Methods and compositions for inhibiting viral entry into cells
09566352 ยท 2017-02-14
Assignee
Inventors
Cpc classification
A61K35/17
HUMAN NECESSITIES
A61K48/005
HUMAN NECESSITIES
A61K35/30
HUMAN NECESSITIES
C07K14/715
CHEMISTRY; METALLURGY
A61K35/15
HUMAN NECESSITIES
A61K35/545
HUMAN NECESSITIES
C12N2740/16122
CHEMISTRY; METALLURGY
C12N2740/16033
CHEMISTRY; METALLURGY
International classification
A61K48/00
HUMAN NECESSITIES
C07K14/00
CHEMISTRY; METALLURGY
A61K38/16
HUMAN NECESSITIES
A61K35/545
HUMAN NECESSITIES
A61K35/30
HUMAN NECESSITIES
A61K35/17
HUMAN NECESSITIES
Abstract
Disclosed herein are methods and compositions for inhibiting viral entry into cells.
Claims
1. An isolated mammalian cell comprising an endogenous CD4, CXCR4 or CCR5 HIV receptor or co-receptor gene and an exogenous nucleic acid sequence encoding a fusion protein comprising a C34 peptide fusion inhibitor comprising the amino acid sequence as shown in SEQ ID NO:5 fused in frame to the N-terminal extracellular domain of a CXCR4 or a CCR5 protein, wherein a regulatory sequence is operatively linked to the nucleic acid sequence encoding the fusion protein, wherein the expression of the endogenous HIV receptor or co-receptor gene product in the cell is knocked out, and further wherein the fusion protein is membrane bound and the C34 peptide fusion inhibitor is expressed on the surface of the isolated cell.
2. The cell of claim 1, wherein the exogenous nucleic acid sequence is integrated into an endogenous locus, wherein the endogenous locus is selected from the group consisting of the CD4 locus, the CXCR4 locus, the CCR5 locus and a safe harbor locus.
3. The cell of claim 2, wherein the exogenous nucleic acid sequence is integrated into the endogenous CD4, CXCR4 and CCR5 gene.
4. The cell of claim 3, wherein integration of the exogenous nucleic acid sequence into the endogenous CD4, CXCR4 or CCR5 gene inactivates the endogenous CD4, CXCR4 or CCR5 gene.
5. The cell of claim 1, wherein the expression of the endogenous CD4, CXCR4 or CCR5 HIV receptor or co-receptor gene in the cell is knocked out by a nuclease and the nuclease is selected from the group consisting of one or more zinc finger nucleases, one or more TALENS, one or more homing endonucleases and combinations thereof.
6. The cell of claim 1, wherein the cell is selected from the group consisting of a stem cell, a T-cell, a macrophage, a dendritic cell, a microglia, and an antigen-presenting cell.
7. A method of producing an isolated mammalian cell according to claim 1, the method comprising integrating the exogenous nucleic acid sequence encoding the fusion protein using one or more nucleases into the genome of the mammalian cell.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
DETAILED DESCRIPTION
(11) Disclosed herein are compositions and methods for treating and/or preventing viral (e.g., HIV) entry into a cell, thereby treating and/or preventing viral infection and resulting disease (e.g., HIV/AIDS). In particular, nuclease-mediated integration is used to integrate a peptide fusion inhibitor onto a cell surface receptor involved in viral entry. Alternatively, the HIV receptor or coreceptor gene is disrupted using nucleases, and the constructs (e.g., viral or non-viral vectors) encoding the fusion protein comprising the peptide fusion inhibitor and the viral receptor or coreceptor is delivered into the modified cells (at the disrupted locus or a different locus). In other aspects, one or more of the viral receptors are disrupted by specific nucleases and then the fusion construct is delivered to inhibit viral entry.
(12) In certain aspects, the virus is HIV and the peptide fusion inhibitor is integrated onto the N-terminus of an HIV receptor or coreceptor (e.g., CD4, CCR5, or CXCR4). In certain embodiments, the HIV coreceptor is a CXCR4 receptor. Attachment of a peptide fusion inhibitor (e.g., C34) onto the N-terminus of CXCR4 renders the modified cells resistant to HIV infection by blocking the formation of a trimer-of-hairpins while retaining the response to CXCL12.
(13) The compositions and methods described herein can be used for therapies for treating viral diseases, such as anti-HIV/AIDS therapies, by inhibiting entry of the virus. In addition, compositions and methods described herein can be used for any research studies or other applications involving HIV receptor/co-receptor proteins or other surface proteins, such as studying functions of the protein under physiological or pathological conditions.
(14) General
(15) Practice of the methods, as well as preparation and use of the compositions disclosed herein employ, unless otherwise indicated, conventional techniques in molecular biology, biochemistry, chromatin structure and analysis, computational chemistry, cell culture, recombinant DNA and related fields as are within the skill of the art. These techniques are fully explained in the literature. See, for example, Sambrook et al.
DEFINITIONS
(16) The terms nucleic acid, polynucleotide, and oligonucleotide are used interchangeably and refer to a deoxyribonucleotide or ribonucleotide polymer, in linear or circular conformation, and in either single- or double-stranded form. For the purposes of the present disclosure, these terms are not to be construed as limiting with respect to the length of a polymer. The terms can encompass known analogues of natural nucleotides, as well as nucleotides that are modified in the base, sugar and/or phosphate moieties (e.g., phosphorothioate backbones). In general, an analogue of a particular nucleotide has the same base-pairing specificity; i.e., an analogue of A will base-pair with T.
(17) The terms polypeptide, peptide and protein are used interchangeably to refer to a polymer of amino acid residues. The term also applies to amino acid polymers in which one or more amino acids are chemical analogues or modified derivatives of corresponding naturally-occurring amino acids.
(18) Binding refers to a sequence-specific, non-covalent interaction between macromolecules (e.g., between a protein and a nucleic acid). Not all components of a binding interaction need be sequence-specific (e.g., contacts with phosphate residues in a DNA backbone), as long as the interaction as a whole is sequence-specific. Such interactions are generally characterized by a dissociation constant (K.sub.d) of 10.sup.6 M.sup.1 or lower. Affinity refers to the strength of binding: increased binding affinity being correlated with a lower K.sub.d.
(19) A binding protein is a protein that is able to bind non-covalently to another molecule. A binding protein can bind to, for example, a DNA molecule (a DNA-binding protein), an RNA molecule (an RNA-binding protein) and/or a protein molecule (a protein-binding protein). In the case of a protein-binding protein, it can bind to itself (to form homodimers, homotrimers, etc.) and/or it can bind to one or more molecules of a different protein or proteins. A binding protein can have more than one type of binding activity. For example, zinc finger proteins have DNA-binding, RNA-binding and protein-binding activity.
(20) A zinc finger DNA binding protein (or binding domain) is a protein, or a domain within a larger protein, that binds DNA in a sequence-specific manner through one or more zinc fingers, which are regions of amino acid sequence within the binding domain whose structure is stabilized through coordination of a zinc ion. The term zinc finger DNA binding protein is often abbreviated as zinc finger protein or ZFP.
(21) A TALE DNA binding domain or TALE is a polypeptide comprising one or more TALE repeat domains/units. The repeat domains are involved in binding of the TALE to its cognate target DNA sequence. A single repeat unit (also referred to as a repeat) is typically 33-35 amino acids in length and exhibits at least some sequence homology with other TALE repeat sequences within a naturally occurring TALE protein.
(22) Zinc finger and TALE binding domains can be engineered to bind to a predetermined nucleotide sequence, for example via engineering (altering one or more amino acids) of the recognition helix region of a naturally occurring zinc finger or TALE protein. Therefore, engineered DNA binding proteins (zinc fingers or TALEs) are proteins that are non-naturally occurring. Non-limiting examples of methods for engineering DNA-binding proteins are design and selection. A designed DNA binding protein is a protein not occurring in nature whose design/composition results principally from rational criteria. Rational criteria for design include application of substitution rules and computerized algorithms for processing information in a database storing information of existing ZFP and/or TALE designs and binding data. See, for example, U.S. Pat. Nos. 6,140,081; 6,453,242; and 6,534,261; see also WO 98/53058; WO 98/53059; WO 98/53060; WO 02/016536 and WO 03/016496 and U.S. Publication No. 20110301073.
(23) A selected zinc finger protein is a protein not found in nature whose production results primarily from an empirical process such as phage display, interaction trap or hybrid selection. See e.g., U.S. Pat. No. 5,789,538; U.S. Pat. No. 5,925,523; U.S. Pat. No. 6,007,988; U.S. Pat. No. 6,013,453; U.S. Pat. No. 6,200,759; WO 95/19431; WO 96/06166; WO 98/53057; WO 98/54311; WO 00/27878; WO 01/60970 WO 01/88197 and WO 02/099084 and U.S. Publication No. 20110301073.
(24) Recombination refers to a process of exchange of genetic information between two polynucleotides. For the purposes of this disclosure, homologous recombination (HR) refers to the specialized form of such exchange that takes place, for example, during repair of double-strand breaks in cells via homology-directed repair mechanisms. This process requires nucleotide sequence homology, uses a donor molecule to template repair of a target molecule (i.e., the one that experienced the double-strand break), and is variously known as non-crossover gene conversion or short tract gene conversion, because it leads to the transfer of genetic information from the donor to the target. Without wishing to be bound by any particular theory, such transfer can involve mismatch correction of heteroduplex DNA that forms between the broken target and the donor, and/or synthesis-dependent strand annealing, in which the donor is used to re-synthesize genetic information that will become part of the target, and/or related processes. Such specialized HR often results in an alteration of the sequence of the target molecule such that part or all of the sequence of the donor polynucleotide is incorporated into the target polynucleotide.
(25) In the methods of the disclosure, one or more targeted nucleases as described herein create a double-stranded break in the target sequence (e.g., cellular chromatin) at a predetermined site, and a donor polynucleotide, having homology to the nucleotide sequence in the region of the break can be introduced into the cell. The presence of the double-stranded break has been shown to facilitate integration of the donor sequence. The donor sequence may be physically integrated or, alternatively, the donor polynucleotide is used as a template for repair of the break via homologous recombination, resulting in the introduction of all or part of the nucleotide sequence as in the donor into the cellular chromatin. Thus, a first sequence in cellular chromatin can be altered and, in certain embodiments, can be converted into a sequence present in a donor polynucleotide. Thus, the use of the terms replace or replacement can be understood to represent replacement of one nucleotide sequence by another, (i.e., replacement of a sequence in the informational sense), and does not necessarily require physical or chemical replacement of one polynucleotide by another.
