NOVEL LACTIC ACID BACTERIA AND USE THEREOF

20220323515 · 2022-10-13

    Inventors

    Cpc classification

    International classification

    Abstract

    A particular Bifidobacterium spp. strain or particular Lactobacillus spp. strain according to the present invention is isolated from excrement of a human or cabbage kimchi, and thus is highly safe and has physiological activities such as an immunity regulatory effect and an inflammation reaction inhibiting effect. Therefore, the particular Bifidobacterium spp. strain or particular Lactobacillus spp. strain according to the present invention may be used as a material for regulating immunity and inhibiting inflammation reactions, and may be also used as a functional food and drug material useful for preventing, alleviating or treating rhinitis, atopy, asthma, etc. which are allergic diseases.

    Claims

    1.-22. (canceled)

    23. A method for preventing or treating allergic diseases, immune diseases or inflammatory diseases, comprising administering a pharmaceutical composition comprising Bifidobacterium longum IM55 KCCM11961P into an individual.

    24. The method according to claim 23, wherein the Bifidobacterium longum IM55 KCCM11961P comprises a 16S rDNA sequence of SEQ ID NO: 1.

    25. The method according to claim 23, wherein the Bifidobacterium longum IM55 KCCM11961P is a live cell body thereof, a dead cell body thereof, a culture product thereof, a crushed product thereof or an extract thereof.

    26. The method according to claim 23, wherein the pharmaceutical composition further comprising Lactobacillus plantarum IM76 KCCM11962P.

    27. The method according to claim 23, wherein the Lactobacillus plantarum IM76 KCCM11962P comprises a 16S rDNA sequence of SEQ ID NO: 2.

    28. The method according to claim 27, wherein the Lactobacillus plantarum IM76 KCCM11962P is a live cell body thereof, a dead cell body thereof, a culture product thereof, a crushed product thereof or an extract thereof.

    29. The method according to claim 23, wherein the allergic diseases are at least one selected from the group comprising rhinitis, atopy, asthma, atopic dermatitis, allergic conjunctivitis, allergic otitis media, hives and anaphylactic shock.

    30. The method according to claim 23, wherein the immune diseases are at least one selected from the group comprising Crohn's disease, erythema, rheumatoid arthritis, Hashimoto's thyroiditis, pernicious anemia, Addison's disease, type 1 diabetes, lupus, chronic fatigue syndrome, fibromyalgia syndrome, hypothyroidism and hyperthyroidism, scleroderma, Behcet's disease, inflammatory bowel disease, multiple sclerosis, myasthenia gravis, Meniere's syndrome, Guillain-Barre syndrome, Sjogren's syndrome, leukoplakia, endometriosis, psoriasis, leukoplakia, systemic scleroderma, asthma and ulcerative colitis.

    31. The method according to claim 23, wherein the inflammatory diseases are at least one selected from the group comprising arthritis, gout, hepatitis, obesity, corneitis, gastritis, enteritis, nephritis, diabetes, tuberculosis, bronchitis, pleurisy, peritonitis, spondylitis, pancreatitis, inflammatory pain, urethritis, cystitis, vaginitis, arteriosclerosis, septicemia, burn, dermatitis, periodontitis, gingivitis and colitis.

    32. The method according to claim 23, wherein the pharmaceutical composition further comprises at least one selected from the group including chitosan, inulin and citrus pectin.

    33. A method for preventing or alleviating allergic diseases, immune diseases or inflammatory diseases, comprising administering a food composition comprising Bifidobacterium longum IM55 KCCM11961P into an individual.

    34. The method according to claim 33, wherein the Bifidobacterium longum IM55 KCCM11961P comprises a 16S rDNA sequence of SEQ ID NO: 1.

    35. The method according to claim 33, wherein the Bifidobacterium longum IM55 KCCM11961P is a live cell body thereof, a dead cell body thereof, a culture product thereof, a crushed product thereof or an extract thereof.

    36. The method according to claim 33, wherein the food composition further comprising Lactobacillus plantarum IM76 KCCM11962P.

    37. The method according to claim 33, wherein the Lactobacillus plantarum IM76 KCCM11962P comprises a 16S rDNA sequence of SEQ ID NO: 2.

    38. The method according to claim 37, wherein the Lactobacillus plantarum IM76 KCCM11962P is a live cell body thereof, a dead cell body thereof, a culture product thereof, a crushed product thereof or an extract thereof.

    39. The method according to claim 33, wherein the allergic diseases are at least one selected from the group comprising rhinitis, atopy, asthma, atopic dermatitis, allergic conjunctivitis, allergic otitis media, hives and anaphylactic shock.

    40. The method according to claim 33, wherein the immune diseases are at least one selected from the group comprising Crohn's disease, erythema, rheumatoid arthritis, Hashimoto's thyroiditis, pernicious anemia, Addison's disease, type 1 diabetes, lupus, chronic fatigue syndrome, fibromyalgia syndrome, hypothyroidism and hyperthyroidism, scleroderma, Behcet's disease, inflammatory bowel disease, multiple sclerosis, myasthenia gravis, Meniere's syndrome, Guillain-Barre syndrome, Sjogren's syndrome, leukoplakia, endometriosis, psoriasis, leukoplakia, systemic scleroderma, asthma and ulcerative colitis.

    41. The method according to claim 33, wherein the inflammatory disease are at least one selected from the group comprising arthritis, gout, hepatitis, obesity, corneitis, gastritis, enteritis, nephritis, diabetes, tuberculosis, bronchitis, pleurisy, peritonitis, spondylitis, pancreatitis, inflammatory pain, urethritis, cystitis, vaginitis, arteriosclerosis, septicemia, burn, dermatitis, periodontitis, gingivitis and colitis.

    42. The method according to claim 33, wherein the food composition further comprises at least one selected from the group including chitosan, inulin and citrus pectin.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0083] FIG. 1 is a graph of identifying that a concentration of IL-10 is increased upon treating macrophage with Bifidobacterium longum IM55 or Lactobacillus plantarum IM76 (NOR, a normal control group; LPS, a group with induced inflammation reactions; I55, a group with induced inflammation reactions+dosed with Bifidobacterium longum IM55 at 1×10.sup.5 CFU/mcustom-character; and I76, a group with induced inflammation reactions+dosed with Lactobacillus plantarum IM76 at 1×10.sup.5 CFU/mcustom-character are hereinafter the same as in FIGS. 2 to 4).

    [0084] FIG. 2 is a graph of identifying that a concentration of IL-12 is decreased upon treating macrophage with Bifidobacterium longum IM55 or Lactobacillus plantarum IM76.

    [0085] FIG. 3 is a graph of identifying that a concentration of IL-10 is increased upon treating dendritic cells with Bifidobacterium longum IM55 or Lactobacillus plantarum IM76.

    [0086] FIG. 4 is a graph of identifying that a concentration of TNF-α is decreased upon treating dendritic cells with Bifidobacterium longum IM55 or Lactobacillus plantarum IM76.

    [0087] FIG. 5 is a graph of identifying that an expression level of GATA3 is inhibited as a result of treatment with Bifidobacterium longum IM55 or Lactobacillus plantarum IM76 upon inducing a differentiation of T cells into Th2 cells (NOR, a normal control group; ThI, a group dosed with a Th2 cytodifferentiation inducer; I55, a group with induced Th2 cytodifferentiation+dosed with Bifidobacterium longum IM55 at 1×10.sup.5 CFU/mcustom-character; and I76, a group with induced Th2 cytodifferentiation+dosed with Lactobacillus plantarum IM76 at 1×10.sup.5 CFU/mcustom-character are hereinafter the same as in FIG. 6).

    [0088] FIG. 6 is a graph of identifying that an expression level of IL-5 is inhibited as a result of treatment with Bifidobacterium longum IM55 or Lactobacillus plantarum IM76 upon inducing a differentiation of T cells into Th2 cells.

    [0089] FIG. 7 is a graph of identifying that an expression level of FOXp3 is increased as a result of treatment with Bifidobacterium longum IM55 or Lactobacillus plantarum IM76 upon inducing a differentiation of T cells into Treg cells (NOR, a normal control group; TrI, a group dosed with a Treg cytodifferentiation inducer; I55, a group with induced Treg cytodifferentiation+dosed with Bifidobacterium longum IM55 at 1×10.sup.5 CFU/ mcustom-character; and I76, a group with induced Treg cytodifferentiation+dosed with Lactobacillus plantarum IM76 at 1×10.sup.5 CFU/mcustom-character are hereinafter the same as in FIG. 8).

    [0090] FIG. 8 is a graph of identifying that an expression level of IL-10 is increased as a result of treatment with Bifidobacterium longum IM55 or Lactobacillus plantarum IM76 upon inducing a differentiation of T cells into Treg cells.

    [0091] FIG. 9 is a graph of identifying that a serum concentration of IL-5 is decreased upon administering Bifidobacterium longum IM55 or Lactobacillus plantarum IM76 into an animal model with induced allergic rhinitis and asthma (NOR, a normal control group (orally administered with PBS only); CON or AR, a group with an induced disease; DX, a group with an induced disease+intraperitoneally dosed with dexamethasone at 1 mg/kg b.w.; I55, a group with an induced disease+orally dosed with Bifidobacterium longum IM55 at 1×10.sup.9 CFU/mouse; and I76, a group with an induced disease+orally dosed with Lactobacillus plantarum IM76 at 1×10.sup.9 CFU/mouse are hereinafter the same as in FIGS. 10 to 17).

