COMPOSITIONS AND METHODS FOR REDUCING PATHOGEN-INDUCED CITRUS GREENING
20170044560 ยท 2017-02-16
Assignee
Inventors
- Nitzan PALDI (MOSHAV BAR GIORA, IL)
- Humberto Freire BONCRISTIANI JUNIOR (Odenton, MD, US)
- Eyal MAORI (Rishon-LeZion, IL)
- Alon WELLNER (Herzlia, IL)
- Shaul ILAN (Nofit, IL)
Cpc classification
A01K2227/706
HUMAN NECESSITIES
C12N15/8245
CHEMISTRY; METALLURGY
C12N15/113
CHEMISTRY; METALLURGY
C12N15/1138
CHEMISTRY; METALLURGY
C12N15/827
CHEMISTRY; METALLURGY
C12N2320/32
CHEMISTRY; METALLURGY
A01K2217/07
HUMAN NECESSITIES
C12N15/8218
CHEMISTRY; METALLURGY
C12N15/8261
CHEMISTRY; METALLURGY
C12N2320/35
CHEMISTRY; METALLURGY
C12N15/8243
CHEMISTRY; METALLURGY
A01N25/002
HUMAN NECESSITIES
C12N15/8271
CHEMISTRY; METALLURGY
International classification
Abstract
The present invention, in some embodiments thereof, relates to methods for enhancing fitness of pathogen-infected plants, and, more particularly, but not exclusively, to methods of using RNA interference for modulation of plant-pathogen resistance response gene expression. In particular, the present invention provides compositions and methods for enhancing host plant fitness and fruit yield and quality following Candidatus Liberibacter spp infection and, specifically, Candidatus Liberibacter spp infection in citrus plants and trees, as in Huang Long Bing.
Claims
1. A method of increasing yield, growth rate, vigor, biomass, fruit quality or stress tolerance of a citrus plant when infected with a plant pathogen, the method comprising introducing into the citrus plant an isolated nucleic acid agent comprising a nucleic acid sequence which specifically reduces the expression of at least one plant pathogen resistance gene product of the plant, thereby modulating at least one plant pathogen resistance response and increasing yield, growth rate, vigor, biomass, fruit quality or stress tolerance of said citrus plant when infected with a plant pathogen.
2. A method of increasing yield, growth rate, vigor, biomass, fruit quality or stress tolerance of a plant when infected with a Candidatus Liberibacter spp, the method comprising introducing into the plant an isolated nucleic acid agent comprising a nucleic acid sequence which specifically reduces the expression of at least one plant pathogen resistance gene product of the plant, thereby modulating at least one plant pathogen resistance response and increasing yield, growth rate, vigor, biomass, fruit quality or stress tolerance of said plant when infected with a Candidatus Liberibacter spp.
3. The method of claim 1, wherein said plant pathogen is a Candidatus Liberibacter spp.
4. The method of claim 2, wherein said plant is a citrus plant or a Solanaceous plant.
5. The method of claim 2, wherein said plant is a citrus plant.
6. The method of claim 1, further comprising monitoring symptoms of infection in the infected plant following said introducing.
7-8. (canceled)
9. The method of claim 1, wherein said plant, when infected, is suffering from HuangLongBing disease (HLB or citrus greening).
10. The method of claim 1, wherein said plant pathogen resistance response is selected from the group consisting of changes in Salicylic acid levels, changes in Jasmonic acid levels, changes in Gibberellic acid levels, changes in Auxin levels, changes in Cytokinin levels, changes in Ethylene levels, changes in ABA phyto-hormones levels, up-regulation of phyto-hormone-related genes, biosynthesis, deposition and degradation of callose, reactive oxygen species production, functional FLS2/BAK1 complex formation, protein-kinase pathway activation, phloem blockage, starch accumulation, starch accumulation in phloem parenchyma cells, polymer sieve formation, changes in carbohydrate metabolism, cambial activity aberrations, sucrose accumulation and carotenoid synthesis.
11. The method of claim 1, wherein said increase in yield, growth rate, vigor, biomass, fruit quality or stress tolerance is a change in a parameter selected from the group consisting of increased water uptake, increased plant height, increased plant flower number, decreased starch accumulation and decreased Disease Sign Index.
12-13. (canceled)
14. The method of claim 1, wherein said plant pathogen resistance gene product is selected from plant gene products having upregulated expression following infection of the plant with said plant pathogen.
15. The method of claim 1, wherein said plant pathogen resistance gene product is selected from the group consisting of the polynucleotide sequences of Table IV and/or Table IV(a).
16. The method of claim 2, wherein said plant pathogen resistance gene product is selected from the group consisting of plant gene products having at least 60% identity to any of the polynucleotide sequences of Table II.
17. The method of claim 15, wherein said plant pathogen resistance gene product is selected from the group consisting of the polynucleotide sequences of Table V.
18. The method of claim 16, wherein said plant pathogen resistance gene product is selected from the group consisting of plant gene products having at least 60% identity to any of the polynucleotide sequences of Table III.
19. The method of claim 1, wherein said plant pathogen resistance gene product is selected from the group consisting of an ADP-glucose pyrophosphorylase large subunit (AGPase) gene product, a glucose-6-phosphate/phosphate translocator (GPT) gene product, a Callose synthase gene product and a Myb transcriptional regulator (MYB) gene product.
20. (canceled)
21. The method of claim 2, wherein said plant is a fruit tree, and optionally, a citrus tree.
22. The method of claim 1, wherein said isolated nucleic acid agent further comprises a cell penetrating agent.
23. The method of claim 1, wherein said introducing is following detection of a symptom of infection of said plant with said pathogen.
24. An isolated nucleic acid agent comprising a nucleic acid sequence which specifically reduces the expression of at least one plant pathogen resistance gene product selected from the group consisting of plant gene products having at least 60% identity to any of the polynucleotide sequences of Table II.
25-30. (canceled)
31. The isolated nucleic acid agent of claim 24, wherein said plant pathogen resistance gene is a HuangLongBing-associated plant pathogen resistance gene selected from SEQ ID NOs: 204-265 and 489-516 or homologs thereof.
32. The isolated nucleic acid agent of claim 24, wherein said plant pathogen resistance gene is a HuangLongBing-associated plant pathogen resistance gene selected from SEQ ID NOs: 1-203 or homologs thereof.
33. The isolated nucleic acid agent of claim 24, wherein said plant pathogen resistance gene is selected from SEQ ID NOs: 623-714 or homologs thereof.
34. The isolated nucleic acid agent of claim 24, wherein said plant pathogen resistance gene product is selected from the group consisting of an ADP-glucose pyrophosphorylase large subunit (AGPase) gene product, a glucose-6-phosphate/phosphate translocator (GPT) gene product, a Callose synthase gene product and a Myb transcriptional regulator (MYB) gene product.
35. The isolated nucleic acid agent of claim 24, wherein said nucleic acid sequence comprises a nucleic acid sequence selected from the group consisting of SEQ ID NOs. 528, 530, 532 and 536.
36. A nucleic acid construct comprising a nucleic acid sequence encoding the isolated nucleic acid agent of claim 24.
37-41. (canceled)
42. A citrus plant comprising at least one exogenous isolated nucleic acid agent comprising a nucleic acid sequence which specifically reduces the expression of at least one plant pathogen resistance gene product.
43. A plant comprising at least one exogenous isolated nucleic acid agent comprising a nucleic acid sequence which specifically reduces the expression of at least one plant pathogen resistance gene product selected from the group consisting of plant gene products having at least 60% identity to any of the polynucleotide sequences of Table II.
44. The plant of claim 43, wherein said plant is selected from the group consisting of a tree, a shrub, a bush, a seedling, a scion, a rootstock, an inarched plant, a bud, a budwood, a root and a graft.
45. The plant of claim 43, wherein said plant is a citrus or citrus-related plant.
46. The plant of claim 42, wherein said plant is a plant at risk of infection with CaLas.
47. A cell of the plant of claim 43.
48-50. (canceled)
51. The method of claim 2, further comprising monitoring symptoms of infection in the infected plant following said introducing.
52. The method of claim 2, wherein said plant pathogen resistance gene product is selected from the group consisting of an ADP-glucose pyrophosphorylase large subunit (AGPase) gene product, a glucose-6-phosphate/phosphate translocator (GPT) gene product, a Callose synthase gene product and a Myb transcriptional regulator (MYB) gene product.
Description
BRIEF DESCRIPTION OF THE SEVERAL VIEWS OF THE DRAWINGS
[0069] Some embodiments of the invention are herein described, by way of example only, with reference to the accompanying drawings. With specific reference now to the drawings in detail, it is stressed that the particulars shown are by way of example and for purposes of illustrative discussion of embodiments of the invention. In this regard, the description taken with the drawings makes apparent to those skilled in the art how embodiments of the invention may be practiced.
[0070] In the drawings:
[0071]
[0072]
[0073]
[0074]
[0075]
[0076]
[0077]
[0078]
[0079]
[0080]
[0081]
[0082]
[0083]
[0084]
[0085]
[0086]
[0087]
[0088]
[0089]
[0090]
[0091]
[0092]
[0093]
[0094]
[0095]
[0096]
[0097]
[0098]
[0099]
[0100]
[0101]
[0102]
[0103]
[0104]
DESCRIPTION OF SPECIFIC EMBODIMENTS OF THE INVENTION
[0105] The present invention, in some embodiments thereof, relates to methods for enhancing fitness of pathogen-infected plants, and, more particularly, but not exclusively, to methods of using RNA interference for modulation of plant-pathogen resistance response gene expression. The present invention discloses compositions for silencing of specific plant pathogen resistance response genes with siRNA in pathogen-susceptible plants, reducing the negative impact of the plant pathogen resistance response upon infection of the host plant and enhancing fitness. In particular, the present invention provides compositions and methods for enhancing host plant fitness and fruit yield and quality following Candidatus Liberibacter spp infection and, specifically, Candidatus Liberibacter spp infection in citrus plants and trees, as in Huang Long Bing.
[0106] Before explaining at least one embodiment of the disclosure in detail, it is to be understood that the disclosure is not necessarily limited in its application to the details set forth in the following description or exemplified by the Examples. The disclosure is capable of other embodiments or of being practiced or carried out in various ways. Also, it is to be understood that the phraseology and terminology employed herein is for the purpose of description and should not be regarded as limiting.
[0107] It is understood that any Sequence Identification Number (SEQ ID NO) disclosed in the instant application can refer to either a DNA sequence or a RNA sequence, depending on the context where that SEQ ID NO is mentioned, even if that SEQ ID NO is expressed only in a DNA sequence format or a RNA sequence format. For example, SEQ ID NO: 527 is expressed in a DNA sequence format (e.g., reciting T for thymine), but it can refer to either a DNA sequence that corresponds to an alpha-amylase nucleic acid sequence, or the RNA sequence of an RNA molecule (e.g. reciting U for uridine) that corresponds to the RNA sequence shown. In any event, both DNA and RNA molecules having the sequences disclosed with any substitutes are envisioned.
[0108] Plant immune response provides protection against a variety of phytopathogenic organisms, including bacteria, fungi, nematodes, viruses, mollicutes (mycoplasmas, spiroplasmas), protozoa, phanerogams; rickettsias, and viroids, insects and parasitic plants. The two-tiered system of plant innate immune response to pathogen insult or invasion [microbial/pathogen-associated molecular pattern- (PAMP or MAMP) triggered immunity, or PTI, and effector-triggered immunity, or ETI) can be divided into characteristic stages: In stage 1, plants detect MAMPs and/or PAMPs via transmembrane pattern recognition receptors (PRRs, such as Receptor-Like Kinases, RLKs), triggering PTI. The plant's initial response to the pathogen insult is mediated by numerous, somewhat overlapping signaling cascades (salicylic acid signaling is critical) and includes molecular, morphological and physiological changes. Early changes occurring within seconds to minutes include ion-flux across the plasma membrane, phytoalexin synthesis, an oxidative burst, mitogen activated protein (MAP) kinase activation and protein phosphorylation, followed by substantial transcriptional reprogramming within the first hour of PTI. Later changes include pathogenesis-related protein synthesis, callose deposition, which serves as a physical barrier at infection sites, and stomatal closure.
[0109] In stage 2, virulent pathogens respond to the PRR-based defenses by deploying effectors into the host cell to evade or suppress PTI responses. These in turn activate stage 3, in which ETI, mediated by intracellular nucleotide-binding domain Leucine-Rich Repeat (LRR) proteins, leads to growth inhibition and often accompanying hypersensitive response.
[0110] The hypersensitive response involves a form of programmed cell death at the site of the pathogen invasion. The hypersensitive response is characterized by cytoplasmic shrinkage, chromatin condensation, mitochondrial swelling, vacuolization and chloroplast disruption. Molecular events underlying the hypersensitive response include down-regulation of photosynthesis, increased production and accumulation of reactive oxygen species, reactive nitrogen oxide intermediates and the defense hormones salicylic and jasmonic acid, activation of MAPK cascades changes in intracellular calcium levels and transcriptional reprogramming, however, with greater amplitude and acceleration than in the PTI stage.
[0111] Pathogen infection also produces a type of systemic response in the plant, remote from the site of infection, priming other plant organs and tissues for pathogen insult. The systemic acquired response (SAR) prepares the unaffected tissues for contact with the pathogens by mobilizing pathogenesis related proteins, signaling and synthetic pathways, allowing for swift and heightened response in the event of pathogen insult in unaffected tissues, while economically avoiding the initiation of a full-blown response until actually challenged. The systemic signals mediating SAR have not been fully elucidated, but salicylic acid has been confirmed as an important signaling intermediate.
[0112] The result of the PTI, ETI, hypersensitive response and SAR, in response to a pathogen insult, is often significant re-allocation of energy resources and growth inhibition, isolation of the affected region and, ultimately cell death and necrosis of affected regions. P-protein accumulation and callose formation act to occlude sieve elements in the vascular system of pathogen-infected tissue, blocking pathogen and pathogen effector dispersal, resulting in bidirectional disruption of water, metabolite and hormone transport.
[0113] Thus, while the plant pathogen responses act to effectively isolate the affected tissues and limit pathogen reproduction, plant pathogen defenses involve significant energy expenditure, metabolic and morphological re-organization, ultimately detrimental to plant vigor, fitness, growth and crop (i.e. fruit, seed, etc) production. Of particular importance is the common re-infection by plant pathogens, for example by repeated contact with pathogen-bearing insect vectors effective in disseminating the pathogenic organisms, and the recurrent activation of the plant pathogen response, depletion of plant resources and subsequent loss of host plant vigor.
[0114] RNA interference (dsRNA and siRNA) strategies have been shown to be effective in silencing gene expression in a broad variety of species, including plants.
[0115] RNA interference (RNAi) inhibits gene expression in a sequence specific fashion, occurring in at least two steps: The first step cleaves a longer dsRNA into shorter, 21- to 25-nucleotide-long dsRNAs, termed small interfering RNAs or siRNAs. In the second step, the smaller siRNAs then mediate the degradation of a target corresponding mRNA molecule. This RNAi effect can be achieved by introduction of either longer double-stranded RNA (dsRNA) or shorter small interfering RNA (siRNA) to the target sequence within cells.
[0116] RNAi has been successfully demonstrated in plant-pest management. Plants possess an innate RNA interference capability, similar but not identical to animal RNAi, highly effective in preventing spread of viral pathogens. Also, as most insects are susceptible to RNAi gene silencing by dsRNA, expression of pest-specific dsRNA in transgenic plants, as well as direct application of dsRNA to the insect pests can afford protection from plant-pest injury and damage. The introduction of dsRNA into transgenic plants can be highly specific to target pathogens. Indeed, gene silencing by dsRNA has been demonstrated effective for plant-pest control and plant-virus control, for example, US Patent Publication No. 20110150839 to Arciello et al discloses the transgenic expression, in a plant host, of a construct encoding a pathogen GPCR receptor-specific dsRNA for enhancing the resistance of the plant to attack by phytopathogenic organisms.
[0117] Resistance to Potato-Y virus, Cucumber and Tobacco Mosaic Virus, Tomato Spotted Wilt Virus, Bean Golden Mosaic Virus, Banana Bract Mosaic Virus, and Rice Tungro Bacilliform Virus among many others has been demonstrated in transgenic plants expressing viral-specific RNA transcripts. Transgenic expression of fungal-specific dsRNA effectively conferred resistance to barley powdery mildew Blumeria graminis in barley.
[0118] It has been found that direct application of dsRNA is also effective in plantsfor example, viral-specific double-stranded RNA (dsRNA) from the tobamovirus, potyvirus, and alfamovirus groups, when directly delivered to leaf cells, effectively inhibited infection of the plants. Methods for introduction of dsRNA into seeds, shoots, plant cell culture and all tissues and organs of adult plants are well known in the art.
[0119] The present inventors propose to reduce the deleterious effects of the plant pathogen resistance response on plant fitness, growth, yield and fruit quality by modulating plant-pathogen resistance response gene expression using RNAi gene silencing of endogenous pathogen resistance response genes, in citrus or other Candidatus Liberibacter spp-susceptible host plants. The present inventors have identified target pathogen-resistance response-associated genes and designed nucleic acid agents for RNAi silencing which, when provided to the plant, improve the fitness, vigor, yield, fruit quality and other traits of the plant following pathogen infection.
[0120] Thus, according to some embodiments of aspects of the invention there is provided a method of increasing yield, growth rate, vigor, biomass, stress tolerance or fruit quality of a citrus plant when infected with a plant pathogen, the method comprising introducing into the citrus plant an isolated nucleic acid agent comprising a nucleic acid sequence which specifically reduces the expression of at least one plant pathogen resistance gene product of a plant, thereby modulating at least one plant pathogen resistance response and increasing yield, growth rate, vigor, biomass, fruit quality or stress tolerance of the citrus plant when infected with the plant pathogen.
[0121] In yet another embodiment of the present invention, there is provided a method of increasing yield, growth rate, vigor, biomass, stress tolerance or fruit quality of a plant when infected with a Candidatus Liberibacter spp bacteria, the method comprising introducing into the plant an isolated nucleic acid agent comprising a nucleic acid sequence which specifically reduces the expression of at least one plant pathogen resistance gene product of the plant, thereby modulating at least one plant pathogen resistance response and increasing yield, growth rate, vigor, biomass, fruit quality or stress tolerance of the plant when infected with the Candidatus Liberibacter spp bacteria.
