MICROORGANISMS FOR PRODUCING PUTRESCINE AND PROCESS FOR PRODUCING PUTRESCINE USING THEM

20170044487 ยท 2017-02-16

    Inventors

    Cpc classification

    International classification

    Abstract

    The present invention relates to a recombinant microorganism capable of producing putrescine at high yield due to inactivated activity of a protein having an amino acid sequence represented by SEQ ID NO: 2 in the microorganism, and a method of producing putrescine using the microorganism.

    Claims

    1. An isolated microorganism of genus Corynebacterium having putrescine productivity, wherein a protein having an amino acid sequence represented by SEQ ID NO: 2 is inactivated.

    2. The microorganism of genus Corynebacterium having putrescine productivity according to claim 1, wherein an activity of ornithine decarboxylase (ODC) is further introduced into the microorganism.

    3. The microorganism of genus Corynebacterium having putrescine productivity according to claim 2, wherein the ODC has an amino acid sequence represented by SEQ ID NO: 10.

    4. The microorganism of genus Corynebacterium having putrescine productivity according to claim 1, wherein acetyltransferase activity is further inactivated in the microorganism.

    5. The microorganism of genus Corynebacterium having putrescine productivity according to claim 4, wherein the acetyltransferase comprises an amino acid represented by SEQ ID NO: 15 or 16.

    6. The microorganism of genus Corynebacterium having putrescine productivity according to claim 1, wherein the microorganism is Corynebacterium glutamicum.

    7. A method of producing putrescine, comprising: culturing a microorganism of genus Corynebacterium having putrescine productivity wherein a protein having an amino acid sequence represented by SEQ ID NO: 2 is inactivated, in a culture medium; and separating putrescine from the cultured microorganism or the culture medium obtained from the above step.

    8. The method of producing putrescine according to claim 7, wherein the microorganism of genus Corynebacterium is Corynebacterium glutamicum.

    Description

    DESCRIPTION OF DRAWINGS

    [0077] FIG. 1 is a schematic diagram showing combined structures of NCgl2523 and the adjacent. In particular, FIG. 1 is a schematic diagram showing a combined structure of NCgl2522-NCgl2523-NCgl2524 which is a combined structure of adjacent genes of a microorganism including NCgl2523 (Type 1); a structure of combined NCgl2522-NCgl2523 and individual NCgl2524 (Type 2); or a combined structure of NCgl2522-NCgl2523 (Type 3).

    MODE FOR INVENTION

    [0078] Hereinafter, the present invention will be described in more detail with reference to Examples. However, the Examples are for illustrative purposes only, and thus the scope of the present invention is not intended to be limited by the Examples.

    Example 1

    Preparation of NCgl2523-Deleted Strains and Verification of its Putrescine Productivity

    <1-1> Preparation of NCgl2523-Deleted Strains in ATCC13032-Derived Putrescine-Producing Strains

    [0079] In order to verify whether deletion of NCgl2523 derived from Corynebacterium glutamicum ATCC13032 has an effect in putrescine productivity, vectors for deletion of a gene encoding NCgl2523 were prepared.

    [0080] In particular, based on the nucleotide sequence of a gene encoding NCgl2523 represented by SEQ ID NO: 1, a pair of primers of SEQ ID NOs: 4 and 5 for obtaining homologous recombination fragments at the N-terminal region of NCgl2523, and a pair of primers of SEQ ID NOs: 6 and 7 for obtaining homologous recombination fragments at the C-terminal region of NCgl2523 were constructed as shown in Table 1.

