Cell line containing a knockout of the glutamine synthetase (GS) gene and a method of producing target proteins using a GS knockout HEK293 cell line

09567578 ยท 2017-02-14

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention relates to a novel GS (glutamine synthetase) gene knock out transgenic HEK293 (human embryonic kidney 293) cell line and a production method of a target protein using the said transgenic HEK293 cell line. Particularly, the present inventors eliminated the expression of GS in the HEK293 cells in order to overcome a barrier of the cell line selection caused by the over-expression of GS, for producing a target protein by GS/MSX system, by which the efficiency of the cell line selection for the high production of a target protein would be increased and accordingly the protein production by the selected cell line would be increased, suggesting that the human originated transgenic HEK293 cell line could be efficiently used for the production of a target protein.

Claims

1. A glutamine synthetase (GS) knockout transgenic HEK293 cell line comprising one or more mutations of the nucleotide sequence of SEQ ID NO:1 within the 4.sup.th exon of the gs gene.

2. The GS knockout transgenic HEK293 cell line according to claim 1, wherein the cell line is the transgenic HEK293 cell line on deposit at the Korean Collection for Type Cultures (KCTC) under accession number KCTC12978BP.

3. The GS knockout transgenic HEK293 cell line according to claim 1, wherein the one or more mutations is an addition of an adenine nucleotide to the nucleotide sequence of SEQ ID NO:1 or a deletion of 11 nucleotides from the nucleotide sequence of SEQ ID NO:1.

4. The GS knockout transgenic HEK293 cell line according to claim 1, wherein the cell line is originated from HEK293 cells.

5. The GS knockout transgenic HEK293 cell line according to claim 4, wherein the HEK293 cell is selected from the group consisting of HEK293E, HEK293.sus, and HEK293T.

6. A method for producing a target protein comprising the following steps: 1) constructing a transformed HEK293 cell line manipulated to express a target protein by introducing a vector containing a gene encoding the target protein into the GS (glutamine synthetase) knockout transgenic HEK293 cell line of claim 1; 2) culturing the cell line prepared in step 1); and 3) separating and purifying the target protein produced in the cell line of step 2).

7. The method for producing a target protein according to claim 6, wherein the GS knockout transgenic HEK293 cell line of step 1) is the transgenic HEK293 cell line on deposit at the Korean Collection for Type Cultures (KCTC) under accession number KCTC12978BP.

8. The method for producing a target protein according to claim 6, wherein the target protein is selected from the group consisting of soluble TNF receptor, soluble IL-4 receptor, soluble IL-1 type II receptor, soluble CD40 ligand, CD39, CD30, CD27, TEK/ORK, IL-15 receptor, GM-CSF, RANKL, RANK, TRAIL, soluble TRAIL receptor, tissue plasminogen activator, factor VIII, factor IX, apolipoprotein E, apolipoprotein A-I, IL-2 receptor, IL-2 antagonist, alpha-1 antitrypsin, growth hormone, insulin-like growth factors, parathyroid hormone, interferon, monoclonal antibody (mAb), erythropoietin (EPO), thrombopoietin (TPO), and Fc containing fusion protein.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) The application of the preferred embodiments of the present invention is best understood with reference to the accompanying drawings, wherein:

(2) FIG. 1 is a graph illustrating the cell growth and the cell viability according to the batch culture of HEK293 (human embryonic kidney 293) cells in a 50 ml added with MSX at different concentrations.

(3) FIG. 2A is a diagram illustrating the gs gene structure in HEK293 cells and the target location of the CRISPR used herein; The exon of gs gene is indicated by the pointing box and the non-coding DNA is indicated by the full line. The sequence of the sense strand of the gene recognized by CRISPR is indicated by the red. The sgRNA adhering onto the corresponding sense strand (guide RNA) is presented under the target sequence and the direction of the said sgRNA is indicated by the black arrow.

(4) FIG. 2B is a diagram illustrating the result of the Western blotting showing that GS protein is not expressed in the gs gene knockout HEK293 host cell (HEK293_GS-KO) in which gs gene is knocked out by CRISPR; Control: the wild type HEK293 host cell not introduced with the CRISPR targeting gs gene.

(5) FIG. 2C is a diagram illustrating the genotype of the gs gene exon 4 knockout HEK293 cell prepared by using CRISPR. Compared with the wild type, the deleted nucleotides are presented by colons and the added nucleotide sequences are presented by the red. Compared with the allele A and B of the wild type sequence, the allele C, D, and E of the transgenic HEK293_GS-KO are presented in the left. The prepared HEK293 GS-KO cell is the heterozygote knockout (KO) displaying the deletion pattern of different base pairs.

(6) FIG. 3 is a graph illustrating the cell growth curve and viability of the gs gene knockout HEK293 host cell and the control which had been batch-cultured in the medium containing 4 mM glutamine and in the glutamine free medium.

(7) FIG. 4 is a graph illustrating the production of the target proteins (monoclonal antibody) in the 50 clones selected by MSX selection from the gs knockout HEK293 host cell and the control, which had been introduced with the target protein gene.