[0122] The term plant as used herein encompasses whole plants, ancestors and progeny of the plants and plant parts, including seeds, shoots, stems, roots (including tubers), and isolated plant cells, tissues and organs. The plant may be in any form including suspension cultures, embryos, meristematic regions, callus tissue, leaves, gametophytes, sporophytes, pollen, and microspores. It will be appreciated, that the plant or seed thereof may be transgenic plants.
[0123] As used herein the phrase plant cell refers to plant cells which are derived and isolated from disintegrated plant cell tissue or plant cell cultures. The phrase plant cell may also refer to plant cells in situ, e.g. cells of plant tissue, which are not isolated from the tissue or plant organ.
[0124] As used herein the phrase plant cell culture refers to any type of native (naturally occurring) plant cells, plant cell lines and genetically modified plant cells, which are not assembled to form a complete plant, such that at least one biological structure of a plant is not present. Optionally, the plant cell culture of this embodiment of the present disclosure may comprise a particular type of a plant cell or a plurality of different types of plant cells. It should be noted that optionally plant cultures featuring a particular type of plant cell may be originally derived from a plurality of different types of such plant cells. In certain embodiments according to the present disclosure, the plant cell is a non-sexually producing plant cell. In other aspects, a plant cell of the present disclosure is a non-photosynthetic plant cell.
[0125] Any commercially or scientifically valuable plant susceptible to infection by Candidatus Liberibacter spp. is envisaged in accordance with some embodiments of the invention. Plants that are particularly useful in the methods of the disclosure include, but are not limited to:
[0126] Plants from the Rutaceae family such as all citrus species and subspecies, including sweet oranges commercial varieties (Citrus sinensis Osbeck (L.), clementines (C. reticulata), limes (C. aurantifolia), lemon (C. limon), sour orange (C. aurantium), hybrids and relatives (Citranges, Citrumelos, Citrandarins), Balsamocitrus dawei, C. maxima, C. jambhiri, Clausena indica, C. lansium, Triphasia trifolia, Swinglea glutinosa, Micromellum tephrocarpa, Merope spp., Eremolemon; Atalantia spp., Severinia buxifolia; Microcitrus spp., Fortunella spp., Calodendrum capense, Murraya spp., Poncirus trifoliate;
[0127] Plants of the Solanaceae family such as Tobacco (Nicotiana spp.), Tomato (Lycopersicon esculentum), Potato (Solanum tuberosum), Capsicum (Capsicum annuum), Cape gooseberry (Physalis peruviana), Tomato tree or Tamarillo (Solanum betaceum);
[0128] Plants from Rosaceae family such as Pear (Pyrus communis);
[0129] Plants from Apiaceae family such as Carrot (Daucus carota);
[0130] Plants from Convolvulaceae family such as Dodder (Cuscuta spp.)
[0131] Plants from Apocynaceae family such as: Vinca (Catharanthus roseus).
[0132] According to some embodiments, the plant used by the method of the invention is a crop plant.
[0133] According to a specific embodiment, the plant is selected from the group consisting of citrus plants, including, but not limited to all citrus species and subspecies, including sweet oranges commercial varieties (Citrus sinensis Osbeck (L.), clementines (C. reticulata), limes (C. aurantifolia), lemon (C. limon), sour orange (C. aurantium), hybrids and relatives (Citranges, Citrumelos, Citrandarins), Balsamocitrus dawei, C. maxima, C. jambhiri, Clausena indica, C. lansium, Triphasia trifolia, Swinglea glutinosa, Micromellum tephrocarpa, Merope spp., Eremolemon; Atalantia spp., Severinia buxifolia; Microcitrus spp., Fortunella spp., Calodendrum capense, Murraya spp. and Poncirus trifoliate. In some embodiments the citrus plant is an orange, a lemon, a lime, a grapefruit, a clementine, a tangerine or a pornello tree. The citrus tree can be a seed-grown tree or a grafted tree, grafted onto a different citrus rootstock.
[0134] As used herein, the phrase plant pathogen or phytopathogen refers to a nucleic acid-containing agent capable of proliferation within the plant cell or plant, the pathogen causing disease in the plant, by disrupting normal function and/or growth of the plant, usually by invasion of the plant cell, and exploiting the plant cell nutrients, metabolites and/or energy metabolism for pathogen reproduction. Plant pathogenic organisms include pathogenic viruses, bacteria, fungi, oomycetes, Ascomycetes, Basidomycetes, nematodes, mollicutes (mycoplasmas, spiroplasmas), protozoa, phanerogams, rickettsias, and viroids, insects and parasitic plants.
[0135] A plant pathogen can be an intracellular or extra-cellular pathogen. Table I below includes a non-exhaustive list of exemplary plant pathogens which cause or facilitate the indicated disease in the indicated host plant, the response to which is amenable to modulation by the compositions and methods of the present invention.
TABLE-US-00001 TABLE I Host plant Disease Bacterial pathogen Tomato Bacterial canker Clavibacter michiganensis subsp. michiganensis Tomato Bacterial speck Pseudomonas syringae pv. tomato Tomato Bacterial spot Xanthomonas campestris pv. vesicatoria Tomato Bacterial stem rot and fruit rot Erwinia carotovora subsp. carotovora Tomato Bacterial wilt Ralstonia solanacearum Tomato Pith necrosis Pseudomonas corrugata Tomato Syringae leaf spot Pseudomonas syringae pv. syringae Tomato Psyllid yellowing Candidatus Liberibacter psyllaurous Tomato Zebra chip Candidatus Liberibacter solanacearum (Lso) Citrus Bacterial spot Xanthomonas campestris pv. citrumelo Citrus Black pit (fruit) Pseudomonas syringae Citrus Blast Pseudomonas syringae Citrus Citrus canker Xanthomonas axonopodis = Xanthomonas campestris pv. citri Citrus Citrus stubborn Spiroplasma citri Citrus Citrus variegated chlorosis Xylella fastidiosa Citrus Huanglongbing = citrus Candidatus Liberibacter asiaticus; greening Candidatus Liberibacter africanus; Candidatus Liberibacter americanus
[0136] According to one embodiment of the invention, the pathogen is a bacteria, causing or facilitating Huanglongbing disease, such as Candidatus Liberibacter asiaticus, Candidatus Liberibacter africanus, Candidatus Liberibacter americanus and the like. According to another embodiment of the invention, the pathogen is a bacteria, causing or facilitating a disease in tomato such as zebra chip disease (Candidatus Liberibacter solanacearum (Lso)), psyllid yellowing (Candidatus Liberibacter psyllaurous) and the like.
[0137] As used herein, the terms plant disease or pathogen infection is defined as undesirable changes in the physiology, morphology, reproductive fitness, economic value, vigor, biomass, fruit quality, stress-tolerance, resistance to infection and/or infestation of a plant, directly or indirectly resulting from contact with a plant pathogenic agent. According to one embodiment of the invention, the undesirable changes include, but are not limited to biomass and/or yield of the diseased or pathogen infected plant. According to another embodiment of the invention, change in yield includes, but is not limited to change in fruit yield, fruit quality, seed yield, flower yield, crop yield and the like. In some embodiments, the host plant is a citrus tree or bush and the plant disease or pathogenic infection is a Candidatus Liberibacter infection, in particular, a Candidatus Liberibacter asiaticus infection. In some embodiments, the Candidatus Liberibacter infection causes HLB disease in the host plant.
[0138] HLB disease, caused by infection of a susceptible host plant (e.g. a citrus plant) with a Candidatus Liberibacter pathogen, such as, but not limited to C. Liberibacter asiaticus, is characterized by asymmetric blotchy mottling of older leaves, chlorotic patterns, twig-dieback, reduced fruit production, premature fruit drop and eventually tree decline, most likely due to blockage of the translocation stream by plugging of sieve elements along with phloem necrosis. Thus, in some embodiments of some aspects of the invention, introducing the isolated nucleic acid agent of the invention into the susceptible plant (e.g. citrus tree) results in reduced mottling and fewer chlorotic patterns in the leaves, reduced twig die-back, improved fruit production, prevention of premature fruit drop, increased vigor and delay or prevention of decline in treated plants and trees following Candidatus Liberibacter infection, as compared to identical untreated plants and trees, following infection by Candidatus Liberibacter spp.
[0139] According to some embodiments of the invention, reducing expression of at least one plant pathogen resistance response gene product in a plant increases at least one of yield, growth rate, vigor, biomass or stress tolerance of the plant following pathogen infection, compared to a similar or identical plant having normal expression of the at least one plant pathogen resistance response gene product, following pathogen infection.
[0140] As used herein, the phrase stress tolerance refers to both tolerance to biotic stress, and tolerance to abiotic stress. The phrase abiotic stress as used herein refers to any adverse effect on metabolism, growth, viability and/or reproduction of a plant caused by a-biotic agents. Abiotic stress can be induced by any of suboptimal environmental growth conditions such as, for example, water deficit or drought, flooding, freezing, low or high temperature, strong winds, heavy metal toxicity, anaerobiosis, high or low nutrient levels (e.g. nutrient deficiency), high or low salt levels (e.g. salinity), atmospheric pollution, high or low light intensities (e.g. insufficient light) or UV irradiation. Abiotic stress may be a short term effect (e.g. acute effect, e.g. lasting for about a week) or alternatively may be persistent (e.g. chronic effect, e.g. lasting for example 10 days or more). The present disclosure contemplates situations in which there is a single abiotic stress condition or alternatively situations in which two or more abiotic stresses occur.
[0141] As used herein the phrase abiotic stress tolerance refers to the ability of a plant to endure an abiotic stress without exhibiting substantial physiological or physical damage (e.g. alteration in metabolism, growth, viability and/or reproducibility of the plant).
[0142] According to some embodiments, reducing expression of at least one plant pathogen resistance response gene product in a pathogen-infected plant increases crop production. Crop production can be measured by biomass, vigor or yield, and can be used to calculate nitrogen use efficiency and fertilizer use efficiency. As used herein, the phrase nitrogen use efficiency (NUE) refers to a measure of crop production per unit of nitrogen fertilizer input. Fertilizer use efficiency (FUE) is a measure of NUE. The plant's nitrogen use efficiency is typically a result of an alteration in at least one of the uptake, spread, absorbance, accumulation, relocation (within the plant) and use of nitrogen absorbed by the plant. Improved crop production, vigor, yield, NUE or FUE is with respect to that of a pathogen-infected or diseased plant not having reduced expression of the at least one plant pathogen resistance gene product (i.e., lacking the nucleic acid agent of the invention) of the same or similar species and developmental stage and grown under the same or similar conditions.
[0143] As used herein the term/phrase biomass, biomass of a plant or plant biomass refers to the amount (e.g., measured in grams of air-dry tissue) of a tissue produced from the plant in a growing season. An increase in plant biomass can be in the whole plant or in parts thereof such as aboveground (e.g. harvestable) parts, vegetative biomass, roots and/or seeds or contents thereof (e.g., oil, starch etc.).
[0144] As used herein the term/phrase vigor, vigor of a plant or plant vigor refers to the amount (e.g., measured by weight) of tissue produced by the plant in a given time. Increased vigor could determine or affect the plant yield or the yield per growing time or growing area. In addition, early vigor (e.g. seed and/or seedling) results in improved field stand.
[0145] As used herein the term/phrase yield, yield of a plant or plant yield refers to the amount (e.g., as determined by weight or size) or quantity (e.g., numbers) of tissues or organs produced per plant or per growing season. Increased yield of a plant can affect the economic benefit one can obtain from the plant in a certain growing area and/or growing time.
[0146] According to one embodiment the yield is measured by cellulose content, oil content, starch content and the like.
[0147] According to another embodiment the yield is measured by oil content.
[0148] According to another embodiment the yield is measured by protein content.
[0149] According to another embodiment, the yield is measured by seed number, seed weight, flower number or flower weight, fruit number or fruit weight per plant or part thereof (e.g., kernel, bean).
[0150] A plant yield can be affected by various parameters including, but not limited to, plant biomass; plant vigor; plant growth rate; seed yield; seed or grain quantity; seed or grain quality; oil yield; content of oil, starch and/or protein in harvested organs (e.g., seeds or vegetative parts of the plant); flower development, number of flowers (e.g. florets) per panicle (e.g. expressed as a ratio of number of filled seeds over number of primary panicles); harvest index; number of plants grown per area; number and size of harvested organs per plant and per area; number of plants per growing area (e.g. density); number of harvested organs in field; total leaf area; carbon assimilation and carbon partitioning (e.g. the distribution/allocation of carbon within the plant); resistance to shade; resistance to lodging, number of harvestable organs (e.g. seeds, flowers), seeds per pod, weight per seed, flowers per plant; and modified architecture [such as increase stalk diameter, thickness or improvement of physical properties (e.g. elasticity)].
[0151] According to some embodiments of aspects of the invention, fruit quality and yield are increased by introduction into the plant of the nucleic acid agent. Fruit yield can be measured according to harvest index (see above), expressed as number and/or size of fruit per plant or per growing area, and/or according to the quality of the fruit-fruit quality can include, but is not limited to sugar content, appearance of the fruit, shelf life and/or suitability for transport of the fruit, ease of storage of the fruit, increase in commercial value, fruit weight, juice weight, juice weight/fruit weight, rind weight, TSStotal soluble solids (Brix), seed quality, symmetry, dry weight, TAtitrable acidity, MImaturity index, CIColour index, peel colour, nutraceutical properties vitamin Cascorbic acidcontent, hesperidin content, total flavonoids content and the like.
[0152] Improved plant NUE is translated in the field into either harvesting similar quantities of yield, while deploying less fertilizer, or increased yields gained by implementing the same levels of fertilizer. Thus, improved NUE or FUE has a direct effect on plant yield in the field.
[0153] As used herein biotic stress refers stress that occurs as a result of damage done to plants by other living organisms, such as bacteria, viruses, fungi, parasites, beneficial and harmful insects, weeds, and cultivated or native plants. It will be appreciated that, in some embodiments, improving or increasing vigor or growth rate of a plant pathogen infected or diseased plant according some aspects of some methods of the invention, while reducing the expression of at least one plant pathogen resistance response gene, contributes to the overall health and robustness of the plant, thereby conferring improved tolerance to biotic, as well as abiotic stress. Such biotic stress can be, for example, the result of infection with same pathogen(s) with which the infected or diseased plant was infected prior to introduction of the isolated nucleic acid agent, or with a different plant pathogen.
[0154] In some embodiments of the invention, introduction of the isolated nucleic acid agent of the invention into the plant, and modulation of the at least one plant pathogen resistance response results in: improved tolerance of abiotic stress (e.g., tolerance of water deficit or drought, heat, cold, non-optimal nutrient or salt levels, non-optimal light levels) or of biotic stress (e.g., crowding, allelopathy, or wounding); a modified primary metabolite (e.g., fatty acid, oil, amino acid, protein, sugar, or carbohydrate) composition; a modified secondary metabolite (e.g., alkaloids, terpenoids, polyketides, non-ribosomal peptides, and secondary metabolites of mixed biosynthetic origin) composition; a modified trace element (e.g., iron, zinc), carotenoid (e.g., beta-carotene, lycopene, lutein, zeaxanthin, or other carotenoids and xanthophylls), or vitamin (e.g., tocopherols) composition; improved yield (e.g., improved yield under non-stress conditions or improved yield under biotic or abiotic stress); improved ability to use nitrogen or other nutrients; modified agronomic characteristics (e.g., delayed ripening; delayed senescence; earlier or later maturity; improved shade tolerance; improved resistance to root or stalk lodging; improved resistance to green snap of stems; modified photoperiod response); modified growth or reproductive characteristics; improved harvest, storage, or processing quality (e.g., improved resistance to pests during storage, improved fruit harvest, fruit storage, or fruit processing quality (e.g., improved resistance to pests during storage, improved resistance to breakage, improved appeal to consumers); or any combination of these traits.
[0155] In some embodiments of the invention, introduction of the isolated nucleic acid agent of the invention into the plant, and modulation of the at least one plant pathogen resistance response results in changes in height, water uptake, number of flowers, starch accumulation and Disease Sign Index of the treated plants when infected with a Candidatus Liberibacter pathogen, relative to infected plants untreated with the nucleic acid agent. In some embodiments, the parameters are increased, such as number of flowers, height and water uptake, indicating improved phenotype of the treated plants in response to the infection with Candidatus Liberibacter pathogen. In other embodiments, parameters such as starch accumulation and disease sign index (DSI) are decreased in plants receiving the isolated nucleic acid agent of the invention into the plant, and undergoing modulation of the at least one plant pathogen resistance response, indicating improved phenotype of the treated plants in response to the infection with Candidatus Liberibacter pathogen.
[0156] As used herein the term improving or increasing refers to at least about 2%, at least about 3%, at least about 4%, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90% or greater increase in NUE, in tolerance to stress, in growth rate, in yield, in biomass, in fruit quality, in height, in flower number, in water uptake or in vigor of a plant, as compared to the same or similar plant infected with the same pathogen or having the same disease, and not having reduced expression of at least one plant pathogen resistance gene product (i.e., plant lacking the nucleic acid agent) of the disclosure.
[0157] As used herein the term decreasing refers to at least about 2%, at least about 3%, at least about 4%, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90% or greater decrease in disease signs such as DSI, starch accumulation and the like of a plant, as compared to the same or similar plant infected with the same pathogen or having the same disease, and not having reduced expression of at least one plant pathogen resistance gene product (i.e., plant lacking the nucleic acid agent) of the disclosure.
[0158] In some embodiments, the changes in height, water uptake, number of flowers, starch accumulation and Disease Sign Index of the treated plants when infected with a Candidatus Liberibacter pathogen, relative to infected plants untreated with the nucleic acid agent is measured at a time point 2-3 weeks post infection, 3-4 weeks post infection, 5-7 weeks post infection, 1-2 months post infection, 2-4 months post infection, 4-6 months post infection, 5-8 months post infection and 5-12 months post infection or more.
[0159] According to some embodiments of the invention, plant parameters are monitored in the treated plants following introduction of the nucleic acid agent. In some embodiments, parameters of plant pathogen resistance response are monitored, for example, expression of plant pathogen resistance response genes, and/or physiological or metabolic symptoms of the expression of such plant pathogen resistance response genes. In other embodiments, instead of, or in addition to monitoring parameters of plant pathogen resistance response gene expression, parameters of the plant's tolerance to stress, growth rate, yield, biomass, fruit quality or vigor of the plant can be monitored, and can be compared to similar parameters from plants lacking the nucleic acid agent of the invention. In some embodiments, monitoring of the plant parameters (of gene expression and/or plant tolerance to stress, growth rate, etc) can be used to determine regimen of treatment of the plant, for example, additional introduction of the nucleic acid agent of the invention, augmentation of the treatment with other treatment modalities (e.g. insecticide, antibiotics, plant hormones, etc), or in order to determine timing of fruit harvest or irrigation times. Selection of plants for monitoring in a crop or field of plants can be random or systematic (for example, sentinel plants can be pre-selected prior to the treatment).
