Method for Producing L-Amino Acids Using an Alkaliphilic Bacteria

Abstract

Surprisingly, it has been found that alkaliphilic bacteria of the genus Corynebacterium are naturally suited to produce L-amino acids.

Claims

1-15. (canceled)

16. A recombinant microorganism, useful in the production of an amino acid, wherein said microorganism has been engineered to overexpress one or more enzymes selected from the group consisting of: a) an alanine dehydrogenase comprising an amino acid sequence at least 85% identical to the sequence of SEQ ID NO:72; b) an enzyme of the hut cluster, selected from the group consisting of: i) a urocanate hydratase (hutU) enzyme, comprising a sequence at least 90% identical to the sequence of SEQ ID NO:192; ii) an imidazolonepropionase (hutI) enzyme comprising a sequence at least 90%, identical to the sequence of SEQ ID NO:194; iii) a histidine ammonia-lyase (hutH) enzyme comprising a sequence at least 90%, identical to the sequence of SEQ ID NO:196; iv) a formimidoylglutamase, characterized in that said enzyme has a sequence identity of at least 90% identical to the sequence of SEQ ID NO:198.

17. The recombinant microorganism of claim 16, wherein said alanine dehydrogenase is overexpressed.

18. The recombinant microorganism of claim 17, wherein said alanine dehydrogenase comprises an amino acid sequence at least 85% identical to the sequence of SEQ ID NO:72.

19. The recombinant microorganism of claim 17, wherein said alanine dehydrogenase comprises an amino acid sequence at least 95% identical to the sequence of SEQ ID NO:72.

20. The recombinant microorganism of claim 17, wherein said alanine dehydrogenase comprises an amino acid sequence at least 98% identical to the sequence of SEQ ID NO:72.

21. The recombinant microorganism of claim 17, wherein said alanine dehydrogenase is encoded by either: a) a sequence at least 75% identical to the sequence from position 301 to position 1365 of SEQ ID NO:71; or b) a sequence complementary to the sequence of paragraph (a).

22. The recombinant microorganism of claim 17, wherein said alanine dehydrogenase is encoded by either: a) a sequence at least 85% identical to the sequence from position 301 to position 1365 of SEQ ID NO:71; or b) a sequence complementary to the sequence of paragraph (a).

23. The recombinant microorganism of claim 17, wherein said alanine dehydrogenase is encoded by either: a) a sequence at least 95% identical to the sequence from position 301 to position 1365 of SEQ ID NO:71; or b) a sequence complementary to the sequence of paragraph (a).

24. The recombinant microorganism of claim 16, wherein at least one of the enzymes i)-iv) of said hut cluster is overexpressed.

25. The recombinant microorganism of claim 24, wherein at least two of the enzymes i)-iv) of said hut cluster are overexpressed.

26. The recombinant microorganism of claim 24, wherein at least three of the enzymes i)-iv) of said hut cluster are overexpressed.

27. The recombinant microorganism of claim 24, wherein all four of the enzymes i)-iv) of said hut cluster are overexpressed.

28. The recombinant microorganism of claim 24, wherein said microorganism is of the species C. humireducens.

29. The recombinant microorganism of claim 24, wherein said microorganism is of the species C. glutamicum.

30. A method for the overproduction of an L-amino acid, comprising: a) culturing the recombinant microorganism of claim 16 in a fermentation medium to produce a fermentation broth; b) recovering the L-amino acid-containing product.

31. The method of claim 30, wherein said L-amino acid is selected from the group consisting of: L-glutamate, L-glutamine, L-proline, L-arginine, L-aspartate, L-asparagine, L-methionine, L-isoleucine and L-threonine.

32. The method of claim 30, wherein said L-amino acid is selected from the group consisting of: L-alanine; L-valine; L-glutamic acid; and L-lysine.