(26) In any of the methods described herein, additional pairs of nuclease proteins (e.g., ZFNs and/or TALENs) can be used for additional double-stranded cleavage of additional target sites within the cell.
(27) In certain embodiments of methods for targeted recombination and/or replacement and/or alteration of a sequence in a region of interest in cellular chromatin, a chromosomal sequence is altered by homologous recombination with an exogenous donor nucleotide sequence. Such homologous recombination is stimulated by the presence of a double-stranded break in cellular chromatin, if sequences homologous to the region of the break are present.
(28) In any of the methods described herein, the first nucleotide sequence (the donor sequence) can contain sequences that are homologous, but not identical, to genomic sequences in the region of interest, thereby stimulating homologous recombination to insert a non-identical sequence in the region of interest. Thus, in certain embodiments, portions of the donor sequence that are homologous to sequences in the region of interest exhibit between about 80 to 99% (or any integer therebetween) sequence identity to the genomic sequence that is replaced. In other embodiments, the homology between the donor and genomic sequence is higher than 99%, for example if only 1 nucleotide differs as between donor and genomic sequences of over 100 contiguous base pairs. In certain cases, a non-homologous portion of the donor sequence can contain sequences not present in the region of interest, such that new sequences are introduced into the region of interest. In these instances, the non-homologous sequence is generally flanked by sequences of 50-1,000 base pairs (or any integral value therebetween) or any number of base pairs greater than 1,000, that are homologous or identical to sequences in the region of interest. In other embodiments, the donor sequence is non-homologous to the first sequence, and is inserted into the genome by non-homologous recombination mechanisms.
(29) Any of the methods described herein can be used for partial or complete inactivation of one or more target sequences in a cell by targeted integration of donor sequence that disrupts expression of the gene(s) of interest. Cell lines with partially or completely inactivated genes are also provided.
(30) Furthermore, the methods of targeted integration as described herein can also be used to integrate one or more exogenous sequences. The exogenous nucleic acid sequence can comprise, for example, one or more genes or cDNA molecules, or any type of coding or non-coding sequence, as well as one or more control elements (e.g., promoters). In addition, the exogenous nucleic acid sequence may produce one or more RNA molecules (e.g., small hairpin RNAs (shRNAs), inhibitory RNAs (RNAis), microRNAs (miRNAs), etc.).
(31) Cleavage refers to the breakage of the covalent backbone of a DNA molecule. Cleavage can be initiated by a variety of methods including, but not limited to, enzymatic or chemical hydrolysis of a phosphodiester bond. Both single-stranded cleavage and double-stranded cleavage are possible, and double-stranded cleavage can occur as a result of two distinct single-stranded cleavage events. DNA cleavage can result in the production of either blunt ends or staggered ends. In certain embodiments, fusion polypeptides are used for targeted double-stranded DNA cleavage.
(32) A cleavage half-domain is a polypeptide sequence which, in conjunction with a second polypeptide (either identical or different) forms a complex having cleavage activity (preferably double-strand cleavage activity). The terms first and second cleavage half-domains; + and cleavage half-domains and right and left cleavage half-domains are used interchangeably to refer to pairs of cleavage half-domains that dimerize.
(33) An engineered cleavage half-domain is a cleavage half-domain that has been modified so as to form obligate heterodimers with another cleavage half-domain (e.g., another engineered cleavage half-domain). See, also, U.S. Patent Publication Nos. 2005/0064474, 20070218528 and 2008/0131962, incorporated herein by reference in their entireties.
(34) The term sequence refers to a nucleotide sequence of any length, which can be DNA or RNA; can be linear, circular or branched and can be either single-stranded or double stranded. The term donor sequence refers to a nucleotide sequence that is inserted into a genome. A donor sequence can be of any length, for example between 2 and 10,000 nucleotides in length (or any integer value therebetween or thereabove), preferably between about 100 and 1,000 nucleotides in length (or any integer therebetween), more preferably between about 200 and 500 nucleotides in length.
(35) Chromatin is the nucleoprotein structure comprising the cellular genome. Cellular chromatin comprises nucleic acid, primarily DNA, and protein, including histones and non-histone chromosomal proteins. The majority of eukaryotic cellular chromatin exists in the form of nucleosomes, wherein a nucleosome core comprises approximately 150 base pairs of DNA associated with an octamer comprising two each of histones H2A, H2B, H3 and H4; and linker DNA (of variable length depending on the organism) extends between nucleosome cores. A molecule of histone H1 is generally associated with the linker DNA. For the purposes of the present disclosure, the term chromatin is meant to encompass all types of cellular nucleoprotein, both prokaryotic and eukaryotic. Cellular chromatin includes both chromosomal and episomal chromatin.
(36) A chromosome, is a chromatin complex comprising all or a portion of the genome of a cell. The genome of a cell is often characterized by its karyotype, which is the collection of all the chromosomes that comprise the genome of the cell. The genome of a cell can comprise one or more chromosomes.
(37) An episome is a replicating nucleic acid, nucleoprotein complex or other structure comprising a nucleic acid that is not part of the chromosomal karyotype of a cell. Examples of episomes include plasmids and certain viral genomes.
(38) A target site or target sequence is a nucleic acid sequence that defines a portion of a nucleic acid to which a binding molecule will bind, provided sufficient conditions for binding exist.
(39) An exogenous molecule is a molecule that is not normally present in a cell, but can be introduced into a cell by one or more genetic, biochemical or other methods. Normal presence in the cell is determined with respect to the particular developmental stage and environmental conditions of the cell. Thus, for example, a molecule that is present only during embryonic development of muscle is an exogenous molecule with respect to an adult muscle cell. Similarly, a molecule induced by heat shock is an exogenous molecule with respect to a non-heat-shocked cell. An exogenous molecule can comprise, for example, a functioning version of a malfunctioning endogenous molecule or a malfunctioning version of a normally-functioning endogenous molecule.
(40) An exogenous molecule can be, among other things, a small molecule, such as is generated by a combinatorial chemistry process, or a macromolecule such as a protein, nucleic acid, carbohydrate, lipid, glycoprotein, lipoprotein, polysaccharide, any modified derivative of the above molecules, or any complex comprising one or more of the above molecules. Nucleic acids include DNA and RNA, can be single- or double-stranded; can be linear, branched or circular; and can be of any length. Nucleic acids include those capable of forming duplexes, as well as triplex-forming nucleic acids. See, for example, U.S. Pat. Nos. 5,176,996 and 5,422,251. Proteins include, but are not limited to, DNA-binding proteins, transcription factors, chromatin remodeling factors, methylated DNA binding proteins, polymerases, methylases, demethylases, acetylases, deacetylases, kinases, phosphatases, integrases, recombinases, ligases, topoisomerases, gyrases and helicases.
(41) An exogenous molecule can be the same type of molecule as an endogenous molecule, e.g., an exogenous protein or nucleic acid. For example, an exogenous nucleic acid can comprise an infecting viral genome, a plasmid or episome introduced into a cell, or a chromosome that is not normally present in the cell. Methods for the introduction of exogenous molecules into cells are known to those of skill in the art and include, but are not limited to, lipid-mediated transfer (i.e., liposomes, including neutral and cationic lipids), electroporation, direct injection, cell fusion, particle bombardment, calcium phosphate co-precipitation, DEAE-dextran-mediated transfer and viral vector-mediated transfer. An exogenous molecule can also be the same type of molecule as an endogenous molecule but derived from a different species than the cell is derived from. For example, a human nucleic acid sequence may be introduced into a cell line originally derived from a mouse or hamster.
(42) By contrast, an endogenous molecule is one that is normally present in a particular cell at a particular developmental stage under particular environmental conditions. For example, an endogenous nucleic acid can comprise a chromosome, the genome of a mitochondrion, chloroplast or other organelle, or a naturally-occurring episomal nucleic acid. Additional endogenous molecules can include proteins, for example, transcription factors and enzymes.
(43) A fusion molecule is a molecule in which two or more subunit molecules are linked, preferably covalently. The subunit molecules can be the same chemical type of molecule, or can be different chemical types of molecules. Examples of the first type of fusion molecule include, but are not limited to, fusion proteins (for example, a fusion between a ZFP DNA-binding domain and one or more activation domains or an anti-HIV fusion peptide and an HIV co-receptor) and fusion nucleic acids (for example, a nucleic acid encoding the fusion protein described supra). Examples of the second type of fusion molecule include, but are not limited to, a fusion between a triplex-forming nucleic acid and a polypeptide, and a fusion between a minor groove binder and a nucleic acid.
(44) Expression of a fusion protein in a cell can result from delivery of the fusion protein to the cell or by delivery of a polynucleotide encoding the fusion protein to a cell, wherein the polynucleotide is transcribed, and the transcript is translated, to generate the fusion protein. Trans-splicing, polypeptide cleavage and polypeptide ligation can also be involved in expression of a protein in a cell. Methods for polynucleotide and polypeptide delivery to cells are presented elsewhere in this disclosure.
(45) A gene, for the purposes of the present disclosure, includes a DNA region encoding a gene product (see infra), as well as all DNA regions which regulate the production of the gene product, whether or not such regulatory sequences are adjacent to coding and/or transcribed sequences. Accordingly, a gene includes, but is not necessarily limited to, promoter sequences, terminators, translational regulatory sequences such as ribosome binding sites and internal ribosome entry sites, enhancers, silencers, insulators, boundary elements, replication origins, matrix attachment sites and locus control regions.
(46) Gene expression refers to the conversion of the information, contained in a gene, into a gene product. A gene product can be the direct transcriptional product of a gene (e.g., mRNA, tRNA, rRNA, antisense RNA, ribozyme, structural RNA or any other type of RNA) or a protein produced by translation of an mRNA. Gene products also include RNAs which are modified, by processes such as capping, polyadenylation, methylation, and editing, and proteins modified by, for example, methylation, acetylation, phosphorylation, ubiquitination, ADP-ribosylation, myristilation, and glycosylation.
(47) Modulation of gene expression refers to a change in the activity of a gene. Modulation of expression can include, but is not limited to, gene activation and gene repression. Genome editing (e.g., cleavage, alteration, inactivation, random mutation) can be used to modulate expression. Gene inactivation refers to any reduction in gene expression as compared to a cell that does not include a ZFP as described herein. Thus, gene inactivation may be partial or complete.