[0160] As used herein, the phrase plant pathogen resistance response relates to any aspect of plant response to pathogen challenge, insult or infection, including, but not limited to microbial/pathogen-associated molecular pattern- (PAMP or MAMP) triggered immunity, or PTI, and effector-triggered immunity, or ETI, including relevant signaling cascades, molecular, morphological and physiological changes such as changes in ion-flux across the plasma membrane, phytoalexin synthesis, ROS generation, mitogen activated protein (MAP) kinase activation and protein phosphorylation, pathogenesis-related protein synthesis, callose deposition, stomatal closure, growth inhibition and hypersensitive response. The hypersensitive response includes, but is not limited to cytoplasmic shrinkage, chromatin condensation, mitochondrial swelling, vacuolization and chloroplast disruption at the site of insult (and remotely, in the systemic acquired response), resulting from down-regulation of photosynthesis, increased production and accumulation of reactive oxygen species, reactive nitrogen oxide intermediates and the defense hormones salicylic and jasmonic acid, activation of MAPK cascades changes in intracellular calcium levels and transcriptional reprogramming, and occlusion of sieve elements by callose formation and P-protein accumulation.
[0161] As used herein, the phrase plant pathogen resistance response gene is defined as a plant gene, the expression of which is associated with, directly or indirectly, the changes occurring in a plant in response to pathogen challenge, insult or infection. The plant pathogen resistance response gene can be a plant gene, the expression of which is altered (i.e. up-regulated or down-regulated) in response to pathogen challenge, insult or infection. The term gene is used broadly to refer to any segment of nucleic acid associated with a biological function. Thus, genes include coding sequences and/or the regulatory sequences required for their expression. For example, gene refers to a nucleic acid fragment that expresses mRNA or functional RNA, or encodes a specific protein, and which includes regulatory sequences. Genes also include nonexpressed DNA segments that, for example, form recognition sequences for other proteins. Genes can be obtained from a variety of sources, including cloning from a source of interest or synthesizing from known or predicted sequence information, and may include sequences designed to have desired parameters.
[0162] Plant pathogen resistance genes include, but are not limited to genes for signaling cascade intermediates such as MAPK, jasmonic acid, salicylic acid and fatty acids, enzymes and proteins associated with ROS production, carbohydrate and energy metabolism, chloroplast- and photosynthesis related gene products, sugar polymer biosynthesis and degradation, sugar transport and export, volatile hormone biosynthesis and degradation, carbohydrate transport genes, R genes and the like. In some embodiments the plant pathogen response includes, but is not limited to changes in Salicylic acid levels, changes in Jasmonic acid levels, changes in Gibberellic acid levels, changes in Auxin levels, changes in Cytokinin levels, changes in Ethylene levels, changes in ABA phyto-hormones levels, up-regulation of phyto-hormone-related genes, biosynthesis, deposition and degradation of callose, reactive oxygen species production, functional FLS2/BAK1 complex formation, protein-kinase pathway activation, phloem blockage, starch accumulation, starch accumulation in phloem parenchyma cells, polymer sieve formation, changes in carbohydrate metabolism, cambial activity aberrations, sucrose accumulation and carotenoid synthesis.
[0163] As used herein, the phrase plant pathogen resistance response gene product refers to a product of the expression of a plant pathogen resistance response gene-including, but not limited to the RNA transcript of the plant pathogen resistance response gene and a peptide or polypeptide encoded by a sequence of a plant pathogen resistance response gene.
[0164] In some embodiments of the invention, modulating the at least one plant pathogen resistance response is achieved by reducing the expression of a plant pathogen resistance response gene. Thus, in some embodiments, the at least one plant pathogen resistance response gene is a plant gene whose expression is increased in association with the plant pathogen resistance response. Many plant pathogen resistance response genes which are up-regulated in response to pathogen challenge, insult or infection have been identified, mostly through expression profiles of diseased and healthy plants. For example, US Patent Publication 20080172765 to Kitagiri et al discloses plant genes, the expression of which is altered, either increased or decreased, in response to pathogen infection.
[0165] In one embodiment, the at least one plant pathogen resistance response gene is selected from the group consisting of an ADP-glucose pyrophosphorylase large subunit (AGPase) gene product, a glucose-6-phosphate/phosphate translocator (GPT) gene product, a Callose synthase gene product and a Myb transcriptional regulator (MYB) gene product.
[0166] Table II provides a partial list of plant genes (Arabidopsis homologues) associated with plant pathogen responses, which can be targets for reduction in expression by introducing the nucleic acid agent of the invention.
TABLE-US-00002 TABLE II PLANT PATHOGEN RESISTANCE GENES-ARABIDOPSIS THALIANA HOMOLOGUES (ARABIDOPSIS GENE SYMBOL) Seq GENE ID NO: SYMBOL 1 AT1G69530.3 member of alpha-expansin gene family 2 AT1G70710.1 endo-1,4-beta-glucanase 3 AT3G11980.1 similar to fatty acid reductases 4 AT2G39700.1 putative expansin 5 AT3G44730.1 kinesin-like protein 1 (KP1) 6 AT4G17030.1 expansin-like B1 (EXLB1), a member of the expansin family 7 AT5G27670.1 HTA7, a histone H2A protein 8 AT1G08560.1 member of SYP11 syntaxin Gene Family 9 AT5G41040.1 feruloyl-CoA transferase 10 AT1G08880.1 HTA5, a histone H2A protein 11 AT1G09200.1 histone superfamily protein 12 AT4G20780.1 calcium sensor (calmoduline like 42) 13 AT1G02360.1 chitinase family protein 14 AT1G72150.1 novel cell-plate-associated protein (PATL1 or Patellin 1) 15 AT1G71692.1 member of the MADS box family of transcription factors 16 AT5G59030.1 putative copper transport protein (copper transporter 1) 17 AT1G49320.1 USPL1 (unknown seed protein like 1) 18 ATCG00830.1 ribosomal protein L2 19 AT2G02780.1 leucine-rich repeat protein kinase family protein 20 AT1G24430.1 HXXXD-type acyl-transferase family protein 21 AT1G58170.1 disease resistance-responsive (dirigent-like protein) family protein 22 AT3G07990.1 serine carboxypeptidase-like 27 (SCPL27) 23 AT3G04920.1 ribosomal protein S24e family protein 24 AT3G49340.1 cysteine proteinases superfamily protein 25 AT5G48740.1 leucine-rich repeat protein kinase family protein 26 AT2G04160.1 protein similar to subtilisin-like serine protease 27 AT2G05920.1 subtilase family protein 28 AT1G04120.1 member of MRP subfamily/ABC transporter subfamily C 29 AT1G08830.1 cytosolic copper/zinc superoxide dismutase CSD1 30 AT3G17390.1 S-adenosylmethionine synthetase 31 AT1G75040.1 thaumatin-like protein (PR5) 32 AT3G45140.1 chloroplast lipoxygenase (lipoxygenase 2) 33 AT5G33340.1 protein with aspartic protease activity (CDR1, constitutive disease resistance 1) 34 AT5G13930.1 chalcone synthase (CHS) 35 AT1G23740.1 oxidoreductase, zinc-binding dehydrogenase family protein 36 AT2G37040.1 phenylalanine ammonia-lyase (PAL1) 37 AT3G46970.1 cytosolic alpha-glucan phosphorylase 38 AT5G24090.1 chitinase A (class III) 39 AT2G21050.1 member of the AUX1 LAX family of auxin influx carriers (LAX2) 40 AT5G02140.1 pathogenesis-related thaumatin superfamily protein 41 AT1G19670.1 chlorophyllase 42 AT1G76690.1 12-oxophytodienoic acid reductases 43 AT3G54420.1 EP3 chitinase 44 AT1G15010.1 unknown protein 45 AT1G76680.2 member of an alpha/beta barrel fold family of FMN-containing oxidoreductases 46 AT2G02990.1 member of the ribonuclease T2 family 47 AT4G33420.1 peroxidase superfamily protein 48 AT5G05340.1 peroxidase superfamily protein 49 AT4G11290.1 peroxidase superfamily protein 50 AT2G36570.1 leucine-rich repeat protein kinase family protein 51 AT5G06800.1 Myb-like HTH transcriptional regulator family protein 52 AT4G08250.1 GRAS family transcription factor 53 AT3G54320.1 transcription factor of the AP2/ERWEBP class 54 AT1G61800.1 glucose-6-phosphate/phosphate transporter 2 55 AT1G05300.1 member of Fe(II) transporter isolog family (ZIP5, zinc transporter 5 precursor) 56 AT2G37870.1 bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein 57 AT3G13080.1 ATP-dependent MRP-like ABC transporter 58 AT1G71050.1 heavy metal transport/detoxification superfamily protein 59 AT3G18280.1 bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein 60 AT5G59030.1 putative copper transport protein (copper transporter 1) 61 AT5G19600.1 sulfate transporter Sultr3; 5. 62 AT1G69870.1 low affinity nitrate transporter NRT1.7 63 AT5G44560.1 VPS2.2 64 AT3G24450.1 heavy metal transport/detoxification superfamily protein 65 AT1G10970.1 member of Zrt- and Irt-related protein (ZIP) family 66 AT1G72160.1 sec14p-like phosphatidylinositol transfer family protein 67 AT3G22910.1 ATPase E1-E2 type family protein/haloacid dehalogenase-like hydrolase family protein 68 AT1G30690.1 sec14p-like phosphatidylinositol transfer family protein 69 AT5G65980.1 auxin efflux carrier family protein 70 AT3G51670.1 SEC14 cytosolic factor family protein/phosphoglyceride transfer family protein 71 AT2G14580.1 pathogenesis related protein (basic PR1-like protein) 72 AT5G51920.1 pyridoxal phosphate (PLP)-dependent transferases superfamily protein 73 AT4G03620.1 myosin heavy chain-related 74 AT4G25000.1 secreted protein involved in starch mobilization 75 AT3G02885.1 GAST1 protein homolog 5 (GASA5) 76 AT4G39230.1 similar to phenylcoumaran benzylic ether reductase (PCBER) 77 AT2G18420.1 gibberellin-regulated GASA/GAST/Snakin family protein 78 AT1G14520.1 MIOX1 (myo-inositol oxygenase) 79 AT4G15800.1 similar to tobacco rapid alkalinization factor (RALF) 80 AT3G08860.1 protein with beta-alanine aminotransferase activity 81 AT2G44740.1 cyclin p4; 1 (CYCP4; 1); 82 AT3G11520.1 B-type mitotic cyclin 83 AT5G67070.1 similar to tobacco rapid alkalinization factor (RALF) 84 AT3G47800.1 galactose mutarotase-like superfamily protein 85 AT3G19000.1 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein 86 AT3G44830.1 lecithin: cholesterol acyltransferase family protein 87 AT5G23960.1 sesquiterpene synthase 88 AT4G39210.1 large subunit of ADP-glucose pyrophosphorylase 89 AT3G13610.1 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein 90 AT5G66150.1 glycosyl hydrolase family 38 protein 91 AT1G60470.1 galactinol synthase 4 (GolS4) 92 AT1G09400.1 FMN-linked oxidoreductases superfamily protein 93 AT5G15140.1 galactose mutarotase-like superfamily protein 94 AT1G73010.1 PPsPase1, a pyrophosphate-specific phosphatase (phosphate starvation-induced gene 2 or PS2) 95 AT5G36160.1 tyrosine transaminase family protein 96 AT1G17710.1 pyridoxal phosphate phosphatase-related protein 97 AT3G22360.1 alternative oxidase (AOX1B) 98 AT1G07180.1 internal mitochondrial NAD(P)H dehydrogenase 99 AT5G33370.1 GDSL-like lipase/acylhydrolase superfamily protein 100 AT1G21850.1 SKU5 similar 8 (sks8) 101 AT1G55120.1 protein with fructan exohydrolase (FEH) activity 102 AT1G71380.1 cellulase 3 (CEL3) 103 AT1G73880.1 UDP-glucosyl transferase 89B1 (UGT89B1) 104 AT5G20870.1 O-glycosyl hydrolases family 17 protein 105 AT2G29980.1 endoplasmic reticulum enzyme responsible for the synthesis of 18:3 fatty acids from phospholipids 106 AT5G22810.1 GDSL-like lipase/acylhydrolase superfamily protein 107 AT1G33720.1 member of CYP76C (cytochrome P450) 108 AT5G56970.1 similar to cytokinin oxidase/dehydrogenase (cytokinin oxidase 3) 109 AT1G41830.1 SKU5-similar 6 (SKS6) 110 AT4G31950.1 member of CYP82C (cytochrome P450) 111 AT1G22380.1 putative UDP-glucosyl transferase 112 AT3G57270.1 member of glycosyl hydrolase family 17 beta-1,3-glucanase 1) 113 AT3G03350.2 NAD(P)-binding Rossmann-fold superfamily protein 114 AT1G73370.1 protein with sucrose synthase activity (SUS6) 115 AT1G22650.1 plant neutral invertase family protein 116 AT5G13870.1 endoxyloglucan transferase EXGT-A4 117 AT4G38540.1 FAD/NAD(P)-binding oxidoreductase family protein 118 AT2G37700.1 fatty acid hydroxylase superfamily 119 AT5G36110.1 member of CYP716A, cytochrome P450 120 AT1G09155.1 phloem protein 2-B15 (PP2-B15) 121 AT1G12030.1 unknown protein 122 AT1G17860.1 Kunitz family trypsin and protease inhibitor protein 123 AT4G35150.1 O-methyltransferase family protein 124 AT4G36850.1 PQ-loop repeat family protein/transmembrane family protein 125 AT3G43110.1 unknown protein 126 AT5G02580.1 protein 1589 of unknown function 127 AT5G62360.1 invertase/pectin methylesterase inhibitor superfamily protein 128 AT1G63310.1 unknown protein 129 AT5G66430.1 S-adenosyl-L-methionine-dependent methyltransferases superfamily protein 130 AT2G18660.1 PNP-A (Plant Natriuretic Peptide A) 131 AT3G01670.1 unknown protein 132 AT3G20570.1 early nodulin-like protein 9 (ENODL9) 133 AT1G55290.1 similar to oxidoreductase, 2OG-Fe(II) oxygenase 134 AT5G04010.1 F-box family protein 135 AT5G67140.1 F-box/RNI-like superfamily protein 136 AT3G01680.1 protein with Mediator complex subunit Med28 137 AT2G32280.1 protein of unknown function (DUF1218) 138 AT3G42725.1 putative membrane lipoprotein 139 AT5G39050.1 HXXXD-type acyl-transferase family protein 140 AT3G15650.2 alpha/beta-Hydrolases superfamily protein 141 AT2G41200.1 unknown protein 142 AT2G42820.1 HVA22-like protein F (HVA22F) 143 AT2G47780.1 rubber elongation factor protein (REF) 144 AT3G17380.1 TRAF-like family protein 145 AT4G35160.1 O-methyltransferase family protein 146 AT4G31840.1 early nodulin-like protein 15 (ENODL15) 147 AT3G17350.1 unknown protein 148 AT3G50930.1 cytochrome BC1 synthesis (BCS1) 149 AT5G22740.1 beta-mannan synthase 150 AT3G54040.1 PAR1 protein 151 AT2G46490.1 unknown protein 152 AT5G66920.1 SKU5 similar 17 (sks17) 153 AT2G03430.1 ankyrin repeat family protein 154 AT2G32300.1 uclacyanin 1 155 AT4G24780.1 pectin lyase-like superfamily protein 156 AT5G23660.1 homolog of the Medicago nodulin MTN3 157 AT5G16250.1 unknown protein 158 AT4G27900.1 CCT motif family protein 159 AT3G01680.1 unknown protein 160 AT3G59940.1 galactose oxidase/kelch repeat superfamily protein 161 AT1G70470.1 unknown protein 162 AT2G32280.1 unknown protein 163 AT2G25737.1 sulfite exporter TauE/SafE family protein 164 AT2G01610.1 plant invertase/pectin methylesterase inhibitor superfamily protein 165 AT5G62350.1 plant invertase/pectin methylesterase inhibitor superfamily protein 166 AT2G25625.1 unknown protein 167 AT1G60390.1 polygalacturonase 1 (PG1) 168 AT1G72000.1 plant neutral invertase family protein 169 AT5G05270.1 chalcone-flavanone isomerase family protein 170 AT4G31590.1 similar to cellulose synthase 171 AT5G35740.1 carbohydrate-binding X8 domain superfamily protein 172 AT2G46630.1 unknown protein 173 AT5G44400.1 FAD-binding berberine family protein 174 AT1G05560.1 UDP-GLUCOSE TRANSFERASE 1 175 AT1G05570.1 CALLOSE SYNTHASE 1 176 AT1G06490.1 GLUCAN SYNTHASE-LIKE 7 177 AT2G13680.1 GLUCAN SYNTHASE-LIKE 2 178 AT2G31960.1 GLUCAN SYNTHASE-LIKE 3 179 AT3G14570.1 GLUCAN SYNTHASE-LIKE 4 180 AT3G59100.1 GLUCAN SYNTHASE-LIKE 11 181 AT4G03550.1 ENHANCER OF EDR1 3 GLUCAN SYNTHASE-LIKE 5 182 AT4G04970.1 GLUCAN SYNTHASE LIKE 1 183 AT5G13000.1 CALLOSE SYNTHASE 3 184 AT5G13000.2 GLUCAN SYNTHASE-LIKE 12 185 AT5G36870.1 GLUCAN SYNTHASE-LIKE 9
[0167] Thus, in some embodiments, the isolated nucleic acid agent comprises a nucleic sequence which specifically reduces a plant pathogen resistance gene product having at least 60% sequence identity to any of the sequences of TABLE II. In some embodiments, the plant pathogen gene product is 60-75% identical, 70-85% identical, 80-90% identical, 90-95% identical or 100% identical to the sequence of Table II.
[0168] In some embodiments, the targeted gene products include, but are not limited to polynucleotide sequences having at least 60% identity to any of the sequences of TABLE III. In some embodiments, the plant pathogen gene product is 60-75% identical, 70-85% identical, 80-90% identical, 90-95% identical or 100% identical to the sequence of Table III.