33. The method of claim 30, wherein said recombinant microorganism is an alkaliphilic bacterium.

34. The method of claim 33, wherein said recombinant microorganism is a bacterium of the species C. humireducens.

35. A recombinant microorganism engineered to overexpress an alanine dehydrogenase comprising an amino acid sequence at least 90% identical to the sequence of SEQ ID NO:72, and further comprising one or more enzymes selected from the group consisting of: a) a threonine dehydratase (IlvA, EC 4.3.1.19) having a a sequence at least 95% identical to the sequence of SEQ ID NO:106; b) a subunit of an acetolactate synthase (IIvB) having a sequence at least 95% identical to SEQ ID NO:98; c) an isomer reductase (IlvC, EC 1.1.1.86) having a sequence at least 95% identical to the sequence of SEQ ID NO:100; d) a dihydroxyacid dehydratase (IlvD, EC 4.2.1.9) having a sequence at least 95%, identical to the sequence of SEQ ID NO:102; e) a transaminase (IlvE, EC 2.6.1.42) having a sequence at least 95%, identical to the sequence of SEQ ID NO:104; f) an acetolactate synthase (IlvH, EC 2.2.1.6) having a sequence at least 95% identical to the sequence of SEQ ID NO:122; g) a threonine synthase (ThrC, EC 4.2.3.1) having a sequence at least 95% identical to the sequence of SEQ ID NO:108; h) an optionally feedback-resistant isopropylmalate synthase (LeuA, EC 2.3.3.13) having a sequence at least 95% identical to the sequence of SEQ ID NO:110; i) an isopropylmalate dehydrogenase (LeuB, EC 1.1.1.85) having a sequence at least 95% identical to the sequence of SEQ ID NO:112; j) the subunits of an isopropylmalate isomerase (LeuCD, EC 4.2.1.33) having sequences at least 95% identical to the sequences of SEQ ID NO:114 or SEQ ID NO:116; k) a 3-methyl-2-oxobutanoate hydroxymethyltransferase (PanB, EC 2.1.2.11) having a sequence at least 95% identical to the sequence of SEQ ID NO:118; l) a pantothenate synthase (PanC, EC 6.3.2.1) having a sequence at least 95% identical to the sequence of SEQ ID NO:120; m) a glutamate dehydrogenase (Gdh) having a sequence at least 95%, identical to the sequence of SEQ ID NO:124; n) a glutamine synthetase (glutamine synthetase 1) having a sequence at least 95% identical to the sequence of SEQ ID NO:126; o) a glutamine synthetase (glutamine synthetase 2) having a sequence at least 95% identical to the sequence of SEQ ID NO:128; p) a glutamate synthase having a sequence at least 95% identical to the sequence of SEQ ID NO:130; q) an isocitrate dehydrogenase having a sequence at least 95% identical to the sequence of: SEQ ID NO:132; r) an aconitate hydrase having a sequence at least 95% identical to the sequence of SEQ ID NO:134; s) a citrate synthase having a sequence at least 95% identical to the sequence of SEQ ID NO:136, t) an aminopeptidase C (PepC) having a sequence at least 95% identical to the sequence of SEQ ID NO:138; u) a pyruvate dehydrogenase having a sequence at least 95% identical to the sequence of SEQ ID NO:140; v) a pyruvate kinase (pyruvate kinase 1) having a sequence at least 95% identical to the sequence of SEQ ID NO:142; w) a pyruvate kinase (pyruvate kinase 2) having a sequence at least 95%, identical to the sequence of SEQ ID NO:144; x) an enolase having a sequence at least 95% identical to the sequence of SEQ ID NO:146; y) a 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase (GpmA) having a sequence at least 95% identical to the sequence of SEQ ID NO:148; z) a phosphoglycerate kinase (Pgk) having a sequence at least 95%, identical to the sequence of SEQ ID NO:150; aa) a glyceraldehyde-3-phosphate dehydrogenase (glycerol-3-phosphate dehydrogenase 1) having a sequence at least 95% identical to the sequence of SEQ ID NO:152; bb) a glyceraldehyde-3-phosphate dehydrogenase (glycerol-3-phosphate dehydrogenase 2) having a sequence at least 95% identical to the sequence of SEQ ID NO:154; cc) a triosephosphate isomerase (TpiA) having a sequence at least 95% identical to the sequence of SEQ ID NO:156; dd) a fructose bisphosphate aldolase having a sequence at least 95%, identical to the sequence of SEQ ID NO:158; ee) a 1-phosphofructokinase