    TABLE-US-00001 TABLE1 NCg12523-del-F1_ CGGGATCCATGACTACCTCGCAGCGTTTC BamHI (SEQIDNO:4) NCg12523-del-R1_ ACGCGTCGACCTAGTGCGCATTATTGGCTCC SalI (SEQIDNO:5) NCg12523-del-F2_ ACGCGTCGACAGCCATGCTGGAAACAATTCTCG SalI (SEQIDNO:6) NCg12523-del-R2_ XbaI CTAGTCTAGAGAGAGCTGCGCATAGTACTG (SEQIDNO:7)

    [0081] PCR was performed using the genomic DNA of Corynebacterium glutamicum ATCC13032 as a template and two pairs of primers, thereby amplifying PCR fragments at the N-terminal and C-terminal regions of NCgl2523 gene. Desired fragments were obtained via electrophoresis of the PCR fragments. Here, PCR reaction was repeated for 30 cycles including 30 seconds of denaturation at 95 C., 30 seconds of annealing at 55 C., and 30 seconds of extension at 72 C. The thus obtained fragments of the N-terminal and C-terminal regions were treated with restriction enzymes BamHI and SalI, and restriction enzymes SalI and XbaI, respectively. The treated fragments were cloned into pDZ vectors treated with restriction enzymes BamHI and XbaI, thereby constructing pDZ-1NCgl2523(K/O) plasmids.

    [0082] The pDZ-1NCgl2523 (K/O) plasmids were each transformed into KCCM11138P (KR Patent No. 10-1348461) and KCCM11240P (KR Patent No. 2013-0082478) by electroporation to obtain transformants. For colony formation, the transformants were plated and cultured on BHIS plate media (Braine heart infusion (37 g/L), sorbitol (91 g/L), and agar (2%)) containing kanamycin (25 g/mL) and X-gal(5-bromo-4-chloro-3-indolin-D-galactoside). From the formed colonies, blue colonies were selected as strains introduced with pDZ-1NCgl2523(K/O) plasmids.

    [0083] The selected strains is cultured in a CM medium (glucose 10 g/L, polypeptone (10 g/L), yeast extract (5 g/L), beef extract (5 g/L), NaCl (2.5 g/L), urea (2 g/L), and pH 6.8) at 30 C. for 8 hours. After serial dilution of each cell culture from 10.sup.4 to 10.sup.10, the diluted samples were plated and cultured in an X-gal-containing solid medium to form colonies. From the formed colonies, white colonies, which appeared at a relatively low frequency, were finally selected as strains with deletion of a gene encoding NCgl2523 by a secondary crossover.

    [0084] PCR was performed using a pair of primers of SEQ ID NOs: 4 and 7 to confirm deletion of a gene encoding NCgl2523 in the finally selected strains. The Corynebacterium glutamicum mutants were each named as KCCM11138P NCgl2523 and KCCM11240P NCgl2523.

    <1-2> Preparation of NCgl2523-Deleted Strains in ATCC13869-Derived Putrescine-Producing Strains

    [0085] NCgl2523-deleted strains were constructed from DAB12-a (KR Patent No. 2013-0082478) and DAB12-b (KR Patent No. 2013-0082478; DAB12-a NCgl1469), which are putrescine-producing strains derived from Corynebacterium glutamicum ATCC13869.

    [0086] In particular, in order to verify a sequence of NCgl2523 gene and the expressed protein therefrom derived from Corynebacterium glutamicum ATCC13869, PCR was performed using genomic DNA of Corynebacterium glutamicum ATCC13869 as a template and a pair of primers of SEQ ID NOs: 4 and 7. Here, PCR reaction was repeated for 30 cycles including 30 seconds of denaturation at 95 C., 30 seconds of annealing at 55 C., and 1 minute 30 seconds of extension at 72 C.

    [0087] By separating the thus obtained PCR products via electrophoresis and analyzing by sequencing, a gene encoding NCgl2523 derived from Corynebacterium glutamicum ATCC13869 was found to include a nucleotide sequence represented by SEQ ID NO: 3. Further, an amino acid sequence of proteins encoded by the gene was compared to an amino acid sequence of NCgl2523 (SEQ ID NO: 2) derived from Corynebacterium glutamicum ATCC13032, and the result showed 100% homology.

