be modified by substituting, inserting, deleting and/or adding one or more amino acids while the enzymatic activity is maintained. For example, it is common to substitute one amino acid at a given position with a chemically equivalent, amino acid without affecting the function and property of the protein. Therefore, it is anticipated that a functionally equivalent product may be produced by substituting one negatively charged residue with another or substituting one positively charged residue with another.

[0076] A linker for covalently binding PEG to KLK1 may be any biocompatible linker. Biocompatible denotes that the compound or group is nontoxic, and can be used in vitro or in vivo without causing injury, vomit, disease or death. PEG can be bound to a linker, for example, by an ester bond, a thiol bond or an amido bond.

[0077] In the present invention, the most preferred biocompatible linkers have a common characteristic that they are conjugated to an N-terminal amino of KLK1 through a propionaldehyde group. In addition, KLK1 may be conjugated directly to PEG through an amino, mercapto, hydroxy or carboxyl group. In a most preferred embodiment, PEG is conjugated to an N-terminal amino of KLK1 through an amido bond.

[0078] The method for preparing PEGylated KLK1 according to the present invention includes reacting a certain amount of PEG and a certain amount of KLK 1 for a sufficient period of time in a buffer, to allow PEG to covalently bind to KLK1. In a particular embodiment, the KLK1 is derived from pancreas, and more particularly from porcine pancreas. More particularly, the KLK1 comprises a sequence of SEQ ID NO: 1. In an embodiment, the PEG is of Y-PALD type.

[0079] In a particular embodiment, the buffer has a pH value ranging from about 4.0 to about 9.0. The most preferred pH value ranges from about 5.0 to 6.0, e.g., about 5.0, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9 or 6.0.

[0080] In addition, PEGylation of kallikrein is carried out at a protein concentration of about 0.5 to 30 mg/mL, more particularly preferably about 2 to 20 mg/mL, most particularly preferably about 3 to 15 mg/mL. In a particular embodiment, the kallikrein PEGylated at these protein concentrations is derived from porcine pancreas, and more particularly, the kallikrein comprise a sequence of SEQ ID NO: 1 or SEQ ID NO: 2.

[0081] At an elevated protein concentration, the PEGylation reaction is carried out quickly, within less than 3 h. In addition, The molar ratio of the PEG to kallikrein is not more than 25:1. For example, the molar excess is less than 25:1, 20:1, 19:1, 18:1, 17:1, 16:1, 15:1, 14:1, 13:1, 12:1, 11:1, 10:1, 9:1, 8:1, 7.5:1, 7:1, 6.5:1, 6:1, and 5.5:1.

[0082] The present invention is further illustrated through the following examples. However, any example or combinations thereof should not be understood as limiting the scope or implementation of the present invention.

EXAMPLE 1

Preparation and Analysis of PEG Conjugates of KLK1

Preparation Example 1

Preparation, Purification and Identification of the PEGylated KLK1 of the Present Invention

1. Preparation of PEG Conjugate Sample

[0083] Kallikrein (available from Changzhou Qianhong BioPharmaceutical Co., Ltd.) was dissolved in a 50 mM acetic acidsodium acetate buffer (pH 5.0) to formulate an 8 mg/mL solution, and reacted respectively with Y-PALD20K, Y-PALD30K, Y-PALD40K (purchased from Beijing Jiankai science and Technology Co. Ltd.) at a molar ratio of kallikrein:PEG:sodium cyanoborohydride of 1:10:100. After 12 h of the reaction at 4 C., 1 M glycine was added to terminate the reaction. 3 mono-modified products Y-PALD-20K-KLK1 (conjugate 2), Y-PALD-30K-KLK (conjugate 3), and Y-PALD-40K-KLK1 (conjugate 4) were prepared.

[0084] In addition, kallikrein was dissolved in a 50 mM Tris-HCl buffer (pH 8.5) to formulate an 8 mg/mL kallikrein solution, and reacted with mPEG-SC5000 (purchased from Beijing Jiankai science and Technology Co, Ltd.) at a molar ratio of kallikrein ; PEG of 1:8. The reaction was carried out for 0.5 h at 4 C. A mono-modified product SC-PEG5000-KLK1 (conjugate 1) was prepared, for comparison with the modified product according to the present invention. The conjugates 1, 2, 3 and 4 had a yield of 40%, 55%, 58%, and 61% respectively.