    [0092] FIG. 10 is a graph of identifying that a serum concentration of IgE is decreased upon administering Bifidobacterium longum IM55 or Lactobacillus plantarum IM76 into an animal model with induced allergic rhinitis and asthma.

    [0093] FIG. 11 is a graph of identifying that a serum concentration of IL-4 is decreased upon administering Bifidobacterium longum IM55 or Lactobacillus plantarum IM76 into an animal model with induced allergic rhinitis and asthma.

    [0094] FIG. 12 is a graph of identifying that a concentration of IL-5 in bronchoalveolar lavage fluid (BALF) is decreased upon administering Bifidobacterium longum IM55 or Lactobacillus plantarum IM76 into an animal model with induced allergic rhinitis and asthma.

    [0095] FIG. 13 is a graph of identifying that a concentration of IL-4 in the BALF is decreased upon administering Bifidobacterium longum IM55 or Lactobacillus plantarum IM76 into an animal model with induced allergic rhinitis and asthma.

    [0096] FIG. 14 is a graph of identifying that a distribution rate of Th2 cells in the BALF is decreased upon administering Bifidobacterium longum IM55 or Lactobacillus plantarum IM76 into an animal model with induced allergic rhinitis and asthma.

    [0097] FIG. 5 is a graph of identifying that a distribution rate of eosinophil cells in the BALF is decreased upon administering Bifidobacterium longum IM55 or Lactobacillus plantarum IM76 into an animal model with induced allergic rhinitis and asthma.

    [0098] FIG. 16 is a graph of identifying that a concentration of IL-10 in the BALF is increased upon administering Bifidobacterium longum IM55 or Lactobacillus plantarum IM76 into an animal model with induced allergic rhinitis and asthma.

    [0099] FIG. 17 is a graph of identifying that a distribution rate of Treg cells in the BALF is increased upon administering Bifidobacterium longum IM55 or Lactobacillus plantarum IM76 into an animal model with induced allergic rhinitis and asthma.

    [0100] FIG. 18 is a graph of identifying that a score of rhinitis symptoms (sneezing and nasal rubbing) is decreased upon administering Bifidobacterium longum IM55 or Lactobacillus plantarum IM76 into an animal model with induced allergic rhinitis and asthma (NOR, a normal control group (orally administered with PBS only); AR, a group with an induced disease; DX, a group with an induced disease+intraperitoneally dosed with dexamethasone at 1 mg/kg b.w.; I55, a group with an induced disease+orally dosed with Bifidobacterium longum IM55 at 1×10.sup.9 CFU/mouse; and I76, a group with an induced disease+orally dosed with Lactobacillus plantarum IM76 at 1×10.sup.9 CFU/mouse are hereinafter the same as in FIGS. 19 to 26).

    [0101] FIG. 19 is a graph of identifying that a concentration of IL-4 in the nasal cavity is decreased upon administering Bifidobacterium longum IM55 or Lactobacillus plantarum IM76 into an animal model with induced allergic rhinitis and asthma.

    [0102] FIG. 20 is a graph of identifying that a concentration of 1L-5 in the nasal cavity is decreased upon administering Bifidobacterium longum IM55 or Lactobacillus plantarum IM76 into an animal model with induced allergic rhinitis and asthma.

    [0103] FIG. 21 is a graph of identifying that a disruption of the nasal cavity and an expansion of epithelial cells in the nasal cavity are decreased upon administering Bifidobacterium longum IM55 or Lactobacillus plantarum IM76 into an animal model with induced allergic rhinitis and asthma.

    [0104] FIG. 22 is a graph of identifying that an expression level of GATA3 in the lung tissues is decreased upon administering Bifidobacterium longum IM55 or Lactobacillus plantarum IM76 into an animal model with induced allergic rhinitis and asthma.

    [0105] FIG. 23 is a graph of identifying that an expression level of IL-10 in the lung tissues is increased upon administering Bifidobacterium longum IM55 or Lactobacillus plantarum IM76 into an animal model with induced allergic rhinitis and asthma.

    [0106] FIG. 24 is a graph of identifying that an expression level of FOXp3 in the lung tissues is increased upon administering Bifidobacterium longum IM55 or Lactobacillus plantarum IM76 into an animal model with induced allergic rhinitis and asthma.

    [0107] FIG. 25 is a graph of identifying that an expression level of IL-5 in the lung tissues is decreased upon administering Bifidobacterium longum IM55 or Lactobacillus plantarum IM76 into an animal model with induced allergic rhinitis and asthma.

    [0108] FIG. 26 is a graph of identifying that a degree of inducing inflammations and edema from the lung tissues is decreased upon administering Bifidobacterium longum IM55 or Lactobacillus plantarum IM76 into an animal model with induced allergic rhinitis and asthma.

    [0109] FIG. 27 is a graph of identifying that a score of rhinitis symptom (sneezing and nasal rubbing) and a concentration of IL-5 in the nasal cavity are decreased upon administering a mixture of Bifidobacterium longum IM55 and Lactobacillus plantarum IM76 (at a ratio of 1:1, 1:3 and 1:9) into an animal model with induced allergic rhinitis and asthma (NOR, a normal control group (orally administered with PBS only); AR, a group with an induced disease; DX, a group with an induced disease+intraperitoneally dosed with dexamethasone at 1 mg/kg b.w.; 1:1, a group orally dosed with a mixture of Bifidobacterium longum IM55 and Lactobacillus plantarum IM76 at a ratio of 1:1 (total 1×10.sup.9 CPU/mouse); 1:3, a group orally dosed with a mixture of Bifidobacterium longum IM55 and Lactobacillus plantarum IM76 at a ratio of 1:3 (total 1×10.sup.9 CFU/mouse); and 1:9, a group orally dosed with a mixture of Bifidobacterium longum IM55 and Lactobacillus plantarum IM76 at a ratio of 1:9 (total 1×10.sup.9 CFU/mouse) are hereinafter the same as in FIG. 28).

    [0110] FIG. 28 is a graph of identifying that an expression level of IL-5 in serum is decreased upon administering a mixture of Bifidobacterium longum IM55 and Lacto bacillus plantarum IM76 (at a ratio of 1:1, 1:3 and 1:9) into an animal model with induced allergic rhinitis and asthma.

    [0111] FIG. 29 is a graph of identifying that a concentration of IL-4 and IL-5 in the colon is decreased and a concentration of IL-10 therein is increased upon administering Bifidobacterium longum IM55, Lactobacillus plantarum IM76 or mixtures thereof into an animal model with induced allergic rhinitis and asthma (NOR, a normal control group (orally administered with PBS only); AR, a group with an induced disease; DX, a group with an induced disease+intraperitoneally dosed with dexamethasone at 1 mg/kg b.w.; I55, a group with an induced disease+orally dosed with Bifidobacterium longum IM55 at 1×10.sup.9 CFU/mouse; I76, a group with an induced disease+orally dosed with Lactobacillus plantarum IM76 at 1×10.sup.9 CFU/mouse; and PM, a group with an induced disease+orally dosed with Bifidobacterium longum IM55 and Lactobacillus plantarum IM76 each at 5×10.sup.8 CFU/mouse are hereinafter the same as in FIG. 30).

    [0112] FIG. 30 is a graph of identifying that a constitution of intestinal microorganisms is changed upon administering Bifidobacterium longum IM55, Lactobacillus plantarum IM76 or mixtures thereof into an animal model with induced allergic rhinitis and asthma.

    MODE FOR INVENTION

    [0113] Hereinafter, the present invention will be described in more detail through exemplary embodiments. However, the following exemplary embodiments are offered only to further clearly illustrate the technical features of the present invention, but are not to be construed to limit the scope of protection of the present invention.

    Example 1. Isolation and Identification of Lactic Acid Bacteria

    [0114] (1) Isolation of Lactic Acid Bacteria

    [0115] Excrement of a healthy person in his/her 20's living in Seoul or a healthy person in his/her 60's living in Gurye, Jeollanam-do Province, or cabbage kimchi made at home was inserted and suspended into a GAM broth (Nissui Pharmaceutical, Japan). After that, supernatant thereof was taken and transplanted into an MRS agar medium (Difco, USA) or a GAM agar medium (Nissui Pharmaceutical, Japan). The resulting medium was anaerobically cultured at 37° C. for about 48 hours, after which Lactobacillus spp. strains and Bifidobacterium spp. strains having formed colonies were isolated therefrom.

    [0116] (2) Identification of Isolated Lactic Acid Bacteria

    [0117] With regard to the strains isolated from the human excrement or cabbage kimchi, the species thereof were confirmed and names were given thereto according to gram staining, physiological characteristics, 16S rDNA sequences and the like of those strains. Management nos. and strain names given to the isolated lactic acid bacteria are shown in following tables 1 and 2. The lactic acid bacteria isolated from human excrement were 15 species of Bifidobacterium longum (management Nos. 51 to 65 of the table 1), 10 species of Bifidobacterium adolescentis (management Nos. 66 to 75 of the table 1) and 10 species of Lactobacillus acidophilus (management Nos. 90 to 99 of the table 2), while the lactic acid bacteria isolated from cabbage kimchi were 14 species of Lactobacillus plantarum (management Nos. 76 to 89 of the table 2).