having a sequence at least 95% identical to the sequence of SEQ ID NO:160; ff) a 6-phosphofructokinase having a sequence at least 95% identical to the sequence of SEQ ID NO:162; gg) subunits of a succinyl-CoA ligase (SucCD, EC 6.2.1.5) coded for by attenuated polynucleotides (sucCD); hh) a DNA binding domain of type HTH tetR (McbR) having a sequence at least 95% identical to the sequence of SEQ ID NO:2; ii) a homoserine kinase (ThrB, EC 2.7.1.39) having a sequence at least 95%, identical to the sequence of SEQ ID NO:4; jj) a glucose-6-phosphate isomerase (Pgi, EC 5.3.1.9) having a sequence at last 95% identical to the sequence of SEQ ID NO:6; kk) a phosphoenolpyruvate carboxykinase (Pck, EC 4.1.1.32) having a sequence at least 95% identical to the sequence of SEQ ID NO:8; ll) a D-methionine-binding lipoprotein (MetQ) having a sequence at least 95% identical to the sequence of SEQ ID NO:10; mm) a methionine transporter (MetP) having a sequence at least 95%, identical to the sequence of SEQ ID NO:12; nn) an ATP-dependent methionine transporter (MetN) having a sequence at least 95%, identical to the sequence of SEQ ID NO:14; oo) an S-adenosylmethionine synthase (MetK) having a sequence at least 95% identical to the sequence of SEQ ID NO:16; pp) a methionine import system permease (MetI) having a sequence at least 95% identical to the sequence of SEQ ID NO:18; qq) a 4-hydroxy-tetrahydrodipicolinate synthase (DapA, EC 4.3.3.7) having a sequence at least 95% identical to the sequence of SEQ ID NO:20; rr) a cysteine synthase (CBS, CysK) having a sequence at least 95% identical to the sequence of SEQ ID NO:22; ss) a carboxylate-amine ligase having a sequence at least 95% identical to the sequence of SEQ ID NO:24; tt) a cystathionine beta-lyase (AecD) having a sequence at least 95%, identical to the sequence of SEQ ID NO:26; uu) an aspartate semialdehyde dehydrogenase (Asd, EC 1.2.1.11) having a sequence at least 95% identical to the sequence of SEQ ID NO:28; vv) a 5-methyltetrahydrofolate homocysteine methyltransferase (MetH, EC 2.1.1.13) coded for by an overexpressed polynucleotide (metH); ww) the smaller subunit of a transporter for branched-chain amino acids (BrnE) having a sequence at least 95% identical to the sequence of SEQ ID NO:30; xx) the larger subunit of a transporter for branched-chain amino acids (BrnF) having a sequence at least 95% identical to the sequence of SEQ ID NO:32; yy) a serine acetyltransferase (CysE) having a sequence at least 95% identical to the sequence of SEQ ID NO:34; zz) a cysteine synthase (CysK) having a sequence at least 95% identical to the sequence of SEQ ID NO:36; aaa) the H protein of a glycine cleavage system (GcvH) having a sequence at least 95% identical to the sequence of SEQ ID NO:38; bbb) the P protein of a glycine cleavage system (GcvP) having a sequence at least 95% identical to the sequence of SEQ ID NO:40; ccc) the T protein of a glycine cleavage system (GcvT) having a sequence at least 95% identical to the sequence of SEQ ID NO:4; ddd) a serine hydroxymethyltransferase (GlyA) having a sequence at least 95% identical to the sequence of SEQ ID NO:44; eee) an optionally feedback-resistant homoserine dehydrogenase (Hom, EC 1.2.1.11) having a sequence at least 95% identical to the sequence of SEQ ID NO:46; fff) a lipoyl synthase (LipA) having a sequence at least 95%, identical to the sequence of SEQ ID NO:48; ggg) a lipoyl transferase (LipB) having a sequence at least 95%, identical to the sequence of SEQ ID NO:50; hhh) a dihydrolipoyl dehyrogenase (Lpd) having a sequence at least 95%, identical to the sequence of SEQ ID NO:52; iii) a lipoate-protein ligase (LplA) having a sequence at least 95% identical to the sequence of SEQ ID NO:94; jjj) a dihydrolipoyl dehyrogenase (GcvL) having a sequence at least 95% identical to the sequence of SEQ ID NO:96; kkk) a feedback-resistant aspartate kinase (LysC, EC 2.7.2.4) having a sequence at least 95% identical to the sequence of SEQ ID NO:54; lll) a cystathionine gamma-synthase (MetB) having a sequence at least 95%, identical to the sequence of SEQ ID NO:56; mmm) a 