    [0088] In order to delete a gene encoding NCgl2523 derived from Corynebacterium glutamicum ATCC13869, PCR was performed using genomic DNA of Corynebacterium glutamicum ATCC13869 as a template and two pairs of primers described in Table 1 as in Example <1-1>, and PCR fragments of the N-terminal C-terminal regions of NCgl2523 gene were amplified, thereby obtaining desired fragments via electrophoresis. Here, PCR reaction was repeated for 30 cycles including 30 seconds of denaturation at 95 C., 30 seconds of annealing at 55 C., and 30 seconds of extension at 72 C. The obtained fragments of the N-terminal and C-terminal regions were treated with restriction enzymes BamHI and SalI, and restriction enzymes SalI and XbaI, respectively. The treated fragments were cloned into pDZ vectors treated with restriction enzymes BamHI and XbaI, thereby constructing pDZ-2NCgl2523(K/O) plasmids.

    [0089] By transforming pDZ-2NCgl2523 (K/O) into each of Corynebacterium glutamicum DAB12-a and DAB12-b in the same manner as described in Example <1-1>, strains with deletion of a gene encoding NCgl2523 were selected. The selected Corynebacterium glutamicum mutants were named as DAB12-a NCgl2523 and DAB12-b NCgl2523.

    <1-3> Evaluation of Putrescine Productivity of NCgl2523-Deleted Strains

    [0090] In order to verify the effects of NCgl2523 deletion on putrescine production in putrescine-producing strains, Corynebacterium glutamicum mutants constructed in Example <1-1> and <1-2> were compared for putrescine productivity.

    [0091] In particular, 4 different types of Corynebacterium glutamicum mutants (KCCM11138P NCgl2523, KCCM11240P NCgl2523, DAB12-a NCgl2523, and DAB12-b NCgl2523) and 4 different types of parent strains (KCCM11138P, KCCM11240P, DAB12-a, and DAB12-b) were each plated on 1 mM arginine-containing CM plate media (1% glucose, 1% polypeptone, 0.5% yeast extract, 0.5% beef extract, 0.25% NaCl, 0.2% urea, 100 L of 50% NaOH, and 2% agar, at pH 6.8, base on 1 L) and cultured at 30 C. for 24 hours. After inoculating each of the cultured stains using a platinum loop in 25 mL of titer media (8% Glucose, 0.25% soybean proteins, 0.50% corn steep solids, 4% (NH.sub.4).sub.2SO.sub.4, 0.1% KH.sub.2PO.sub.4, 0.05% MgSO.sub.4.7H.sub.2O, 0.15% urea, 100 g of biotin, 3 mg of thiamine hydrochloride, 3 mg of calcium-pantothenic acid, 3 mg of nicotinamide, and 5% of CaCO.sub.3, based on 1 L), shake culturing was carried out at 30 C. and 200 rpm for 98 hours. 1 mM arginine was added to the media for culturing all strains. The concentration of putrescine produced from each culture was measured, and results are shown in Table 2.

    TABLE-US-00002 TABLE 2 Strain Putrescine (g/L) KCCM11138P 9.8 KCCM11138P NCgl2523 11.8 KCCM11240P () 12.4 KCCM11240P NCgl2523 14.9 DAB12-a 10.2 DAB12-a NCgl2523 12.2 DAB12-b 13.1 DAB12-b NCgl2523 15.2

    [0092] As shown in Table 2, putrescine production was increased in 4 kinds of NCgl2523-deleted Corynebacterium glutamicum mutants.

    Example 2

    Measurement of Intercellular Putrescine Concentrations in NCgl2523-Deleted Strains

    [0093] To examine changes in intercellular putrescine concentration in Corynebacterium glutamicum mutants having inactivated NCgl2523 activity, intercellular putrescine concentrations were measured in Corynebacterium glutamicum mutant KCCM11240P NCgl2523 and parent strain KCCM11240P by extraction using an organic solvent. Intracellular metabolite analysis was carried out in accordance with a method described in literature (Nakamura J et al., Appl. Environ. Microbiol., 73(14): 4491-4498, 2007).