    TABLE-US-00001 TABLE 1 Management no. Strain name 51 Bifidobacterium longum IM51 52 Bifidobacterium longum IM52 53 Bifidobacterium longum IM53 54 Bifidobacterium longum IM54 55 Bifidobacterium longum IM55 56 Bifidobacterium longum IM56 57 Bifidobacterium longum IM57 58 Bifidobacterium longum IM58 59 Bifidobacterium longum IM59 60 Bifidobacterium longum IM60 61 Bifidobacterium longum IM61 62 Bifidobacterium longum IM62 63 Bifidobacterium longum IM63 64 Bifidobacterium longum IM64 65 Bifidobacterium longum IM65 66 Bifidobacterium adolescentis IM66 67 Bifidobacterium adolescentis IM67 68 Bifidobacterium adolescentis IM68 69 Bifidobacterium adolescentis IM69 70 Bifidobacterium adolescentis IM70 71 Bifidobacterium adolescentis IM71 72 Bifidobacterium adolescentis IM72 73 Bifidobacterium adolescentis IM73 74 Bifidobacterium adolescentis IM74 75 Bifidobacterium adolescentis IM75

    TABLE-US-00002 TABLE 2 Management no. Strain name 76 Lactobacillus plantarum IM76 77 Lactobacillus plantarum IM77 78 Lactobacillus plantarum IM78 79 Lactobacillus plantarum IM79 80 Lactobacillus plantarum IM80 81 Lactobacillus plantarum IM81 82 Lactobacillus plantarum IM82 83 Lactobacillus plantarum IM83 84 Lactobacillus plantarum IM84 85 Lactobacillus plantarum IM85 86 Lactobacillus plantarum IM86 87 Lactobacillus plantarum IM87 88 Lactobacillus plantarum IM88 89 Lactobacillus plantarum IM89 90 Lactobacillus acidophilus IM90 91 Lactobacillus acidophilus IM91 92 Lactobacillus acidophilus IM92 93 Lactobacillus acidophilus IM93 94 Lactobacillus acidophilus IM94 95 Lactobacillus acidophilus IM95 96 Lactobacillus acidophilus IM96 97 Lactobacillus acidophilus IM97 98 Lactobacillus acidophilus IM98 99 Lactobacillus acidophilus IM99

    [0118] Out of the strains described in the table 1 above, it was identified that Bifidobacterium longum IM55 is a gram-positive bacillus, which neither shows a catalase activity nor has a spore. Also, it was shown that 16S rDNA of Bifidobacterium longum IM55 has a sequence of SEQ ID NO: 1. As a result of comparing the 16S rDNA sequences of Bifidobacterium longum IM55 by means of BLAST search, it was shown that a Bifidobacterium longum strain having the same 16S rDNA sequence is not searched at all, and 99% homologous to the 16S rDNA sequence of a known Bifidobacterium longum strain. Also, out of the physiological characteristics of Bifidobacterium longum IM55, the availability of carbon source was analyzed with a sugar fermentation test using an API kit (model name: API 20 strep; and manufacturer: BioMerieux's, USA), wherein results thereof are shown in a following table 3. In the table 3 below, “+” indicates that the availability of carbon source is positive and “−” indicates that the availability of carbon source is negative.

    TABLE-US-00003 TABLE 3 Strain name Bifidobacterium Carbon source longum IM55 L-tryptophane − Urea − D-glucose + D-mannitol + D-lactose + D-sucrose + D-maltose + Salicin + D-xylose + L-arabinose + Gelatin − Esculin ferric citrate + Glycerol − D-cellobiose − D-mannose − D-melezitose − D-raffinose + D-sorbitol + D-rhamnose + D-trehalose −

    [0119] Out of the strains described in the table 2 above, it was identified that Lactobacillus plantarum IM76 is a gram-positive bacillus. Also, it was shown that 16S rDNA of Lactobacillus plantarum IM76 has a sequence of SEQ ID NO: 2. As a result of comparing the 16S rDNA sequences of Lactobacillus plantarum IM76 by means of BLAST search, it was shown that a Lactobacillus plantarum strain having the same 16S rDNA sequence is not searched at all, and such sequence was 99% homologous to the 16S rDNA sequence of a known Lactobacillus plantarum strain. Also, out of the physiological characteristics of Lactobacillus plantarum IM76, the availability of carbon source was analyzed with a sugar fermentation test using an API kit (model name: API 50 CHL; and manufacturer: BioMerieux's, USA), wherein results thereof are shown in a following table 4. In the table 4 below, “+” indicates that the availability of carbon source is positive and “−” indicates that the availability of carbon source is negative.

    TABLE-US-00004 TABLE 4 Strain name Lactobacillus Carbon source plantarum IM76 Glycerol − Erythritol − D-arabinose − L-arabinose + D-ribose + D-xylose − L-xylose − D-adonitol − Methyl-β-D- + xylopyranoside D-galactose + D-glucose + D-fructose + D-mannose + L-sorbose − L-rhamnose − Dulcitol − Inositol − Mannitol + Sorbitol + α-methyl-D-mannoside − α-methly-D-glucoside − N-acetyl-glucosamine + Amygdalin + Arbutin + Esculin + Salicin + Cellobiose + Maltose + Lactose + Melibiose + Sucrose + Trehalose + Inulin − Melezitose − Raffinose + Starch − Glycogen − Xylitol − Gentiobiose + D-turanose + D-lyxose − D-tagatose − D-fucose − L-fucose − D-arabitol − L-arabitol − Gluconate + 2-keto-gluconate − 5-keto-gluconate −

    Example 2. Test on the Inflammation Reaction Inhibiting Effect of Lactic Acid Bacteria

    [0120] (i) Test on the Inflammation Reaction Inhibiting Effect of Lactic Acid Bacteria on Macrophage

    [0121] A six-week old C57BL/6J male mouse (20-23 g) was purchased from Raonbio Co., Ltd. 2 mcustom-character of sterilized 4% thioglycolate was intraperitoneally administered into the mouse, which was then anesthetized in 96 hours later. After that, 8 mcustom-character of RPMI 1640 medium was intraperitoneally administered to the mouse. In 5 to 10 minutes later, the RPMI medium (including macrophage) was intraperitoneally extracted again from the mouse, then centrifuged on condition of 1000 rpm for 10 minutes, and then washed twice again with the RPMI 1640 medium. The macrophage was plated into a 24-well plate at 0.5×10.sup.6 cells per well, then cultured for 24 hours, and then unattached cells were removed therefrom. The macrophage culture fluid was treated with a test material, i.e., lactic acid bacteria as well as an inflammation reaction inducer, i.e., lipopolysaccharide (LPS) for 90 minutes or 24 hours, and then supernatant and cells were obtained therefrom. At that time, a treatment concentration of lactic acid bacteria was 1×10.sup.4 CPU/mcustom-character. Also, in order to compare the effects of lactic acid bacteria, various prebiotics were used as the test material.

    [0122] An expression level of TNF-α from said obtained supernatant was measured by means of an ELISA kit. Also, the expression level of p65 (NF-κB), p-p65 (phosphor-NF-κB) and β-actin was measured from said obtained cells by means of an immunoblotting method. Particularly, 50 μg of the supernatant was taken and subjected to electrophoresis in SDS 10% (w/v) polyacrylamide gel for one and half an hour. The electrophoresed sample was transferred onto a nitrocellulose paper on condition of 100 V and 400 mA for one hour and 10 minutes. The nitrocellulose paper, onto which the sample was transferred, was subjected to blocking by means of 5% skim milk for 30 minutes, then washed with PBS-Tween three times for five minutes each, and then subjected to reaction overnight with an addition of primary antibodies (Santa Cruz Biotechnology, the U.S.) at a ratio of 1:100. After that, such paper was washed three times for ten minutes each, and subjected to reaction with the addition of secondary antibodies (Santa Cruz Biotechnology, the U.S.) at a ratio of 1:1000 for one hour and 20 minutes. Then, such paper was washed three times for 1.5 minutes each, then subjected to fluorescent color formation, then developed, and then the intensity of chromophore band was measured. The results of testing the inflammation reaction inhibiting effect of lactic acid bacteria on macrophage are shown in following tables 5 to 7.

    TABLE-US-00005 TABLE 5 NF-κB activation TNF-α Test material for inhibition rate expression treating macrophage (p-p65/p65) inhibition rate Untreated − − Bifidobacterium longum IM51 + + Bifidobacterium longum IM52 + + + + Bifidobacterium longum IM53 + + + + Bifidobacterium longum IM54 + + + Bifidobacterium longum IM55 + + + + + + Bifidobacterium longum IM56 + + + + Bifidobacterium longum IM57 + + Bifidobacterium longum IM58 + + Bifidobacterium longum IM59 + + Bifidobacterium longum IM60 + + Bifidobacterium longum IM61 + + Bifidobacterium longum IM62 + + Bifidobacterium longum IM53 + + Bifidobacterium longum IM64 + + Bifidobacterium longum IM65 + + Bifidobacterium adolescentis IM66 + + + + Bifidobacterium adolescentis IM67 + + Bifidobacterium adolescentis IM68 + + Bifidobacterium adolescentis IM69 + + Bifidobacterium adolescentis IM70 + + Bifidobacterium adolescentis IM71 + +