TABLE-US-00003 TABLE III ABBREVIATED LIST of PLANT PATHOGEN RESISTANCE GENES-ARABIDOPSIS THALIANA HOMOLOGUES Seq GENE ID NO: SYMBOL 186 AT1G70710.1 endo-1,4-beta-glucanase 187 AT4G20780.1 calcium sensor (calmoduline like 42) 188 AT5G59030.1 putative copper transport protein (copper transporter 1) 189 AT1G58170.1 disease resistance-responsive (dirigent-like protein) family protein 190 AT1G08830.1 cytosolic copper/zinc superoxide dismutase CSD1 191 AT3G17390.1 S-adenosylmethionine synthetase 192 AT3G45140.1 chloroplast lipoxygenase (lipoxygenase 2) 193 AT5G33340.1 protein with aspartic protease activity (CDR1, constitutive disease resistance 1) 194 AT5G13930.1 chalcone synthase (CHS) 195 AT5G06800.1 Myb-like HTH transcriptional regulator family protein 196 AT1G61800.1 glucose-6-phosphate/phosphate transporter 2 197 AT4G39210.1 large subunit of ADP-glucose pyrophosphory- lase 198 AT1G73880.1 UDP-glucosyl transferase 89B1 (UGT89B1) 199 AT1G22380.1 putative UDP-glucosyl transferase 200 AT1G09155.1 phloem protein 2-B15 (PP2-B15) 201 AT1G17860.1 Kunitz family trypsin and protease inhibitor protein 202 AT5G05270.1 chalcone-flavanone isomerase family protein 203 AT4G31590.1 similar to cellulose synthase
[0169] Thus, according to some embodiments of the invention there is provided an isolated nucleic acid agent comprising a nucleic acid sequence which specifically reduces the expression of at least one plant pathogen resistance gene product.
[0170] In some embodiments, the isolated nucleic acid agent comprises a nucleic sequence which specifically reduces a plant pathogen resistance gene product having at least 60%, sequence identity to any of the sequences of TABLE II.
[0171] HuangLongBing is predominately a disease of citrus and citrus-related plants and trees. Thus, in some embodiments, the isolated nucleic acid of the invention is directed to downregulation of citrus-specific gene products.
[0172] Table IV provides a partial list of citrus plant polynucleotide sequences associated with citrus plant pathogen responses, which can be targets for reduction in expression by introducing the nucleic acid agent of the invention. Table IV(a) provides a further list of candidate targets for reduction of gene expression, based on function of the specified gene-sequences in italics are citrus pathogen plant response-associated sequences, while the bolded sequences are sugar metabolism-related genes.
TABLE-US-00004 TABLE IV CITRUS TARGET SEQUENCES (GenBank Accession Nos.) Seq ID NO: GENE SYMBOL 204 DN959507 205 CD573747 206 CF828218 207 CV710432 208 CD575625 209 CF835126 210 CF505371 211 CX675973 212 CV719481 213 CX642677 214 CK935733 215 CX643907 216 CX296236 217 CF832155 218 CX053912 219 CX643504 220 CX077483 221 DN618428 222 CX666928 223 CX675636 224 CD574876 225 CX663894 226 CF838213 227 CV884462 228 CB292401 229 DN623815 230 CX635745 231 CX301461 232 CX672038 233 CX045698 234 C95463 235 CX673765 236 CB290861 237 CN188208 238 CF504694 239 CX674093 240 CK936991 241 CF509114 242 CX643181 243 CX665015 244 CX043703 245 CX668229 246 CX053885 247 CX299724 248 DR403986 249 CX663493 250 CX663308 251 DN623584 252 CK934943 253 CX044216 254 CX078485 255 CX046318 256 CX303177 257 CF53269 258 CX287481 259 CK739465 260 CX675684 261 CF835779 262 DN620798 263 CX051466 264 CF836284 265 CX286914 266 CF418391 267 CX293439 268 CX664023 269 CV720146 270 CF508503 271 CN185151 272 CF835597 273 CV885632 274 CX665957 275 DN619087 276 CF417971 277 CX674752 278 CX672325 279 CX675696 280 CB290596 281 CX075198 282 DN618043 283 CV704545 284 CX671045 285 CF653559 286 CX640391 287 CX302689 288 DN958063 289 CB250380 290 CX543436 291 CF508354 292 CN184547 293 CF837402 294 DT214662 295 CF507791 296 CV716571 297 CN184617 298 CX666534 299 CX293884 300 CF418573 301 DN795637 302 DN622894 303 DN799150 304 CX671694 305 DN619965 306 CX664606 307 CX544543 308 DN618893 309 CV714863 310 DN795132 311 CX293755 312 CF417383 313 AU300374 314 CX046632 315 CX663293 316 CK933255 317 CV709925 318 CX077593 319 BQ624438 320 CN189092 321 CX075046 322 CF832471 323 CX308646 324 CN192282 325 CX307078 326 C95332 327 CX295397 328 CN181803 329 CX076871 330 CN191204 331 CV704769 332 CF417791 333 CF831073 334 CX664109 335 CK934765 336 DN622570 337 CX302870 338 CX298333 339 CN191069 340 C22284 341 CK936315 342 CX665686 343 CD576001 344 CV885460 345 CX674613 346 CV707520 347 DN623989 348 CX641508 349 CV718422 350 CX669149 351 CV708715 352 BQ623232 353 CF418736 354 DN959078 355 CV708663 356 CX673097 357 CX302123 358 CN187632 359 CX673300 360 CK701797 361 CX635438 362 CX545339 363 CX053315 364 CV709535 365 DN798478 366 CB292827 367 CX671357 368 CX069447 369 CX287588 370 CX297166 371 CK934054 372 CB291312 373 CX076597 374 CX301940 375 CX544117 376 CK665535 377 CX669825 378 CX670154 379 CX674833 380 CX072993 381 CX641923 382 CV709392 383 CK936214 384 CK936713 385 CX046656 386 CN190414 387 DN618740 388 CX667496 389 CK933819 390 CX666282 391 BQ624534 392 CD574984 393 CX299253 394 U82977.1 395 DN959563 396 DN625629 397 DN622423 398 DN621393 399 DN620655 400 DN617955 401 DN617601 402 CX675719 403 CX673052 404 CX671909 405 CX671908 406 CX669790 407 CX667860 408 CX667462 409 CX666073 410 CX663867 411 CX663363 412 CX643067 413 CX640562 414 CX636575 415 CX636360 416 CX635683 417 CX546685 418 CX545718 419 CX544442 420 CX543942 421 CX543689 422 CX542606 423 CX309167 424 CX308494 425 CX307626 426 CX307101 427 CX306527 428 CX305853 429 CX304999 430 CX303309 431 CX302610 432 CX301947 433 CX297896 434 CX296140 435 CX296097 436 CX295546 437 CX290706 438 CX289600 439 CX288823 440 CX287363 441 CK078233 442 CX078190 443 CX076996 444 CX070279 445 CX048605 446 CX048208 447 CX047376 448 CX046977 449 CX046019 450 CX043864 451 CV887291 452 CV886686 453 CV886073 454 CV884354 455 CV720075 456 CV719759 457 CV719483 458 CV719426 459 CV717016 460 CV716643 461 CV714792 462 CV714551 463 CV714253 464 CV713804 465 CV713122 466 CV713085 467 CV711700 468 CV710341 469 CV709126 470 CV707867 471 CV706656 472 CV705672 473 CV705217 474 CV704366 475 CN191865 476 CN186090 477 CN185887 478 CN182557 479 CN182178 480 CK939832 481 CK939153 482 CK938892 483 CK938479 484 CK936961 485 CK933484 486 CK702328 487 CF836843 488 CF836817 489 CF835056 490 CF833518 491 CF418886 492 CF418485 493 CD576435 494 CD576111 495 CD575905 496 CD575735 497 CD575303 498 CD575247 499 CD574599 500 CD573799 501 CB611071 502 CB322174 503 CB305061 504 CB291815 505 CB291722 506 CB291657
TABLE-US-00005 TABLE IV(a) SEQ Gene Symb. ID NO CX303072 623 Beta-glucosidase-like DN622894 624 ADP-glucose pyrophosphorylase DN625620 625 Glucose-6-phosphate dehydrogenase CB292132 626 Granule-ground starch synthase CX637561 627 Putative UDP-glucuronosyltransferase DT214451 628 Beta-amylase CX046632 629 Extracellular acid invertase CX070113 630 Starch branching enzyme CB292174 631 Sugar transport protein CX045485 632 Hexose transporter CX665157 633 Galactose oxidase CX639454 634 Plant glycogenin-like starch initiation protein CX663848 635 Glycosyl transferase CV705038 636 4-alpha-galacturonosyltransferase CF831824 637 Trehalose-phosphatase CK938541 638 Galacturonosyltransferase CX294095 639 Glycosyl hydrolase CN187456 640 Trehalose-phosphatase CK938256 641 Mannase CV886325 642 Glycerol-3-phosphate dehydrogenase DN617689 643 Raffinose synthase CF836851 644 Probable alcohol degydrogenase DN959139 645 Trehalose-6-phosphate phosphatase CX044393 646 Probable short chain alcohol dehydrogenase CK936380 647 Alcohol acyl transferase BQ623570 648 Dirigent protein CX309407 649 Alpha-glucosidase-like CX668300 650 Chitinase CF832155 651 Acidic class II chitinase CX638776 652 Delta 1-pyrroline-5-carboxylate synthetase CK937251 653 Miraculin-like protein CX303148 654 Nam-like protein 11 CN186431 655 CTV protein CX301461 656 Unnamed protein product DN619110 657 Unknown protein CX669483 658 Early nodulin DN618893 659 Tyrosine aminotransferase CX306211 660 Nectarin 5 CF507855 661 Delta 1-pyrroline-5-carboxylate synthetase 2 CF653559 662 Pathogenesis-related protein PR-1 precursor CK935794 663 Glycolate oxidase CX666928 664 BURP domain-containing protein CX305834 665 Seed-specific protein CX640129 666 Glutaredoxin-like protein CK935883 667 Disease resistance-responsive protein CX045772 668 Putative cell death associated protein CN191283 669 NAM-like protein CK934775 670 Disease-resistance protein CX286941 671 Nodulin-like CX301618 672 Dehydration-responsive protein RD22 CX296222 673 Blight-associated protein p12 precursor CX641603 674 Disease-resistance protein DR406181 675 Metallothionein-like protein CB293886 676 NAM-like protein CF835337 677 Pathogenesis-related protein 4A CX048331 678 Putative ripening-related protein CX637285 679 Pathogenesis-related protein 4A CX044399 680 NBS-LRR resistance-like protein RGC359 DN618428 681 BURP-domain containing protein CX545242 682 Berberine bridge enzyme-like protein AU186381 683 Acidic class II chitinase DN958104 684 Beta-cyanoalanine synthase CX076066 685 Resistance protein candidate RGC2J CF835944 686 MLO protein (mildew resistance locus) CX671223 687 Chitinase AU300664 688 Pathogenesis-related protein CF832471 689 Multi-copper oxidase DN795254 690 Putative calmodulin-binding protein CX292843 691 Photoassimilate-responsive protein CF507442 692 Nodulin-like protein CX305678 693 Basic chitinase CX048700 694 Leucine-rich repeat protein DN625052 695 Disease resistance RGA3 protein CX070975 696 Small MW heat shock protein CX671683 697 Nodulin-like protein DN618117 698 NBS-LRR type disease resistance protein CX045895 699 Chitinase CX291159 700 Elicitor-inducible cytochrome P450 CF833037 701 Putative salicylate monooxygenase CF829440 702 Pectate lyase CV709277 703 Phosphoesterase family protein CX069929 704 Abl interactor-like protein-1 CX643843 705 Putative BURP domain containing protein CX293287 706 Putative nodulin protein CO913159 707 Glyoxal oxidase related CF838393 708 Chitinase class II precursor CX637639 709 Chitinase CK936056 710 Subtilisin-like protease CF417485 711 ENSP-like protein CX296119 712 Immediate-early fungal elicitor protein CMPG1 CN181971 713 Disease resistance LRR family protein CX076036 714 Avr9 Cf-9 rapidly elicited protein 111B
[0173] In some embodiments, the nucleic acid agent of the invention is directed towards any one or more subset of the sequences of Tables IV and IV(a). Table V provides an exemplary subset of citrus plant polynucleotide sequences associated with citrus plant pathogen responses, which are also suitable targets for reduction in expression by introducing the nucleic acid agent and methods of the invention.
TABLE-US-00006 TABLE V ABBREVIATED LIST OF CITRUS TARGET SEQUENCES (GenBank Accession No.) GENE Seq ID NO: SYMBOL 205 CD573747 216 CX296236 220 CX077483 226 CF838213 231 CX301461 235 CX673765 236 CB290861 238 CF504694 239 CX674093 240 CK936991 258 CX287481 261 CF835779 263 CX051466 269 CV720146 302 DN622894 324 CN192282 333 CF831073 335 CK934765 339 CN191069 379 CX674833 389 CK933819 390 CX666282
[0174] In some embodiments, the isolated nucleic acid agent comprises a nucleic acid sequence which specifically reduces any of plant pathogen resistance gene products of the sequences of TABLES IV and IV(a). In other embodiments, the isolated nucleic acid agent comprises a nucleic acid sequence which specifically reduces any of plant pathogen resistance gene products of the sequences of TABLE V.
[0175] In some embodiments, the isolated nucleic acid agent comprises a nucleic acid sequence which specifically reduces the gene products of a gene selected from the group consisting of the AGPase gene, the GPT gene, the Callose synthase gene, the Lipoxygenase D gene, the Myb gene and the PP2-B-15 gene. In some embodiments, the AGPase gene product is encoded by SEQ ID NO: 527, or a portion thereof, the GPT gene product is encoded by SEQ ID NO: 529 or a portion thereof, the Callose synthase gene product is encoded by SEQ ID NO: 531 or a portion thereof, the Lipoxygenase D gene product is encoded by SEQ ID NO: 533 or a portion thereof, the Myb gene product is encoded by SEQ ID NO: 535 or a portion thereof, and the PP2 gene product is encoded by SEQ ID NO: 537 or a portion thereof.
[0176] In some embodiments, the isolated nucleic acid agent comprises a nucleic acid sequence comprising a nucleic acid sequence complementary to a portion of the nucleic acid sequence of the gene product of any one of the AGPase gene, the GPT gene, the Callose synthase gene, the Lipoxygenase D gene, and the Myb gene, which specifically reduces the gene products of the corresponding gene. In some embodiments, the nucleic acid sequence targeting the AGPase gene comprises SEQ ID NO: 528, or a portion thereof, the nucleic acid sequence targeting the GPT gene comprises SEQ ID NO: 530, or a portion thereof, the nucleic acid sequence targeting the Callose synthase gene comprises SEQ ID NO: 532, or a portion thereof, the nucleic acid sequence targeting the Lipoxygenase D gene comprises SEQ ID NO: 534, or a portion thereof, the nucleic acid sequence targeting the Myb gene comprises SEQ ID NO: 536, or a portion thereof and the nucleic acid sequence targeting the PP2 gene comprises SEQ ID NO: 538, or a portion thereof.
[0177] In some embodiments of aspects of the invention, the nucleic acid agent is a double stranded RNA (dsRNA). As used herein the term dsRNA relates to two strands of anti-parallel polyribonucleic acids held together by base pairing. The two strands can be of identical length or of different lengths provided there is enough sequence homology between the two strands that a double stranded structure is formed with at least 80%, 90%, 95% or 100% complementarity over the entire length. According to an embodiment of the invention, there are no overhangs for the dsRNA molecule. According to another embodiment of the invention, the dsRNA molecule comprises overhangs. According to other embodiments, the strands are aligned such that there are at least 1, 2, or 3 bases at the end of the strands which do not align (i.e., for which no complementary bases occur in the opposing strand) such that an overhang of 1, 2 or 3 residues occurs at one or both ends of the duplex when strands are annealed.
[0178] It will be noted that the dsRNA can be defined in terms of the nucleic acid sequence of the DNA encoding the target gene transcript, and it is understood that a dsRNA sequence corresponding to the coding sequence of a gene comprises an RNA complement of the gene's coding sequence, or other sequence of the gene which is transcribed into RNA.
[0179] Thus, in some embodiments, the isolated nucleic acid agent comprises a nucleic sequence which is complementary to a nucleic acid sequence having at least 60% sequence identity to any of the sequences of TABLE II or TABLE III. In some embodiments, the nucleic acid sequence is 60-75% identical, 70-85% identical, 80-90% identical, 90-95% identical or 100% identical to the sequence of Table II or III.
[0180] In other embodiments, wherein the plant or tree is a citrus or citrus-related plant or tree, the isolated nucleic acid agent comprises a nucleic sequence complementary to any of the polynucleotide sequences of TABLES IV and IV(a). In still other embodiments, the plant is a citrus or citrus-related plant or tree and the isolated nucleic acid agent comprises a nucleic sequence which is complementary to any of the polynucleotide sequences of TABLE V.
[0181] The inhibitory RNA sequence can be greater than 90% identical, or even 100% identical, to the portion of the target gene transcript. Alternatively, the duplex region of the RNA may be defined functionally as a nucleotide sequence that is capable of hybridizing with a portion of the target gene transcript under stringent conditions (e.g., 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA, 60 degrees C. hybridization for 12-16 hours; followed by washing). The length of the double-stranded nucleotide sequences complementary to the target gene transcript may be at least about 18, 19, 21, 25, 50, 100, 200, 300, 400, 491, 500, or more bases. In some embodiments of some aspects of the invention, the length of the double-stranded nucleotide sequence is approximately from about 18 to about 510 nucleotides in length for genes of Citrus spp. Such as, but not limited to sweet oranges: Citrus sinensis, lemons: Citrus limon and sour orange: Citrus aurantium.
[0182] The term corresponds to as used herein means a polynucleotide sequence homologous to all or a portion of a reference polynucleotide sequence. In contradistinction, the term complementary to is used herein to mean that the complementary sequence is homologous to all or a portion of a reference polynucleotide sequence. For example, the nucleotide sequence TATAC corresponds to a reference sequence TATAC and is complementary to a reference sequence GTATA.