    [0094] First, after inoculating each of Corynebacterium glutamicum mutant KCCM11240P NCgl2523 and parent strain KCCM11240P in 25 ml of 1 mM arginine-containing CM liquid media (1% glucose, 1% polypeptone, 0.5% yeast extract, 0.5% beef extract, 0.25% NaCl, 0.2% urea, and 100 L of 50% NaOH, at pH 6.8, based on 1 L), shake culturing was carried out at 30 C. and 200 rpm. When cell growth reached the exponential phase during cultivation, cells were isolated from the culture media by rapid vacuum filtration (Durapore HV, 0.45 m; Millipore, Billerica, Mass.). The cell-adsorbed filter was washed twice with 10 ml of cooled water and emerged in methanol-containing 5 M morpholine ethanesulfonic acid and 5 M methionine sulfone for 10 minutes. The extraction liquid obtained therefrom was mixed well with an equal volume of chloroform and 0.4-fold volume of water. Only the aqueous phase was applied to a spin column to remove protein contaminants. The filtered extraction liquid was analyzed by capillary electrophoresis mass spectrometry, and the results are shown in Table 3.

    TABLE-US-00003 TABLE 3 Strain Putrescine (mM) KCCM11240P 7 KCCM11240P NCgl2523 1

    [0095] As shown in Table 3, the intercellular putrescine concentration was significantly reduced in Corynebacterium glutamicum mutants having inactivated NCgl2523 activity compared to that of parent strain KCCM11240P.

    [0096] It is suggested that when NCgl2523 is deleted in Corynebacterium glutamicum mutant KCCM11240P, inhibition of NCgl2522 expression is withdrawn and NCgl2522 activity is enhanced, thereby enhancing putrescine-exporting ability and subsequently exporting putrescine produced inside the cell to the outside of cells efficiently.

    Example 3

    Ortholog Search of NCgl2523 Gene and Gene Context Analysis

    [0097] Ortholog search was conducted for NCgl2523, which is derived from Corynebacterium glutamicum ATCC13032, using KEGG, MetaCyc Database and NCBI blastP. Via gene cluster, a combined structure of NCgl2523, and NCgl2522 and NCgl2524, which constitute an operon in the genome of each microorganism was examined.

    [0098] The gene name of NCgl2522 is cgmA, which is a major facilitator superfamily permease belonging to DHA2 family, and the gene name of NCgl2523 is cgmR, which is TetR-family transcriptional regulator. NCgl2524 has not been attributed with a function, but is a major facilitator superfamily permease belonging to UMF1 family.

    [0099] According to the analysis results, while NCgl2522 and NCgl2523 mostly constitute the same operon, NCgl2524 may be present in the same operons (Type 1), present in a different position in the genome (Type 2), or not present in the genome (Type 3), depending on microorganisms.

    [0100] In this regard, each of analyzed microorganisms was classified into 3 types according to a combined structure of genes adjacent to NCgl2523. In particular, microorganisms which are expected to have NCgl2523 were classified into a combined structure of NCgl2522-NCgl2523-NCgl2524 (Type 1); a structure of combined NCgl2522-NCgl2523 and individual NCgl2524 (Type 2); or a combined structure of NCgl2522-NCgl2523 (Type 3) (FIG. 1). The classification results are shown in Table 4.