    TABLE-US-00006 TABLE 6 NF-κB activation TNF-α Test material for inhibition rate expression treating macrophage (p-p65/p65) inhibition rate Bifidobacterium adolescentis IM72 + + Bifidobacterium adolescentis IM73 + + Bifidobacterium adolescentis IM74 + + Bifidobacterium adolescentis IM75 + + Lactobacillus plantarum IM76 + + + + + + Lactobacillus plantarum IM77 + + + Lactobacillus plantarum IM78 + + Lactobacillus plantarum IM79 + + + Lactobacillus plantarum IM80 + + Lactobacillus plantarum IM81 + + + + + + Lactobacillus plantarum IM82 + + Lactobacillus plantarum IM83 + + Lactobacillus plantarum IM84 + + Lactobacillus plantarum IM85 + + Lactobacillus plantarum IM86 + + Lactobacillus plantarum IM87 + + + + Lactobacillus plantarum IM88 + + Lactobacillus plantarum IM89 + + Lactobacillus acidophilus IM90 + + Lactobacillus acidophilus IM91 + + + + + + Lactobacillus acidophilus IM92 + + Lactobacillus acidophilus IM93 + +

    TABLE-US-00007 TABLE 7 NF-κB activation TNF-α Test material for inhibition rate expression treating macrophage (p-p65/p65) inhibition rate Lactobacillus acidophilus IM94 + + Lactobacillus acidophilus IM95 + + Lactobacillus acidophilus IM96 + + Lactobacillus acidophilus IM97 + + Lactobacillus acidophilus IM98 + + Lactobacillus acidophilus IM99 + + Inulin + + + + Citrus pectin + + + Carrageenan + − Trehalose + − Lactulose + − Cyclodextrin + − Carboxymethyl cellulose + + Gelatin + + Chitosan + + + + Alginic acid + + Fructo-oligosaccharide + + Defatted soybean protein + + Apple pectin + + + Arabino-galactan + + + Xylan + − * Inhibition rate: −, <10%; +, 10-30%; + +, 30-60%; + + +, >60%

    [0123] As a result of tests in the tables 5 to 7, it was identified that the inflammation reaction inhibiting effect on macrophage differs depending on types of lactic acid bacteria. Particularly, in case of Bifidobacterium spp. lactic acid bacteria and Lactobacillus spp. lactic acid bacteria, it was identified that an inflammation reaction inhibiting effect differs not only depending on species but also depending on strains, even if those strains are the same species. Out of those strains, in case of Bifidobacterium longum IM55 and Lactobacillus plantarum IM76, it was identified that an NF-kB activation inhibition rate and a TNF-α expression inhibition rate are all high at the same time.

    [0124] Also, in case of chitosan, inulin and citrus pectin as prebiotics, it was identified that an NF-kB activation inhibition rate and a TNF-α expression inhibition rate are excellent compared to other prebiotics.

    [0125] (2) Test on the Inflammation Reaction Inhibiting Effect of Lactic Acid Bacteria on Dendritic Cells

    [0126] Immune cells were isolated from the bone marrow of a C57BL/6 mouse (male, 20-23 g) by using RPMI 1640 containing 10% FBS, 1% antibiotics, 1% glutamax and 0.1% mercaptoethanol, then treated with RBC lysis buffer, and then washed. Said cells were divided into each well of a 24-well plate, then treated with GM-CSF and IL-4 at a ratio of 1:1000, and then cultured. On a 5th day of culture, the cells were replaced with a new medium, then collected on an 8th day thereof, and then used as dendritic cells. After that, the dendritic cells were plated into a 24-well plate at 0.5×10.sup.6 cells per well, then treated with a test material, i.e., lactic acid bacteria, as well as an inflammation reaction inducer, i.e., lipopolysaccharide (LPS) for 90 minutes or 24 hours, and then supernatant and cells were obtained therefrom. At that time, a treatment concentration of lactic acid bacteria was 1×10.sup.4 CFU/mcustom-character. Also, in order to compare the effects of lactic acid bacteria, various prebiotics were used as the test material.

    [0127] An expression level of IL-10 and IL-12 was measured from said obtained supernatant by means of an ELISA kit. Also, the expression level of p65 (NF-κB), p-p65 (phosphor-NF-κB) and β-actin was measured from the cells, which have been obtained after being treated with the test material for 90 minutes, by means of the same immunoblotting method as in Example 2.(1) above. The results of testing the inflammation reaction inhibiting effect of lactic acid bacteria on dendritic cells are shown in following tables 8 to 10.

    TABLE-US-00008 TABLE 8 NF-κB IL-12 IL-10 activation expression expression Test material for inhibition rate inhibition increasing treating dendritic cells (p-p65/p65) rate rate Untreated − − − Bifidobacterium longum IM51 + + + Bifidobacterium longum IM52 + + − − Bifidobacterium longum IM53 + − − Bifidobacterium longum IM54 + + + Bifidobacterium longum IM55 + + + + + + + + Bifidobacterium longum IM56 + + + + + + Bifidobacterium longum IM57 + + + Bifidobacterium longum IM58 + + − Bifidobacterium longum IM59 + + − Bifidobacterium longum IM60 + + − Bifidobacterium longum IM61 + + − Bifidobacterium longum IM62 + + − Bifidobacterium longum IM53 + + − Bifidobacterium longum IM64 + + + Bifidobacterium longum IM65 + + − Bifidobacterium adolescentis IM66 + + + + + − Bifidobacterium adolescentis IM67 + + + Bifidobacterium adolescentis IM68 + + + Bifidobacterium adolescentis IM69 + + − Bifidobacterium adolescentis IM70 + + − Bifidobacterium adolescentis IM71 + + −

    TABLE-US-00009 TABLE 9 NF-κB IL-12 IL-10 activation expression expression Test material for inhibition rate inhibition increasing treating dendritic cells (p-p65/p65) rate rate Bifidobacterium adolescentis IM72 + + − Bifidobacterium adolescentis IM73 + + + Bifidobacterium adolescentis IM74 + + + Bifidobacterium adolescentis IM75 + + + Lactobacillus plantarum IM76 + + + + + + Lactobacillus plantarum IM77 + + + Lactobacillus plantarum IM78 + + + Lactobacillus plantarum IM79 + + − Lactobacillus plantarum IM80 + + + Lactobacillus plantarum IM81 + + + Lactobacillus plantarum IM82 + + − Lactobacillus plantarum IM83 + + + Lactobacillus plantarum IM84 + + + Lactobacillus plantarum IM85 + + + Lactobacillus plantarum IM86 + + − Lactobacillus plantarum IM87 + + + + + Lactobacillus plantarum IM88 + + − Lactobacillus plantarum IM89 + + − Lactobacillus acidophilus IM90 + + + Lactobacillus acidophilus IM91 + + − Lactobacillus acidophilus IM92 + + − Lactobacillus acidophilus IM93 + + +

    TABLE-US-00010 TABLE 10 NF-κB IL-12 IL-10 activation expression expression Test material for inhibition rate inhibition increasing treating dendritic cells (p-p65/p65) rate rate Lactobacillus acidophilus IM94 + + − Lactobacillus acidophilus IM95 + + − Lactobacillus acidophilus IM96 + + − Lactobacillus acidophilus IM97 + + − Lactobacillus acidophilus IM98 + + − Lactobacillus acidophilus IM99 + + + Inulin + + + + Citrus pectin + + + + + + Carrageenan + + − Trehalose + + + Lactulose + + − Cyclodextrin + + − Carboxymethyl cellulose + + − Gelatin + + + Chitosan + + + + + Alginic acid + + + Fructo-oligosaccharide + + − Defatted soybean protein + + + Apple pectin + + − Arabino-galactan + + + Xylan + + + + * Inhibition rate: −, <10%; +, 10-30%; + +, 30-60%; + + +, >60% * Inhibition rate: −, <10%; +, 10-50%; + +, 50-100%; + + +, >100%

    [0128] As a result of tests in the tables 8 to 10, it was identified that the inflammation reaction inhibiting effect on dendritic cells differs depending on types of lactic acid bacteria. Particularly, in case of Bifidobacterium spp. lactic acid bacteria and Lactobacillus spp. lactic acid bacteria, it was identified that an inflammation reaction inhibiting effect differs not only depending on species, but also depending on strains, even if those strains are the same species. In particular, a part of the strains showed results, in which IL-12 expression is increased. On the other hand, most of the strains showed results, in which IL-10 expression is decreased. Out of those strains, in case of Bifidobacterium longum IM55 and Lactobacillus plantarum IM76, it was identified that an NF-kB activation inhibition rate and an IL-12 expression inhibition rate are highest, and an IL-10 expression increasing rate is highest at the same time.

    [0129] Also, in case of chitosan, inulin and citrus pectin as prebiotics, it was identified that the NF-kB activation inhibition rate, the IL-12 expression inhibition rate and the IL-10 expression increasing rate are excellent compared to other prebiotics.

    [0130] From Example 2 above, out of various lactic acid bacteria, Bifidobacterium longum IM55 and Lactobacillus plantarum IM76 showed the most excellent inflammation reaction inhibiting effect. Also, out of various prebiotics, it was identified that chitosan, inulin and citrus pectin show an excellent inflammation reaction inhibiting effect.

    Example 3. Evaluation of the Immunity Regulatory Effect of Lactic Acid Bacteria

    [0131] (1) Cell Differentiation Rate

    [0132] To control, prevent, alleviate or treat allergic diseases, particularly the diseases caused by a type 1 hypersensitivity reaction, it is important to decrease a production of IgE antibodies and increase a production of regulatory T cells (Treg cells) of releasing IL-10 upon an immune reaction to an allergen. It is known that an allergic reaction becomes more complicated not only by means of mediators made by mast cells, basophils or the like, but also by means of an action of cytokines secreted from those cells, and a part of symptoms shown as the allergic reaction result from an action of those cytokines. Cytokines such as TNF-α, IL-4, IL-5, IL-6, IL-13, etc., are made in the mast cells, and those cytokines play a role in gathering neutrophils and eosinophils. Also, IL-4 and IL-13 secreted from the mast cells activate B cells to make IgE antibodies, and IL-5 plays a role in gathering and activating eosinophils. Cytokines such as IL-4 and IL-5 are generally classified into Th2 cytokines because many of those cytokines are secreted from Th2 cells, and the cytokines secreted from mast cells and Th2 cells bind to respective receptors, and thus act to induce an interaction between cells and amplify an allergic reaction. Also, an allergic shock symptom may occur when TNF-α, a representative proinflammatory cytokine, is systemically produced in quantity in an allergy state.