[0183] The present teachings relate to various lengths of dsRNA, whereby the shorter version i.e., x is shorter or equals 50 bp (e.g., 17-50), is referred to as siRNA or miRNA. Longer dsRNA molecules of 51-600 are referred to herein as dsRNA, which can be further processed for siRNA molecules. According to some embodiments, the nucleic acid sequence of the dsRNA is greater than 15 base pairs in length. According to yet other embodiments, the nucleic acid sequence of the dsRNA is 19-25 base pairs in length, 30-100 base pairs in length, 100-250 base pairs in length or 100-500 base pairs in length. According to still other embodiments, the dsRNA is 300-600 base pairs in length, 350-500 base pairs in length or 400-450 base pairs in length. In some embodiments, the dsRNA is 400 base pairs in length.
[0184] The term siRNA refers to small inhibitory RNA duplexes (generally between 17-30 basepairs, but also longer e.g., 31-50 bp) that induce the RNA interference (RNAi) pathway. Typically, siRNAs are chemically synthesized as 21mers with a central 19 bp duplex region and symmetric 2-base 3-overhangs on the termini, although it has been recently described that chemically synthesized RNA duplexes of 25-30 base length can have as much as a 100-fold increase in potency compared with 21mers at the same location. The observed increased potency obtained using longer RNAs in triggering RNAi is theorized to result from providing Dicer with a substrate (27mer) instead of a product (21mer) and that this improves the rate or efficiency of entry of the siRNA duplex into RISC.
[0185] It has been found that position of the 3-overhang influences potency of an siRNA and asymmetric duplexes having a 3-overhang on the antisense strand are generally more potent than those with the 3-overhang on the sense strand (Rose et al., 2005). This can be attributed to asymmetrical strand loading into RISC, as the opposite efficacy patterns are observed when targeting the antisense transcript.
[0186] The strands of a double-stranded interfering RNA (e.g., an siRNA) may be connected to form a hairpin or stem-loop structure (e.g., an shRNA). Thus, as mentioned the RNA silencing agent of some embodiments of the invention may also be a short hairpin RNA (shRNA).
[0187] The term shRNA, as used herein, refers to an RNA agent having a stem-loop structure, comprising a first and second region of complementary sequence, the degree of complementarity and orientation of the regions being sufficient such that base pairing occurs between the regions, the first and second regions being joined by a loop region, the loop resulting from a lack of base pairing between nucleotides (or nucleotide analogs) within the loop region. The number of nucleotides in the loop is a number between and including 3 to 23, or 5 to 15, or 7 to 13, or 4 to 9, or 9 to 11. Some of the nucleotides in the loop can be involved in base-pair interactions with other nucleotides in the loop. Examples of oligonucleotide sequences that can be used to form the loop include 5-UUCAAGAGA-3 (Brummelkamp, T. R. et al. (2002) Science 296: 550, SEQ ID NO: 517) and 5-UUUGUGUAG-3 (Castanotto, D. et al. (2002) RNA 8:1454, SEQ ID NO: 518). It will be recognized by one of skill in the art that the resulting single chain oligonucleotide forms a stem-loop or hairpin structure comprising a double-stranded region capable of interacting with the RNAi machinery.
[0188] As used herein, the phrase microRNA (also referred to herein interchangeably as miRNA or miR) or a precursor thereof refers to a microRNA (miRNA) molecule acting as a post-transcriptional regulator. Typically, the miRNA molecules are RNA molecules of about 20 to 22 nucleotides in length which can be loaded into a RISC complex and which direct the cleavage of another RNA molecule, wherein the other RNA molecule comprises a nucleotide sequence essentially complementary to the nucleotide sequence of the miRNA molecule.
[0189] Typically, a miRNA molecule is processed from a pre-miRNA or as used herein a precursor of a pre-miRNA molecule by proteins, such as DCL proteins, present in any plant cell and loaded onto a RISC complex where it can guide the cleavage of the target RNA molecules.
[0190] Pre-microRNA molecules are typically processed from pri-microRNA molecules (primary transcripts). The single stranded RNA segments flanking the pre-microRNA are important for processing of the pri-miRNA into the pre-miRNA. The cleavage site appears to be determined by the distance from the stem-ssRNA junction (Han et al. 2006, Cell 125, 887-901, 887-901).
[0191] As used herein, a pre-miRNA molecule is an RNA molecule of about 100 to about 200 nucleotides, preferably about 100 to about 130 nucleotides which can adopt a secondary structure comprising an imperfect double stranded RNA stem and a single stranded RNA loop (also referred to as hairpin) and further comprising the nucleotide sequence of the miRNA (and its complement sequence) in the double stranded RNA stem. According to a specific embodiment, the miRNA and its complement are located about 10 to about 20 nucleotides from the free ends of the miRNA double stranded RNA stem. The length and sequence of the single stranded loop region are not critical and may vary considerably, e.g. between 30 and 50 nucleotides in length. The complementarity between the miRNA and its complement need not be perfect and about 1 to 3 bulges of unpaired nucleotides can be tolerated. The secondary structure adopted by an RNA molecule can be predicted by computer algorithms conventional in the art such as mFOLD. The particular strand of the double stranded RNA stem from the pre-miRNA which is released by DCL activity and loaded onto the RISC complex is determined by the degree of complementarity at the 5 end, whereby the strand which at its 5 end is the least involved in hydrogen bonding between the nucleotides of the different strands of the cleaved dsRNA stem is loaded onto the RISC complex and will determine the sequence specificity of the target RNA molecule degradation. However, if empirically the miRNA molecule from a particular synthetic pre-miRNA molecule is not functional (because the wrong strand is loaded on the RISC complex), it will be immediately evident that this problem can be solved by exchanging the position of the miRNA molecule and its complement on the respective strands of the dsRNA stem of the pre-miRNA molecule. As is known in the art, bonding between A and U involving two hydrogen bonds, or G and U involving two hydrogen bonds is less strong that between G and C involving three hydrogen bonds.
[0192] Naturally occurring miRNA molecules may be comprised within their naturally occurring pre-miRNA molecules but they can also be introduced into existing pre-miRNA molecule scaffolds by exchanging the nucleotide sequence of the miRNA molecule normally processed from such existing pre-miRNA molecule for the nucleotide sequence of another miRNA of interest. The scaffold of the pre-miRNA can also be completely synthetic. Likewise, synthetic miRNA molecules may be comprised within, and processed from, existing pre-miRNA molecule scaffolds or synthetic pre-miRNA scaffolds. Some pre-miRNA scaffolds may be preferred over others for their efficiency to be correctly processed into the designed microRNAs, particularly when expressed as a chimeric gene wherein other DNA regions, such as untranslated leader sequences or transcription termination and polyadenylation regions are incorporated in the primary transcript in addition to the pre-microRNA.
[0193] In some embodiments, the nucleic acid agent is a hairpin RNA (hpRNA) interference or intron-containing hairpin RNA (ihpRNA) interference construct. Methods for gene silencing in plants using hairpin RNA vectors are well known in the art and considered efficient at inhibiting the gene expression in plants. See, for example, Waterhouse and Helliwell (2003) Nat. Rev. Genet. 4:29-38 and Yan et al, PLoS one (2012) 7:e38186.
[0194] For hpRNA silencing, the expression cassette is designed to express an RNA molecule that hybridizes with itself to form a hairpin structure that includes a single-stranded loop region and a base-paired stem. The base-paired stem region includes a sense sequence corresponding to all or part of the endogenous messenger RNA encoding the gene whose expression is to be inhibited, and an antisense sequence that is fully or partially complementary to the sense sequence. Thus, the base-paired stem region of the molecule generally determines the specificity of the RNA interference for silencing. hpRNA molecules are considered efficient at inhibiting and silencing gene expression, and the RNA interference they induce may be inherited by subsequent plant generations. Methods for using hpRNA interference to inhibit or silence the expression of genes are described, for example, in US Patent Publication No. 2010058490 to Waterhouse et al. A transient assay for the efficiency of hpRNA constructs to silence gene expression in vivo has been described by Panstruga et al. (2003) Mol. Biol. Rep. 30:135-150.
[0195] For ihpRNA, the silencing molecules have the same general structure as for hpRNA, but the RNA molecule additionally includes an intron that is capable of being spliced in the cell in which the ihpRNA is expressed. The use of an intron minimizes the loop size in the hairpin RNA molecule following splicing, and this increases the interference efficiency.
[0196] According to the present teachings, the dsRNA molecules may be naturally occurring or synthetic.
[0197] The dsRNA can be a mixture of long and short dsRNA molecules such as, dsRNA, siRNA, siRNA+dsRNA, siRNA+miRNA, hpRNA or a combination of same. According to a specific embodiment, the dsRNA is an siRNA (100%).
[0198] The dsRNA molecule is designed for specifically targeting a target gene of interest. It will be appreciated that the dsRNA can be used to down-regulate one or more target genes. If a number of target genes are targeted, a heterogenic composition which comprises a plurality of dsRNA molecules for targeting a number of target genes is used. Alternatively said plurality of dsRNA molecules are separately applied to the seeds (but not as a single composition). According to a specific embodiment, a number of distinct dsRNA molecules for a single target are used, which may be separately or simultaneously (i.e., co-formulation) applied.
[0199] According to an embodiment of the invention, the target gene is endogenous to the plant. Downregulating such a gene is typically important for conferring the plant with an improved, agricultural, horticultural, nutritional trait (improvement or an increase is further defined herein).
[0200] As used herein endogenous refers to a gene which expression (mRNA or protein) takes place in the plant. Typically, the endogenous gene is naturally expressed in the plant or originates from the plant. Thus, the plant may be a wild-type plant. However, the plant may also be a genetically modified plant (transgenic).
[0201] Downregulation of the target gene may be important for conferring improved one of, or at least one of (e.g., two of or more), biomass, vigor, yield, fruit quality, abiotic and/or biotic stress tolerance or improved nitrogen use efficiency.
[0202] In some embodiments, target genes for downregulation by the methods and nucleic acid agents of the present invention are plant pathogen resistance gene products which expression thereof is upregulated following infection of the plant with a plant pathogen, for example, the plant pathogen of the plant infection (e.g. Candidatus Liberibacter spp).
[0203] Exemplary target genes include, but are not limited to, genes for signaling cascade intermediates such as MAPK, jasmonic acid, salicylic acid and fatty acids, enzymes and proteins associated with ROS production, carbohydrate and energy metabolism, chloroplast- and photosynthesis related gene products and the like, sugar polymer biosynthesis and degradation, sugar transport and export, volatile hormone biosynthesis and degradation, carbohydrate transport, R genes, which expression can be silenced to improve the yield, growth rate, vigor, biomass, fruit quality or stress tolerance of a plant when infected with a plant pathogen. Other examples of target genes which may be subject to modulation according to the present teachings are described herein.
[0204] In some embodiments, target genes include, but are not limited to genes for pathogen resistance response such as changes in Salicylic acid levels, changes in Jasmonic acid levels, changes in Gibberellic acid levels, changes in Auxin levels, changes in Cytokinin levels, changes in Ethylene levels, changes in ABA phyto-hormones levels, up-regulation of phyto-hormone-related genes, biosynthesis, deposition and degradation of callose, reactive oxygen species production, functional FLS2/BAK1 complex formation, protein-kinase pathway activation, phloem blockage, starch accumulation, starch accumulation in phloem parenchyma cells, polymer sieve formation, changes in carbohydrate metabolism, cambial activity aberrations, sucrose accumulation and carotenoid synthesis.
[0205] The target gene may comprise a nucleic acid sequence which is transcribed to an mRNA which codes for a polypeptide.
[0206] Alternatively, the target gene can be a non-coding gene such as a miRNA or a siRNA.
[0207] For example, in order to silence the expression of an mRNA of interest, synthesis of the dsRNA suitable for use with some embodiments of the invention can be selected as follows. First, the mRNA sequence is scanned including the 3 UTR and the 5 UTR.
[0208] Second, the mRNA sequence is compared to an appropriate genomic database using any sequence alignment software, such as the BLAST software available from the NCBI server (wwwdotncbidotnlmdotnihdotgov/BLAST/). Putative regions in the mRNA sequence which exhibit significant homology to other coding sequences are filtered out.
[0209] Qualifying target sequences are selected as template for dsRNA synthesis. Preferred sequences are those that have as little homology to other genes in the genome to reduce an off-target effect.
[0210] It will be appreciated that the RNA silencing agent of some embodiments of the invention need not be limited to those molecules containing only RNA, but further encompasses chemically-modified nucleotides and non-nucleotides.
[0211] The dsRNA may be synthesized using any method known in the art, including either enzymatic syntheses or solid-phase syntheses. These are especially useful in the case of short polynucleotide sequences with or without modifications as explained above. Equipment and reagents for executing solid-phase synthesis are commercially available from, for example, Applied Biosystems. Any other means for such synthesis may also be employed; the actual synthesis of the oligonucleotides is well within the capabilities of one skilled in the art and can be accomplished via established methodologies as detailed in, for example: Sambrook, J. and Russell, D. W. (2001), Molecular Cloning: A Laboratory Manual; Ausubel, R. M. et al., eds. (1994, 1989), Current Protocols in Molecular Biology, Volumes I-III, John Wiley & Sons, Baltimore, Md.; Perbal, B. (1988), A Practical Guide to Molecular Cloning, John Wiley & Sons, New York; and Gait, M. J., ed. (1984), Oligonucleotide Synthesis; utilizing solid-phase chemistry, e.g. cyanoethyl phosphoramidite followed by deprotection, desalting, and purification by, for example, an automated trityl-on method or HPLC.
[0212] According to a specific embodiment, the nucleic acid agent is provided to the plant in a configuration devoid of a heterologous promoter for driving recombinant expression of the dsRNA (exogenous), rendering the nucleic acid molecule of the instant invention a naked molecule. The nucleic acid agent may still comprise modifications that may affect its stability and bioavailability (e.g., PNA).
[0213] The term recombinant expression refers to an expression from a nucleic acid construct.
[0214] As used herein devoid of a heterologous promoter for driving expression of the dsRNA means that the molecule doesn't include a cis-acting regulatory sequence (e.g., heterologous) transcribing the dsRNA. As used herein the term heterologous refers to exogenous, not-naturally occurring within a native cell of the plant (such as by position of integration, or being non-naturally found within the cell).
[0215] The nucleic acid agent can be further comprised within a nucleic acid construct comprising additional regulatory elements. Thus, according to some embodiments of aspects of the invention there is provided a nucleic acid construct comprising isolated nucleic acid agent comprising a nucleic acid sequence which specifically reduces the expression of at least one plant pathogen resistance gene product.
[0216] For transcription from a transgene in vivo or from an expression cassette, a regulatory region (e.g., promoter, enhancer, silencer, leader, intron and polyadenylation) may be used to modulate the transcription of the RNA strand (or strands). Therefore, in one embodiment, there is provided a nucleic acid construct comprising the nucleic acid agent. The nucleic acid construct can have polynucleotide sequences constructed to facilitate transcription of the RNA molecules of the present invention are operably linked to one or more promoter sequences functional in a host cell. The polynucleotide sequences may be placed under the control of an endogenous promoter normally present in the host genome. The polynucleotide sequences of the present invention, under the control of an operably linked promoter sequence, may further be flanked by additional sequences that advantageously affect its transcription and/or the stability of a resulting transcript. Such sequences are generally located upstream of the promoter and/or downstream of the 3 end of the expression construct. The term operably linked, as used in reference to a regulatory sequence and a structural nucleotide sequence, means that the regulatory sequence causes regulated expression of the linked structural nucleotide sequence. Regulatory sequences or control elements refer to nucleotide sequences located upstream, within, or downstream of a structural nucleotide sequence, and which influence the timing and level or amount of transcription, RNA processing or stability, or translation of the associated structural nucleotide sequence. Regulatory sequences may include promoters, translation leader sequences, introns, enhancers, stem-loop structures, repressor binding sequences, termination sequences, pausing sequences, polyadenylation recognition sequences, and the like. In some embodiments, the host is a plant, and promoter and other regulatory elements are active in plants.
[0217] The nucleic acid agent can be delivered to the plants in a variety of ways. As mentioned, nucleic acids can be introduced into plants by injection, aerosol application, dusting, in a dry flowable, an emulsifiable flowable, as a granule, in a microencapsulation, in a pellet, as a soluble powder, with an injuring agent, bombardment, by air-brush spraying, supplemented with a plant hormone, added to an agar-based germination platform, supplemented with a wetting agent, supplemented with polysaccharide such as sodium alginate or chitosan, supplemented with transfection reagents. In some non-limiting embodiments, the nucleic acid agent is formulated for application by irrigation, positive or negative pressure application. In other non-limiting embodiments, the nucleic acid agent is formulated for application along with a plant nutrition supplement, for example, a urea-triazone supplement, such as the commercially available urea-triazone N (N-SURE, Tessenderlo-Kerley, Pheonix, Ariz.). Administration of the nucleic acid with such a urea-triazone supplement is suitable for both foliar and soil application in all plants, particularly for commercial vegetable and fruit crops. The nucleic acid agent can be provided to the plant as a nucleic acid, without additional agents (e.g. transfection agents) or encapsulation or other formulation, or, optionally, formulated with additional agents for example, for enhancing uptake or efficacious downregulation of the target gene products.
[0218] In some particular embodiments, the nucleic acid agent is introduced into the plant via injection into the plant or tree. Methods suitable for injection of nucleic acids and nucleic acid agents into the plant or tree are described, for example, in Utah State University Cooperative Extension's informational paper by Michael Kuhns (NR/FF/020), including trunk implantation (see for example, Acecaps and Medicaps), pressurized and no-pressure trunk injection (see, for example, Arborjet Tree IV and Wedgle, Tree Tech and Rainbow Tree Care), soil injection and trunk basal spray.
[0219] In other embodiments, the nucleic acid agent is introduced into the plant using virus-induced gene silencing. Virus-induced gene silencing (VIGS) offers an attractive alternative to transgenic technology as it allows the investigation of gene functions without plant transformation (Ruiz et al., 1998; Burch-Smith et al., 2004). A partial fragment of a candidate gene is inserted into the virus vector to generate a recombinant virus. Infection (e.g. via Agrobacterium) of plants with this recombinant virus leads to the production of virus-related small interfering RNAs (siRNAs) (Baulcombe, 2004), which can mediate degradation of related endogenous gene transcripts, resulting in silencing of the candidate gene expression in inoculated plants (Brigneti et al., 2004; Burch-Smith et al., 2004). The silencing effect on endogenous gene expression can usually be assayed 1-2 weeks after virus inoculation. VIGS has become one of the most widely used and indeed important reverse genetics tools, especially for non-model plants. In some embodiments, candidate nucleic acid sequences for specifically reducing the expression of plant pathogen resistance gene products are screened in model infections and/or field conditions using VIGS.