2. Purification of PEG Conjugate Sample

2.1 Removal of Unreacted PEG by Chromatography

[0085] Chromatography conditions: Q ion exchange column (purchased from GE Inc., HiTrap Q HP 5 mL), solution A:20 mM Tris-HCl (pH 8.0), solution B: 1 M NaCl in 20mM Tris-HCl (pH 8.0), flow rate 2.5 mL/min, and detection wavelength 280 nm.

[0086] Sample Loading: The modified product was adjusted to pH 8.0 with a 0.5 M NaOH solution, and bound to the Q ion exchange column.

[0087] Equilibrium: The column was washed with 5 column volumes of the solution A.

[0088] Collection: The modified product was eluted off with 50% (v/v) of the solution B, and the sample corresponding to the elution peak was collected.

2.2 Purification of Mono-Modified PEG Conjugates by Chromatography

[0089] Chromatography conditions: Hiload 16/60 Superdex 200 pg (purchased from GE Inc.) semi-preparative gel filtration column, eluant: PBS, flow rate 1.5 mL/min, and detection wavelength 280 nm.

3. Detection of PEG Conjugate Sample

[0090] Chromatography conditions: HPLC (Waters, e2695 HPLC), Superdex 200 10/300 GL (purchased from GE Inc.), mobile phase: 0.1 M Na.sub.2SO.sub.4 in PBS (pH 7.4), flow rate 0.4 mL/min, detection wavelength 280 nm, sampling volume 50 L, and detection time 60 min.

[0091] Analysis results are shown in FIG. 1. As can be seen from FIG. 1, the 4 mono-modified products SC-PEG5000-KLK1 (conjugate 1), Y-PALD-20K-KLK1 (conjugate 2), Y-PALD-30K-KLK1 (conjugate 3), and Y-PALD-40K-KLK1 (conjugate 4) prepared all have a purity that is higher than 98%, and the molecular weight of the conjugates 1 to 4 gradually increases with the gradual increase of the molecular weight of PEG employed.

[0092] The methods in Preparation Examples 2 to 4 was the same as that in Preparation Example 1 except for the pH value, reaction temperature, reaction time, protein concentration, and molar ratio. The specific parameters and yields are shown in a table below:

TABLE-US-00001 Preparation Preparation Preparation Example 2 Example 3 Example 4 pH 5.0 5.5 6.0 Modifier Y-PALD-30K Y-PALD- Y-PALD-30K 30K Molar ratio 1:5:100 1:15:15000 1:25:2500 (protein:PEG:reductant) Reaction temperature 4 C. 25 C. 37 C. Reaction time (h) 24 10 0.5 Protein concentration 15 10 0.5 (mg/mL) Yield (%) 61 59 63

[0093] The activity and purity of the mono-modified products prepared in Preparation Examples 2, 3, and 4 have no significant difference from those of the mono-modified product conjugate 3 obtained in Preparation Example 1. The PEG-KLK1 conjugates employed in the following examples are all the conjugates obtained in Preparation Example 1.

EXAMPLE 2

[0094] Detection of in vitro Activity of PEG-KLK1 Conjugates

[0095] N-benzoyl-L arginine ethyl ester hydrochloride (BAEE, purchased from sigma Inc.) may be degraded by Kallikrein, and the activity of kininogenase may be determined according to the change in the absorbance before and after the enzymatic reaction, see Pharmacopoeia of People's Republic of China, pages 850-851, Section 2, 2010 version for a particular determination method. Samples to be detected were, respectively, SC-PEG5000-KLK1 (conjugate 1), Y-PALD-20K-KLK1 (conjugate 2), Y-PALD-30K-KLK1 (conjugate 3), and Y-PALD-40K-KLK1 (conjugate 4) from Preparation Example 1, and the original unmodified protein. The comparison results of relative activity thereof are shown in FIG. 2.

[0096] As can be seen from the results in FIG. 2, the activity of the original protein is reduced to some degree after PEG modification. As compared with the original unmodified protein, the conjugates 1 to 4 retain 81%, 83%, 90%, and 86% of the activity of the original protein respectively. Among the PEG modified products, the conjugate 3 has the highest biological activity, and the conjugate 1 has the lowest activity. It can be seen that the PEG modified KLK1 according to the present invention retains the in vitro biological activity of the original protein to a greater degree. The conjugate 1 has an activity consistent with that reported in literatures.

[0097] Secondly, according to a general rule of PEG modification, the influence on the activity is increased with increasing molecular weight of the PEG employed. However, this rule is not demonstrated in the present invention. The PEG modifiers employed herein all have a molecular weight that is far greater than 5000 Da, but the biological activity of the modified kallikrein is still greater than the former modified with PEG5000, and the conjugate 3 with PEG having a molecular weight of 30 KDa has the highest biological activity.