    [0133] Thus, in order to evaluate an immunity regulatory effect of the lactic acid bacteria isolated from excrement or cabbage kimchi, an influence of the lactic acid bacteria on the immune reactions of spleen cells was measured by measuring an inhibition rate of differentiation into cells of secreting said cytokines and an increasing rate of differentiation into Treg cells.

    [0134] Particularly, a spleen was isolated from a C56BL/6J mouse, then crushed, then suspended in an RPMI 1640 medium containing 10% FCS, and then CD4 T cells were isolated by using a CD4 T cell isolation kit (MiltenyiBiotec, Bergisch Gladbach, Germany). The isolated CD4 T cells were divided into a 12-well plate at 5×10.sup.5 cells per well. After that, the cells were cultured in each well with an addition of anti-CD3, anti-CD28, IL-2 and IL-12 to induce a differentiation of T cells into Th1 cells; with the addition of anti-CD3, anti-CD28, IL-2 and IL-4 to induce the differentiation of T cells into Th2 cells; with the addition of anti-CD3, anti-CD28, IL-6 and TGF-β to induce the differentiation of T cells into Th17 cells; and with the addition of anti-CD3 and anti-CD28 to induce the differentiation of T cells into Treg cells, and a test material, i.e., lactic acid bacteria were inserted thereinto at 1×10.sup.5 CFU per well, and then cultured for four days. Also, in order to compare the effects of lactic acid bacteria, various prebiotics were used as the test material.

    [0135] After that, a differentiation potency of the T cells isolated from the spleen into Th1, Th2, Th17 and Treg cells was measured. Particularly, the cells of culture fluid were stained with anti-FOXp3 or anti-IL-17A antibodies, after which a distribution of Th1, Th2, Th17 and Treg cells was analyzed by means of a FACS (fluorescence-activated cell sorting) device (C6 Flow Cytometer® System, San Jose, Calif., USA), wherein results thereof are shown in following tables 11 to 13. In the tables 11 to 13 below, the lactic acid bacteria are shown without species names thereof, and are given strain names assigned by the present inventors.

    TABLE-US-00011 TABLE 11 Test material Differentiation for treating Differentiation inhibition rate increasing rate spleen T cells Th1 cell Th2 cell Th17 cell Treg cell Untreated − − − − IM51 + + + + IM52 + + − − − IM53 + − + + IM54 + + + + IM55 + + + + + + + + + + + + IM56 + + + + + IM57 + + − + + IM58 + + − + − IM59 + + + − IM60 + + + − IM61 + + + + + + IM62 + + + + + + IM63 + + + + IM64 + + + + + + IM65 + + + + IM66 + + + + + + + IM67 + + + + + + IM68 + + + + + + IM69 + + + + IM70 + + + + + + IM71 + + + + + +

    TABLE-US-00012 TABLE 12 Test material Differentiation for treating Differentiation inhibition rate increasing rate spleen T cells Th1 cell Th2 cell Th17 cell Treg cell IM72 + + + + IM73 + + + + + IM74 + + + + IM75 + + + + + + + IM76 + + + + + + + + + + + IM77 + + + + IM78 + + + + + + IM79 + + + + + IM80 + + + + + IM81 + + + + + IM82 + + + + IM83 + + + + + + IM84 + + + + + IM85 + + + + IM86 + + + + IM87 + + + + + IM88 + + + + IM89 + + + + + + IM90 + + + + IM91 + + + + IM92 + + + + IM93 + + + + + +

    TABLE-US-00013 TABLE 13 Test material Differentiation for treating Differentiation inhibition rate increasing rate spleen T cells Th1 cell Th2 cell Th17 cell Treg cell IM94 + + + + IM95 + + + + IM96 + + + + + + + IM97 + + + + IM98 + + + − IM99 + + + + P1  + + + + P2  + + + + + + + + P3  + + + + + + + P4  + + + + P5  + + + − + + P6  + + + + + + P7  + + + + + + − P8  + + + + + P9  + + + + + P10 + + + + + P11 + + + + + P12 + + + + P13 + + + − P14 + + + − P15 + + + + + − * Inhibition rate: −, <10%; +, 10-30%; + +, 30-60%; + + +, >60% * Inhibition rate: −, <10%; +, 10-50%; + +, 50-100%; + + +, >100% * P1: inulin; P2: citrus pectin; P3: carrageenan; P4: trehalose; P5: lactulose; P6: cyclodextrin; P7: carboxymethyl cellulose; P8: gelatin; P9: chitosan; P10: alginic acid; P11: fructooligosaccharide; P12: defatted soybean protein; P13: apple pectin; P14: arabino-galactan; and P15: xylan

    [0136] As a result of experiments in the tables 11 to 13, it was identified that a differentiation rate of T cells differs depending on types of lactic acid bacteria. Particularly, in case of Bifidobacterium spp. lactic acid bacteria, an inhibition rate of differentiation into Th1, Th2 and Th17 cells and an increasing rate of differentiation into Treg cells differ depending on types of lactic acid bacteria, and a part of the lactic acid bacteria showed results, in which a Th2 cell inhibition rate and a Treg cell increasing rate are opposite to those of other lactic acid bacteria. Out of those lactic acid bacteria, it was identified for Bifidobacterium longum IM55 that the inhibition rate of differentiation into Th1, Th2 and Th17 cells is highest, and an increasing rate of differentiation into Treg cells is highest at the same time. Also, Lactobacillus spp. lactic acid bacteria showed results, similar to Bifidobacterium spp. lactic acid bacteria, in which the inhibition and increasing rates of cell differentiation differ depending on types of lactic acid bacteria. Out of those lactic acid bacteria, it was identified for Lactobacillus plantarum IM76 that the inhibition rate of differentiation into Th1, Th2 and Th17 cells and the increasing rate of differentiation into Treg cells are highest.

    [0137] (2) Cytokine Expression Rate

    [0138] Also, an expression rate of transcription factors and cytokines of Th1, Th2, Th17 and Treg cells differentiated from the spleen T cells was measured. Particularly, expression levels were respectively analyzed by means of qRT-PCR with regard to T-bet, IFN-γ and IL-12 from culture fluid for inducing a Th1 cell differentiation; GATA3 and IL-5 from culture fluid for inducing a Th2 cell differentiation; RORγt and IL-17 from culture fluid for inducing a Th17 cell differentiation; and Foxp3 and IL-10 from culture fluid for inducing a Treg cell differentiation. A following table 14 shows results in such a way that a sequence of a primer used for qRT-PCR corresponds to that of an amplification target. Also, the results of measuring the expression rates of transcription factors and cytokines of Th1, Th2, Th17 and Treg cells differentiated from the spleen T cells are shown in following tables 15 and 16. In the tables 15 and 16 below, the lactic acid bacteria are shown without species names thereof, and are given strain names assigned by the present inventors.

    TABLE-US-00014 TABLE 14 Amplification target Primer type Primer sequence T-bet Forward (SEQ ID NO: 3) 5′-CCTCTTCTATCCACCAGTATC-3′ Reverse (SEQ ID NO: 4) 5′-CTCCGCTTCATAACTGTGT-3′ IFN-γ Forward (SEQ ID NO: 5) 5′-TCAAGTGGCATAGATGTGGAAGAA-3′ Reverse (SEQ ID NO: 6) 5′-TGGCTCTGCAGGATTTTCATG-3′ GATA3 Forward (SEQ ID NO: 7) 5′-GAAGGCATCCAGACCCGAAAC-3′ Reverse (SEQ ID NO: 8) 5′-ACCCATGGCGGTGACCATGC-3′ IL-5 Forward (SEQ ID NO: 9) 5′-AAAGAGAAGTGTGGCGAGGAGAGAC-3′ Reverse (SEQ ID NO: 10) 5′-CCTTCCATTGCCCACTCTGTACTCATC-3′ RORyt Forward (SEQ ID NO: 11) 5′-ACAGCCACTGCATTCCCAGTTT-3′ Reverse (SEQ ID NO: 12) 5′-TCTCGGAAGGACTTGCAGACAT-3′ IL-17 Forward (SEQ ID NO: 13) 5′-TTTAACTCCCTTGGCGCAAAA-3′ Reverse (SEQ ID NO: 14) 5′-CTTTCCCTCCGCATTGACAC-3′ FOXp3 Forward (SEQ ID NO: 15) 5′-CCCATCCCCAGGAGTCTT-3′ Reverse (SEQ ID NO: 16) 5′-ACCATGACTAGGGGCACTGTA-3′ IL-10 Forward (SEQ ID NO: 17) 5′-ATGCTGCCTGCTCTTACTGACTG-3′ Reverse (SEQ ID NO: 18) 5′-CCCAAGTAACCCTTAAAGTCCTGC-3′ GAPDH Forward (SEQ ID NO: 19) 5′-TGCAGTGGCAAAGTGGAGAT-3′ Reverse (SEQ ID NO: 20) 5′-TTTGCCGTGAGTGGAGTCAT-3′