(48) A region of interest is any region of cellular chromatin, such as, for example, a gene or a non-coding sequence within or adjacent to a gene, in which it is desirable to bind an exogenous molecule. Binding can be for the purposes of targeted DNA cleavage and/or targeted recombination. A region of interest can be present in a chromosome, an episome, an organellar genome (e.g., mitochondrial, chloroplast), or an infecting viral genome, for example. A region of interest can be within the coding region of a gene, within transcribed non-coding regions such as, for example, leader sequences, trailer sequences or introns, or within non-transcribed regions, either upstream or downstream of the coding region. A region of interest can be as small as a single nucleotide pair or up to 2,000 nucleotide pairs in length, or any integral value of nucleotide pairs.
(49) Eukaryotic cells include, but are not limited to, fungal cells (such as yeast), plant cells, animal cells, mammalian cells and human cells (e.g., T-cells).
(50) The terms operative linkage and operatively linked (or operably linked) are used interchangeably with reference to a juxtaposition of two or more components (such as sequence elements), in which the components are arranged such that both components function normally and allow the possibility that at least one of the components can mediate a function that is exerted upon at least one of the other components. By way of illustration, a transcriptional regulatory sequence, such as a promoter, is operatively linked to a coding sequence if the transcriptional regulatory sequence controls the level of transcription of the coding sequence in response to the presence or absence of one or more transcriptional regulatory factors. A transcriptional regulatory sequence is generally operatively linked in cis with a coding sequence, but need not be directly adjacent to it. For example, an enhancer is a transcriptional regulatory sequence that is operatively linked to a coding sequence, even though they are not contiguous.
(51) With respect to fusion polypeptides, the term operatively linked can refer to the fact that each of the components performs the same function in linkage to the other component as it would if it were not so linked. For example, with respect to a fusion polypeptide in which a ZFP DNA-binding domain is fused to an activation domain, the ZFP DNA-binding domain and the activation domain are in operative linkage if, in the fusion polypeptide, the ZFP DNA-binding domain portion is able to bind its target site and/or its binding site, while the activation domain is able to up-regulate gene expression. When a fusion polypeptide in which a ZFP DNA-binding domain is fused to a cleavage domain, the ZFP DNA-binding domain and the cleavage domain are in operative linkage if, in the fusion polypeptide, the ZFP DNA-binding domain portion is able to bind its target site and/or its binding site, while the cleavage domain is able to cleave DNA in the vicinity of the target site.
(52) A functional fragment of a protein, polypeptide or nucleic acid is a protein, polypeptide or nucleic acid whose sequence is not identical to the full-length protein, polypeptide or nucleic acid, yet retains the same function as the full-length protein, polypeptide or nucleic acid. A functional fragment can possess more, fewer, or the same number of residues as the corresponding native molecule, and/or can contain one ore more amino acid or nucleotide substitutions. Methods for determining the function of a nucleic acid (e.g., coding function, ability to hybridize to another nucleic acid) are well-known in the art. Similarly, methods for determining protein function are well-known. For example, the DNA-binding function of a polypeptide can be determined, for example, by filter-binding, electrophoretic mobility-shift, or immunoprecipitation assays. DNA cleavage can be assayed by gel electrophoresis. See Ausubel et al., supra. The ability of a protein to interact with another protein can be determined, for example, by co-immunoprecipitation, two-hybrid assays or complementation, both genetic and biochemical. See, for example, Fields et al. (1989) Nature 340:245-246; U.S. Pat. No. 5,585,245 and PCT WO 98/44350.
(53) A vector is capable of transferring gene sequences to target cells. Typically, vector construct, expression vector, and gene transfer vector, mean any nucleic acid construct capable of directing the expression of a gene of interest and which can transfer gene sequences to target cells. Thus, the term includes cloning, and expression vehicles, as well as integrating vectors.
(54) A reporter gene or reporter sequence refers to any sequence that produces a protein product that is easily measured, preferably although not necessarily in a routine assay. Suitable reporter genes include, but are not limited to, sequences encoding proteins that mediate antibiotic resistance (e.g., ampicillin resistance, neomycin resistance, G418 resistance, puromycin resistance), sequences encoding colored or fluorescent or luminescent proteins (e.g., green fluorescent protein, enhanced green fluorescent protein, red fluorescent protein, luciferase), and proteins which mediate enhanced cell growth and/or gene amplification (e.g., dihydrofolate reductase). Epitope tags include, for example, one or more copies of FLAG, His, myc, Tap, HA or any detectable amino acid sequence. Expression tags include sequences that encode reporters that may be operably linked to a desired gene sequence in order to monitor expression of the gene of interest.
(55) Nucleases
(56) Described herein are compositions, particularly nucleases, which are useful in integration of a peptide fusion inhibitor into a cell surface receptor (e.g., viral receptor) or disruption of the cell surface receptor to inhibit entry of macromolecules that bind to the cell surface receptor. In certain embodiments, the nuclease is naturally occurring. In other embodiments, the nuclease is non-naturally occurring, i.e., engineered in the DNA-binding domain and/or cleavage domain. For example, the DNA-binding domain of a naturally-occurring nuclease may be altered to bind to a selected target site (e.g., a meganuclease that has been engineered to bind to site different than the cognate binding site). In other embodiments, the nuclease comprises heterologous DNA-binding and cleavage domains (e.g., zinc finger nucleases; TAL-effector domain DNA binding proteins; meganuclease DNA-binding domains with heterologous cleavage domains).
(57) A. DNA-Binding Domains
(58) In certain embodiments, the nuclease is a meganuclease (homing endonuclease). Naturally-occurring meganucleases recognize 15-40 base-pair cleavage sites and are commonly grouped into four families: the LAGLIDADG (SEQ ID NO: 22) family, the GIY-YIG family, the His-Cyst box family and the HNH family. Exemplary homing endonucleases include I-SceI, I-CeuI, PI-PspI, PI-Sce, I-SceIV, I-CsmI, I-PanI, I-SceII, I-PpoI, I-SceIII, I-CreI, I-TevI, I-TevII and I-TevIII. Their recognition sequences are known. See also U.S. Pat. No. 5,420,032; U.S. Pat. No. 6,833,252; Belfort et al. (1997) Nucleic Acids Res. 25:3379-3388; Dujon et al. (1989) Gene 82:115-118; Perler et al. (1994) Nucleic Acids Res. 22, 1125-1127; Jasin (1996) Trends Genet. 12:224-228; Gimble et al. (1996) J. Mol. Biol. 263:163-180; Argast et al. (1998) J. Mol. Biol. 280:345-353 and the New England Biolabs catalogue.
(59) In certain embodiments, the nuclease comprises an engineered (non-naturally occurring) homing endonuclease (meganuclease). The recognition sequences of homing endonucleases and meganucleases such as I-SceI, I-CeuI, PI-PspI, PI-Sce, I-SceIV, I-CsmI, I-PanI, I-SceII, I-PpoI, I-SceIII, I-CreI, I-TevI, I-TevII and I-TevIII are known. See also U.S. Pat. No. 5,420,032; U.S. Pat. No. 6,833,252; Belfort et al. (1997) Nucleic Acids Res. 25:3379-3388; Dujon et al. (1989) Gene 82:115-118; Perler et al. (1994) Nucleic Acids Res. 22, 1125-1127; Jasin (1996) Trends Genet. 12:224-228; Gimble et al. (1996) J Mol. Biol. 263:163-180; Argast et al. (1998) J Mol. Biol. 280:345-353 and the New England Biolabs catalogue. In addition, the DNA-binding specificity of homing endonucleases and meganucleases can be engineered to bind non-natural target sites. See, for example, Chevalier et al. (2002) Molec. Cell 10:895-905; Epinat et al. (2003) Nucleic Acids Res. 31:2952-2962; Ashworth et al. (2006) Nature 441:656-659; Paques et al. (2007) Current Gene Therapy 7:49-66; U.S. Patent Publication No. 20070117128. The DNA-binding domains of the homing endonucleases and meganucleases may be altered in the context of the nuclease as a whole (i.e., such that the nuclease includes the cognate cleavage domain) or may be fused to a heterologous cleavage domain.
(60) In other embodiments, the DNA-binding domain comprises a naturally occurring or engineered (non-naturally occurring) TAL effector DNA binding domain. The plant pathogenic bacteria of the genus Xanthomonas are known to cause many diseases in important crop plants. Pathogenicity of Xanthomonas depends on a conserved type III secretion (T3S) system which injects more than 25 different effector proteins into the plant cell. See, e.g., U.S. Publication No. 20110301073. Among these injected proteins are transcription activator-like (TAL) effectors which mimic plant transcriptional activators and manipulate the plant transcriptome (see Kay et al (2007) Science 318:648-651). These proteins contain a DNA binding domain and a transcriptional activation domain. One of the most well characterized TAL-effectors is AvrBs3 from Xanthomonas campestgris pv. Vesicatoria (see Bonas et al (1989) Mol Gen Genet 218: 127-136 and WO2010079430). TAL-effectors contain a centralized domain of tandem repeats, each repeat containing approximately 34 amino acids, which are key to the DNA binding specificity of these proteins. In addition, they contain a nuclear localization sequence and an acidic transcriptional activation domain (for a review see Schornack S, et al (2006) J Plant Physiol 163(3): 256-272). In addition, in the phytopathogenic bacteria Ralstonia solanacearum two genes, designated brg11 and hpx17 have been found that are homologous to the AvrBs3 family of Xanthomonas in the R. solanacearum biovar 1 strain GMI1000 and in the biovar 4 strain RS1000 (See Heuer et al (2007) Appl and Envir Micro 73(13): 4379-4384). These genes are 98.9% identical in nucleotide sequence to each other but differ by a deletion of 1,575 bp in the repeat domain of hpx17. However, both gene products have less than 40% sequence identity with AvrBs3 family proteins of Xanthomonas.