EXAMPLE 3

Thermostability of PEG-KLK1 Conjugates

[0098] In order to confirm whether the PEG modification can increase the stability of kallikrein, the activity of the conjugates 1 and 3 and the original protein after standing for a period of time in a water bath at 65 C. was detected respectively in this example. The method specifically included the following steps. The conjugates 1 and 3 and the unmodified kallikrein dissolved in a PBS buffer at a protein concentration of 1 mg/mL were stood in a water bath at 65 C., sampled at 0 min, 2.5 min, 5 min, 7.5 min, 10 min, 20 min, 25 min, and 30 min respectively, and stored in freezer at 4 C. for later use. After sampling, the biological activity was detected by employing the method (i.e., the method described in appendix IX F in Pharmacopoeia of People's Republic of China, Section 3, 2005 version). The detection results are shown in FIG. 3.

[0099] As can be seen from FIG. 3, in comparison with the original protein, the thermostability of the PEG modified kallikrein is increased; however, the increase in the thermostability of the conjugate 1 is unobvious, and the thermostability of the conjugate 3is significantly increased as compared with the original protein.

EXAMPLE 4

Comparison of Efficacy of Various PEG-KLK1 Conjugates in Treatment of Cerebral Apoplexy

[0100] A cerebral ischemia reperfusion model of middle cerebral artery obstruction (MCAO) was established by thread embolizing the internal carotid artery of SD rats (purchased from Shanghai Sippr bk Laboratory Animal Co. LTD.) A positive control 1 group (urinary kallikrein, Guangdong Tianpu Biochemical Pharmaceutical Co., LTD.), a positive control 2 group (tPA, Shanghai Boehringer Ingelheim Pharmaceuticals Co., LTD), a model control group (PBS), a sham group, a kallikrein group (from Changzhou Qianhong Biochemical Pharmaceutical Co., LTD.), a conjugate 1 group, a conjugate 2 group, a conjugate 3 group, and a conjugate 4 group were arranged respectively. Administration by injection through vena caudalis was performed once at 3 g/kg (calculated according to the protein amount) immediately after the cerebral ischemia reperfusion. Neurologic deficit symptoms were observed 24 h after the reperfusion, and the cerebral infarction area was determined.

[0101] In the model group, an equal volume of PBS was injected through vena caudalis into the rat. In the sham group, only blood vessels were separated, no embolizing thread was inserted, and an equal volume of PBS was injected through vena caudalis into the rats.

[0102] Neurologic deficit symptoms were evaluated employing an improved Bederson 5-point system method. Neurologic deficit symptoms of the rats after brain trauma were evaluated by a single-blind method, i.e., the animals were marked according to groups by designers of the experiment, and scores of the neurologic deficit symptoms were given by experimenters blind to the grouping situation.

[0103] The cerebral infarction area was calculated employing the following method. Cerebrums of the SD rats were stained with TTC (2,3,5-triphenyltetrazolium chloride) and then the photographs were subjected to statistics using an image analysis software, and the percentage of cerebral infarction area was calculated according to the following formula:


% cerebral infarction area=100(total ischemic area/total area on the right side)

[0104] Experimental results are as shown in FIG. 4 and Tables 1 and 2.

TABLE-US-00002 TABLE 1 Efficacy studies on PEG-KLK1 conjugates, kallikrein and positive control drugs-comparison of neurologic deficit symptoms Total number Score of of Failed in neurologic animals operation Death Sample deficit Groups (n) (n) (n) (n) symptom Model group 25 3 2 20 2.92 0.18 Sham group 15 0 0 15 0.00 0.00 Positive control 1 26 2 3 21 2.47 0.21* group Positive control 2 24 2 0 22 3.00 0.20 group Kallikrein group 25 2 1 22 2.41 0.19 Conjugate 1 25 2 1 22 2.45 0.27 group Conjugate 2 25 2 0 23 2.27 0.24* group Conjugate 3 23 1 2 20 2.10 0.23* group Conjugate 4 26 2 3 21 2.65 0.34 group