    TABLE-US-00015 TABLE 15 Test material for Expression treating spleen Expression inhibition rate increasing rate T cells T-bet IFN-γ GATA3 IL-5 RORγt IL-17 FOXp3 IL-10 Untreated − − − − − − − − IM51 + ++ + + + + + + IM52 ++ + − + − + − − IM53 + + − + + ++ + − IM54 + + + ++ + + ++ + IM55 +++ + +++ +++ +++ +++ +++ +++ IM56 ++ + + ++ + ++ + ++ IM57 ++ ++ − + + + + + IM58 ++ ++ − ++ + + − − IM59 + + + + + + − + IM60 + ++ + ++ + + − − IM61 ++ + + ++ ++ ++ + − IM62 ++ + + ++ ++ ++ + + IM63 + ++ + + + + + − IM64 ++ + ++ ++ + + + + IM65 + + + + + + + − IM66 ++ + + + ++ ++ + + IM67 + + + + ++ + + + IM68 ++ ++ + + ++ ++ + + IM69 + + + + + + + − IM70 ++ + + + ++ ++ + + IM71 ++ + + + ++ ++ + + IM72 + ++ + + + + + + IM73 ++ + + + + + + + IM74 + + + + + + + +

    TABLE-US-00016 TABLE 16 Test material for Expression treating spleen Expression inhibition rate increasing rate T cells T-bet IFN-γ GATA3 IL-5 RORγt IL-17 FOXp3 IL-10 IM75 ++ + + + + + ++ + IM76 ++ ++ +++ +++ +++ +++ +++ +++ IM77 + + + ++ + + + + IM78 + + + + ++ ++ ++ + IM79 + + + ++ ++ ++ + − IM80 + + ++ + + + + + IM81 + + + + ++ ++ + + IM82 + + + + + + + + IM83 + ++ ++ ++ ++ ++ + + IM84 + + + + ++ ++ + + IM85 + ++ + ++ + + + + IM86 + + + + + + + − IM87 + + + + ++ ++ + + IM88 + ++ + + + ++ + − IM89 ++ + + + ++ + + − IM90 + + + ++ + + + + IM91 + + + ++ + + + − IM92 + + + + + + + − IM93 ++ + + ++ ++ + + + IM94 + + + + + + + + IM95 + + + + + + + − IM96 ++ + ++ ++ ++ ++ + − IM97 + + + + + + + + IM98 + + + + + + − − IM99 + + + + + + + + *Inhibition rate: −, <10%; +, 10-30%; ++, 30-60%; +++, >60% *Increasing rate: −, <10%; +, 10-50%; ++, 50-100%; +++, >100%

    [0139] As a result of measurements in the tables 15 and 16, it was identified that a rate of change in cytokine expression differs depending on types of lactic acid bacteria. Particularly, in case of Bifidobacterium spp. lactic acid bacteria, a part of the lactic acid bacteria showed results, in which an inhibition rate of GATk3 and IL-5 expressions is opposite to that of other lactic acid bacteria. Out of those lactic acid bacteria, it was identified for Bifidobacterium longum IM55 that an inhibition rate of T-bet, IFN-γ, GATA3, IL-5, RORγt and IL-17 expressions is highest, and an increasing rate of FOXp3 and IL-10 expressions is highest at the same time. Also, in case of Lactobacillus spp. lactic acid bacteria, a part of the lactic acid bacteria show results, similar to Bifidobacterium spp. lactic acid bacteria, in which a rate of change in cytokine expression differs, too. Out of those lactic acid bacteria, it was identified for Lactobacillus plantarum IM76 that an inhibition rate of T-bet, IFN-γ, GATA3, IL-5, RORγt and IL-17 expressions is highest, and an increasing rate of FOXp3 and IL-10 expressions is highest at the same time.

    Example 4. Test on the Inflammation Reaction Inhibiting Effect of IM55 or IM76

    [0140] Out of the lactic acid bacteria isolated in Example 1 above, a test was performed on the inflammation reaction inhibiting effect of Bifidobacterium longum IM55 and Lactobacillus plantarum IM76.

    [0141] (1) Test on the Inflammation Reaction Inhibiting Effect of IM55 or IM76 on Macrophage

    [0142] A seven week-old BALB/c female mouse (20-22 g) was purchased from Raonbio Co., Ltd., and acclimated for seven days before an experiment. 2 mcustom-character of 4% thioglycolate was intraperitoneally administered into the mouse, which was then sacrificed in 96 hours later. Peritoneal cavity fluids were collected with 10 mcustom-character of RPMI 1640, then centrifuged on condition of 300 xg for 10 minutes, and then washed with RPMI 1640. Cells were plated into a 12-well microplate at 0.5×10.sup.6 cells per well, then cultured in an RPMI 1640 medium containing 1% antibiotic-antimycotic and 10% FBS at 37° C. for 20 hours, and then washed three times. Attached cells were used as macrophage. To measure an effect of IM55 or IM76 on cytokine expressions, macrophage at 1×10.sup.6 cells/well was treated with lactic acid bacteria at 1×10.sup.5 CFU/mcustom-character as well as an inflammation reaction inducer, i.e., the LPS for 20 hours. An expression level of each cytokine was measured by means of the same ELISA kit as in Example 2.(1) above. As a result of the measurement, it was identified that an expression of IL-10 is increased and an expression of IL-12 is inhibited upon administration of IM55 or IM76 (FIGS. 1 and 2).

    [0143] (2) Test on the Inflammation Reaction Inhibiting Effect of IM55 or IM76 on Dendritic Cells

    [0144] Mouse marrow cells were collected from a seven week-old BALB/c female mouse (20-22 g) with RPMI 1640 according to a known method (Immunopharmacol. Immunotoxicol., 2016, 38, 447-454). 2×10.sup.6 collected cells were seeded into a 12-well plate and cultured in an RPMI 1640 medium containing rGM-CSF at 20 ng/mcustom-character, 10% FBS, 1% antibiotic-antimycotic and gentamycin at 150 μg/mcustom-character.

    [0145] To measure an effect of IM55 or IM76 on cytokine expressions, said cells were replaced with a conditioned medium on 3rd and 6th days of culture to remove granulocytes therefrom, and then treated with lactic acid bacteria at 1×10.sup.5 CFU/mcustom-character and the LPS at 100 ng/mcustom-character on an 8th day of culture. An expression level of each cytokine was measured by means of the same ELISA kit as in Example 2.(2) above. As a result of the measurement, it was identified that an expression of IL-10 is increased and an expression of TNF-α is inhibited upon administration of IM55 or IM76 (FIGS. 3 and 4).

    [0146] From the results of Example 4 above, it might be seen that novel lactic acid bacteria, i.e., Bifidobacterium longum IM55 and Lactobacillus plantarum IM76 show an excellent inflammation reaction inhibiting effect, and thus show an excellent effect on preventing, alleviating and treating inflammatory diseases.

    Example 5. Evaluation of the Immunity Regulatory Effect of IM55 or IM76

    [0147] A rate of T cell differentiation was analyzed by means of a method similar to Example 3 above, in order to evaluate the immunity regulatory effect of Bifidobacterium longum IM55 and Lactobacillus plantarum IM76 out of the lactic acid bacteria isolated from Example 1 above.

    [0148] Particularly, a spleen was sterilely isolated from a seven week-old BALB/c female mouse (20-22 g), then appropriately crushed, and then treated with tris-buffered ammonium chloride. The resulting cells were suspended in an RPMI 1640 medium containing 10% FCS, after which T cells were isolated from a cell suspension by using Pan T Cell Isolation Kit II. The cells were respectively cultured with an addition of anti-CD28 (1 μg/mcustom-character), anti-CD3 (1 μg/mcustom-character), rIL-4 (10 μg/mcustom-character) and rIL-2 (10 μg/mcustom-character) to induce a differentiation of the isolated T cells (1×10.sup.5 cells/well) into Th2 cells; and with the addition of anti-CD28 (1 μg/mcustom-character) and anti-CD3 (1 μg/mcustom-character) to induce the differentiation of T cells (1×10.sup.5 cells/well) into Treg cells, and the cells were also respectively cultured for four days with the addition of IM55 or IM76 at 1×105 CFU/mcustom-character per well. RNA was isolated from those cells, after which an expression level of IL-10, GATA3, FOXp3 and IL-5 was analyzed by carrying out qRT-PCR. The same qRT-PCR was performed as in Example 3 above, and by using the same primer as in the table 14 above.

    [0149] As a result of the analysis, it was identified for treatment with IM55 or IM76 that an expression level of GATA3 and IL-5 is decreased to inhibit a differentiation into Th2 cells (FIGS. 5 and 6), while an expression level of FOXp3 and IL-10 is increased to promote a differentiation into Treg cells (FIGS. 7 and 8).

    [0150] From the results of Example 5 above, it might be seen that novel lactic acid bacteria, i.e., Bifidobacterium longum IM55 and Lactobacillus plantarum IM76 show an excellent immunity regulatory effect, and thus show an excellent effect on preventing, alleviating and treating immune diseases.