(61) Specificity of these TAL effectors depends on the sequences found in the tandem repeats. The repeated sequence comprises approximately 102 bp and the repeats are typically 91-100% homologous with each other (Bonas et al, ibid). Polymorphism of the repeats is usually located at positions 12 and 13 and there appears to be a one-to-one correspondence between the identity of the hypervariable diresidues at positions 12 and 13 with the identity of the contiguous nucleotides in the TAL-effector's target sequence (see Moscou and Bogdanove, (2009) Science 326:1501 and Boch et al (2009) Science 326:1509-1512). Experimentally, the code for DNA recognition of these TAL-effectors has been determined such that an HD sequence at positions 12 and 13 leads to a binding to cytosine (C), NG binds to T, NI to A, C, G or T, NN binds to A or G, and IG binds to T. These DNA binding repeats have been assembled into proteins with new combinations and numbers of repeats, to make artificial transcription factors that are able to interact with new sequences and activate the expression of a non-endogenous reporter gene in plant cells (Boch et al, ibid). Engineered TAL proteins have been linked to a FokI cleavage half domain to yield a TAL effector domain nuclease fusion (TALEN) exhibiting activity in a yeast reporter assay (plasmid based target). Christian et al ((2010)<Genetics epub 10.1534/genetics. 110.120717). See, also, U.S. Publication No. 20110301073.
(62) In certain embodiments, the DNA binding domain comprises a zinc finger protein. Preferably, the zinc finger protein is non-naturally occurring in that it is engineered to bind to a target site of choice. See, for example, Beerli et al. (2002) Nature Biotechnol. 20:135-141; Pabo et al. (2001) Ann. Rev. Biochem. 70:313-340; Isalan et al. (2001) Nature Biotechnol. 19:656-660; Segal et al. (2001) Curr. Opin. Biotechnol. 12:632-637; Choo et al. (2000) Curr. Opin. Struct. Biol. 10:411-416; U.S. Pat. Nos. 6,453,242; 6,534,261; 6,599,692; 6,503,717; 6,689,558; 7,030,215; 6,794,136; 7,067,317; 7,262,054; 7,070,934; 7,361,635; 7,253,273; and U.S. Patent Publication Nos. 2005/0064474; 2007/0218528; 2005/0267061, all incorporated herein by reference in their entireties.
(63) An engineered zinc finger binding domain can have a novel binding specificity, compared to a naturally-occurring zinc finger protein. Engineering methods include, but are not limited to, rational design and various types of selection. Rational design includes, for example, using databases comprising triplet (or quadruplet) nucleotide sequences and individual zinc finger amino acid sequences, in which each triplet or quadruplet nucleotide sequence is associated with one or more amino acid sequences of zinc fingers which bind the particular triplet or quadruplet sequence. See, for example, co-owned U.S. Pat. Nos. 6,453,242 and 6,534,261, incorporated by reference herein in their entireties.
(64) Exemplary selection methods, including phage display and two-hybrid systems, are disclosed in U.S. Pat. Nos. 5,789,538; 5,925,523; 6,007,988; 6,013,453; 6,410,248; 6,140,466; 6,200,759; and 6,242,568; as well as WO 98/37186; WO 98/53057; WO 00/27878; WO 01/88197 and GB 2,338,237. In addition, enhancement of binding specificity for zinc finger binding domains has been described, for example, in co-owned WO 02/077227.
(65) In addition, as disclosed in these and other references, DNA domains (e.g., multi-fingered zinc finger proteins) may be linked together using any suitable linker sequences, including for example, linkers of 5 or more amino acids in length. See, also, U.S. Pat. Nos. 6,479,626; 6,903,185; and 7,153,949 for exemplary linker sequences 6 or more amino acids in length. The zinc finger proteins described herein may include any combination of suitable linkers between the individual zinc fingers of the protein. In addition, enhancement of binding specificity for zinc finger binding domains has been described, for example, in co-owned WO 02/077227.
(66) Selection of target sites; ZFPs and methods for design and construction of fusion proteins (and polynucleotides encoding same) are known to those of skill in the art and described in detail in U.S. Pat. Nos. 6,140,081; 5,789,538; 6,453,242; 6,534,261; 5,925,523; 6,007,988; 6,013,453; 6,200,759; WO 95/19431; WO 96/06166; WO 98/53057; WO 98/54311; WO 00/27878; WO 01/60970 WO 01/88197; WO 02/099084; WO 98/53058; WO 98/53059; WO 98/53060; WO 02/016536 and WO 03/016496.
(67) In addition, as disclosed in these and other references, zinc finger domains and/or multi-fingered zinc finger proteins may be linked together using any suitable linker sequences, including for example, linkers of 5 or more amino acids in length. See, also, U.S. Pat. Nos. 6,479,626; 6,903,185; and 7,153,949 for exemplary linker sequences 6 or more amino acids in length. The proteins described herein may include any combination of suitable linkers between the individual zinc fingers of the protein.
(68) B. Cleavage Domains
(69) Any suitable cleavage domain can be operatively linked to a DNA-binding domain to form a nuclease. For example, ZFP DNA-binding domains have been fused to nuclease domains to create ZFNsa functional entity that is able to recognize its intended nucleic acid target through its engineered (ZFP) DNA binding domain and cause the DNA to be cut near the ZFP binding site via the nuclease activity. See, e.g., Kim et al. (1996) Proc Nat'l Acad Sci USA 93(3):1156-1160. More recently, ZFNs have been used for genome modification in a variety of organisms. See, for example, United States Patent Publications 20030232410; 20050208489; 20050026157; 20050064474; 20060188987; 20060063231; and International Publication WO 07/014275.
(70) As noted above, the cleavage domain may be heterologous to the DNA-binding domain, for example a zinc finger DNA-binding domain and a cleavage domain from a nuclease or a TALEN DNA-binding domain and a cleavage domain, or meganuclease DNA-binding domain and cleavage domain from a different nuclease. Heterologous cleavage domains can be obtained from any endonuclease or exonuclease. Exemplary endonucleases from which a cleavage domain can be derived include, but are not limited to, restriction endonucleases and homing endonucleases. See, for example, 2002-2003 Catalogue, New England Biolabs, Beverly, Mass.; and Belfort et al. (1997) Nucleic Acids Res. 25:3379-3388. Additional enzymes which cleave DNA are known (e.g., S1 Nuclease; mung bean nuclease; pancreatic DNase I; micrococcal nuclease; yeast HO endonuclease; see also Linn et al. (eds.) Nucleases, Cold Spring Harbor Laboratory Press, 1993). One or more of these enzymes (or functional fragments thereof) can be used as a source of cleavage domains and cleavage half-domains.
(71) Similarly, a cleavage half-domain can be derived from any nuclease or portion thereof, as set forth above, that requires dimerization for cleavage activity. In general, two fusion proteins are required for cleavage if the fusion proteins comprise cleavage half-domains. Alternatively, a single protein comprising two cleavage half-domains can be used. The two cleavage half-domains can be derived from the same endonuclease (or functional fragments thereof), or each cleavage half-domain can be derived from a different endonuclease (or functional fragments thereof). In addition, the target sites for the two fusion proteins are preferably disposed, with respect to each other, such that binding of the two fusion proteins to their respective target sites places the cleavage half-domains in a spatial orientation to each other that allows the cleavage half-domains to form a functional cleavage domain, e.g., by dimerizing. Thus, in certain embodiments, the near edges of the target sites are separated by 5-8 nucleotides or by 15-18 nucleotides. However any integral number of nucleotides or nucleotide pairs can intervene between two target sites (e.g., from 2 to 50 nucleotide pairs or more). In general, the site of cleavage lies between the target sites.
(72) Restriction endonucleases (restriction enzymes) are present in many species and are capable of sequence-specific binding to DNA (at a recognition site), and cleaving DNA at or near the site of binding. Certain restriction enzymes (e.g., Type IIS) cleave DNA at sites removed from the recognition site and have separable binding and cleavage domains. For example, the Type IIS enzyme Fok I catalyzes double-stranded cleavage of DNA, at 9 nucleotides from its recognition site on one strand and 13 nucleotides from its recognition site on the other. See, for example, U.S. Pat. Nos. 5,356,802; 5,436,150 and 5,487,994; as well as Li et al. (1992) Proc. Natl. Acad. Sci. USA 89:4275-4279; Li et al. (1993) Proc. Natl. Acad. Sci. USA 90:2764-2768; Kim et al. (1994a) Proc. Natl. Acad. Sci. USA 91:883-887; Kim et al. (1994b) J. Biol. Chem. 269:31,978-31,982. Thus, in one embodiment, fusion proteins comprise the cleavage domain (or cleavage half-domain) from at least one Type IIS restriction enzyme and one or more zinc finger binding domains, which may or may not be engineered.
(73) An exemplary Type IIS restriction enzyme, whose cleavage domain is separable from the binding domain, is Fok I. This particular enzyme is active as a dimer. Bitinaite et al. (1998) Proc. Natl. Acad. Sci. USA 95: 10,570-10,575. Accordingly, for the purposes of the present disclosure, the portion of the Fok I enzyme used in the disclosed fusion proteins is considered a cleavage half-domain. Thus, for targeted double-stranded cleavage and/or targeted replacement of cellular sequences using zinc finger-Fok I fusions, two fusion proteins, each comprising a FokI cleavage half-domain, can be used to reconstitute a catalytically active cleavage domain. Alternatively, a single polypeptide molecule containing a DNA binding domain and two Fok I cleavage half-domains can also be used.
(74) A cleavage domain or cleavage half-domain can be any portion of a protein that retains cleavage activity, or that retains the ability to multimerize (e.g., dimerize) to form a functional cleavage domain.
(75) Exemplary Type IIS restriction enzymes are described in International Publication WO 07/014275, incorporated herein in its entirety. Additional restriction enzymes also contain separable binding and cleavage domains, and these are contemplated by the present disclosure. See, for example, Roberts et al. (2003) Nucleic Acids Res. 31:418-420.
(76) In certain embodiments, the cleavage domain comprises one or more engineered cleavage half-domain (also referred to as dimerization domain mutants) that minimize or prevent homodimerization, as described, for example, in U.S. Patent Publication Nos. 20050064474; 20060188987 and 20080131962, the disclosures of all of which are incorporated by reference in their entireties herein. Amino acid residues at positions 446, 447, 479, 483, 484, 486, 487, 490, 491, 496, 498, 499, 500, 531, 534, 537, and 538 of Fok I are all targets for influencing dimerization of the Fok I cleavage half-domains.
(77) Exemplary engineered cleavage half-domains of Fok I that form obligate heterodimers include a pair in which a first cleavage half-domain includes mutations at amino acid residues at positions 490 and 538 of Fok I and a second cleavage half-domain includes mutations at amino acid residues 486 and 499.