(8) FIG. 5A is a graph illustrating the cell growth curve and the target protein concentration measured during the batch culture of the clones selected from the gs gene knockout HEK293 host cell introduced with the target protein by using MSX (0 M, 25 M, and 50 M).

(9) FIG. 5B is a graph illustrating the unit time and the specific production rate per cell measured during the batch culture of the clones selected from the gs gene knockout HEK293 host cell introduced with the target protein by using MSX (0 M, 25 M, and 50 M).

DETAILED DESCRIPTION OF THE INVENTION

(10) Hereinafter, the terms used in this invention are described in more detail.

(11) The term batch culture used in this invention indicates the method of culture that continues until the first supplied raw materials are all consumed without additional supply, with which the concentration of substrates, the concentration of metabolites, and the density of cells are changed continuously over the culture time.

(12) The term knockout, elimination, and deletion in this invention can be used interchangeably. This term means any addition or loss of a target gene sequence of cell genome so that the protein expression mediated by the target gene is completely removed.

(13) The term clone and cell line can be used interchangeably, which both indicate a cell group having the same characteristics.

(14) In this invention, CRISPR is the system composed of sgRNA (guide RNA) complementarily binding to the target genome and Cas9 protein that can cut the genome gene by binding to sgRNA and the target genome simultaneously. As a result, when sgRNA vector and Cas9 vector are expressed temporarily in cells together at the same time, sgRNA and Cas9 protein are produced to change gs gene sequence, leading to the suppression of the GS protein expression.

(15) Hereinafter, the present invention is described in detail.

(16) The present invention provides a GS (glutamine synthetase) knockout novel transgenic HEK293 cell line.

(17) The transgenic HEK293 cell line was deposited at Korean Collection for Type Cultures (KCTC), Korea Research Institute of Bioscience and Biotechnology (KRIBB), 181 Ipsin-gil, Jeongeup-si, Jeollabuk-do 56212, Republic of Korea, on Feb. 17, 2016 according to the Budapest Treaty for the purposes of patent procedure. The cell line has been accorded the deposit number Accession No: KCTC12978BP. Upon grant of a patent, all restrictions imposed by the depositor on the availability to the public of the deposited biological material will be irrevocably removed.

(18) The cell line is preferably characterized by the mutation of the nucleotide sequence in the 4.sup.th exon of gs gene. gDNA of Homo sapiens gs gene can be found in SEQ. ID. NO: 9 (see also GenBank NG_013347.2).

(19) The nucleotide sequence that has mutation in the 4.sup.th exon of gs gene is preferably TTTTTGCCCCAGAGTTGCCTGAGTGGAATTT (SEQ. ID. NO: 1), and characterized by the addition of the nucleotide A to the sequence or the deletion of 11 nucleotides therefrom.

(20) The cell line is preferably originated from human, precisely the transformed HEK293 cell line, or can be constructed with the cell lines originated from HEK293 (HEK293 EBNA, HEK293.sus, HEK293T, etc).

(21) The cell line above is dependent on glutamine but has no resistance against MSX (methionine sulfoximine). It is thus preferred to increase the selection efficiency of the production cell line mediated by MSX by using GS as the selection marker protein.

(22) In a preferred embodiment of the present invention, the inventors constructed GS knockout HEK293 cell line (HEK293_GS-KO) by deleting gs gene. Particularly, CRISPR (the vector expressing sgRNA targeting gs gene and the vector expressing Cas9 protein) was introduced in the wild type HEK293 host cells adhesion-cultured in DMEM supplemented with 7% (v/v) fetal bovine serum, 1GSEM (glutamine synthetase expression medium, Sigma-Aldrich, St. Louis, Mo., USA), and glutamine. Then, the cells that could not grow in the absence of glutamine were selected. Western blotting was performed to select the cell line that did not express GS protein (see FIGS. 2A and 2B). The exon #4 of the genomic DNA gs gene of the GS knockout cell line was analyzed. The cell line wherein the change of gene sequence on the targeted area has been observed in every homologous chromosome pair was selected to construct gs gene knockout HEK293 cell line (HEK293_GS-KO) (see FIG. 2C). The prepared HEK293_GS-KO cell line was deposited at Korean Collection for Type Cultures (KCTC), Korea Research Institute of Bioscience and Biotechnology (KRIBB), 181 Ipsin-gil, Jeongeup-si, Jeollabuk-do 56212, Republic of Korea, on Feb. 17, 2016 according to the Budapest Treaty for the purposes of patent procedure. The cell line has been accorded the deposit number Accession No: KCTC12978BP. Upon grant of a patent, all restrictions imposed by the depositor on the availability to the public of the deposited biological material will be irrevocably removed.