TABLE-US-00003 TABLE 2 Efficacy studies on PEG-KLK1 conjugates, kallikrein and positive control drugs-comparison of cerebral infarction areas Total number of Failed in Cerebral animals operation Death Sample infarction Groups (n) (n) (n) (n) area (%) Model group 25 3 2 20 31.62 3.10 Sham group 15 0 0 15 0.00 0.00 Positive control 1 26 2 3 21 24.49 3.96* group Positive control 2 24 2 0 22 31.55 2.71 group Kallikrein group 25 2 1 22 26.52 3.67 Conjugate 1 25 2 1 22 27.67 4.34 group Conjugate 2 25 2 0 23 21.34 1.70* group Conjugate 3 23 1 2 20 17.16 4.07* group Conjugate 4 26 2 3 21 31.27 5.08 group

[0105] Experimental results indicate that in experiments where neurologic deficit symptoms are scored and cerebral infarction area is calculated, neither of the conjugate 4 group, positive control 2 (tPA) and kallikrein has apparently ameliorated cerebral infarction states in the model animals, whereas the positive control 1 group (urinary kallikrein), conjugate 1 group, conjugate 2 group, and conjugate 3 group all have significant differences from the model group, and both the conjugate 2 group and conjugate 3 group have higher therapeutic effects against acute atherothrombotic cerebral infarction, than that of the positive control 1 group. In summary, in comparison with the original protein unmodified with PEG and two positive drugs, conjugates 2 and 3 had apparent protective effects against cerebral ischemic injury in cerebral ischemia reperfusion model of SD rats established employing the MACO method, and had efficacy superior to that of commercially available products. The conjugate 1 only partially ameliorated the cerebral infarction state in the model animals, whereas the conjugate 4 essentially did not reduce the cerebral infarction area in the experimental animals, and did not ameliorate the neurologic deficit symptoms, indicating that the two conjugates failed to play a role in the treatment of cerebral infarction diseases, and failed to ameliorate the final physiological state of patients with cerebral infarction. Thus it can be seen that, the employment of PEG modification to ameliorate pharmacological efficacy or pharmacokinetic properties of protein polypeptides has higher differences across different conjugates.

EXAMPLE 5

Comparison of Efficacy of PEG-KLK1 Conjugates and the Original Protein in the Treatment of Nephropathy Caused by Diabetes Mellitus

[0106] db/db mice (purchased from Shanghai Slaccas Experimental Animal Co., LTD., grade SPF, 8-week aged, male, with a conformity certification No. of 2007000552656) were employed as animal models for diabetic nephropathy. A model group, a kallikrein (purchased from Changzhou Qianhong Biochemical Pharmaceutical Co., LTD.) original protein group and a conjugate 3 group were provided respectively. The administered dose was 2 g/kg (calculated according to the protein amount), through vena caudalis, where the model group and the original protein group were dosed once a week, and the conjugate 3 group was dosed once every 2 weeks, for 2 continuous months before detection of urine volume, urine protein, urea nitrogen and urine creatinine. (Urine protein detection kits, urine creatinine detection kits, and urea nitrogen detection kits were all purchased from Nanjing Jiaticheng Bioengineering Co., LTD.)

[0107] Detection results are seen in FIG. 5. As can be seen from the experimental results that, in comparison with the model group, the experimental animals in the original protein group and the conjugate 3 group had significantly decreased numerical values of urine volume, urine protein, urine creatinine and urea nitrogen, indicating that kallikrein has an apparent therapeutic effect in the treatment of nephropathy caused by diabetes mellitus. In addition, the conjugate 3 group had more apparent reduction in urine protein, urine creatinine and urea nitrogen in comparison with the original protein group. If can be known from the experimental arrangement that, the conjugate 3 group was dosed once every 2 weeks, and the original protein group was dosed once every 1 week. Through comprehensive analysis, the conjugate 3 group received efficacy apparently superior to that of the original protein group, indicating that kallikrein has apparently extended half-life in vivo after PEG modification, thus significantly improve the efficacy.

EXAMPLE 6

Immunogenicity of PEG-KLK1 Conjugates

[0108] Relative immunogenicity of different PEG-KLK1 conjugates to mice was determined in this example, and compared with the original protein. The experiment was

[0109] divided into a conjugate 2 group, a conjugate 3 group, a urinary kallikrein group and an original protein group. 1 mg/kg (calculated according to the protein amount) of the above protein was injected through vena caudalis into the mice at a frequency of twice a week, for 4 continuous weeks. Blood was taken from eye sockets 1 week after administration. The anti-kallikrein antibody level in serum was determined by indirect. ELISA, with results shown in FIG. 6.