[0220] VIGS can be used for silencing or reducing expression of candidate plant-pathogen related genes. Using viral vectors to silence an endogenous plant gene may involve cloning into the viral genome, without significantly compromising viral replication and movement, a nucleotide fragment sharing a certain percentage identity or complementarity to the endogenous plant gene. The principle and detailed protocol regarding the VIGS system have been described (Dinesh-Kumar, et al., (2003) Methods in Mol. Biol. 236:287-94; Lu, et al., (2003) Methods 30:296-303). Several different RNA and DNA plant viruses have been modified to serve as vectors for gene expression. These RNA viruses, such as TMV (tobacco mosaic virus), PVX (potato virus X), and TRV (tobacco rattle virus), can been used to silence many different target genes (Angell, et al., (1999) Plant J. 20:357-62; Kumagai, et al., (1995) PNAS 92:1679-83; MacFarlane, et al., (2000) Virology 267:29-35). Other suitable viruses for VIGs construction include, but are not limited to Citrus tristeza virus (CTV), apple latent spherical virus (ALSV), Barley stripe mosaic virus (BSMV), Satellite tobacco mosaic virus (STMV) and Anthoxanthum latent blanching virus (ALBV). Though DNA viruses, limited to Geminiviridae, have not been extensively used as expression vector, tomato golden mosaic virus (TGMV) and cabbage leaf curl virus (CaLCuV) have been used to generate silencing vectors and silenced both transgenes and native genes in tomato and Arabidopsis (Peele, et al., (2001) Plant J. 27:357-66; Turnage, et al., (2001) Plant J. 107:14). As is known to those skilled in the art, each virus/host combination should be optimized for producing effective silencing vectors. In the Examples provided herewith, the viral genome is provided as a bipartite virus. However, it is to be understood that other optimized vectors can be used and are included within the scope of the applicant's teachings. For example, the silencing vector may include the origin of to replication, the genes necessary for replication in a plant cell, and one or more nucleotide sequences with similarity to one or more target genes. The vector may also include those genes necessary for viral movement. In the case of bipartite viruses, for example geminiviruses, the A and B components may be carried in the same silencing vector. Alternatively, as in the case of TRV, the plant may be transformed with both components on separate vectors. In one example, the A genome component of a geminivirus (which replicates autonomously) was shown to be sufficient for VIGS, as was the B component (WO 01/94694 and US Patent Application Publication Number 2002/0148005, both of which are incorporated herein by reference). These references indicate that the A genome (AL1, AL2 and/or AL3) or the B genome (BR1 and/or BL1) may be used as a silencing vector. Other silencing vectors are disclosed in U.S. Pat. No. 6,759,571 and US Patent Application Publication Numbers 2004/0019930 and 20110016584, both of which are herein incorporated by reference. WO 01/94694 (incorporated herein by reference) discloses the locations of the geminivirus genome where the nucleotide sequences may be inserted. For example, the nucleotide sequence that is similar to at least a fragment of a target gene may replace any coding or non-coding region that is nonessential for the present purposes of gene silencing, may be inserted into the vector outside the viral sequences, or may be inserted just downstream of an endogenous viral gene, such that the viral gene and the nucleotide sequence are cotranscribed. For example, the nucleotide sequence may be inserted in the common region of the viral genome, however it is preferred that the nucleotide sequences not be inserted into or replace the Ori sequences or the flanking sequences that are required for viral DNA replication. The size of the nucleotide sequence that is similar to the target gene may depend on the site of insertion or replacement within the viral genome.
[0221] Thus, in some embodiments, the nucleic acid agent comprising a nucleic acid which specifically reduces the expression of at least one plant pathogen resistance gene product is comprised in a VIGS viral-induced gene silencing vector construct. In some embodiments, the VIGS vector construct is further comprised in a suitable bacterial host, for example, an Agrobacterium. In yet further embodiments, administering or providing the nucleic acid agent of the invention to the plant comprises introducing a VIGS vector comprising the nucleic acid agent into the cells of a host plant.
[0222] Expression comprises transcription of the heterologous DNA sequence into mRNA. Regulatory elements ensuring expression in eukaryotes are well known to those skilled in the art. In the case of eukaryotic cells, they comprise polyA signals ensuring termination of transcription and stabilization of the transcript. The polyA signals commonly used include that of the 35S RNA from CaMV and that of the nos gene from Agrobacterium. Other regulatory elements can include transcriptional and/or translational; enhancers, introns, and others as is known to those skilled in the art.
[0223] Any methods of inoculation or transformation may be used as is known to those skilled in the art. The delivery methods for VIGS constructs include but are not limited to, mechanical injection of in vitro transcribed RNA or extracts from infected plants, Agrobacterium (Agro)-inoculation, inoculation by gentle abrasion of the surfaces of the leaves with carborundum and plasmid DNA (plasmid inoculation), and microprojectile bombardment. Mechanical injection is time consuming but can increase the efficiency of silencing in certain hosts such as Arabidopsis (Ratcliff, et al., (2001) Plant J. 25:237-45). Agro-inoculation is the most popular and has been developed for both DNA and RNA viruses (Schob, et al., (1997) Mol. Gen. Genet. 256:581-85). Agro-inoculation is more feasible for large-scale production application and less time consuming. Tobacco, tomato, and barley VIGS vectors have been developed and shown extensive silencing using Agro-inoculation. Specifically, TRV-derived VIGS vector/Agro-inoculation is becoming the dominant combination for many investigators. Inoculation by gentle abrasion of the surfaces of the leaves with carborundum and plasmid DNA is described in Uhde, et al., (2005) Arch. Virol. 150:327-340. Microprojectile bombardment of plasmid DNA-coated tungsten or gold micron-sized particles has been extremely useful for DNA virus-based VIGS vector (Muangsan, et al., (2004) Plant J. 38:1004-14). Ryu, et al., (WO 2005/103267) describes a method of VIGS via agroinoculation by drenching roots of the plants in a suspension of Agrobacterium (Agrodrench).
[0224] Thus, according to some embodiments of the invention, there is provided a plant comprising at least one exogenous isolated nucleic acid agent comprising a nucleic acid which specifically reduces the expression of at least one plant pathogen resistance gene product selected from the group consisting of plant gene products having at least 60% identity to any of the polynucleotide sequences of Table II or Table III. The plant can be any one of a tree, a shrub, a bush, a seedling, a seed, a scion, rootstock, an inarched plant, a bud, a budwood, a root or a graft. In some particular embodiments the plant is a citrus or citrus-like plant selected from the group consisting of including sweet oranges commercial varieties (Citrus sinensis Osbeck (L.), clementines (C. reticulata), limes (C. aurantifolia), lemon (C. limon), sour orange (C. aurantium), hybrids and relatives (Citranges, Citrumelos, Citrandarins), Balsamocitrus dawei, C. maxima, C. jambhiri, Clausena indica, C. lansium, Triphasia trifolia, Swinglea glutinosa, Micromellum tephrocarpa, Merope spp., Eremolemon; Atalantia spp., Severinia buxifolia; Microcitrus spp., Fortunella spp., Calodendrum capense, Murraya spp., Poncirus trifoliate. In some embodiments, wherein the plant is a citrus or citrus-related plant, the at least one exogenous isolated nucleic acid agent comprises a nucleic acid which specifically reduces the expression of at least one plant pathogen resistance gene product selected from the group consisting of the polynucleotide sequences of Table IV. In some embodiments there is provided a cell of the plant comprising the at least one exogenous isolated nucleic acid agent. The cell can be a cell of any organ or tissue of the plant.
[0225] It will be appreciated that some non-citrus plants can also be hosts to Candidatus Liberibacter spp, such as the Solanacaea, for example, tomatoes and potatoes. Tomato has been known to contract C. Liberibacter infection both in the wild and under controlled, laboratory conditions. A non-limiting list of tomato sequences suitable for use with the compositions and methods of the present invention is provided in Table VI:
TABLE-US-00007 TABLE VI SOME TOMATO PLANT PATHOGEN RESPONSE GENE SEQUENCES [SEQ ID NO. and GENE IDENTIFICATION (gi) NO.] 489 460374150 490 460395563 491 460365404 492 460365402 493 460381148 494 460366991 495 460397655 496 460408956 497 460395273 498 460407453 499 460389683 500 460388052 501 460404051 502 460368826 503 460414034 504 460368828 505 460383569 506 460388054 507 350535071 508 460377611 509 460397175 510 225321497 511 460388987 512 225319432 513 460397173 514 225321666 515 1654139 516 460379599
[0226] The isolated nucleic acid can be provided in an agrochemical composition. Thus, according to some embodiments, there is provided an agrochemical composition comprising an isolated nucleic acid sequence which specifically reduces the expression of at least one plant pathogen resistance gene product in a plant. As used herein, the phrase agrochemical composition is defined as a composition for agrochemical use, and, as further defined, the agrochemical composition comprises at least one agrochemically active substance. Thus, in addition to the isolated nucleic acid sequence, the agrochemical composition of the present invention can include additional plant-beneficial or agrochemically active compounds. Exemplary plant-beneficial or agrochemically active compounds include, but not are limited to fertilizers, antibiotics, biocides, pesticides, pest repellents, herbicides, plant hormones, bacteriocides such as copper and the like. In some particular embodiments, the agrochemical composition comprises plant hormones. As used herein, the term plant hormone is used to indicate a plant-generated signaling molecule that normally affects at least one aspect of plant development, including but not limited to, growth, seed development, flowering and root growth. One of skill in the art will readily understand the term plant hormone and what entities fall under the scope of this term. For example, plant hormones include but are not limited to, abscisic acid (ABA) or a derivative thereof, gibberellins (GA), auxins (IAA), ethylene, cytokinins (CK), brassinosteroids (BR), jasmonates (JA), salicylic acid (SA), strigolactones (SL). In select embodiments, the fusion proteins of the present invention comprise a plant hormone binding domain that binds abscisic acid (ABA), gibberellins (GA), auxins (IAA) and/or jasmonates (JA).
[0227] Further, the agrochemical composition can optionally comprise with one or more additives favoring optimal dispersion, atomization, deposition, leaf wetting, distribution, retardation of degradation by soil organisms and their secretion (for example, by addition of bacteriocides such as copper), retention and/or uptake of the agrochemical composition by the plant. As a non-limiting example such additives are diluents, solvents, adjuvants, surfactants, wetting agents, spreading agents, oils, stickers, thickeners, penetrants, buffering agents, acidifiers, anti-settling agents, anti-freeze agents, photo-protectors, defoaming agents, biocides and/or drift control agents.
[0228] The nucleic acid agents, compositions and agrochemical compositions of the present invention are suitable for agrochemical use. Agrochemical use, as used herein, not only includes the use of agrochemical compositions as defined above that are suitable and/or intended for use in field grown crops (e.g., agriculture), but also includes the use of agrochemical compositions that are meant for use in greenhouse grown crops (e.g., horticulture/floriculture) or hydroponic culture systems or uses in public or private green spaces (e.g., private gardens, parks, sports fields), for protecting plants or parts of plants, including but not limited to bulbs, tubers, fruits and seeds (e.g., from harmful organisms, diseases or pests), for controlling, preferably promoting or increasing, the growth of plants; and/or for promoting the yield of plants, or the parts of plants that are harvested (e.g., its fruits, flowers, seeds etc.).
[0229] Agrochemical active substance, as used herein, means any active substance or principle that may be used for agrochemical use, as defined above. Examples of such agrochemical active substances will be clear to the skilled person and may for example include compounds that are active as insecticides (e.g., contact insecticides or systemic insecticides, including insecticides for household use), acaricides, miticides, herbicides (e.g., contact herbicides or systemic herbicides, including herbicides for household use), fungicides (e.g., contact fungicides or systemic fungicides, including fungicides for household use), nematicides (e.g., contact nematicides or systemic nematicides, including nematicides for household use) and other pesticides (for example avicides, molluscicides, piscicides) or biocides (for example, agents for killing bacteria, algae or snails); as well as fertilizers; growth regulators such as plant hormones; micro-nutrients, safeners; pheromones; repellants; baits (e.g., insect baits or snail baits); and/or active principles that are used to modulate (i.e., increase, decrease, inhibit, enhance and/or trigger) gene expression (and/or other biological or biochemical processes) in or by the targeted plant (e.g., the plant to be protected or the plant to be controlled). Agrochemical active substances include chemicals, but also nucleic acids, peptides, polypeptides, proteins (including antigen-binding proteins) and micro-organisms. Examples of such agrochemical active substances will be clear to the skilled person; and for example include, without limitation: Diamides: chlorantraniliprole, cyantraniliprole, flubendiamide, tetronic and tetramic acid derivatives: spirodiclofen, spirotetramat, spiromisifen, modulators of chordotonal organs: pymetrozine, flonicamid; nicotinic acetylcholine receptor agonists: sulfoxaflor, flupyradifurone; spiroxamines, glyphosate, paraquat, metolachlor, acetochlor, mesotrione, 2,4-D,atrazine, glufosinate, sulfosate, fenoxaprop, pendimethalin, picloram, trifluralin, bromoxynil, clodinafop, fluoroxypyr, nicosulfuron, bensulfuron, imazetapyr, dicamba, imidacloprid, thiamethoxam, fipronil, chlorpyrifos, deltamethrin, lambda-cyhalotrin, endosulfan, methamidophos, carbofuran, clothianidin, cypermethrin, abamectin, diflufenican, spinosad, indoxacarb, bifenthrin, tefluthrin, azoxystrobin, thiamethoxam, tebuconazole, mancozeb, cyazofamid, fluazinam, pyraclostrobin, epoxiconazole, chlorothalonil, copper fungicides, trifloxystrobin, prothioconazole, difenoconazole, carbendazim, propiconazole, thiophanate, sulphur, boscalid and other known agrochemicals or any suitable combination(s) thereof. Other suitable agrochemicals will be clear to the skilled person based on the disclosure herein, and may for example be any commercially available agrochemical, and for example include each of the compounds listed in any of the websites of the Herbicide Resistance Action Committee, Fungicide Resistance Action Committee and Insecticide Resistance Action Committee, as well as those listed in Phillips McDougall, AgriService November 2007 V4.0, Products Section2006 Market, Product Index pp. 10-20. The agrochemical active substances can occur in different forms, including but not limited to, as crystals, as micro-crystals, as nano-crystals, as co-crystals, as a dust, as granules, as a powder, as tablets, as a gel, as a soluble concentrate, as an emulsion, as an emulsifiable concentrate, as a suspension, as a suspension concentrate, as a suspoemulsion, as a dispersion, as a dispersion concentrate, as a microcapsule suspension or as any other form or type of agrochemical formulation clear to those skilled in the art. Agrochemical active substances not only include active substances or principles that are ready to use, but also precursors in an inactive form, which may be activated by outside factors. As a non limiting example, the precursor can be activated by pH changes, caused by plant wounds upon insect damage, by enzymatic action caused by fungal attack, or by temperature changes or changes in humidity.
[0230] The agrochemical composition hereof may be in a liquid, semi-solid or solid form and for example be maintained as an aerosol, flowable powder, wettable powder, wettable granule, emulsifiable concentrate, suspension concentrate, microemulsion, capsule suspension, dry microcapsule, tablet or gel or be suspended, dispersed, emulsified or otherwise brought in a suitable liquid medium (such as water or another suitable aqueous, organic or oily medium) for storage or application. Optionally, the composition further comprises one or more further components such as, but not limited to diluents, solvents, adjuvants, surfactants, wetting agents, spreading agents, oils, stickers, thickeners, penetrants, buffering agents, acidifiers, anti-settling agents, anti-freeze agents, photo-protectors, defoaming agents, biocides and/or drift control agents or the like, suitable for use in the composition hereof.
[0231] According to some aspects of the present invention there is also provided a method for manufacturing an agrochemical composition, the method comprising (i) selecting at least one, preferably more, nucleic acid sequence which specifically reduces the expression of at least one plant pathogen resistance gene product in a plant (e.g. dsRNA), and (ii) formulating the nucleic acid agent in a compound with additional substance or substances, such as an agrochemical active substance, or a combination of compounds, and optionally (iii) adding further components that may be suitable for such compositions, preferably for agrochemical compositions. In some embodiments, the compound is comprised in a carrier.
[0232] The method of the present invention comprises at least one application of a composition hereof to the plant or to plant parts.
[0233] If needed, the composition is dissolved, suspended and/or diluted in a suitable solution before use. The application to the plant or plant parts is carried out using any suitable or desired manual or mechanical technique for application of an agrochemical composition, including but not limited to spraying, brushing, dressing, dripping, dipping, coating, spreading, applying as small droplets, a mist or an aerosol. Increasing yield, growth rate, vigor, biomass, fruit quality or stress tolerance of a plant when infected by a plant pathogen as used herein, is the protection of the plant against damage or yield decrease, caused by the plant pathogen infection (as defined earlier). Thus, in addition to the action on the plant pathogen response, the composition hereof can have an insecticidal or an antibiotic or insecticidal activity, helping to combat damage, and as such prevent yield lossescaused by plant pathogenic organisms.
[0234] In some embodiments, the dsRNA or compositions of the invention will be provided to the plant by injection.
[0235] Exemplary concentrations of dsRNA in the composition include, but are not limited to, 0.01-0.3 ug/ul, 0.01-0.15 ug/ul, 0.04-0.15 ug/ul, 0.1-100 ug/u1; 0.1-50 ug/ul, 0.1-10 ug/ul, 0.1-5 ug/ul, 0.1-1 ug/ul, 0.1-0.5 ug/ul, 0.15-0.5 ug/ul, 0.1-0.3 ug/ul, 0.01-0.1 ug/ul, 0.01-0.05 ug/ul, 0.02-0.04 ug/ul, 0.001-0.02 ug/ul. According to further embodiments, the concentration of dsRNA in the treating solution includes, but is not limited to, 0.01-0.3 ng/ul, 0.01-0.15 ng/ul, 0.04-0.15 ng/ul, 0.1-100 ng/u1; 0.1-50 ng/ul, 0.1-10 ng/ul, 0.1-5 ng/ul, 0.1-1 ng/ul, 0.1-0.5 ng/ul, 0.15-0.5 ng/ul, 0.1-0.3 ng/ul, 0.01-0.1 ng/ul, 0.01-0.05 ng/ul, 0.02-0.04 ng/ul, 0.001-0.02 ng/ul. According to a specific embodiment, the concentration of the dsRNA in the treating solution is 0.1-1 ug/ul. According to some embodiments, the nucleic acid agent is provided in amounts effective to reduce or suppress expression of at least one plant pathogen resistance gene product. As used herein a suppressive amount or an effective amount refers to an amount of dsRNA which is sufficient to down regulate (reduce expression of) the target gene by at least 20%, 30%, 40%, 50%, or more, say 60%, 70%, 80%, 90% or more even 100%.