(78) Thus, in one embodiment, a mutation at 490 replaces Glu (E) with Lys (K); the mutation at 538 replaces Iso (I) with Lys (K); the mutation at 486 replaced Gln (Q) with Glu (E); and the mutation at position 499 replaces Iso (I) with Lys (K). Specifically, the engineered cleavage half-domains described herein were prepared by mutating positions 490 (E.fwdarw.K) and 538 (I.fwdarw.K) in one cleavage half-domain to produce an engineered cleavage half-domain designated E490K:I538K and by mutating positions 486 (Q.fwdarw.E) and 499 (I.fwdarw.L) in another cleavage half-domain to produce an engineered cleavage half-domain designated Q486E:I499L. The engineered cleavage half-domains described herein are obligate heterodimer mutants in which aberrant cleavage is minimized or abolished. See, e.g., U.S. Patent Publication No. 2008/0131962, the disclosure of which is incorporated by reference in its entirety for all purposes. In certain embodiments, the engineered cleavage half-domain comprises mutations at positions 486, 499 and 496 (numbered relative to wild-type Fold), for instance mutations that replace the wild type Gln (Q) residue at position 486 with a Glu (E) residue, the wild type Iso (I) residue at position 499 with a Leu (L) residue and the wild-type Asn (N) residue at position 496 with an Asp (D) or Glu (E) residue (also referred to as a ELD and ELE domains, respectively). In other embodiments, the engineered cleavage half-domain comprises mutations at positions 490, 538 and 537 (numbered relative to wild-type Fold), for instance mutations that replace the wild type Glu (E) residue at position 490 with a Lys (K) residue, the wild type Iso (I) residue at position 538 with a Lys (K) residue, and the wild-type His (H) residue at position 537 with a Lys (K) residue or a Arg (R) residue (also referred to as KKK and KKR domains, respectively). In other embodiments, the engineered cleavage half-domain comprises mutations at positions 490 and 537 (numbered relative to wild-type FokI), for instance mutations that replace the wild type Glu (E) residue at position 490 with a Lys (K) residue and the wild-type His (H) residue at position 537 with a Lys (K) residue or a Arg (R) residue (also referred to as KIK and KIR domains, respectively). (See U.S. Patent Publication No. 20110201055).
(79) Engineered cleavage half-domains described herein can be prepared using any suitable method, for example, by site-directed mutagenesis of wild-type cleavage half-domains (Fok I) as described in U.S. Patent Publication Nos. 20050064474; 20080131962 and 20110201055).
(80) Alternatively, nucleases may be assembled in vivo at the nucleic acid target site using so-called split-enzyme technology (see e.g. U.S. Patent Publication No. 20090068164). Components of such split enzymes may be expressed either on separate expression constructs, or can be linked in one open reading frame where the individual components are separated, for example, by a self-cleaving 2A peptide or IRES sequence. Components may be individual zinc finger binding domains or domains of a meganuclease nucleic acid binding domain.
(81) Nucleases can be screened for activity prior to use, for example in a yeast-based chromosomal system as described in WO 2009/042163 and 20090068164. Nuclease expression constructs can be readily designed using methods known in the art. See, e.g., United States Patent Publications 20030232410; 20050208489; 20050026157; 20050064474; 20060188987; 20060063231; and International Publication WO 07/014275. Expression of the nuclease may be under the control of a constitutive promoter or an inducible promoter, for example the galactokinase promoter which is activated (de-repressed) in the presence of raffinose and/or galactose and repressed in presence of glucose.
(82) Target Sites
(83) As described in detail above, DNA domains can be engineered to bind to any sequence of choice. An engineered DNA-binding domain can have a novel binding specificity, compared to a naturally-occurring DNA-binding domain. Engineering methods include, but are not limited to, rational design and various types of selection. Rational design includes, for example, using databases comprising triplet (or quadruplet) nucleotide sequences and individual (e.g., zinc finger) amino acid sequences, in which each triplet or quadruplet nucleotide sequence is associated with one or more amino acid sequences of DNA binding domain which bind the particular triplet or quadruplet sequence. See, for example, co-owned U.S. Pat. Nos. 6,453,242 and 6,534,261, incorporated by reference herein in their entireties. Rational design of TAL-effector domains can also be performed. See, e.g., U.S. Publication No. 20110301073.
(84) Exemplary selection methods applicable to DNA-binding domains, including phage display and two-hybrid systems, are disclosed in U.S. Pat. Nos. 5,789,538; 5,925,523; 6,007,988; 6,013,453; 6,410,248; 6,140,466; 6,200,759; and 6,242,568; as well as WO 98/37186; WO 98/53057; WO 00/27878; WO 01/88197 and GB 2,338,237.
(85) Selection of target sites; nucleases and methods for design and construction of fusion proteins (and polynucleotides encoding same) are known to those of skill in the art and described in detail in U.S. Patent Application Publication Nos. 20050064474 and 20060188987, incorporated by reference in their entireties herein.
(86) In addition, as disclosed in these and other references, DNA-binding domains (e.g., multi-fingered zinc finger proteins) may be linked together using any suitable linker sequences, including for example, linkers of 5 or more amino acids. See, e.g., U.S. Pat. Nos. 6,479,626; 6,903,185; and 7,153,949 for exemplary linker sequences 6 or more amino acids in length. The proteins described herein may include any combination of suitable linkers between the individual DNA-binding domains of the protein. See, also, U.S. Publication No. 20110301073.
(87) For anti-HIV therapies, a peptide fusion inhibitor can be integrated (via nucleases) into any cell surface protein. DNA-binding domains of the nucleases may be targeted to any desired site in the genome. The sequence encoding the peptide fusion inhibitor can be integrated anywhere in cell surface gene, for example at the C-terminal or N-terminal end. Multiple copies may be integrated at the same or different locations. In certain embodiments, the peptide fusion inhibitor is integrated into a locus encoding an HIV receptor or co-receptor (e.g., CXCR4, CCR5, etc.). Non-limiting examples of other cell surface proteins include additional HIV coreceptors such as CCR2b, CCR3, CCR8, CX3CR1/GPR13, CXCR6/CD186/Bonzo/STRL33, CXCR7/RDC1, D6/CCBP2, GPR1, GPR15 (Gabuzda and Wang (2000) J Neurovirol 6 Suppl 1: S24-43), (Lusso (2006), EMBO J. 25(3):447-456).
(88) Peptide Fusion Inhibitors
(89) For inhibition of virus entry into a cell mediated by a cell surface receptor, the integrated (donor) sequence encodes any functional peptide fusion inhibitor. The peptide fusion inhibitor integrated into cell surface receptor gene can be naturally occurring, a portion of a naturally occurring peptide or synthetic. Non-limiting examples of suitable peptide fusion inhibitions include C-HR based peptides (such as C34, C34M3, C42, C43, CP32M, CP621-652, DP, DP-C8-C16, SC34EK, SC29EK, sifuvirtide, T-20, T649, T1249, T2544, and T2635) and N-HR based peptides (such as N36, T21, N42, N36F10, and IZN17) See, e.g., Naider and Anglister (2009), Curr Opin Struct Biol 19(4):473-482, Naito et al. (2009) Antimicrobial Agents and Chemotherapy 53(3):1013-1018; Gupta et al. (2006) Retrovirology 2006; 3(Suppl 1):S86; Munoz-Barroso et al. (1998) J Cell Biol 140:315-323; Rockstroh et al. (2004) J Antimicrob Chemother 53:700-702; Liu et at (2005) J Biol Chem 280:11259-11273; Wexler-Cohen et al. (2009) PLoS Pathog 5, e1000509; Stoddart et al. (2008) J Biol Chem 283:34045-34052.
(90) As noted above, in some embodiments, the sequence encoding the peptide fusion inhibitor is integrated into the genome of the cell such that it is expressed with a viral receptor or co-receptor (e.g., at the N-terminus of the viral receptor or co-receptor) as a fusion protein. In other embodiments, the sequence integrated into the genome encodes a fusion protein comprising the peptide fusion inhibitor and a viral receptor or co-receptor.
(91) The peptide fusion inhibitor donor sequence can be introduced into the cell prior to, concurrently with, or subsequent to, expression of the nucleases(s). The donor polynucleotide carrying the peptide fusion inhibitor typically contains sufficient homology to a genomic sequence to support homologous recombination (or homology-directed repair) between it and the genomic sequence to which it bears homology. See, e.g., U.S. Patent Publication Nos. 2005/0064474; 2007/0134796 and 2009/0263900.
(92) It will be readily apparent that the donor sequence is typically not identical to the genomic sequence that it replaces. For example, the sequence of the donor polynucleotide can contain one or more single base changes, insertions, deletions, inversions or rearrangements with respect to the genomic sequence, so long as sufficient homology with chromosomal sequences is present. Alternatively, a donor sequence can contain a non-homologous sequence flanked by two regions of homology. Alternatively, a donor sequence can be a non-homologous sequence that is integrated by end capture during non-homologous end joining (NHEJ) driven by the introduction of a double strand break by an engineered nuclease. Additionally, donor sequences can comprise a vector molecule containing sequences that are not homologous to the region of interest in cellular chromatin. A donor molecule can contain several, discontinuous regions of homology to cellular chromatin. For example, for targeted insertion of sequences not normally present in a region of interest, said sequences can be present in a donor nucleic acid molecule and flanked by regions of homology to sequence in the region of interest.
(93) The donor polynucleotide can be DNA or RNA, single-stranded or double-stranded and can be introduced into a cell in linear or circular form. If introduced in linear form, the ends of the donor sequence can be protected (e.g., from exonucleolytic degradation) by methods known to those of skill in the art. For example, one or more dideoxynucleotide residues are added to the 3 terminus of a linear molecule and/or self-complementary oligonucleotides are ligated to one or both ends. See, for example, Chang et al. (1987) Proc. Natl. Acad. Sci. USA 84:4959-4963; Nehls et al. (1996) Science 272:886-889. Additional methods for protecting exogenous polynucleotides from degradation include, but are not limited to, addition of terminal amino group(s) and the use of modified internucleotide linkages such as, for example, phosphorothioates, phosphoramidates, and O-methyl ribose or deoxyribose residues.
(94) A polynucleotide can be introduced into a cell as part of a vector molecule having additional sequences such as, for example, replication origins, promoters and genes encoding antibiotic resistance. Moreover, donor polynucleotides can be introduced as naked nucleic acid, as nucleic acid complexed with an agent such as a liposome or poloxamer, or can be delivered by viruses (e.g., adenovirus, AAV, herpesvirus, retrovirus, lentivirus and integrase defective lentivirus (IDLV)).