5,10-methylenetetrahydrofolate reductase (MetF) having a sequence at least 95% identical to the sequence of SEQ ID NO:58; nnn) a homoserine O-acetyltransferase (MetX) having a sequence at least 95%, identical to the sequence of SEQ ID NO:60; ooo) an O-acetylhomoserine lyase (MetY) having a sequence at least 95% identical to the sequence of SEQ ID NO:62; ppp) a feedback-resistant pyruvate carboxylase (Pyc, EC 6.4.1.1) having a sequence at least 95% identical to the sequence of SEQ ID NO:64; qqq) an optionally feedback-resistant D-3-phosphoglycerate dehydrogenase (SerA) having a sequence at least 95%, identical to the sequence of SEQ ID NO:66; rrr) a phosphoserine phosphatase (SerB) having a sequence at least 95% identical to the sequence of SEQ ID NO:68; sss) a phosphoserine aminotransferase (SerC) having a sequence at least 95% identical to the sequence of SEQ ID NO:70; ttt) the subunit of a sulphate adenylyltransferase (CysD) having a sequence at least 95% identical to the sequence of SEQ ID NO:74; uuu) an adenosine phosphosulphate reductase (CysH), having a sequence at least 95% identical to the sequence of SEQ ID NO:76; vvv) a sulphite reductase (CysI) having a sequence at least 95%, identical to the sequence of SEQ ID NO:78; www) an NADPH-dependent glutamate synthase beta chain (CysJ) having a sequence at least 95%, identical to the sequence of SEQ ID NO:80; xxx) the subunit of a sulphate adenylyltransferase (CysN) having a sequence at least 95% identical to the sequence of SEQ ID NO:82; yyy) a cystathionine beta-synthase (CysY) having a sequence at least 95%, to the sequence of SEQ ID NO:84; zzz) a sulphate transporter (CysZ) having a sequence at least 95% identical to the sequence of SEQ ID NO:86; aaaa) a 5-methyltetrahydropteroyltriglutamate-homocysteine methyltransferase (MetE) having a sequence at least 95% identical to the sequence of SEQ ID NO:88; bbbb) a peptidyl-tRNA hydrolase 1 (PtH1) having a sequence at least 95%, identical to the sequence of SEQ ID NO:90; cccc) a peptidyl-tRNA hydrolase 2 (PtH2) having a sequence at least 95%, identical to the sequence of SEQ ID NO:92; dddd) a diaminopimelate dehrogenase (Ddh, EC 1.4.1.16) encoded by an overexpressed polynucleotide (ddh); eeee) a diaminopimelate decarboxylase (LysA, EC 4.1.1.20) having a sequence at least 95% identical to the sequence of SEQ ID NO:164; ffff) an aspartate aminotransferase (AaT, EC 2.6.1.1) having a sequence at least 95% identical to the sequence of SEQ ID NO:166; gggg) an L-lysine exporter (LysE, lysine efflux permease) having a sequence at least 95% identical to the sequence of SEQ ID NO:168; hhhh) a diaminopimelate epimerase (DapF, EC 5.1.1.7) encoded by an overexpressed polynucleotide (dapF); iiii) a dihydropicolinate reductase (DapB, EC 1.3.1.26) having a sequence at least 95% identical to the sequence of SEQ ID NO:170; jjjj) a glucose-6-phosphate dehydrogenase (EC 1.1.1.49) having a sequence at least 95% identical to the sequence of SEQ ID NO:172; kkkk) the Zwf subunit of a glucose-6-phosphate dehydrogenase (Zwf, EC 1.1.1.49) having a sequence at least 95% identical to the sequence of SEQ ID NO:186; llll) the OpcA subunit of a glucose-6-phosphate dehydrogenase (OpcA, EC 1.1.1.49) having a sequence at least 95%, identical to the sequence of SEQ ID NO:188; mmmm) a phosphogluconic acid dehydrogenase (Gnd, EC 1.1.1.44) having a sequence at least 95% identical to the sequence of SEQ ID NO:174; nnnn) a malate: quinone oxidoreductase (Mqo, EC 1.1.99.16) having a sequence at least 95% identical to the sequence of SEQ ID NO:176; oooo) the E1p subunit of a pyruvate dehydrogenase complex (AceE, EC 1.2.4.1) having a sequence at least 95% identical to the sequence of SEQ ID NO:178; pppp) a citrate synthase (GltA, EC 4.1.3.7) having a sequence at least 95% identical to the sequence of SEQ ID NO: 180; qqqq) a malate dehydrogenase (Mdh, EC 1.1.1.37) having a sequence at least 95% identical to the sequence of SEQ ID NO:182; and rrrr) a UDP-N-acetylmuramoylalanyl-D-glutamate-2,6-diaminopimelate ligase (MurE, EC 6.3.2.13) having a sequence at least 95% identical to the sequence of SEQ ID NO:184.