[0236] According to some embodiments of the present invention, the concentration of dsRNA is provided to the plant in effective amounts, measured in mass/kg plant. Such effective amounts include, but are not limited to, 0.001-0.003 mg/kg, 0.005-0.015 mg/kg, 0.01-0.15 mg/kg, 0.1-100 mg/kg; 0.1-50 mg/kg, 0.1-10 mg/kg, 0.1-5 mg/kg, 0.1-1 mg/kg, 0.1-0.5 mg/kg, 0.15-0.5 mg/kg, 0.1-0.3 mg/kg, 0.01-0.1 mg/kg, 0.01-0.05 mg/kg, 0.02-0.04 mg/kg, 0.001-0.02 mg/kg, 0.001-0.003 g/kg, 0.005-0.015 g/kg, 0.01-0.15 g/kg, 0.1-100 g/kg; 0.1-50 g/kg, 0.1-10 g/kg, 0.1-5 g/kg, 0.1-1 g/kg, 0.1-0.5 g/kg, 0.15-0.5 g/kg, 0.1-0.3 g/kg, 0.01-0.1 g/kg, 0.01-0.05 g/kg, 0.02-0.04 g/kg, 0.001-0.02 g/kg plant. According to a specific embodiment, the effective amount of the dsRNA provided to the plant is 0.0001-10000 mg/kg plant. In another embodiment, the effective amount is 1-1000 mg/kg plant.
[0237] Reagents of the present invention can be packed in a kit including the nucleic acid agent (e.g. dsRNA), instructions for introducing the nucleic acid agent, construct or composition into the plants and optionally an agrochemically active agent.
[0238] Compositions of some embodiments of the invention may, if desired, be presented in a pack or dispenser device, which may contain one or more dosage forms containing the active ingredient. The pack may, for example, comprise metal or plastic foil, such as a blister pack. The pack or dispenser device may be accompanied by instructions for introduction to the plant.
[0239] According to an exemplary embodiment, the nucleic acid agent, or composition and additives are comprised in separate containers.
[0240] As used herein the term about refers to 10%.
[0241] The terms comprises, comprising, includes, including, having and their conjugates mean including but not limited to.
[0242] The term consisting of means including and limited to.
[0243] The term consisting essentially of means that the composition, method or structure may include additional ingredients, steps and/or parts, but only if the additional ingredients, steps and/or parts do not materially alter the basic and novel characteristics of the claimed composition, method or structure.
[0244] As used herein, the singular form a, an and the include plural references unless the context clearly dictates otherwise. For example, the term a compound or at least one compound may include a plurality of compounds, including mixtures thereof.
[0245] Throughout this application, various embodiments of this invention may be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 3, 4, 5, and 6. This applies regardless of the breadth of the range.
[0246] Whenever a numerical range is indicated herein, it is meant to include any cited numeral (fractional or integral) within the indicated range. The phrases ranging/ranges between a first indicate number and a second indicate number and ranging/ranges from a first indicate number to a second indicate number are used herein interchangeably and are meant to include the first and second indicated numbers and all the fractional and integral numerals therebetween.
[0247] As used herein the term method refers to manners, means, techniques and procedures for accomplishing a given task including, but not limited to, those manners, means, techniques and procedures either known to, or readily developed from known manners, means, techniques and procedures by practitioners of the chemical, pharmacological, biological, biochemical and medical arts.
[0248] It is appreciated that certain features of the invention, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable subcombination or as suitable in any other described embodiment of the invention. Certain features described in the context of various embodiments are not to be considered essential features of those embodiments, unless the embodiment is inoperative without those elements.
[0249] Various embodiments and aspects of the present invention as delineated hereinabove and as claimed in the claims section below find experimental support in the following examples.
EXAMPLES
[0250] Reference is now made to the following examples, which together with the above descriptions, illustrate the invention in a non limiting fashion.
[0251] Generally, the nomenclature used herein and the laboratory procedures utilized in the present invention include molecular, biochemical, microbiological and recombinant DNA techniques. Such techniques are thoroughly explained in the literature. See, for example, Molecular Cloning: A laboratory Manual Sambrook et al., (1989); Current Protocols in Molecular Biology Volumes I-III Ausubel, R. M., ed. (1994); Ausubel et al., Current Protocols in Molecular Biology, John Wiley and Sons, Baltimore, Md. (1989); Perbal, A Practical Guide to Molecular Cloning, John Wiley & Sons, New York (1988); Watson et al., Recombinant DNA, Scientific American Books, New York; Birren et al. (eds) Genome Analysis: A Laboratory Manual Series, Vols. 1-4, Cold Spring Harbor Laboratory Press, New York (1998); methodologies as set forth in U.S. Pat. Nos. 4,666,828; 4,683,202; 4,801,531; 5,192,659 and 5,272,057; Cell Biology: A Laboratory Handbook, Volumes I-III Cellis, J. E., ed. (1994); Culture of Animal CellsA Manual of Basic Technique by Freshney, Wiley-Liss, N. Y. (1994), Third Edition; Current Protocols in Immunology Volumes I-III Coligan J. E., ed. (1994); Stites et al. (eds), Basic and Clinical Immunology (8th Edition), Appleton & Lange, Norwalk, Conn. (1994); Mishell and Shiigi (eds), Selected Methods in Cellular Immunology, W. H. Freeman and Co., New York (1980); available immunoassays are extensively described in the patent and scientific literature, see, for example, U.S. Pat. Nos. 3,791,932; 3,839,153; 3,850,752; 3,850,578; 3,853,987; 3,867,517; 3,879,262; 3,901,654; 3,935,074; 3,984,533; 3,996,345; 4,034,074; 4,098,876; 4,879,219; 5,011,771 and 5,281,521; Oligonucleotide Synthesis Gait, M. J., ed. (1984); Nucleic Acid Hybridization Hames, B. D., and Higgins S. J., eds. (1985); Transcription and Translation Hames, B. D., and Higgins S. J., eds. (1984); Animal Cell Culture Freshney, R. I., ed. (1986); Immobilized Cells and Enzymes IRL Press, (1986); A Practical Guide to Molecular Cloning Perbal, B., (1984) and Methods in Enzymology Vol. 1-317, Academic Press; PCR Protocols: A Guide To Methods And Applications, Academic Press, San Diego, Calif. (1990); Marshak et al., Strategies for Protein Purification and CharacterizationA Laboratory Course Manual CSHL Press (1996); all of which are incorporated by reference as if fully set forth herein. Other general references are provided throughout this document. The procedures therein are believed to be well known in the art and are provided for the convenience of the reader. All the information contained therein is incorporated herein by reference.
[0252] General Materials and Experimental Procedures
[0253] Gene Target Selection
[0254] Target plant resistance response genes are selected according to reported microarray and RNAseq experiments, for example, Tables II, IV and IV(a). Genes from different functional categories are targeted, such as: changes in Salicylic acid levels, changes in Jasmonic acid levels, changes in Gibberellic acid levels, changes in Auxin levels, changes in Cytokinin levels, changes in Ethylene levels, changes in ABA phyto-hormones levels, up-regulation of phyto-hormone-related genes, biosynthesis, deposition and degradation of callose, reactive oxygen species production, functional FLS2/BAK1 complex formation, protein-kinase pathway activation, phloem blockage, starch accumulation, starch accumulation in phloem parenchyma cells, polymer sieve formation, changes in carbohydrate metabolism, cambial activity aberrations, sucrose accumulation and carotenoid synthesis. The specific sequence for targeting is selected according to siRNA analysis available on-line, such as http://www(dot)med(dot)nagoya-u(dot)ac(dot)jp/neurogenetics/i_Score/i_score(dot)html. The selected sequences are ordered synthetically and serve as template for in vitro reverse transcription reaction.
[0255] For example, genes and sequences such as those in Table III, and homologues thereof, are selected for targeting and dsRNA targeting them is generated as described below.
[0256] Bioassay
[0257] Tomato plants are susceptible to C. Liberibacter psyllaurous infection via the psyllid B. cockerelli. Thus, tomato plants constitute a model species for assessing the efficacy of compositions and methods for enhancing fitness of HLB-infected plants.
[0258] dsRNA, generated as described above, comprising sequences of selected target tomato genes associated with plant pathogen resistance response is introduced into uninfected tomato plants by dusting, spraying, irrigation, injection or other effective means of delivering the dsRNA to the plant. Exemplary target genes from tomato are detailed in Table VI.
[0259] Presence of the dsRNA in the tomato plant tissues and organs is monitored by PCR, gel electrophoresis dot blotting or other typical detection technique, and effective means of delivery are selected. Persistence and integrity of the dsRNA is monitored periodically.
[0260] RNA extractions and cDNA syntheses are performed. The cDNA from each replicate treatment is then used to assess the amount and integrity of RNAi by measuring levels of gene expression using qRT-PCR. Reactions are performed in triplicate and compared to an internal reference to compare levels of RNAi. Tomato plants with decreased levels of a tested gene are further grown and experimentally infected with HLB.
[0261] Both control and dsRNA-bearing tomato plants are infected with C. Liberibacter psyllaurous (also known as Lso) by contacting with infected psyllid or grafting of infected shoots onto tomato rootstock. C. Liberibacter infection is identified by visual inspection for characteristic yellowing, mottling, spotting, leaf curling, stiffness, springiness, purpling, stunting, growth, fruiting etc. and verified by PCR for C. Liberibacter-specific markers.
[0262] Fitness of the control and treated tomato plants is assayed according to fruit quality, fruit drop and visual inspection. dsRNA, expression of targeted genes and severity of C. Liberibacter infection are also monitored, in order to assess the correlation between the extent of downregulation of the targeted gene expression, the severity of the disease and the fitness of the treated plants, compared with untreated or sham treated controls.
[0263] The present inventors contemplate that introducing dsRNA targeted to tomato plant pathogen resistance response genes into the tomato plants will enhance their fitness and fruit quality following C. Liberibacter (e.g. Lso) infection by attenuating the severity of plant response to infection and preventing or alleviating other adverse effects of plant pathogen resistance response on the infected plant.
[0264] Candidate pathogen resistance response genes whose downregulation proves effective in enhancing fitness and fruit quality can serve as valid targets for dsRNA silencing studies in other HLB-susceptible plant species, such as Citrus.
Example 1
Screening for Tomato Cultivar Compatibility with Psyllids Yellows (Lso) Disease and with Tobacco Rattle Virus (TRV)-Mediated Virus-Induced Gene Silencing
[0265] In order to select tomato cultivars suitable for modeling HBL disease, and the attenuation thereof by gene silencing, expression of the phytoene desaturase (PDS) gene was targeted by viral-induced gene silencing (VIGS), using a tomato rattle virus (TRV) vector and Agrobacterium transformation. Plants exhibiting photobleaching and strong, uniform gene silencing were selected as candidates for infection via psyllid rearing.
[0266] Cultivars
[0267] Tomato cultivars having a variety of different characteristics were chosen, including open-pollinating-early maturation cultivars (Gold Nugget, Yellow Pear, Early Cascade), open pollination-late maturation cultivars (Manitoba, Prudens Purple, Red Zebra), hybrid-early maturation cultivars (Juliet, Tiny Tim) and Hybrid-Late Maturation cultivars (Big Beef and Celebrity).
[0268] Gene silencing Seeds were germinated in water-saturated germination soil mixture in germination cones, cones covered to exclude light and incubated for 48-72 hours at 23-26 degrees C., then transferred to 16/8 light/dark cycle. Seedlings appeared typically after 5 days. The seedlings were then grown to the four true leaf stage (approximately 3 weeks post germination).
[0269] Agrobacterium containing constructs pTRV1, pTRV2-Empty Vector (no PDS sequence) and pTRV2-PDS were grown in LB medium+antibiotics overnight, pelleted and resuspended in inoculation medium (10 mM MES, 10 mM MgCl, 250 uM acetosyringone), and OD.sub.600 measured. pTRV2-PDS contains the tomato phytoene desaturase sequence SEQ ID NO: 520. SEQ ID NO: 519 is the complete tomato PDS sequence. Agrobacterium cultures were mixed 1:1 just prior to infiltration of the plants by spray inoculation. TRV is a bipartite virus and, as such, two different A. tumefaciens strains are used for VIGSone carrying pTRV1, which encodes the replication and movement viral functions while the other, pTRV2, harbors the coat protein and the plant endogenous sequence used for VIGS. Inoculation of the tomato seedlings with a mixture of both strains results in gene silencing.
[0270] Seedlings grown to four-true-leaf stage were inoculated with the transformed Agrobacterium, and grown for another 20 days, and observed for appearance of photo-bleaching (indicating PDS silencing). In order to monitor the levels of target mRNA in the inoculated plants, quantitative PCR analysis was performed on the RNA extracted from homogenized plant material samples, following synthesis of cDNA copies using reverse transcriptase.
[0271] Infection of Plants with Lso Via Psyllids
[0272] In order to expose the plants to the Lso bacterial pathogen, lower leaves of test plants are covered with an organza bag, one end of which is closed on the leaf, psyllids introduced into the bag (e.g. 15 adult psyllids per treatment) from the other opening and the bag drawn closed to prevent psyllid migration. Test and matching control plants (no psyllids) were returned to normal photoperiod for 72 hours, in order to allow psyllids to feed on the leaves. At 72 hours, the treated leaf (and corresponding control plant leaves) was removed and bag discarded.
[0273] Nucleic Acid Extraction
[0274] DNA was extracted using cetyl trimethyl ammonium bromide (CTAB) buffer. Extraction of RNA alone was performed using TRI reagent extraction with DNase treatment to remove DNA.
[0275] Results
[0276] Three cultivars were highly compatible with VIGS silencing (
[0277] All the rest of the examined cultivars were deemed incompatible for one of the following reasons: 1. The TRV infection resulted in severe stunting of the plants 2. The photo bleaching appeared at low rates 3. The photo bleaching was very weak and patchy.
[0278] Leaves were picked and processed to determine whether the PDS gene silencing is exclusive to the photo bleaching phenotype. Both green and white leaves were analyzed. The results in
[0279] Among the three cultivars that exhibited satisfactory gene silencing, only one was compatible with Lso infection via infected psyllid rearing. Tiny Tim infection resulted in fast progression of disease symptomology. Within 3 weeks post infection, the infected plants were visibly distinguishable from the non-infected plants.
[0280] The presence of actual infection of the psyllid reared tomato plants with the Lso bacterial pathogen was confirmed by PCR using either of two nucleic acid extraction protocols, one in which DNA is extracted, and another extracting RNA. Samples from infected and control plants were assayed for the presence of the Lso 16s ribosomal sequence (SEQ ID NO: 521), using the following primers:
TABLE-US-00008 OA2(alsoknownasCP_P97) GCGCTTATTTTTTAATAGGAGCGGCA (SEQIDNO:522) O12C(alsoknownasCP_P98) GCCTCGCGACTTCGCAACCCAT. (SEQIDNO:523)
Internal control of the PCR was provided by measuring the presence of tomato actin sequences. Tomato actin primers used were:
TABLE-US-00009 ACTIN-LIKE7_FActin2qRTF(AlsoknownasCP_P23): TTGCTGACCGTATGAGCAAG (SEQIDNO:525) ACTINLIKE7_RActin2qRTR(AlsoknownasCP_P24) GGACAATGGATGGACCAGAC (SEQIDNO:526) Tomatoactinamplicon (SEQIDNO:524) is291basesinlength.
[0281] Plant tissue harvested from plants infected via psyllid rearing exhibited clear disease signs at 6 weeks post infection. The non-infected plants (mock treatment in which an empty organza bag was applied similarly followed by snipping of the petiole) showed no signs of the disease (
[0282] When cDNA was used as template for Lso detection, the detection was in agreement with the severity of disease signs (
Example II
Gene Silencing of Endogenous Tomato Genes Mink Virus-Induced Gene Silencing (VIGS)
[0283] Once tomato cultivars suitable for both gene silencing and Lso infection were identified, and infection with the bacterial pathogens confirmed, actual gene silencing of candidate genes was undertaken.
[0284] Tiny Tim tomato plants, grown from seed as described above, were agro-infiltrated with Agrobacterium bacterial culture harboring TRV plasmids as described above, using a 1 ml needleless syringe. Targets for gene silencing included genes corresponding to those differentially expressed in HLB infection in citrus:
TABLE-US-00010 TABLE VII Gene Silencing Targets in tomatoes. SEQ ID PRIMERS Full (SEQ ID NOs) GENE Target Sequence Forward Reverse AGPase (NCBI 528 527 541 542 NM_001246989.1) GPT (NCBI 530 529 547 548 XM_004240097.2) Callose Synthase 532 531 539 540 (NCBI XM_004232827.2) Lipoxygenase 534 533 549 550 (GenBank U37840.1) MYB transcriptional 536 535 543 544 regulator homologue (NCBI XM_004249199.2) PP2-B-15 538 537 545 546 (NCBI XM_004230217.1)
[0285] After ligation and transformation into E. coli cells, colony PCR and sequencing were conducted to verify the identity and integrity of each clone (
[0286] After agro-infiltration, the plants were kept at 22 C.+/1 for an additional 22 days before harvesting plant tissue. RNA was extracted and mRNA levels were measured for each gene similarly to the procedure described in Example I.
Results:
[0287] Silencing, to varying degrees, of tomato plant genes is illustrated in
[0288] Small RNA Deep Sequencing of Silenced Tomato Plants
[0289] Small RNA associated with gene silencing were mapped to identify abundant small RNA species, and map the small RNA distribution along the genes.
[0290] RNA was extracted from silenced and control (EV) plants using the MirVana small RNA kit, according to the manufacturer's protocol, and a library representing the population of small RNA fragments (200 bases or fewer) was prepared. The RNA was sequenced, reads smaller than 18 bases were discarded, and siRNA was quantified in the samples either by alignment to the plant genes silencing targets, or by quantification without alignment to the genome and comparison to tomato mature or stem-and-loop miRNA databases.
[0291]
Example III
Differential Gene Expression Resulting from Lso Infection in Tomatoes
[0292] The transcriptional response of tomato plants to Lso infection was analyzed, in order to identify potential targets for prevention or mitigation of disease symptomology by gene silencing. Expression profiles were generated at one week prior to developing clear symptoms, i.e. when unequivocal differences start to emerge between the infected and non-infected plants, in an effort to identify genes that are likely to be critical to disease symptomology.