(95) The donor is generally inserted so that its expression is driven by the endogenous promoter at the integration site, namely the promoter that drives expression of the cell surface receptor with which the peptide fusion inhibitor is expressed. However, it will be apparent that the donor may comprise a promoter and/or enhancer, for example a constitutive promoter or an inducible or tissue specific promoter that drives expression of the function peptide fusion inhibitor upon integration.
(96) Furthermore, although not required for expression, exogenous sequences may also be transcriptional or translational regulatory sequences, for example, promoters, enhancers, insulators, internal ribosome entry sites, sequences encoding 2A peptides and/or polyadenylation signals.
(97) Delivery
(98) The nucleases, polynucleotides encoding these nucleases, donor polynucleotides and compositions comprising the proteins and/or polynucleotides described herein may be delivered in vivo or ex vivo by any suitable means.
(99) Methods of delivering nucleases as described herein are described, for example, in U.S. Pat. Nos. 6,453,242; 6,503,717; 6,534,261; 6,599,692; 6,607,882; 6,689,558; 6,824,978; 6,933,113; 6,979,539; 7,013,219; and 7,163,824, the disclosures of all of which are incorporated by reference herein in their entireties.
(100) Nucleases and/or donor constructs as described herein may also be delivered using vectors containing sequences encoding one or more of the DNA binding protein(s). Any vector systems may be used including, but not limited to, plasmid vectors, retroviral vectors, lentiviral vectors, adenovirus vectors, poxvirus vectors; herpesvirus vectors and adeno-associated virus vectors, etc. See, also, U.S. Pat. Nos. 6,534,261; 6,607,882; 6,824,978; 6,933,113; 6,979,539; 7,013,219; and 7,163,824, incorporated by reference herein in their entireties. Furthermore, it will be apparent that any of these vectors may comprise one or more of the sequences needed for treatment. Thus, when one or more nucleases and a donor construct are introduced into the cell, the nucleases and/or donor polynucleotide may be carried on the same vector or on different vectors. When multiple vectors are used, each vector may comprise a sequence encoding one or multiple nucleases and/or donor constructs.
(101) Conventional viral and non-viral based gene transfer methods can be used to introduce nucleic acids encoding nucleases and donor constructs in cells (e.g., mammalian cells) and target tissues. Non-viral vector delivery systems include DNA plasmids, naked nucleic acid, and nucleic acid complexed with a delivery vehicle such as a liposome or poloxamer. Viral vector delivery systems include DNA and RNA viruses, which have either episomal or integrated genomes after delivery to the cell. For a review of gene therapy procedures, see Anderson, Science 256:808-813 (1992); Nabel & Feigner, TIBTECH 11:211-217 (1993); Mitani & Caskey, TIBTECH 11:162-166 (1993); Dillon, TIBTECH 11:167-175 (1993); Miller, Nature 357:455-460 (1992); Van Brunt, Biotechnology 6(10):1149-1154 (1988); Vigne, Restorative Neurology and Neuroscience 8:35-36 (1995); Kremer & Perricaudet, British Medical Bulletin 51(1):31-44 (1995); Haddada et al., in Current Topics in Microbiology and Immunology Doerfler and Bhm (eds.) (1995); and Yu et al., Gene Therapy 1:13-26 (1994).
(102) Methods of non-viral delivery of nucleic acids include electroporation, lipofection, microinjection, biolistics, virosomes, liposomes, immunoliposomes, polycation or lipid:nucleic acid conjugates, naked DNA, artificial virions, and agent-enhanced uptake of DNA. Sonoporation using, e.g., the Sonitron 2000 system (Rich-Mar) can also be used for delivery of nucleic acids.
(103) Additional exemplary nucleic acid delivery systems include those provided by Amaxa Biosystems (Cologne, Germany), Maxcyte, Inc. (Rockville, Md.), BTX Molecular Delivery Systems (Holliston, Mass.) and Copernicus Therapeutics Inc, (see for example U.S. Pat. No. 6,008,336). Lipofection is described in e.g., U.S. Pat. Nos. 5,049,386; 4,946,787; and 4,897,355) and lipofection reagents are sold commercially (e.g., Transfectam and Lipofectin). Cationic and neutral lipids that are suitable for efficient receptor-recognition lipofection of polynucleotides include those of Feigner, WO 91/17424, WO 91/16024.
(104) The preparation of lipid:nucleic acid complexes, including targeted liposomes such as immunolipid complexes, is well known to one of skill in the art (see, e.g., Crystal, Science 270:404-410 (1995); Blaese et al., Cancer Gene Ther. 2:291-297 (1995); Behr et al., Bioconjugate Chem. 5:382-389 (1994); Remy et al., Bioconjugate Chem. 5:647-654 (1994); Gao et al., Gene Therapy 2:710-722 (1995); Ahmad et al., Cancer Res. 52:4817-4820 (1992); U.S. Pat. Nos. 4,186,183, 4,217,344, 4,235,871, 4,261,975, 4,485,054, 4,501,728, 4,774,085, 4,837,028, and 4,946,787).
(105) Additional methods of delivery include the use of packaging the nucleic acids to be delivered into EnGeneIC delivery vehicles (EDVs). These EDVs are specifically delivered to target tissues using bispecific antibodies where one arm of the antibody has specificity for the target tissue and the other has specificity for the EDV. The antibody brings the EDVs to the target cell surface and then the EDV is brought into the cell by endocytosis. Once in the cell, the contents are released (see MacDiarmid et al (2009) Nature Biotechnology 27(7):643).
(106) The use of RNA or DNA viral based systems for the delivery of nucleic acids (e.g., nucleic acids encoding engineered nucleases or for donor molecules) take advantage of highly evolved processes for targeting a virus to specific cells in the body and trafficking the viral payload to the nucleus. Viral vectors can be administered directly to patients (in vivo) or they can be used to treat cells in vitro and the modified cells are administered to patients (ex vivo). Conventional viral based systems for the delivery of ZFPs include, but are not limited to, retroviral, lentivirus, adenoviral, adeno-associated, vaccinia and herpes simplex virus vectors for gene transfer. Integration in the host genome is possible with the retrovirus, lentivirus, and adeno-associated virus gene transfer methods, often resulting in long term expression of the inserted transgene. Additionally, high transduction efficiencies have been observed in many different cell types and target tissues.
(107) The tropism of a retrovirus can be altered by incorporating foreign envelope proteins, expanding the potential target population of target cells. Lentiviral vectors are retroviral vectors that are able to transduce or infect non-dividing cells and typically produce high viral titers. Selection of a retroviral gene transfer system depends on the target tissue. Retroviral vectors are comprised of cis-acting long terminal repeats with packaging capacity for up to 6-10 kb of foreign sequence. The minimum cis-acting LTRs are sufficient for replication and packaging of the vectors, which are then used to integrate the therapeutic gene into the target cell to provide permanent transgene expression. Widely used retroviral vectors include those based upon murine leukemia virus (MuLV), gibbon ape leukemia virus (GaLV), Simian Immunodeficiency virus (SIV), human immunodeficiency virus (HIV), and combinations thereof (see, e.g., Buchscher et al., J. Virol. 66:2731-2739 (1992); Johann et al. J. Virol. 66:1635-1640 (1992); Sommerfelt et al. Virol. 176:58-59 (1990); Wilson et al. J. Virol. 63:2374-2378 (1989); Miller et al., J Virol. 65:2220-2224 (1991); PCT/US94/05700).
(108) In applications in which transient expression is preferred, adenoviral based systems can be used. Adenoviral based vectors are capable of very high transduction efficiency in many cell types and do not require cell division. With such vectors, high titer and high levels of expression have been obtained. This vector can be produced in large quantities in a relatively simple system. Adeno-associated virus (AAV) vectors are also used to transduce cells with target nucleic acids, e.g., in the in vitro production of nucleic acids and peptides, and for in vivo and ex vivo gene therapy procedures (see, e.g., West et al., Virology 160:38-47 (1987); U.S. Pat. No. 4,797,368; WO 93/24641; Kotin, Human Gene Therapy 5:793-801 (1994); Muzyczka, J. Clin. Invest. 94:1351 (1994). Construction of recombinant AAV vectors are described in a number of publications, including U.S. Pat. No. 5,173,414; Tratschin et al., Mol. Cell. Biol. 5:3251-3260 (1985); Tratschin, et al., Mol. Cell. Biol. 4:2072-2081 (1984); Hermonat & Muzyczka, PNAS 81:6466-6470 (1984); and Samulski et al., J. Virol. 63:03822-3828 (1989).
(109) At least six viral vector approaches are currently available for gene transfer in clinical trials, which utilize approaches that involve complementation of defective vectors by genes inserted into helper cell lines to generate the transducing agent.
(110) pLASN and MFG-S are examples of retroviral vectors that have been used in clinical trials (Dunbar et al., Blood 85:3048-305 (1995); Kohn et al., Nat. Med. 1:1017-102 (1995); Malech et al., PNAS 94:22 12133-12138 (1997)). PA317/pLASN was the first therapeutic vector used in a gene therapy trial. (Blaese et al., Science 270:475-480 (1995)). Transduction efficiencies of 50% or greater have been observed for MFG-S packaged vectors. (Ellem et al., Immunol Immunother. 44(1):10-20 (1997); Dranoff et al., Hum. Gene Ther. 1:111-2 (1997).
(111) Recombinant adeno-associated virus vectors (rAAV) are a promising alternative gene delivery systems based on the defective and nonpathogenic parvovirus adeno-associated type 2 virus. All vectors are derived from a plasmid that retains only the AAV 145 bp inverted terminal repeats flanking the transgene expression cassette. Efficient gene transfer and stable transgene delivery due to integration into the genomes of the transduced cell are key features for this vector system. (Wagner et al., Lancet 351:9117 1702-3 (1998), Kearns et al., Gene Ther. 9:748-55 (1996)). Other AAV serotypes, including AAV1, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9 and AAVrh.10 can also be used in accordance with the present invention.