[0110] As can be found from the results that conjugates 2 and 3 have antibody titers on mice that are much lower than those of kallikrein from porcine pancreas and urinary kallikrein sourced from human urine, indicating that the PEG modification can apparently reduce the protein immunogenicity, and the conjugate 3 has slightly lower relative immunogenicity to mice than the conjugate 2.

EXAMPLE 7

Pharmacokinetic Studies on PEG-KLK1 Conjugates

[0111] The in vivo blood drug concentrations of kallikrein before and after the PEG modification were studied employing a .sup.125I isotope labelling tracer method in this example. In order to reduce the absorption of the labelled drug by the thyroid gland of rats, 1 ml of a 1% KI (Sinopharm Group) solution was intraperitoneally injected about 8 hours before the experiment, to saturate the thyroid gland of the rats. The rats were randomly divided into 3 groups, i.e., a conjugate 3 group, a kallikrein group, and a urinary kallikrein group, 8 in each group, half male and half female (purchased from Experimental Animal Center of Zhejiang Province).

[0112] A particular operation method is as follows:

[0113] 1. Hydroxy on the amino acid residue phenyl ring in a protein molecule is substituted with radioiodine, to obtain the above protein with .sup.125I having a radioactive tracing effect.

[0114] 2. Numbering is performed on the rats using picric acid according to the numbering rule, and weighing is performed. After fixing with a rat fixer, administration is performed by injection through vena caudalis (1.5 U/kg). The rat is let go immediately after the dosage, and allowed to move around, drink water, and eat food freely.

[0115] 3. 0.2 mL of blood is taken from eye sockets 1 min, 3 min, 10 min, 20 min, 40 min, 60 min, 2 h, 4 h, 8 h, 12 h, 24 h, 48 h, 72 h, 96 h, and 120 h respectively after the dosage, and EDTA is added therein for anticoagulation.

[0116] 4. The rat plasma is subjected to centrifugal separation at 5000 rpm for 3 min, and determined for plasma radioactivity using a gamma counter (Anke Zhongjia, GC-911), for 1 min.

[0117] 5. Plasma is recovered after radioactivity determination, and undegraded proteinogenous drugs are separated by HPLC (Shimadzu LC-20AT).

[0118] A time-concentration curve is shown in FIG. 6, and each parameter is calculated as shown in Table 3.

TABLE-US-00004 TABLE 3 Comparison of pharmacokinetic parameters of PEG-KLK1 conjugate 3, kallikrein, and urinary kallikrein Sample T (h) AUC (g/L * h) CL (L/h/kg) V (L/kg) Kallikrein 18.81 18.59 0.13 3.53 Positive 17.49 11.68 0.21 5.16 control 1 (urinary kallikrein) Conjugate 3 20.03 113.62 0.02 0.64

[0119] Experimental results indicate that, the pharmacodynamic model of the above drug belongs to a 2-compartment model. The half-life of the conjugate 3 is apparently extended and the area under the time-concentration curve (AUC) of the conjugate 3 is increased significantly, as compared with those of the original protein and urinary kallikrein. Secondly, the clearance rate from blood of the conjugate 3 is also significantly lower than those of the original protein and the positive control, and among the 3 groups, the conjugate 3 has the minimal apparent distribution volume, indicating that the conjugate 3 is more concentrated in the plasma than the other two unmodified proteins. Thus it can be seen that, as compared with unmodified kallikrein and urinary kallikrein derived from human urine, the conjugate 3 obtained by modifying kallikrein with PEG has a significantly increased half-life, and an apparently reduced metabolism rate, effectively extendeding the efficacy duration of kallikrein.

EXAMPLE 8

Analysis of PEG-KLK1 Conjugates and Original Protein by Circular Dichroism Spectra

[0120] Secondary and tertiary structures of the modified and unmodified proteins can be characterized with a circular dichroism spectrometer. The protein concentration ranged from 0.1 to 0.2 mg/mL. The sample was loaded into a circular dichroism cuvette, and detected for its circular dichroism spectra within the extreme ultraviolet region (190 nm-250 nm) and the near ultraviolet region (253 nm-480 nm), at a scanning bandwidth of 1 nm and a scanning speed of 500 nm/min. A corresponding buffer was used as the background in each detection, and values from detection of three times were averaged. As can be seen from FIG. 8a, the circular dichroism spectra within the extreme ultraviolet region of conjugates 2 and 3 have hardly any peak shift in the conjugate spectra, as compared with the original protein, indicating that PEG modification has no influence on the secondary structure of KLK1. As can be seen from FIG. 8b, the circular dichroism spectra within the near ultraviolet region of conjugates 2 and 3 have hardly any peak shift in the conjugate spectra, as compared with the original protein, indicating that PEG modification has no influence on the tertiary structure of KLK1. On the whole, through conjugates prepared by different modifiers, high-level structures of KLK1 have essentially no change. Because the conjugate has no change in the structure thereof after PEG modification, it loses less activity than the original protein, which is also validated by the data in Example 2. This result is also in line with the general rule of PEG modification. Most protein drugs have no change in the high-level structures thereof after PEG modification.