    Example 6. Evaluation of the Alleviation Effect of Lactic Acid Bacteria on Rhinitis and Asthma (1)

    [0151] Bronchoalveolar lavage (BAL), which is performed together with bronchial endoscopy, has been widely used to collect cells and other soluble components from an epithelial mucous layer, which covers respiratory tracts and pulmonary alveoli. Bronchoalveolar lavage fluid (BALF) includes not only various proteins in a blood flow, but also proteins secreted from various cell types including epithelial cells and inflammatory cells. The BALF is generally used to diagnose bronchial asthma, bronchitis or lung disease, or analyze pathological conditions thereof. Thus, in order to identify an effect of alleviating rhinitis and asthma, indicators related to anti-rhinitis and anti-asthma effects were analyzed from serum and lung tissues as well as the BALF.

    [0152] (1) Experimental Method

    [0153] Seven week-old BALB/C female mice (21-23 g) were acclimated for one week on condition of a controlled environment with humidity of 50%, temperature of 25° C., and light/dark cycle of 12:12 hours. After that, 20 μg of allergy-inducing ovalbumin (OVA) and 2 mg of aluminum hydroxide (Alum) were suspended into 0.2 mcustom-character of phosphate buffered saline (PBS: pH 7.4) and intraperitoneally injected into each of the mice on initial and 14th days of an experiment. Then, 100 μg of the OVA was dissolved in 10 μcustom-character of distilled water, and intranasally smeared onto each of the mice to induce allergic rhinitis and asthma therefrom on 26th, 27th and 28th days of the experiment. Meanwhile, a test drug, i.e., lactic acid bacteria were orally administered into each of the mice once daily for a total of five days from 26th to 30th days of the experiment. Also, dexamethasone, which was used as a positive control drug instead of lactic acid bacteria, was intraperitoneally administered at a dose of 1 mg/kg b.w. Further, in case of the mice of a normal group, allergic rhinitis and asthma were not induced therefrom, but only the phosphate buffered saline (PBS: 7.4) was orally administered thereinto instead of the OVA and the test drug. Furthermore, in case of the mice of a control group, allergic rhinitis and asthma were induced therefrom, and only the phosphate buffered saline (PBS: pH 7.4) was orally administered thereinto as the test drug. After an end of the experiment, the mice were anesthetized, after which blood, lung tissues and the BALF were collected therefrom. Serum was isolated from the blood collected by means of centrifugation, and used as an assay sample.

    [0154] Indicators related to anti-rhinitis and anti-asthma effects were analyzed from serum, the BALF and lung tissues by using various analysis methods. Each analysis method and indicators analyzed thereby are as follows.

    [0155] *Enzyme-linked immunosorbent assay (ELISA): IL-10, IL-5, IL-6, IL-4, IgE, etc.

    [0156] *FACS (fluorescence-activated cell sorting): Distribution of T cells (Th1: CD4.sup.+/IFN-γ.sup.+; Th2: CD4.sup.+/IL-4.sup.+; Treg: CD4.sup.+/FOXp3.sup.+; Th17: CD4.sup.+/IL-17.sup.+), Distribution of eosinophils (CD11b.sup.+, Siglec-F.sup.+)

    [0157] (2) Experimental Results

    [0158] As a result of the experiment, it was identified that an expression of IL-5, IgE and IL-4, i.e., the indicators related to rhinitis and asthma, is remarkably inhibited in serum of a group dosed with IM55 or IM76 (table 17 and FIGS. 9 to 11). Also, it was identified that an amount of IL-5 and IL-4, i.e., the indicators related to rhinitis and asthma, is remarkably decreased and a ratio of Th2 cells and eosinophils is remarkably decreased in the BALF, too (table 18 and FIGS. 12 to 15). Furthermore, it was identified that an expression of IL-10, related to an effect of preventing and treating rhinitis and asthma, is increased and a ratio of Treg cells is increased in the BALF (table 18 and FIGS. 16 and 17).

    TABLE-US-00017 TABLE 17 Classification of experimental Inhibition rate groups IL-5 IgE IL-4 Con − − − IM55 + + + + + + + + IM76 + + + + + Dx + + + + + + + +

    TABLE-US-00018 TABLE 18 Classification of experimental Inhibition rate Increasing rate groups IL-5 IL-4 Th2 cell Eosinophils IL-10 Treg cell Con − − − − − − IM55 +++ +++ ++ +++ +++ +++ IM76 ++ +++ +++ +++ +++ + Dx +++ +++ +++ +++ ++ − *Inhibition rate: −, <10%; +, 10-30%; ++, 30-60%; +++, >60% *Increasing rate: −, <10%; +, 10-50%; ++, 50-100%; +++, >100%

    Example 7. Evaluation of the Alleviation Effect of Lactic Acid Bacteria on Rhinitis and Asthma (2)

    [0159] (1) Experimental Method

    [0160] The OVA-induced allergic rhinitis models were prepared with reference to a known method (Oh et al., Immunopharmacol. Immunotoxicol., 2013, 35, 678-686). Particularly, the mice were randomly divided into six groups (n=8 per group). For five groups, the OVA (20 μg) diluted in aluminum potassium sulfate solution was intraperitoneally injected into the mice thereof on 1st and 14th days of an experiment. 100 μg of the OVA was dissolved in 10 μcustom-character of distilled water and intranasally smeared onto each of said mice to induce allergic rhinitis and asthma therefrom on 26th, 27th and 28th days of the experiment. Meanwhile, a test material (IM55 (1×10.sup.9 CFU/mouse), IM76 (1×10.sup.9 CFU/mouse), dexamethasone 1 mg/kg) or saline solution) was administered into the mice once daily for a total of five days from 26th to 30th days of the experiment. In case of the mice of a normal group, allergic rhinitis and asthma were not induced therefrom, but only the saline solution was administered thereinto. The mice were subjected to irritation by intranasally administering the OVA (10 μcustom-character/nostril, dissolved in 10 mg/mcustom-character of saline solution) into both nasal cavities thereof, after which the number of sneezing and nasal rubbing behaviors (score of rhinitis symptoms) was counted for 10 minutes on a 31st day of the experiment.

    [0161] A lung and nasal cavity tissues were isolated for biopsy, then fixed with 4% neutral buffered formalin, and then frozen. By using a cryostat, said frozen tissues were cut into a 10-μm cross-section, and stained with hematoxylin and eosin (H&E) and periodic acid Schiff reaction (PAS).

    [0162] Also, indicators related to anti-rhinitis and anti-asthma effects were analyzed from the nasal cavity, serum, the BALF and lung tissues by using various analysis methods of Example 3 above, etc. Particularly, the indicators of the nasal cavity and serum were measured by means of an ELISA kit, and the indicators related to rhinitis and asthma of the BALF and lung tissues were measured by means of qRT-PCR, using primers of the table 14 above.

    [0163] (2) Experimental Results

    [0164] When the mice were treated with the OVA, a score of rhinitis symptoms (the number of sneezing and nasal rubbing behaviors) and allergic rhinitis symptoms including an expression of IL-4 and IL-5 in the nasal cavity were significantly increased. However, upon treatment with IM55 or IM76, a level of allergic rhinitis symptoms and IL-4 and IL-5 in the nasal cavity caused by the OVA was significantly decreased (FIGS. 18 to 20). Also, in case of treatment with IM55 or IM76, a disruption of the nasal cavity caused by the OVA was alleviated, and an expansion of epithelial cells in the nasal cavity was relieved (FIG. 21).

    [0165] Furthermore, as a result of histological examination, in case of an animal model with induced rhinitis, lung inflammations and edema were induced therefrom; an expression of IL-5 and GATA3 was increased; and an expression of IL-10 and FOXp3 was decreased. However, upon treatment with IM55 or IM76, a disruption of lung tissues and an expansion of epithelial cells caused by the OVA were inhibited; an expression of GATA3 and IL-5 was inhibited; and an expression of FOXp3 and IL-10 was increased (FIGS. 22 to 26).

    Example 8. Evaluation of the Alleviation Effect of Mixed Lactic Acid Bacteria on Rhinitis and Asthma (3)

    [0166] An evaluation was made not only for an effect of IM55 or IM76 alone, but also for an effect of IM55 and IM76 mixtures on alleviating rhinitis and asthma. Particularly, a score of rhinitis symptoms, a distribution rate (%) of eosinophil cells in the BALF, and an expression level of cytokines in blood were analyzed by means of the same method as in Example 3 above, etc.

    [0167] In result, it was identified for a group dosed with a mixture of IM55 and IM76 at a ratio of 1:1, 1:3 and 1:9 that a score of inflammatory symptoms, checked with the number of sneezing and nasal rubbing behaviors, is decreased and an expression level of IL-5 in the nasal cavity is decreased (FIG. 27). Also, it was identified that an expression level of IL-5 in serum is decreased (FIG. 28).

    [0168] From the experiment on a model with induced rhinitis in Examples 6 to 8 above, it might be seen that a mixture of Bifidobacterium longum IM55 and Lactobacillus plantarum IM76 shows an effect of preventing, alleviating and treating asthma and rhinitis.

    Example 9. Effect of Normalization of Intestinal Microorganisms and Alleviation of Colitis

    [0169] Intestinal microorganisms, which have been recently reported to have an influence on the occurrence and deterioration of allergic diseases, are an important factor in the occurrence of allergic diseases. Thus, to identify a change of microorganisms in colon according to administration of novel lactic acid bacteria, an expression of cytokines and a change in intestinal microorganisms in the colon were analyzed with regard to an allergic rhinitis model of Example 7 above.

    [0170] Particularly, 2 μg of RNA was isolated from colon tissues of said animal model by using Takara thermal cycler and SYBR premix. qPCR was performed by means of said RNA, and a primer used for the qPCR was the same as shown in the table 14 above.