Description

WORKING EXAMPLES

Example 1

L-Alanine and L-Valine Performance Assay

[0330] For the L-alanine/L-valine performance assay, the type strain C. humireducens (DSM 45392) was cultured in a shaking flask batch. For this purpose, the C. humireducens strain was incubated in 10 ml of BHI liquid medium (Brain Heart Infusion; Merck) (37 g/l of H.sub.2O) at 37 C. at 200 rpm for 24 h as preculture. 10 ml of shaking flask medium were then inoculated to an OD.sub.660 of 0.2 and cultured at 37 C. at 200 rpm for 48 h. To prepare said medium, 20 g of ammonium sulphate, 0.4 g of MgSO.sub.4*7H.sub.2O, 0.6 g of KH.sub.2PO.sub.4 and 10 g of yeast extract were dissolved in 750 ml of H.sub.2O. The pH of the solution was adjusted to 7.8 with 20% NH.sub.4OH and the solution was then autoclaved. 4 ml of a vitamin solution (pH 7 with NH.sub.4OH), consisting of 0.25 g/l of thiamine, 50 mg/l of cyanocobalamin, 25 mg/l of biotin and 1.25 g/l of pyridoxine, were then added. In addition, 140 ml of a sterile-filtered 50% glucose solution and 50 g of dry autoclaved CaCO.sub.3 were added and the medium subsequently made up to one litre.

[0331] After culturing, the supernatant of four parallel cultures was in each case analysed by HPLC to determine the alanine and valine content with a detection limit of 0.01 g/l.

[0332] The type strain C. humireducens after culturing for 48 h in shaking flask medium at 37 C., 200 rpm at a shaking flask scale produces around 0.81 g/l of alanine (net yield: 0.011 g.sub.alanine/g.sub.glucose) and 1.6 g/l of valine (net yield: 0.022 g.sub.valine/g.sub.glucose) (Tab. 1).