EXAMPLE 9

Identification of PEG Modification Site of Conjugate 3

[0121] In order to determine the PEG modification site of conjugate 3, the conjugate 3 was subjected to an enzymolysis experiment with trypsase, and compared with the finger print of the original protein. The PEG modification site can be determined by comparison of the difference in peptide segments of the original protein and the modified product. Particular experimental steps include: adding 100 L 0.5 mg/mL sample into 0.9 L 1 mg/mL trypsin solution, and carrying out the reaction for 5 h at 37 C. The reaction was terminated by adding therein 10% (v/v) TFA after the reaction. Products of the enzymolysis were analyzed using a C18 reversion phase chromatographic column (purchased from Waters Inc.), with liquid A:H.sub.2O+0.1 wt % TFA and liquid B: acetonitrile+0.1% (v/v) TFA as mobile phases respectively, at a loading amount of 80 l, and a flow rate of 0.5 mL/min, for running time of 120 min. Gradient elution condition: 0-100 min 5%-60% (v/v) B. Comparison results of peptide maps are shown in FIG. 9. As can be seen from the diagram that, as compared with the map of the original protein, the N-terminal peptide segment of conjugate 3 has disappeared, but a PEG modified N-terminal peak appears at 68 min, indicating that PEG actually conjugates onto the N-terminal amino acid of KLK1, which is consistent with the expected result.

EXAMPLE 10

[0122] Preparation of Yeast-Expressed Recombinant Human Kallikrein (hK1)

(1) Gene Design

[0123] According to a sequence of GenBank accession number AAA59455, the gene was subjected to codon optimization, to obtain a recombinant hK1 gene according to the present invention, as shown in SEQ ID No: 3.

(2) Construction of Expression Plasmid of Recombinant hK1 Gene

[0124] 1. The fragment synthesized from the optimized recombinant hK1 full gene was constructed into pUC57 plasmids (purchased from Nanjing Genscript Biotechnology Co., LTD.), to obtain a long-term storage plasmid, denoted as pUC57-opt-hK1 plasmid.

[0125] 2. The pUC57-opt-hK1 plasmid was used as a template, and upstream and downstream primers were introduced respectively into Xho I and Not I restriction enzyme cutting sites. Conduct the PGR amplification. The primers employed had sequences as follows:

TABLE-US-00005 Upstreamprimer: P1:GCCGCTCGAGAAGAGAGAAGCAGAGGCTATCGTC; and Downstreamprimer: P2:AAGGAAAAAAGCGGCCGCCTAACTATTTTCAGCGAT

[0126] The total reaction volume was 50 L, where 2.5 L each of the primers at a concentration of 10 mol/L was added, and 1 L dNTP at a concentration of 10 mmol/L was added, and DNA polymerase employed was Q5 super-fidelity DNA polymerase (M0491S, purchased from New England Biolabs Inc.), 2 U/L. Reaction condition included 98 C. for 10 s, 55 C. for 30 s, and 72 C. for 30 s. After 25 cycles, the product was analyzed by 1.0% agarose gel electrophoresis, and the size of the product was consistent with the expected size (760 bp). The obtained gene product was purified by a DNA gel recovery kit. After the purification, with Xho I and Not I double enzyme digestion, it was linked to pPICZ A (VI9520, purchased from Invitrogen) by T4 ligase, transformed into DH5 competent cells, and cultured overnight at 37 C. in an LB flat plate containing Zeocin. The next day, positive clone bacteria were screened, sequenced, and aligned, to be completely identical with the expected sequence, so as to obtain a form of expression plasmid of recombinant hK1, denoted as pPICZ-opt-hK1.

(3) Construction of Recombinant hK1 Protein Yeast Engineering Strain

[0127] X-33 strains (C18000, purchased from Invitrogen) were prepared as electroporation-competent cells, according to the method in the instruction of Multi-Copy Pichia Expression Kit of Invitrogen Inc. The resultant containing the pPICZ-opt-hK1 plasmid was linearized by enzyme digestion with Sac I restriction endonuclease, and ethanol precipitated, then the linearized vector was electrically transformed into X-33competent yeast cells, coated onto a YPD soild medium containing Zeocin, and cultured at 30 C. until growth of clones.