    TABLE-US-00004 TABLE 4 Combined Type structure Corresponding microorganisms Microorganism Acidovorax avenae, Actinobaculum sp., Actinomyces sp., having Actinomyces vaccimaxillae, Actinoplanes missouriensis, NCgl2523 Actinosynnema mirum, Agrobacterium tumefaciens, alpha- proteobacterium, Amycolatopsis mediterranei, Amycolatopsis orientalis, Arcanobacterium haemolyticum, Arthrobacter aurescens, Arthrobacter sp., Bdellovibrio bacteriovorus, Beutenbergia cavernae, Bordetella bronchiseptica, Bordetella pertussis, Bordetella parapertussis, Brachybacterium paraconglomeratum, Clavibacter michiganensis subsp., Corynebacterium atypicum, Corynebacterium callunae, Corynebacterium casei, Corynebacterium diphtheriae, Corynebacterium glutamicum, Corynebacterium glutamicum AR1, Corynebacterium glutamicum ATCC 13032, Corynebacterium glutamicum ATCC 13869, Corynebacterium glutamicum ATCC 14067, Corynebacterium glutamicum ATCC 21831, Corynebacterium glutamicum K051, Corynebacterium glutamicum MB001, Corynebacterium glutamicum R, Corynebacterium glutamicum SCgG1, Corynebacterium glutamicum SCgG2, Corynebacterium glycinophilum, Corynebacterium maris, Corynebacterium pseudotuberculosis, Corynebacterium sp. ATCC 6931, Corynebacterium terpenotabidum, Corynebacterium ulcerans, Corynebacterium urealyticum, Corynebacterium variabile, Corynebacterium vitaeruminis, Dermabacter sp. HFH0086, Enterobacter cloacae EcWSU1, Enterobacter sp. R4-368, Gammaproteobacteria, Granulicoccus phenolivorans, Hafnia alvei, Ilumatobacter coccineus, Isoptericola variabilis, Janthinobacterium agaricidamnosum, Ketogulonicigenium vulgare, Microbacterium sp., Microbacterium testaceum, Micrococcus luteus, Micromonospora aurantiaca, Micromonospora sp., Mycobacterium gilvum, Nakamurella multipartita, Nesterenkonia alba, Nesterenkonia sp., Nocardia brasiliensis, Nocardia cyriacigeorgica, Nocardia farcinica, Nocardiopsis dassonvillei, Nocardiopsis, kunsanensis, Nocardiopsis sp., Nocardiopsis valliformis, Nocardiopsis xinjiangensis, Ochrobactrum anthropi, Ochrobactrum intermedium, Paracoccus aminophilus, Paracoccus sp. 5503, Pectobacterium carotovorum subsp. carotovorum PCC21, Promicromonospora sukumoe, Propionibacterium acidipropionici, Propionibacterium freudenreichii, Proteobacteria, Providencia stuartii ATCC 33672, Pseudomonas aeruginosa, Pseudomonas cremoricolorata, Pseudomonas geniculata, Pseudomonas stutzeri, pseudonocardia dioxanivorans, Renibacterium salmoninarum, Rhodococcus equi, Rhodococcus erythropolis, Rhodococcus jostii, Rhodococcus opacus B4, Rhodococcus opacus PD630, Rhodococcus pyridinivorans, Saccharomonospora viridis, Saccharopolyspora erythraea, Salinispora, Salinispora arenicola, Salinispora pacifica, Salinispora tropica, Sanguibacter keddieii, Serratia liquefaciens, Serratia marcescens, Serratia plymuthica, Serratia proteamaculans, Serratia sp., Sodalis sp. HS1, Sphingobium chinhatense, Stenotrophomonas maltophilia, Stenotrophomonas sp., Streptococcus anginosus, Streptomyces, Streptomyces alboviridis, Streptomyces albus, Streptomyces atroolivaceus, Streptomyces baarnensis, Streptomyces cyaneofuscatus, Streptomyces fulvissimus, Streptomyces globisporus, Streptomyces griseus, Streptomyces mediolani, Streptomyces scopuliridis, Streptomyces sp., Xanthomonas citri pv. citri, Xenorhabdus nematophila, Yaniella halotolerans, Yersinia enterocolitica 1 Combined Corynebacterium callunae, Corynebacterium casei, structure of Corynebacterium glutamicum AR1, Corynebacterium