TABLE-US-00001 TABLE 1 Analytical data from a shaking flask experiment with the type strain C. humireducens. The values measured after culturing with cells and with the blank medium are shown. Alanine (g/l) Valine (g/l) C. humireducens 1.27 1.9 Blank medium without cells 0.46 0.3

Example 2

Glutamate Performance Assay

[0333] For the L-glutamate performance assay, the type strain C. humireducens (DSM 45392) was cultured in a shaking flask batch. For this purpose, the C. humireducens strain was incubated in 10 ml of BHI liquid medium (Brain Heart Infusion; Merck) (37 g/l of H.sub.2O) at 37 C. at 200 rpm for 24 h as preculture. 10 ml of shaking flask medium were then inoculated to an OD.sub.660 of 0.2 and cultured at 37 C. at 200 rpm for 48 h. To prepare said medium, 20 g of ammonium sulphate, 0.4 g of MgSO.sub.4*7H.sub.2O, 0.6 g of KH.sub.2PO.sub.4 and 10 g of yeast extract were dissolved in 750 ml of H.sub.2O. The pH of the solution was adjusted to 7.8 with 20% NH.sub.4OH and the solution was then autoclaved. 4 ml of a vitamin solution (pH 7 with NH.sub.4OH), consisting of 0.25 g/l of thiamine, 50 mg/l of cyanocobalamin, 25 mg/l of biotin and 1.25 g/l of pyridoxine, were then added. In addition, 140 ml of a sterile-filtered 50% glucose solution and 50 g of dry autoclaved CaCO.sub.3 were added. 5 ml of a 400 mM sterile-filtered threonine stock solution were then added and the medium was subsequently made up to one litre.

[0334] After culturing, the supernatant of four parallel cultures was in each case analysed by HPLC to determine the glutamate content with a detection limit of 0.01 g/l.

[0335] The type strain C. humireducens after culturing for 48 h in shaking flask medium at 37 C., 200 rpm at a shaking flask scale produced 1.8 (+/0.6) g/l of L-glutamate. The initial concentration of L-glutamate in the medium was 0.78 (+/0.1) g/l.

Example 4

AEC Screening

[0336] Ten individual clones of the wild-type strain C. humireducens (DSM 45392) were each cultured in 10 ml of BHI liquid medium (Brain Heart Infusion; Merck) (37 g/l of H.sub.2O) in shaker flasks overnight at 37 C. and 200 rpm. Next in each case 100 l of the overnight culture was plated out onto minimal medium agar plates with 25 mM S-2-aminoethyl-L-cysteine (AEC) (MW=164 g/mol) and incubated for three days at 37 C. For the production of the minimal medium, 5 g of (NH.sub.4).sub.2SO.sub.4, 5 g of urea, 2 g of KH.sub.2PO.sub.4, 2 g of K.sub.2HPO.sub.4 and 10 g of MOPS were dissolved in 750 ml of H.sub.2O, the pH adjusted to 7.6 with 1 M KOH and the mixture autoclaved. The remaining components were made up and sterile-filtered separately. For this, 20 ml of 50% (w/v) glucose, 1 ml of 1% (w/v) CaCl.sub.2, 1 ml of 1 M MgSO.sub.4, 1 ml of 0.02% biotin and 1 ml of trace element solution (1 g of FeSO.sub.47 H.sub.2O, 1 g of MnSO.sub.47 H.sub.2O, 0.1 g of ZnSO.sub.47 H.sub.2O, 0.021 g of CuSO.sub.45 H.sub.2O and 0.002 g of NiCl.sub.26 H.sub.2O per 100 ml of H.sub.2O) were added to the medium and then made up to 1000 ml with sterile H.sub.2O. For the culturing on solid medium plates, 15 g/l agar-agar (Merck) was added to the medium. Visible individual colonies were again plated out onto fresh minimal medium agar plates with 25 mM AEC and 12.5 mM threonine as a fractionated smear and incubated for three days at 37 C. Then in each case 10 ml of BHI liquid medium (Brain Heart Infusion; Merck) (37 g/l of H.sub.2O) in the shaker flask were inoculated with a single clone and incubated overnight at 37 C. shaking at 200 rpm, then treated with 10% glycerine and stored at 80 C. as reference samples.