(4) Expression of Recombinant hK1 Protein

[0128] X-33 positive monoclonal strains of hK1 were picked out, and cultured, in 5 mL BMGY medium, at 30 C. and 220 rpm in a 50-mL sterile centrifuge tube. When OD.sub.600=3.0-2.0, 1 mL bacterium liquid was taken out to store the strain, and the remaining bacterium liquid was resuspended and then transferred to BMMY for induction and expression in a small amount, and methanol was supplemented every 24 h to a final concentration of 1 wt %. One week later, supernatant of the bacterium liquid was collected by centrifugation.

(5) Expression and Purification of Recombinant hK1 Protein

[0129] 1. Impurity removal pretreatment of fermentation liquid

[0130] The recombinant hK1 fermentation liquid was centrifuged for 15 min at 12000rpm and at low temperature, to collect a supernatant. A high-concentration (NH).sub.2SO.sub.4 solution was added into the supernatant, and had a final concentration of 1.0 M in the supernatant, and the mixture was filtered through a 0.45-m filter membrane.

[0131] 2. HisTrap Phenyl HP hydrophobic chromatography

[0132] By the optimization of the HisTrap Phenyl HP purification process of the recombinant hK1 fermentation liquid obtained from the pretreatment, through the use of the DOE method in the UNICORN6.1 operational software in a full-automatic intelligent protein purification system (AKTA avantl50, purchased from GE heal care), it was finally determined that the equilibration buffer was 20 mM sodium phosphate, 1.0 M (NH.sub.4).sub.2SO.sub.4, 10% glycerin, pH 6.0, and the elution buffer was 20 mM phosphate, 10% glycerin, pH 6.0. The sample was eluted with a gradient concentration of (NH.sub.4).sub.2SO.sub.4 decreased stepwise by 0.2 M. The elution peaks were collected, and the samples separated were identificated by SDS-PAGE. Results are shown in FIG. 10, and two recombinant hK1 proteins with inconsistent molecular weight sizes due to glycosylation modification were separated completely.

EXAMPLE 11

Protein Electrophoretic Analysis and Activity Determination of PEG Modified Products of Recombinant Human Kallikrein Expressed in Yeasts

[0133] The recombinant expressed low-molecular weight human kallikrein (hK1K1) from Example 10 was modified with a Y-PALD-30K modifier, and after the modification, a mono-modified product (Y-PALD-30K-hK1K1) was prepared according to the method described in Example 1. Electrophoresis results of the mono-modified product and the original protein are shown in FIG. 11. As can be seen from FIG. 11, the mono-modified product obtained after the purification exhibits a single band, and as compared with the original protein, the molecular weight is increased significantly, up to about 130 KDa. Because PEG can bind to a plethora of water molecules, in electrophoresis the apparent molecular weight thereof will be significantly greater than the actual molecular weight thereof. According to the experimental method in Example 2, the activity of human kallikrein (hK1K1) before and after the modification was determined. Activity determination results indicate that the modified hK1K1 retained 85% of activity of the original protein before modification. Thus it can be seen that, efficacy and pharmacokinetic results of Y-PALD-3 OK-hK1K1 will also be ameliorated significantly, as compared with the original protein.

EXAMPLE 12

Preparation of Recombinant Human Kallikrein Expressed in CHO Cells

(1) Gene Design

[0134] According to a sequence of GenBank accession number AAA59455, the gene was subjected to codon optimization, to obtain a recombinant hK1 gene according to the present invention, as shown in SEQ ID No: 4.

(2) Construction of Expression Plasmid of Recombinant hK1 Gene

[0135] The fragment synthesized from the optimized recombinant hK1 full gene was constructed into pUC57 plasmids (provided by Nanjing Genscript Biotechnology Co., LTD.), to obtain a long-term storage plasmid, denoted as pUC57-opt-hK1 plasmid.