[0293] Disease Sign Index
[0294] Lso disease severity in tomato plants was assessed visually according to phenotype, by blinded comparison with a standardized disease sign chart (See
[0295] In order to prepare an expression profile, 110 Tiny Tim tomato plants were germinated simultaneously. After 15 days, 55 of them were infected via infected psyllid rearing, as described above. The remaining plants were defined as controls, for which a petiole was snipped similarly to the infected plants. At each week post infection, leaf samples were taken in duplicates from 5 infected plants and from 5 control plants, for 8 weeks. Each plant was sampled only once to prevent gene expression changes that result from the sampling itself (injury). All plants were monitored for disease signs according to the DSI (Disease Sign Index) (
[0296] A sample that was taken from a plant that exhibited a DSI level of 1, at one week post sampling was defined as a pre-symptomatic sample. Three such samples were defined, and accordingly three controls plants were paired. RNA was extracted with Trizol (according to above protocol) and verified for high quality by gel electrophoresis and measurement of 230 nm/260 nm and 260 nm/280 nm absorbance ratios (inclusionat least 2). To verify Lso infection, cDNA prepared from these extractions was used as template for the Lso detection PCR protocol, as described above.
[0297] Results
[0298] All the three infected plants were positive for Lso infection, while the controls were negative (results not shown). Samples were subjected to microarray analysis using a tomato gene chip (2.0 by Affymetrix). Candidate genes were identified according to the abovementioned criteria, and selected for further investigation as silencing targets.
Example IV
Experimental HLB Disease in Citrus Trees
[0299] In order to establish a disease model for experiments in a laboratory-controlled environment, and in order to synchronize the infections, HLB was introduced into the trees via grafting. The grafted trees can also be used as a template for studying differential gene expression along time.
[0300] Grafting Procedure:
[0301] Currently, each experiment consists of between 30 to 50 infected plants and an equivalent number of graft controls. The infected trees are roughly six months old and belong to the cultivar sweet orange Valencia grafted on top of Swingle rootstock.
[0302] Infection is conducted by grafting two budwoods from different sources onto a tree's stem. The source of grafting material (the budwood) is from infected trees that have been identified as highly symptomatic trees. The graft control trees are self-grafted, i.e. a budwood is removed from a tree and grafted again onto the same tree, in order to rule out gene differential expression that results from the injury involved in grafting (
[0303] A modified protocol for the chip budding graft, where usually, a bud is taken from one plant and inserted onto another, has been used. As the purpose of the graft here is just to connect vascular tissues and not for vegetative propagation, the scions cut to be used do not need any bud.
[0304] Exemplary Grafting Protocol:
[0305] 1. With a scalpel, make a 45 angled cut to a quarter of the distance through the rootstock, a young non-lignified stem from a healthy Citrus sp. Four centimeters above the first cut, make a second downward and inward cut until it meets the first cut to create a small notch and remove the chunk of bark;
[0306] 2. With a scalpel, cut a piece of the scion, a stem of the HLB infected Citrus sp., in a root-apical direction, with the same size of the chunk cut of the rootstock. This scion should have the same caliber of the rootstock's stem cut;
[0307] 3. Insert the stem infected with HLB cut (scion) into the cut of the healthy plant's stem (rootstock), reassuring that both stems are in the same vascular flow direction (root-apical);
[0308] 4. Wrap the region with a plastic strip as tight as possible;
[0309] 5. After forty days take the plastic strip off, if the infected stem died, there is a high possibility that the bacteria failed to transmit in the healthy tissue, therefore discard the tree;
[0310] 6. If the grafting succeeded (the infected stem is still alive), after two months, the grafted plant can be tested (from a leaf sample above the graft) by PCR reaction to evaluate success of infection;
[0311] 7. Monitor growth effects, symptoms should appear from 4 months;
[0312] Control Group:
[0313] To produce a control plant, use the same procedure described above, but performing only with healthy plants (no infected scions).
[0314] HLB Detection by Conventional PCR.
[0315] In order to assess the success rate of huanglongbing (HLB) infection of grafted citrus plants and to confirm that control plants are free of these bacteria, HLB specific DNA can be detected by conventional PCR.
[0316] DNA is extracted from citrus similarly to the DNA extraction protocol described above for tomato.
[0317] To detect the presence or absence of Ca. L. asiaticus, Ca. L. africanus and Ca. L. americanus in citrus plants, a duplex PCR is performed using bacterial-specific primers, for example, targeting the operon ribosomal protein gene of Ca. L. asiaticus and Ca. L. africanus and the 16S rDNA of Ca. L. americanus.
[0318] Exemplary Primers for PCT Detection of HLB Infection:
Ca. L. americanus:
TABLE-US-00011 (SEQIDNO:715) GB1-forwardprimer: AAGTCGAGCGAGTACGCAAGTACT (SEQIDNO:716) GB3-reverseprimer: CCAACTTAATGATGGCAAATATAG
Ca. L. asiaticus and Ca. L. africanus:
TABLE-US-00012 (SEQIDNO:717) A2-forwardprimer: TATAAGGTTGACCTTTCGAGTTT (SEQIDNO:718) J5-reverseprimer: ACAAAAGCAGAAATAGCACGAACAA
[0319] Additional Primers:
TABLE-US-00013 (SEQIDNO:719) CaLasPGK_RT_L3forward CAATCGTGGGAGGCTCTAAG (SEQIDNO:720) CaLasPGK_RT_R3reverse CCATGCCCTGTGCTACTAA (SEQIDNO:589) Citrus18Sforward GCTTAGGCCAAGGAAGTTTG (SEQIDNO:590) Citrus18Sreverse TCTATCCCCATCACGATGAA
[0320]
Example V
HLB Infection-Sensitive ParametersPlant Height
[0321] One of the most pronounced symptomatic responses of young citrus trees to HLB infection is vertical growth retardation. Establishment of a quantitative measurement of this parameter is important to the ability to assess results of treatment(s). Trees were pruned to 50 cm, and then measured for 8 months. Careful measurement of both infected trees and uninfected control trees over the eight months revealed that height differences emerge approximately at 5 months post infection, and proceed to increase, consistently, in successive months:
TABLE-US-00014 TABLE VIII Months Post-Infection Control Height (cm) Infected Plant Height (cm) 0 50 50 1 53.8 53.7 2 57.1 58.0 3 59.3 58.4 4 61.3 60.1 5 63.9 61.3 6 69.3 62.9
Example VI
Differential Gene Expression in HLB
[0322] Genes that are up-regulated in response to HLB (differentially expressed between infected and non-infected trees), and genes that are up-regulated in response to infection only in a susceptible strain, but not (or to a lesser degree) in a tolerant strain, are attractive targets for silencing. One example is callose synthase, responsible for callose deposition in the phloem. Thus, a callose synthase gene whose regulation adheres to the criteria mentioned above was selected for gene expression analysis. mRNA abundance of genes of interest was compared between infected and non-infected groups of plants, both from experimental groups (e.g. grafting experiments) and from field samples collected from commercial orange groves.
[0323] For each measurement, ten infected and ten non-infected samples were sampled. RNA was extracted according to the protocol described above and cDNA was synthesized accordingly. mRNA levels were compared using the SYBR Green (Life Technologies, Carlsbad Calif.) protocol for detection of PCR products. mRNA levels were calculated using differential Ct (cycle threshold) calculation (see above). The 18S gene was used as normalizing transcript.
[0324] Average relative mRNA abundance levels detected for PP-2 (phloem-specific lectin PP2-like protein) (
TABLE-US-00015 Annotation direc- Sequence (SEQIDNO) tion (SEQIDNO:) Phloem-specific F AGATTAGTGTTGCCGCTGGT lectinPP2-like (551) proteinNCBI XM_006433409.1 R GAAGGAAGGGTTTCCAGGTC (571) (552) ADPglucosepyro- F CATTCGTTCAGGAATCACCA phosphorylaselarge (553) subunitNCBI R CTTCTTTCCAGGCCAAAATG XM_006487154.1(572) (554) Alpha-amylase, F GCTTACATCCTCACACATCCC putative (555) XM_006473264.1(574) R CCATCTTTGGTCCAATCTTCA T(556) Glucose-6-phos- F TTGTGTGGTGGGTAGC phate/phosphate (557) translocator, putativeNCBI R GAGCATTGACGGGTTGA XM_006467936.1(573) (558) citrus18SrRNA F GCTTAGGCCAAGGAAGTTTG (559) R TCTATCCCCATCACGATGAA (560) cytosoliccop- F CTGGAACTAACGGTCGCAAG per/zincsuperoxide (563) dismutase R AAGTGTGAATAATGAGTGCGTGA CSD1GenBank: (564) AJ000045.1(577) oxidoreductase, F ACCAGCTTCCTCGTTTGTGT zincbinding (567) dehydrogenase R TCAAGGTGGGAAAATGCTTC familyproteinNCBI (568) XM_006470280.1(575) Callosesynthase F TTCCTCTTCAACCCATCAGG (569) NCBIXM_006482747.1 R TCCAATCTGTCCAGTCATCAA (576) (570)
Example VII
Fine Analysis of Differential Gene Expression by Signal Amplification
[0325] Signal amplification, as opposed to molecular amplification (as in PCR) of nucleic acid sequences provides a sensitive tool for measuring gene expression along the infection cycle of HLB, since it is not limited to fold-changes as in PCR. The expression dynamics of eight different genes, from three different time points were monitored and compared.
[0326] For each of the three time points, ten trees were sampled in triplicate. Five trees were verified for infection by PCR (as described above) and three were graft controls that were verified to be bacteria free. (The exception was time point 1 months post infection for which it was too soon to verify infection since HLB bacteria could be detected only after 8-20 months post grafting).
[0327] Sample preparation for signal amplification (Quantigene 2.0, Affymetrix, Inc, Santa Clara, Calif.) is typically as follows: 400 uL of homogenization solution with 4 ul proteinase K was added to each sample. Each sample was homogenized at 25 Hz for 15 minutes per cycle, for a total of 3 cycles, incubated at 65 C. for 30 minutes, and centrifuged to pellet debris. Each homogenate was then transferred to a new tube, resedimented to clarify, and aliquoted to the hybridization plate and processed according to the manufacturer's protocol.
[0328] The genes analyzed by signal amplification include GPT (NCBI Reference Sequence: XM_006449009.1, SEQ ID NO: 721), Alpha amylase (NCBI Reference Sequence: XM_006473264.1, SEQ ID NO: 722), PP2 (NCBI Reference Sequence: XM_006472910.1, SEQ ID NO: 723), AGPase NCBI Reference Sequence: XM_006423259.1, SEQ ID NO: 724), Zinc transporter (NCBI Reference Sequence: XM_006448556.1, SEQ ID NO: 725), MYB transcriptional regulator (NCBI Reference Sequence: XM_006429779.1, SEQ ID NO: 726), CDR1 (NCBI Reference Sequence: XM_006437293.1, SEQ ID NO: 727), Cu/Zn Superoxide dismutase (GenBank: AJ000045.1, SEQ ID NO: 577), Elongation factor 1 HKG (Gene ID: 102578002, SEQ ID NO: 729) and Actin like-HKG (NCBI Reference Sequence: XM_006492793.1, SEQ ID NO: 730).
[0329] Results
[0330] Gene expression was normalized to Actin. Results of gene expression with signal amplification indicated that while certain genes, such as superoxide dismutase (
Example VIII
Analysis of Starch Accumulation Dynamics in HLB Infected and Non-Infected Citrus Plants
[0331] Starch is the major and the most abundant storage polysaccharide in plants and is a primary product of photosynthesis deposited transiently in the chloroplast in the form of insoluble granules. It is synthesized inside plastids, but its function depends upon the particular type of plastid and the plant tissue from which it is derived. Starch synthesis can be influenced by day length, night temperature and the time of the day. Normally, all starch synthesized during the light period is degraded during the night, supplying sugars needed for metabolism in the whole plant. In general, starch biosynthesis starts with the formation of ADP-glucose and then transfer of the glucose moiety on to an acceptor, usually a short chain of malto-oligosaccharides and at the end of whole processes in which participate numerous enzymes they build up final structure of starch granule.
[0332] A major symptom associated with HLB infection is massive starch build up in leaves and petioles. HLB affected trees have starch accumulated extensively in photosynthetic cells as well as phloem elements and vascular parenchyma in leaves and petioles. In contrast, roots from HLB-affected trees are depleted of starch whereas roots from control trees contain substantial starch deposits. Starch accumulation, however, is also observed in response to nutritional deficiencies and viral infection.
[0333] Investigation of the host response through microarray analysis indicated that HLB infection up-regulates starch biosynthetic enzymes: three key starch biosynthetic genes including ADP-glucose pyrophosphorylase, starch synthase, granule-bound starch synthase and starch debranching enzyme likely contributed to accumulation of starch in HLB affected leaves.
[0334] Starch Content Assay
[0335] Simple measurement of the starch content of plant tissues involved solubilizing the starch, converting it quantitatively to glucose and assaying the glucose. Plant tissue must initially be frozen rapidly to arrest metabolism, then extracted to remove free glucose. Starch is solubilized by heating, then digested to glucose by adding glucan hydrolases. Glucose is assayed enzymatically. Iodine-based protocols can also be used, however, they tend to be less sensitive and less accurate, while the enzymatic assays are more suitable for tissues that have a wide range of starch contents.
[0336] Briefly, starch measurement is performed as follows:
[0337] Starch Extraction:
[0338] Leaf tissue is harvested, flash frozen, ground (e.g. in a mortar and pestle), weighed and extracted with ethanol. Starch is pelleted and washed with ethanol, dried and reconstituted in water. Starch is then gelatinized by autoclaving, then digested with alpha-amylase and amyloglucosidase.
[0339] Glucose content of the digested starch samples is measured by the Hexokinase assay [Glucose (HK) Assay, Sigma, St Louis, Mo.]. Glucose is phosphorylated by adenosine triphosphate (ATP) in the reaction catalyzed by hexokinase. Glucose-6-phosphate (G6P) is then oxidized to 6-phosphogluconate in the presence of oxidized nicotinamide adenine dinucleotide (NAD) in a reaction catalyzed by glucose-6-phosphate dehydrogenase (G6PDH). During this oxidation, an equimolar amount of NAD is reduced to NADH. The consequent increase in absorbance at 340 nm is directly proportional to glucose concentration.
Results:
[0340]
[0341]
Example IX
Lso Disease Sign Mitigation by Gene Silencing
[0342] The effect of gene silencing on disease sign in LSO infected tomato plants can be measured quantitatively, for example, according to differences in starch content of the leaves, or semi-quantitatively using phenotypic scoring, and correlated molecular data indicating gene silencing and the presence of LSO.
[0343] Plants
[0344] Tiny Tim tomato plants were germinated as described above. Plants having two or more true leaves at 6-9 days were excluded from the experiment.
[0345] VIGS Infiltration
[0346] VIGS infiltration was conducted using a 1 ml needleless syringe at the bottom side of the cotyledon, at 6-9 days post germination, as described above.
[0347] 290 plants were divided into the following groups:
[0348] 20 untreated controls
[0349] 50 empty vector (EV)
[0350] 40 PDS (photobleaching silencing control)
[0351] 30 each for GPT silencing, AGPase silencing, PP2 silencing, CalS silencing, LoxD silencing and MYB silencing.
[0352] Plants were kept at 22 degrees C. for optimal gene silencing. After 20 days, all PDS plants (100%) displayed substantial photo bleaching, suggesting robust gene silencing for all treatment groups.
[0353] After exactly two weeks Lso infection was conducted as previously described, according to the following grouping: 10 plants NO VIGS infected, 10 plants NO VIGS uninfected, 30 plants EV infected, 20 plants EV uninfected, 20 plants PDS infected, 20 plants PDS uninfected, 20 plants each individual gene silencing treatment infected and 10 plants each individual gene silencing treatment uninfected.
[0354] Analysis and Sampling:
[0355] Plants were observed at each week after the infection for four weeks. Samples were taken from all plants at two and four weeks after infection.
[0356] At each week, the DSI (Disease Sign Index) index was measured in a double blind procedure.
[0357] RNA was extracted from 4 weeks post infection samples, converted to cDNA and submitted to Lso detection protocol, since by that time all infected plants can be detected by PCR. 94% of the plants were confirmed for infection. Plants that were identified as non-infected were excluded from both the phenotypic and molecular (gene expression) analysis.
[0358] Results
[0359] In an ideal situation, candidate HLB-associated genes are up-regulated with infection. While it has been observed that VIGS suppresses gene expression in nave plants to a certain degree, the combination of VIGS and bacterial infection restores the basal expression levels such that if the gene's up-regulation is responsible for disease symptoms, those would be mitigated upon treatment.
[0360]
[0361] Disease Sign Index
[0362]
[0363] Observation of the phenotypic parameters of DSI indicated good correlation between silencing of some of the candidate genes and phenotype. When compared with the untreated and empty vector-treated plants (EV) at 2 weeks, nearly all of the treated plants had significantly reduced DSI. At 3 weeks post infection, the correlation between gene silencing and low DSI persisted.
[0364] Flower Number
[0365] Another phenotypic parameter that can provide indication of relative health of the plant in Lso infection is the number of flowers observed. When compared with untreated and empty vector plants (EV), flower number of plants in which genes were silenced showed some advantage (
[0366] Water Uptake
[0367] Water uptake is yet another significant phenotypic parameter which indicates relative health of the plant. Infected plants tend to imbibe less water than their non-infected counterparts (see
[0368]
[0369] Taken together, the results indicate that gene silencing of some of the candidate gene targets can clearly influence the phenotype of tomato plants in response to Lso infection. Differential effects of silencing of different genes indicates that gene silencing, when effective, can affect parameters separately and at different stages of the Lso infection.
[0370] Although the invention has been described in conjunction with specific embodiments thereof, it is evident that many alternatives, modifications and variations will be apparent to those skilled in the art. Accordingly, it is intended to embrace all such alternatives, modifications and variations that fall within the spirit and broad scope of the appended claims.
[0371] All publications, patents and patent applications mentioned in this specification are herein incorporated in their entirety by reference into the specification, to the same extent as if each individual publication, patent or patent application was specifically and individually indicated to be incorporated herein by reference. In addition, citation or identification of any reference in this application shall not be construed as an admission that such reference is available as prior art to the present invention. To the extent that section headings are used, they should not be construed as necessarily limiting.