(112) Replication-deficient recombinant adenoviral vectors (Ad) can be produced at high titer and readily infect a number of different cell types. Most adenovirus vectors are engineered such that a transgene replaces the Ad E1a, E1b, and/or E3 genes; subsequently the replication defective vector is propagated in human 293 cells that supply deleted gene function in trans. Ad vectors can transduce multiple types of tissues in vivo, including non-dividing, differentiated cells such as those found in liver, kidney and muscle. Conventional Ad vectors have a large carrying capacity. An example of the use of an Ad vector in a clinical trial involved polynucleotide therapy for anti-tumor immunization with intramuscular injection (Sterman et al., Hum. Gene Ther. 7:1083-9 (1998)). Additional examples of the use of adenovirus vectors for gene transfer in clinical trials include Rosenecker et al., Infection 24:1 5-10 (1996); Sterman et al., Hum. Gene Ther. 9:7 1083-1089 (1998); Welsh et al., Hum. Gene Ther. 2:205-18 (1995); Alvarez et al., Hum. Gene Ther. 5:597-613 (1997); Topf et al., Gene Ther. 5:507-513 (1998); Sterman et al., Hum. Gene Ther. 7:1083-1089 (1998).
(113) Packaging cells are used to form virus particles that are capable of infecting a host cell. Such cells include 293 cells, which package adenovirus, and 2 cells or PA317 cells, which package retrovirus. Viral vectors used in gene therapy are usually generated by a producer cell line that packages a nucleic acid vector into a viral particle. The vectors typically contain the minimal viral sequences required for packaging and subsequent integration into a host (if applicable), other viral sequences being replaced by an expression cassette encoding the protein to be expressed. The missing viral functions are supplied in trans by the packaging cell line. For example, AAV vectors used in gene therapy typically only possess inverted terminal repeat (ITR) sequences from the AAV genome which are required for packaging and integration into the host genome. Viral DNA is packaged in a cell line, which contains a helper plasmid encoding the other AAV genes, namely rep and cap, but lacking ITR sequences. The cell line is also infected with adenovirus as a helper. The helper virus promotes replication of the AAV vector and expression of AAV genes from the helper plasmid. The helper plasmid is not packaged in significant amounts due to a lack of ITR sequences. Contamination with adenovirus can be reduced by, e.g., heat treatment to which adenovirus is more sensitive than AAV.
(114) In many gene therapy applications, it is desirable that the gene therapy vector be delivered with a high degree of specificity to a particular tissue type. Accordingly, a viral vector can be modified to have specificity for a given cell type by expressing a ligand as a fusion protein with a viral coat protein on the outer surface of the virus. The ligand is chosen to have affinity for a receptor known to be present on the cell type of interest. For example, Han et al., Proc. Natl. Acad. Sci. USA 92:9747-9751 (1995), reported that Moloney murine leukemia virus can be modified to express human heregulin fused to gp70, and the recombinant virus infects certain human breast cancer cells expressing human epidermal growth factor receptor. This principle can be extended to other virus-target cell pairs, in which the target cell expresses a receptor and the virus expresses a fusion protein comprising a ligand for the cell-surface receptor. For example, filamentous phage can be engineered to display antibody fragments (e.g., FAB or Fv) having specific binding affinity for virtually any chosen cellular receptor. Although the above description applies primarily to viral vectors, the same principles can be applied to nonviral vectors. Such vectors can be engineered to contain specific uptake sequences which favor uptake by specific target cells.
(115) Gene therapy vectors can be delivered in vivo by administration to an individual patient, typically by systemic administration (e.g., intravenous, intraperitoneal, intramuscular, subdermal, or intracranial infusion) or topical application, as described below. Alternatively, vectors can be delivered to cells ex vivo, such as cells explanted from an individual patient (e.g., lymphocytes, bone marrow aspirates, tissue biopsy) or universal donor hematopoietic stem cells, followed by reimplantation of the cells into a patient, usually after selection for cells which have incorporated the vector.
(116) Vectors (e.g., retroviruses, adenoviruses, liposomes, etc.) containing nucleases and/or donor constructs can also be administered directly to an organism for transduction of cells in vivo. Alternatively, naked DNA can be administered. Administration is by any of the routes normally used for introducing a molecule into ultimate contact with blood or tissue cells including, but not limited to, injection, infusion, topical application and electroporation. Suitable methods of administering such nucleic acids are available and well known to those of skill in the art, and, although more than one route can be used to administer a particular composition, a particular route can often provide a more immediate and more effective reaction than another route.
(117) Vectors suitable for introduction of polynucleotides (nuclease-encoding and/or peptide fusion inhibitor-encoding) described herein include non-integrating lentivirus vectors (IDLV). See, for example, Ory et al. (1996) Proc. Natl. Acad. Sci. USA 93:11382-11388; Dull et al. (1998) J. Virol. 72:8463-8471; Zuffery et al. (1998) J. Virol. 72:9873-9880; Follenzi et al. (2000) Nature Genetics 25:217-222; WO 2009/054985.
(118) Pharmaceutically acceptable carriers are determined in part by the particular composition being administered, as well as by the particular method used to administer the composition. Accordingly, there is a wide variety of suitable formulations of pharmaceutical compositions available, as described below (see, e.g., Remington's Pharmaceutical Sciences, 17th ed., 1989).
(119) It will be apparent that the nuclease-encoding sequences and donor constructs can be delivered using the same or different systems. For example, a donor polynucleotide can be carried by a plasmid, while the one or more nucleases can be carried by a AAV vector. Furthermore, the different vectors can be administered by the same or different routes (intramuscular injection, tail vein injection, other intravenous injection, intraperitoneal administration and/or intramuscular injection. The vectors can be delivered simultaneously or in any sequential order.
(120) Thus, the instant disclosure includes in vivo or ex vivo treatment of viral diseases, via nuclease-mediated integration of peptide fusion inhibitor-encoding sequence. The sequence encoding the peptide fusion inhibitor is integrated so as to be expressed with a cell surface protein that mediates virus entry into the cell. Expression of the peptide fusion inhibitor with the cell surface protein blocks viral entry into the cell.
(121) The compositions are administered to a human patient in an amount effective to obtain the desired expression of the peptide fusion inhibitor with the cell surface receptor. Administration can be by any means in which the polynucleotides are delivered to the desired target cells. For example, both in vivo and ex vivo methods are contemplated. In vivo administration modes include, for example, injection (intravenously or intraperitoneally) or mucosal administration. Ex vivo modes of administration include transduction in vitro of any cell, for example, an induced pluripotent stem cell (iPSC), an embryonic stem cell, a hematopoietic stem/progenitor cell (e.g., CD34.sup.+ cells), a T-cell (e.g., CD4.sup.+ T-cell), a macrophage, a dendritic cell and an antigen-presenting cell, peripheral Blood Mononuclear Cells (PBMCs), microglia cells, monocytes, mesenchymal stem cells, or antigen-presenting cells; or a cell line such as K562 (chronic myelogenous leukemia), HEK293 (embryonic kidney), PM-1 (CD4.sup.+ T-cell), Sup-T1 (lymphoblastic leukemia), THP-1 (monocytic leukemia) or GHOST (osteosarcoma) cells.
(122) Formulations for both ex vivo and in vivo administrations include suspensions in liquid or emulsified liquids. The active ingredients often are mixed with excipients which are pharmaceutically acceptable and compatible with the active ingredient. Suitable excipients include, for example, water, saline, dextrose, glycerol, ethanol or the like, and combinations thereof. In addition, the composition may contain minor amounts of auxiliary substances, such as, wetting or emulsifying agents, pH buffering agents, stabilizing agents or other reagents that enhance the effectiveness of the pharmaceutical composition.
(123) The following Examples relate to exemplary embodiments of the present disclosure in which the nuclease comprises a zinc finger nuclease (ZFN). It will be appreciated that this is for purposes of exemplification only and that other nucleases can be used, for instance homing endonucleases (meganucleases) with engineered DNA-binding domains and/or fusions of naturally occurring of engineered homing endonucleases (meganucleases) DNA-binding domains and heterologous cleavage domains or TALENs.
EXAMPLES
Example 1
Disruption of Endogenous CXCR4 Gene and Reconstitution with a Sequence Encoding a Fusion Protein Composed of the Peptide Fusion Inhibitor C34 and CXCR4
(124) Endogenous CXCR4 gene was disrupted by ZFN-mediated genome editing, followed by re-introduction of a sequence encoding a fusion protein composed of C34 and CXCR4 (C34-CXCR4 or more specifically, C34-X4b as the predominantly transcribed/expressed form, isoform b of CXCR4 was used in these studies) to render the modified cells resistant to HIV infection but responsive to CXCL12 signaling through random integration of the gene encoding the C34-CXCR4 fusion. In particular, the CXCR4.sup./ SupT1 B4 cell line described in U.S. Patent Publication No. 20100291048 was used as the parental cell line to generate a C34-CXCR4 transfectant. One CXCR4 allele of the parental B4 SupT1 has a 12 bp deletion, the other CXCR4 allele has a 19 bp deletion in exon 2 (
(125) The parental CXCR4.sup./ B4 SupT1 cells were transduced with lentiviral constructs encoding either GFP, wild-type CXCR4 isoform B (X4b-WT), or C34-CXCR4 isoform B (C34-X4b) to generate stable cell lines. The amino acid sequence of C34-X4b is as follows, with the C34 sequence shown in straight underlining (SEQ ID NO:5) and the CXCR4 isoform B shown in bold with wavy underlining:
(126) TABLE-US-00001 (SEQIDNO:4)
(127) Surface expression of CXCR4 on the parental CXCR4.sup./ B4 SupT1 cells, and X4b-WT or C34-X4b transfectant was evaluated by flow cytometry analysis. Briefly, B4 SupT1 transfectants were incubated with isotype controls (mIgG1 and mIgG2a) or the anti-CXCR4 monoclonal antibodies 4G10 (Santa Cruz Biotechnology, Inc.), or 12G5 (BD Biosciences), washed, then incubated with PE-conjugated goat anti-mIgG. Cells were then washed again and analyzed with a Guava flow cytometer (Millipore). Results of the frequency (%) of positively stained cells and mean fluorescence intensity (MFI) of the antibody staining is shown in Table 1.