[0136] The pUC57-opt-hK1 plasmid was used as a template, and upstream primer P3 was introduced into Avrll and downstream primer P4 was introduced into BstZ171 restriction enzyme cutting sites, to perform PGR amplification. The primers employed had sequences as follows:

TABLE-US-00006 UpstreamprimerP3: CATGCCTAGGGCCACCATGTCCGCTCTGCT DownstreamprimerP4: GGGCGTATACTCAACTGTTTTCAGCAATGGT

[0137] The total reaction volume was 50 L, where 2.5 L each of the primers at a concentration of 10 mol/L was added, 1 L of dNTP at a concentration of 10 mmol/L was added, and 0.5 L of DNA polymerase employed, which was Q5 High-Fidelity DNA Polymerase, at 2 U/L, was added. Reaction condition included 98 C. for 10 s, 55 C. for 20 s, and 72 C. for 30 s. After 25 cycles, the product was analyzed by 1.0% agarose gel electrophoresis, and the size of the product was consistent with the expected size (780 bp, as shown in FIG. 7). The obtained gene product was purified by a DNA gel recovery kit. After the purification, with Avrll (R0104S, purchased from New England Biolabs) and BstZ171 (R0136S, purchased from New England Biolabs), it was linked to pCHOl.O plasmid (A1369601, purchased from Invitrogen) by T4 ligase, transformed into Top 10competent cells (CB104, purchased from Beijing Tiangen Biotech), and cultured overnight at 37 C. in an LB fiat plate containing kanamycin (0408-100G, purchased from Amresco). The next day, positive clone bacteria were screened, sequenced, and aligned, to be completely identical with the expected sequence, so as to obtain a form of expression plasmid of recombinant hK1, denoted as pCHO1.0-opt-hK1.

(3) Preparation of CHO Positive Clones

[0138] An appropriate amount of CHOS (A1369601, purchased from Invitrogen) cells were added into a 24-well plate respectively, followed by the addition of CD FortiCHO (A1148301, purchased from Invitrogen) medium with various concentrations of puromycin successively. 2 weeks later, the working concentration of puromycin was determined, by the MTT method, to be between 5 and 10 g/mL. In this application, the working concentration of puromycin was initially 10 g/mL.

[0139] Correctly sequenced pCHO1.0-opt-hK1 plasmids were linearized by NruI (R0192S, purchased from Invitrogen), electrically transfected into CHOS cells, then puromycin and MTX were added therein respectively to perform screening, and cell viability was calculated after one week. When the cell viability was greater than 30%, the plasmids were transferred to a shaker, and pressurized screening was performed by continuously increasing the puromycin and MTX concentrations, until the expression amount evaluation was passed. Monoclonal cell strains were screened by a limiting dilution method, and high-expression cell strains were identified by protein immunoblotting.

(4) Expression of Recombinant hK1 in Mammal Cell CHO

[0140] Monoclonal cell strains CHOS expressing recombinant hK1 were inoculated into a CD FortCD medium, and cultured in a shaker at 37 C., 8% CO.sub.2, and 130 rpm. When the cell density satisfied the requirement, 2 g/L glucose was sequentially added every other day, and samples were taken, to detect the viability and density of the cells. When the cell viability was lower than 70%, the medium containing recombinant human kallikrein was collected. Glucose was sequentially added everyday, and the supernatant culture solution was collected for identification by immunoblotting maps, with results shown in FIG. 12. Experimental results show that, CHOS can express the recombinant hK1 protein with high efficiency, and due to the different sugar modification, the recombinant hK1 protein has relatively broad molecular weight distribution.

EXAMPLE 13

HPLC Analysis and Activity Determination of PEG Modified Products of Recombinant Human Kallikrein Expressed in CHO Cells

[0141] The recombinant human kallikrein expressed in CHO cells prepared in Example 12 was modified with a Y-PALD-30K modifier, and after the modification, a mono-modified product (Y-PALD-30K-rhK1K1) was prepared according to the method described in Example 1. HPLC analytic results of the mono-modified product are shown in FIG. 13. As can be seen from FIG. 13, the mono-modified product obtained after the purification has higher purity, up to more than 98%. Also, the peak position is apparently-left shifted as compared with the original protein, indicating that its molecular weight is significantly increased after the PEG modification. According to the experimental method in Example 2, the activity of human kallikrein before and after the modification was determined. Activity determination results indicate that the modified rhK1K1 retains 88% of activity of the original protein, which is also similar to the results in Examples 2 and 11. Thus it can be seen that, efficacy and pharmacokinetic results of Y-PALD-30K-rhK1K1 will also be ameliorated significantly, as compared with the original protein.

[0142] The above examples are only used for illustrating the technical conception and feature of the present invention, for the prupose of enabling those familiar in the art to understand and thereby implement the content of the present invention, instead of limiting the protection scope of the present invention therewith. Any equivalent changes or modifications made according to the spirit and essence of the present invention shall all be encompassed within the protection scope of the present invention.