Sequence Analysis of the lysC Sequence Region

[0337] For the analysis of the lysC sequence regions of the isolated individual clones, the relevant gene region of lysC was amplified by means of primers (lysC_for: 5AGACGAAAGGCGGCCTACAC3 and lysC_rev: 5TCCAGGATCGAGCGCATCAC3) and the PCR technique. The DNA sequences obtained were analysed by means of the software Clone Manager. Through the analysis of the lysC sequence of the isolated AEC+threonine resistant C. humireducens clones, the following point mutations were identified:

TABLE-US-00002 TABLE 2 Identified changes in the lysC gene of AEC + threonine resistant C. humireducens clones and amino acid substitutions caused thereby. C. humireducens clones Point mutation AA substitution C. humireducens AEC Thr r#1 C .fwdarw. T T308I C. humireducens AEC Thr r#2 G .fwdarw. A G359D C. humireducens AEC Thr r#3 C .fwdarw. T T311I C. humireducens AEC Thr r#4 C .fwdarw. T T311I C. humireducens AEC Thr r#5 G .fwdarw. T D274Y C. humireducens AEC Thr r#6 C .fwdarw. T T308I C. humireducens AEC Thr r#7 C .fwdarw. A S301Y C. humireducens AEC Thr r#9 C .fwdarw. T T308I C. humireducens AEC Thr r#10 C .fwdarw. A A279E

Example 5

L-Lysine Performance Assay

[0338] The type strain C. humireducens and the isolated individual clones from the AEC+threonine screening were cultured in shaker flasks and subjected to a performance assay as regards their lysine synthesis on the shaker flask scale. For this, the C. humireducens strain and the isolated AEC+threonine resistant C. humireducens clones were incubated in 10 ml of BHI liquid medium (Brain Heart Infusion; Merck) (37 g/l of H.sub.2O) as a preculture at 37 C. and 200 rpm for 24 hrs. 10 ml of shaking flask medium were then inoculated to an OD.sub.660 of 0.2 and cultured at 37 C. at 200 rpm for 48 h. For the preparation of this medium 7.5 g of corn steep liquor (50%), 20 g of morpholinopropanesulphonic acid (MOPS), 25 g of (NH.sub.4).sub.2SO.sub.4, 0.1 g of KH.sub.2PO.sub.4, 1 g of MgSO.sub.4*7H.sub.2O, 0.01 g of CaCl.sub.2*2H.sub.2O, 0.01 g of FeSO.sub.4*7H.sub.2O and 0.005 g of MnSO.sub.4*H.sub.2O were dissolved in 750 ml of H.sub.2O, the pH was adjusted to 7.0 with aqueous ammonia and the mixture autoclaved. Next, 25 g of dry autoclaved CaCO.sub.3 were added. The remaining components were made up and sterile-filtered separately. For this, 90 ml of 50% (w/v) glucose and 10 ml of a solution of 30 mg/l thiamine and 20 mg/l biotin were added to the medium and then made up to 1000 ml with sterile H.sub.2O.

[0339] After the culturing, in each case from the supernatant of two parallel cultures, an HPLC analysis was performed for determination of the L-lysine contents with a detection limit of 0.01 g/l. The lysine end titres and yields of the cultures are shown in the following table.

TABLE-US-00003 TABLE 3 Mean values and standard deviation of the lysine end titres of two parallel cultures with AEC + threonine resistant C. humireducens clones after 48 h culturing in shaker flask medium at 37 C. and 200 rpm. Lysine (g/l) Mean value Std. dev. Type strain C. humireducens 0.13 0.01 C. humireducens_AEC_Thr_r#1 1.33 0.08 C. humireducens_AEC_Thr_r#2 1.33 0.08 C. humireducens_AEC_Thr_r#3 1.25 0.01 C. humireducens_AEC_Thr_r#4 1.29 0.01 C. humireducens_AEC_Thr_r#5 1.24 0.09 C. humireducens_AEC_Thr_r#6 0.85 0.04 C. humireducens_AEC_Thr_r#7 1.12 0.00 C. humireducens_AEC_Thr_r#9 1.18 0.02 C. humireducens_AEC_Thr_r#10 1.34 0.03