(128) TABLE-US-00002 TABLE 1 Surface CXCR4 expression on B4 SupT1 transfectants mIgG1 4G10 mIgG2a 12G5 (%) 4G10 (%) (MFI) (%) 12G5 (%) (MFI) Parent 0.08 1.9 21.08 0.46 0.24 4.09 X4b WT 0 96.07 494.91 0.98 95.84 214.48 C34-X4b 0 90.62 336.52 0.39 96.59 253.39
(129) Thus, the C34-X4b and X4b-WT transfectants have comparable levels of CXCR4 expression on their surface based on surface staining with 4G10 and 12G5 monoclonal antibodies, which recognize the N-terminus and the second extracellular loop of CXCR4, respectively.
(130) Alternatively, the C34-CXCR4 fusion is made by targeted integration of a C34 into a endogenous CXCR4 gene to produce the C34-CXCR4 fusion. In one approach, C34 is introduced at the N-terminus of the endogenous CXCR4 gene such that the expression of the C34-CXCR4 fusion is controlled by the endogenous CXCR4 promoter. ZFNs 28945 and 28947 are made to target the sequence (SEQ ID NO:10) shown below corresponding to the sequences encoding the N-terminus of the CXCR4 protein:
(131) TABLE-US-00003 5-28947 GATATACACTTCAGATAACTACACCGAGGAAATGGGCTCAGGGGACTAT -3 3- CTATATGTGAAGTCTATTGATGTGGCTCCTTTACCCGAGTCCCCTGATA 28945-5
(132) The characteristics of the CXCR4 specific ZFNs are shown below in Table 2 which displays the recognition helices for each of the fingers in the DNA binding domains and the target sites for the ZFNs.
(133) TABLE-US-00004 TABLE2 CXCR4-specificZFNs ZFNName target F1 F2 F3 F4 F5 ZFN28947 RSDHLSN QSHDRTK DRSHLAR RSDSLSA QSGNLAR agGAAATGG (SEQID (SEQID (SEQID (SEQID (SEQID GCTCAGGGg NO:13) NO:14) NO:15) NO:16) NO:17) actatgactc (SEQID NO:11) ZFN28945 RSDALAR QSGNLAR LAYDRRK TSGSLSR QSGSLTR gtGTAGTTa (SEQID (SEQID (SEQID (SEQID (SEQID TCTGAAGTG NO:18) NO:17) NO:19) NO:20) NO:21) tatatctgca (SEQID NO:12)
(134) Donor C34 DNAs are co-transfected into B4 SupT1 cells with homology to the target site in the CXCR4 gene to allow insertion of the C34 encoding sequences at the target sequences corresponding to the N-terminus of CXCR4.
(135) In an alternative approach, ZFNs are used to create a knock out of the endogenous CXCR4 gene and an expression cassette comprising the C34-CXCR4 fusion and a promoter is integrated by insertion of the fusion sequence into the endogenous gene. ZFNs targeting the endogenous CXCR4 gene are used as described in co-owned U.S. Patent Publication No. 20100291048. The C34-CXCR4 expression cassette contains the constitutive EF1 or similar promoter and insertion of the transgene occurs by either end capture driven by non-homologous end joining following ZFN-induced double strand break, or by homology driven repair using a donor containing the transgene flanked by DNA sequences that are nearly identical to sequences flanking the ZFN cleavage site.
Example 2
Functional Response to CXCR4 Ligand
(136) Functional responses of cells to the natural CXCR4 ligand CXCL12 (also called stromal-derived factor-1, SDF-1) were also evaluated using a transendothelial migration assay (Wang et al. (1998) Leukoc Biol 64(5):642-649). Briefly, the hybrid endothelial cell line EA.hy926 (ATCC) was cultured in transwell inserts (Corning) with 5 nm pores at 37 C. for 3 days. The indicated SupT1 cell lines were loaded into the washed transwell inserts (upper part of the transwell), whereas SDF-1 was added into lower part of the transwell (outside of the inserts). Cells were allowed to migrate at 37 C. for 4 hours, then centrifuged at 1400 rpm for 5 min, and collect for counting with a Guava flow cytometry. The frequency of migrated cells (% of input) was calculated using the following formula: Frequency of migrated cells (% of input)=(number of migrated cells)/(total number of cells added into the transwell insert)100%.
(137) As shown in
(138) Thus, attachment of the C34 peptide to the N-terminus of CXCR4 has no adverse effect on this normal function of CXCR4, i.e., binding to its natural SDF 1 ligand and transfer of the signal.
Example 3
Resistance to HIV Infection in C34-CXCR4 Containing Cells
(139) To evaluate whether fusion of the C34 peptide to the N-terminus of CXCR4 co-receptor protein renders cells resistant to HIV-1, the B4 SupT1 transfectants were infected with an X4-tropic HIV-1 strain HXB or a R5/X4 dual-tropic HIV-1 strain R3A and monitored for viral replication by a reverse transcriptase assay. Briefly, cells were plated at 1e6 cells/ml and spin-infected with the indicated HIV-1 strains for 1 hour at 1,500 rpm. Cell culture supernatants were collected over the course of 2 weeks to measure HIV-1 reverse transcriptase (RT) activity
(140) As shown in
Example 4
Construction of C34-CCR5 and C34-CD4 Fusion Proteins
(141) Similar to the experiment described in Example 1, using standard techniques a construct comprising a gene encoding a fusion of the C34 peptide and the CCR5 protein was generated. The amino acid sequence of C34-CCR5 fusion protein (SEQ ID NO:6) is shown below, with the C34 sequence shown in straight underlining (SEQ ID NO:5) and the CCR5 shown in bold with wavy underlining:
(142) TABLE-US-00005 (SEQIDNO:6)
(143) In a similar construction, a construct was produced encoding a fusion protein of the C34 peptide and the CD4 protein. The amino acid sequence of the C34-CD4 fusion protein (SEQ ID NO:7) is shown below, with the C34 sequence shown in straight underlining (SEQ ID NO:5) and the CD4 sequence shown in bold with wavy underlining. In this sequence, the italicized text indicates the CD4 leader sequence:
(144) TABLE-US-00006 (SEQIDNO:7)
Example 5
Construction of Mutant C34-CXCR4 Fusion Proteins
(145) As described previously, genes encoding C34-CXCR4 fusion proteins were constructed, except that rather than using the wild type C34 sequence, mutant C34 peptides were encoded in the fusions. In the S2 mutants, two of the amino acids were altered (Y638A, S649A), while in the S10 mutants, ten amino acids have been altered (W628A, W631A, I635A, Y638A, I642A, L645A, S649A, Q652A, N656A, E659A).
(146) The sequences of the S2 and S10 mutants are shown in
Example 6
Effect of C34 Fusions on HIV Entry
(147) To investigate the effect of the C34 CXCR4, CCR5 and CD4 fusions on entrance of HIV into cells, the following assay system involving a canine thymocyte line CF2 luc which contains a reporter construct in which a HIV LTR promoter is fused to a luciferase gene (see Etemad-Moghadam et al, (2000) J Virol 74(9) p. 4433) was used. Since the CF2 luc cells are resistant to HIV (they lack the CCR5 and CXCR4 HIV co-receptors, and the HIV receptor CD4), they do not express the luciferase reporter unless the HIV receptor and co-receptors are expressed in the cell.
(148) The CD4 receptor and CCR5 or CXCR4 co-receptors were thus introduced into the cells using expression plasmids. In the presence of the CD4 plus CCR5 combination, luciferase was expressed in the presence of R5 tropic HIV strains. In the presence of the CD4 plus CXCR4 combination, luciferase was expressed in the presence of X4 tropic HIV. Single-cycle HIV infection is sufficient to the HIV that product to activate luciferase in this model system. Briefly, CF2-luc cells were transfected with the C34 fusion constructs in pVAX plasmids. One day after transfection, the cells were re-plated in 24 well plates. The following day, the cells were challenged with virus corresponding to 20 ng p24, and then were incubated for 48 hours at 37 C. Following incubation, the cells were lysed, and luciferase substrate added. Luciferase signal was then measured. In all cases, the cells were co-transfected with a CD4 expression plasmid.
(149) As shown in
(150) When the R5/X4 dual tropic HIV strain R3A was used for the challenge (
(151) Furthermore, as shown in
Example 7
Titration of C34 Fusion Viral Entry Inhibition
(152) To characterize the ability of the C34 fusion proteins to block viral entry, a series of titration experiments were performed. In these experiments, the CF2 luc system described above was utilized but the cells were transfected with differing ratios of the expression plasmids (from 1:1 up to 100:1) encoding the wild type co-receptor with expression plasmids encoding the C34 fusion co-receptors.
(153) As shown in
Example 8
Heterologous Trans Inhibition of HIV Entry
(154) The C34 fusion proteins were also tested to examine if the presence of the C34 peptide on the co-receptor not utilized by a HIV strain inhibit HIV entry. For this experiment, the CF2luc system was again utilized, and the cells were transfected by C34-CXCR4 and C34-CCR5 expression plasmids.
(155) As shown in
(156) This data demonstrates that the C34 peptide is capable of inhibition when fused to the non-targeted co-receptor.
Example 9
Prevention of Viral Infection
(157) Human CD34+ hematopoietic stem cells are isolated from umbilical cord blood and nucleofected with vectors encoding CXCR4-specific engineered nucleases and a donor construct encoding the C34-CXCR4 fusion as described in Example 1 (see also Holt et al (2010) Nat. Biotechnol, 28(8) p. 839). These cells are engrafted into 1 day old NSG mice previously irradiated with low dose (150 cGy) radiation (see Ishikawa et al (2005) Blood 106 p. 1565). Engrafted mice are then challenged with CXCR4-tropic HIV when they are 8-12 weeks post transplantation (Holt et al, ibid). Following infection, blood samples are collected from the mice every 2 weeks and analyzed for HIV viral levels, T cell subset ratios and the extent of C34-CXCR4 fusion protein expression. These data are compared to control irradiated NSG mice that have received wild type, non-treated hCD34+. These data demonstrate that while the ratio of CD4/CD8 cells becomes skewed in mice receiving the wild type hCD34+ cells, reflecting changes that occur in human AIDS patients, the mice receiving the C34-CXCR4 fusion expressing CD34+ cells exhibit less of a shift in the CD4:CD8 ration, or maintain the wild type CD4:CD8 ratios.
(158) All patents, patent applications and publications mentioned herein are hereby incorporated by reference in their entirety.
(159) Although disclosure has been provided in some detail by way of illustration and example for the purposes of clarity of understanding, it will be apparent to those skilled in the art that various changes and modifications can be practiced without departing from the spirit or scope of the disclosure. Accordingly, the foregoing descriptions and examples should not be construed as limiting.