    [0171] As a result of the analysis, an expression of IL-4 and IL-5 was increased and an expression of IL-10 was decreased in the colon upon treatment with the OVA. However, upon treatment with IM55, IM76 or mixtures thereof, it was identified that an expression of IL-4 and IL-5 is decreased and an expression of IL-10 is increased (FIG. 29).

    [0172] Also, after isolating the colon from said animal model, 100 ng of total DNA was isolated from colonic fluid of said animal model by using Takara thermal cycler and SYBER premix. qPCR was performed by means of said DNA, and a primer used for the qPCR was the same as shown in a following table 19.

    TABLE-US-00019 TABLE 19 Bacteria type Primer type Printer sequence (5′-3′) Firmicutes Forward (SEQ ID NO: 21) GGAGYATGTGGTTTAATTCGAAGCA Reverse (SEQ ID NO: 22) AGCTGACGACAACCATGCAC Bacteroidetes Forward (SEQ ID NO: 23) AACGCGAAAAACCTTACCTACC Reverse (SEQ ID NO: 24) TGCCCTTTCGTAGCAACTAGTG Actinobacteria Forward (SEQ ID NO: 25) TGTAGCGGTGGAATGCGC Reverse (SEQ ID NO: 26) AATTAAGCCACATGCTCCGCT δ/γ-proteobacteria Forward (SEQ ID NO: 27) GCTAACGCATTAAGTRYCCCG Reverse (SEQ ID NO: 28) GCCATGCRGCACCTGTCT TM7 Forward (SEQ ID NO: 29) GCAACTCTTTACGCCCAGT Reverse (SEQ ID NO: 30) GAGAGGATGATCAGCCAG

    [0173] As a result of the analysis, upon treatment with the OVA, a population of Firmicutes, Proteobacteria and TM7 was increased, and a population of Bacteroidetes and Actinobacteria was decreased, and thus a ratio of Firmicutes/Bacteroides (F/B) and Proteobacteria/Bacteroidetes (P/B) was increased. However, upon treatment with IM55, IM76 or mixtures thereof, it was identified that a group of Proteobacteria increased by the OVA is significantly inhibited, and a group of Bacteroidetes and Actinobacteria decreased by occurrence of rhinitis is recovered (FIG. 30).

    [0174] From the results, it might be seen that IM55, IM76 and mixtures thereof not only normalize the changed intestinal microorganisms, but also show an effect of controlling, preventing, alleviating and treating colitis.

    Example 10. Preparation for Pharmaceutical Compositions containing Lactic Acid Bacteria, etc.

    [0175] In preparation for following pharmaceutical compositions, a Bifidobacterium longum IM55 culture product may be replaced with a Bifidobacterium longum IM55 strain itself, a crushed product thereof or an extract thereof. Also, in preparation for the following pharmaceutical compositions, the Bifidobacterium longum IM55 culture product may be replaced with a Lactobacillus plantarum IM76 strain itself, a crushed product thereof or an extract thereof. Moreover, the following pharmaceutical composition may further contain chitosan.

    [0176] <10-1> Preparation for Powder

    [0177] Bifidobacterium longum IM55 culture product 20 mg

    [0178] Lactose 100 mg

    [0179] Talc 10 mg

    [0180] Said components were mixed and filled into an airtight pack to prepare powder.

    [0181] <10-2> Preparation for Tablet

    [0182] Bifidobacterium longum IM55 culture product 10 mg

    [0183] Maize starch 100 mg

    [0184] Lactose 100 mg

    [0185] Magnesium stearate 2 mg

    [0186] Said components were mixed and compressed to prepare a tablet according to a conventional method for preparing tablets.

    [0187] <10-3> Preparation for Capsule Preparation

    [0188] Bifidobacterium longum IM55 culture product 10 mg

    [0189] Crystalline cellulose 3 mg

    [0190] Lactose 15 mg

    [0191] Magnesium stearate 0.2 mg

    [0192] Said components were mixed, and then filled into a gelatin capsule to prepare a capsule preparation according to a conventional method for preparing capsule preparations.

    [0193] <10-4> Preparation for Pill

    [0194] Bifidobacterium longum IM55 culture product 10 mg

    [0195] Lactose 150 mg

    [0196] Glycerin 100 mg

    [0197] Xylitol 50 mg

    [0198] Said components were mixed and prepared into a pill, each of which is 4 g, according to a conventional method.

    [0199] <10-5> Preparation for Granules

    [0200] Bifidobacterium longum IM55 culture product 15 mg

    [0201] Soybean extract 50 mg

    [0202] Glucose 200 mg

    [0203] Starch 600 mg

    [0204] Said components were mixed, after which 100 mg of 30% ethanol was added thereinto, then dried at 60° C., then formed into granules, and then filled into a pack.

    [0205] <10-6> Preparation for Injection

    [0206] Bifidobacterium longum IM55 culture product 10 mg

    [0207] Sodium metabisulfite 3.0 mg

    [0208] Methylparaben 0.8 mg

    [0209] Propylparaben 0.1 mg

    [0210] Suitable amount of sterile distilled water for injection

    [0211] Said components were mixed, after which 2 mcustom-character thereof was filled into an ample, then sterilized, and then prepared into an injection.

    Example 11. Preparation for Health Functional Foods containing Lactic Acid Bacteria, etc.

    [0212] In preparation for following health functional foods, a Bifidobacterium longum IM55 culture product may be replaced with a Bifidobacterium longum IM55 strain itself, a crushed product thereof or an extract thereof. Also, in preparation for the following health functional foods, a Bifidobacterium longum IM55 culture product may be replaced with a Lactobacillus plantarum IM76 strain itself, a crushed product thereof or an extract thereof. Also, the following health functional foods may further contain chitosan.

    [0213] <11-1> Preparation for Flour Food

    [0214] 0.5 parts by weight of the Bifidobacterium longum IM55 culture product was added into 100 parts by weight of flour, after which the resulting mixture was used to prepare bread, cake, cookies, cracker and noodles.

    [0215] <11-2> Preparation for Dairy Products

    [0216] 0.5 parts by weight of the Bifidobacterium longum IM55 culture product was added into 100 parts by weight of milk, after which said milk was used to prepare various dairy products such as butter and ice cream.

    [0217] <11-3> Preparation for Powder of Mixed Grains

    [0218] Unpolished rice, barley, glutinous rice and adlay, which were pregelatinized and dried by means of a known method, were roasted, and then prepared into powder of 60 mesh particle size with a grinder.

    [0219] Black bean, black sesame and perilla seed, which were steamed and dried by means of a known method, were also roasted, and then prepared into powder of 60 mesh particle size with a grinder.

    [0220] Said prepared grains, seeds and nuts, and Bifidobacterium longum IM55 culture product were compounded at a following ratio to prepare powder of mixed grains.

    [0221] Grains (30 parts by weight of unpolished rice, 17 parts by weight of adlay and 20 parts by weight of barley);

    [0222] Seeds and nuts (7 parts by weight of perilla seed, 8 parts by weight of black bean and 7 parts by weight of black sesame);

    [0223] Bifidobacterium longum IM55 culture product (1 part by weight);

    [0224] Ganoderma lucidum 0.5 parts by weight); and

    [0225] Rehmannia glutinosa (0.5 parts by weight)

    [0226] <11-4> Preparation for Healthy Drink

    [0227] Minor ingredients such as high fructose corn syrup (0.5 g), oligosaccharide (4 g), sugar (2 g), culinary salt (0.5 g) and water (77 g) as well as 1 g of the Bifidobacterium longum IM55 culture product were homogeneously compounded, then flash pasteurized, and then packed into each of small packing containers such as glass bottle, PET bottle, etc., to prepare healthy drink.

    [0228] <11-5> Preparation for Vegetable Juice

    [0229] 2 g of the Bifidobacterium longum IM55 culture product was added into 1,000 mcustom-character of tomato or carrot juice to prepare vegetable juice.

    [0230] <11-6> Preparation for Fruit Juice

    [0231] 1 g of Bifidobacterium longum IM55 culture product was added into 1,000 mcustom-character of apple or grape juice to prepare fruit juice.

    [0232] 6. Accession Information of Lactic Acid Bacteria

    [0233] The present inventors deposited Bifidobacterium longum IM55 for the purpose of patent to the Korean Culture Center of Microorganisms, a certified depository institution (address: Yulim Building, 45, Hongjenae 2ga-gil, Seodaemun-gu, Seoul, South Korea) on Jan. 20, 2017, and received an accession number of KCCM11961P. Also, the present inventors deposited Lactobacillus plantarum IM76 for the purpose of patent to the Korean Culture Center of Microorganisms, a certified depository institution (address: Yulim Building, 45, Hongjenae 2ga-gil, Seodaemun-gu, Seoul, South Korea) on Jan. 20, 2017, and received an accession number of KCCM11962P. Deposition of said lactic acid bacteria was performed in compliance with Budapest Treaty on the International Recognition of the Deposit of Microorganism for the Purposes of Patent Procedure.

    [0234] As shown above, the present invention has been described through Examples above, but is riot necessarily limited thereto, and may be variously modified without departing from the scope and spirit of the present invention. Thus, the scope of protection of the present invention is to be interpreted to include all the embodiments belonging to the scope of patent claims attached to the present invention.

    [0235] [Accession Number]

    Depository institution name: Korean Culture Center of Microorganisms (overseas)
    Accession number: KCCM11961P
    Accession date: 20170120
    Depository institution name: Korean Culture Center of Microorganisms (overseas)
    Accession number: KCCM11962P
    Accession date: 20170120