glutamicum NCgl2522-NCgl2523- ATCC 13032, Corynebacterium glutamicum ATCC 13869, NCgl2524 Corynebacterium glutamicum ATCC 14067, Corynebacterium glutamicum ATCC 21831, Corynebacterium glutamicum K051, Corynebacterium glutamicum MB001, Corynebacterium glutamicum R, Corynebacterium glutamicum SCgG1, Corynebacterium glutamicum SCgG2, Corynebacterium vitaeruminis 2 Structure of Actinoplanes missouriensis, Actinosynnema mirum, combined Amycolatopsis mediterranei, Amycolatopsis mediterranei, NCgl2522-NCgl2523; Amycolatopsis orientalis, Arcanobacterium haemolyticum, individual Arthrobacter aurescens, Arthrobacter sp., Bordetella NCgl2524 bronchiseptica, Bordetella parapertussis, Bordetella pertussis, Clavibacter michiganensis, Corynebacterium glycinophilum, Corynebacterium maris, Corynebacterium terpenotabidum, Corynebacterium variabile, Isoptericola variabilis, Microbacterium testaceum, Micromonospora aurantiaca, Micromonospora sp. L5, Mycobacterium gilvum, Nakamurella multipartita, Nocardia brasiliensis, Nocardia cyriacigeorgica, Nocardia cyriacigeorgica, Nocardia farcinica, Nocardiopsis dassonvillei, Nocardiopsis dassonvillei, Ochrobactrum anthropi, Paracoccus aminophilus, Propionibacterium acidipropionici, Pseudonocardia dioxanivorans, Renibacterium salmoninarum, Rhodococcus equi, Rhodococcus pyridinivorans, Saccharomonospora viridis, Saccharopolyspora erythraea, Salinispora tropica, Streptomyces albus, Streptomyces fulvissimus, Streptomyces griseus 3 Combined Acidovorax avenae, Bdellovibrio bacteriovorus, Beutenbergia structure of cavernae, Corynebacterium atypicum, Corynebacterium NCgl2522-NCgl2523 diphtheriae, Corynebacterium pseudotuberculosis, Corynebacterium ulcerans, Corynebacterium urealyticum, Enterobacter cloacae, Enterobacter sp., Hafnia alvei, Ilumatobacter coccineus, Janthinobacterium agaricidamnosum, Ketogulonicigenium vulgare, Pectobacterium carotovorum subsp. carotovorum PCC21, Providencia stuartii, Pseudomonas aeruginosa, Pseudomonas cremoricolorata, Pseudomonas stutzeri, Sanguibacter keddieii, Serratia liquefaciens, Serratia marcescens, Serratia plymuthica, Serratia proteamaculans, Serratia sp., Sodalis sp. HS1, Stenotrophomonas maltophilia, Xenorhabdus nematophila, Yersinia enterocolitica

    [0101] From these results, it is expected that putrescine productivity may be enhanced as in the present invention by inactivating genes encoding NCgl2523 and an amino acid sequence similar thereto, for microorganisms having an amino acid including a sequence similar to NCgl2523 and consisting of an operon with a protein expected to be a putrescine exporter, such as NCgl2522, as in the classification.

    [0102] Based on the above description, it should be understood by one of ordinary skill in the art that other specific embodiments may be employed in practicing the invention without departing from the technical idea or essential features of the present invention. In this regard, the above-described examples are for illustrative purposes only, and the invention is not intended to be limited by these examples. The scope of the present invention should be understood to include all of the modifications or modified form derived from the meaning and scope of the following claims or its equivalent concepts, rather than the above detailed description.

    DEPOSIT DESIGNATION

    [0103] Depository Authority: Korea Culture Center of Microorganisms

    [0104] Accession No.: KCCM11520P

    [0105] Date of Deposit: 20140225