(23) The present inventors cultured the prepared gs gene knockout HEK293 cell line in order to investigate the glutamine dependency of the cell line. The wild type HEK293 cells and the gs gene knockout HEK293 cells were cultured in DMEM supplemented with 10% (v/v) dialyzed FBS (dFBS) and 1GSEM. At this time, two different DMEMs, DMEM containing 4 mM glutamine and glutamine-free DMEM, were used to make the culture environment with and without glutamine. The wild type HEK293 cell line grew normally in both environments, that is in the presence and in the absence of glutamine. On the other hand, the growth of the gs knockout HEK293 cell line was inhibited in the glutamine-free medium because of the knockout of GS protein and accordingly the cell viability dropped rapidly (see FIG. 3). GS protein induces the synthesis of endogenous glutamine to maintain cell growth and survival, which is though inhibited by MSX. High GS expression in HEK293 cells inhibits the MSX selection and as a result the selection of the cell line having a high productivity is limited. However, when gs gene is knocked out, the glutamine dependency and the reactivity to MSX are increased, suggesting that the selection efficiency of HEK293 cell line in GS/MSX system can be increased.

(24) The present inventors investigated the MSX reactivity of the gs gene knockout HEK293 cell line and the possibility to increase the selection efficiency of the high production cell line by MSX mediated by the increased glutamine dependency. Particularly, the control cells normally expressing GS protein (wild type HEK293 host cells) or the HEK293_GS-KO cells were transfected with the vector containing the selection marker gene gs and the target protein (monoclonal antibody) gene together. Then, the transformed cells were cultured in the medium not supplemented with glutamine but supplemented with MSX at the concentrations of 0 M, 25 M, 50 M, and 100 M in order to select the clone that produced the target protein. The protein productivity of the selected clone was investigated. While the clones selected from the control cell line did not produce the target protein, the clones selected from the HEK293 GS-KO produced the target protein stably. As the concentration of MSX was increased, the protein productivity of the selected clones was also increased (see FIG. 3). In conclusion, the selection efficiency of the production cell line using MSX was increased by transforming the HEK293_GS-KO cell line.

(25) Therefore, the HEK293 GS-KO confirms the possibility of applying the selection process of the production cell line using GS/MSX system to the human originated HEK293 cell line. That is, when the cells are introduced with the vector encoding a target protein and the selection marker gene (gs) and thereafter the production cell line is selected by using MSX, the efficiency of selecting the cell line displaying a high productivity can be increased. Thus, the novel transgenic HEK293 cell line wherein gs gene is knocked out by CRISPR can be effectively used.

(26) The present invention also provides a method for producing a target protein using the transgenic HEK293 cell line which is prepared by transfecting the transgenic HEK293 cell line with a vector comprising a gene encoding a target protein.

(27) The method above is composed of the following steps, but not always limited thereto:

(28) 1) constructing the transformed HEK293 cell line manipulated to express a target protein by introducing a vector containing the gene encoding the target protein and gs gene together into the transgenic HEK293 cell line of the present invention;

(29) 2) culturing the cell line prepared in step 1); and

(30) 3) separating and purifying the target protein produced in the cell line of step 2).

(31) The method for producing a target protein above can be accomplished by transfecting the transgenic HEK293 cell line with a vector containing the gene encoding the target protein.

(32) In the method above, the GS knockout novel transgenic HEK293 cell line of step 1) is preferably the one deposited under the accession number of KCTC12978BP.

(33) The cell line is preferably characterized by the mutation of the nucleotide sequence in the 4.sup.th exon of gs gene.

(34) The nucleotide sequence that has mutation in the 4.sup.th exon of gs gene is preferably TTTTTGCCCCAGAGTTGCCTGAGTGGAATTT (SEQ. ID. NO: 1), and characterized by the addition of the nucleotide A to the sequence or the deletion of 11 nucleotides therefrom.

(35) In the method above, the target protein of step 1) is exemplified by soluble TNF receptor, soluble IL-4 receptor, soluble IL-1 type II receptor, soluble CD40 ligand, CD39, CD30, CD27, TEK/ORK, IL-15 receptor, GM-CSF, RANKL, RANK, TRAIL, soluble TRAIL receptor, tissue plasminogen activator, factor VIII, factor IX, apolipoprotein E, apolipoprotein A-I, IL-2 receptor, IL-2 antagonist, alpha-1 antitrypsin, growth hormone, insulin-like growth factors, parathyroid hormone, interferon, monoclonal antibody (mAb), erythropoietin (EPO), thrombopoietin (TPO), and Fc containing fusion protein.

(36) To investigate whether or not the gs gene knockout HEK293 cell line prepared above could be used for the production of a target protein, the present inventors cultured the transgenic HEK293 cell line in 4 mM glutamine DMEM supplemented with 7% (v/v) FBS and 1GSEM. The cell line was transfected with a vector containing the target protein gene and gs gene together. Then, the cell line introduced with the vector containing the target gene was selected in the glutamine-free DMEM supplemented with 10% (v/v) dFBS, 1GSEM, and MSX at the concentrations of 0 M, 25 M, and 50 M. At this time, the cell line confirmed to be able to grow in the glutamine-free medium and to show the MSX resistance was selected as a pool or as each clone. In a preferred embodiment of the present invention, the clones that could produce a target protein were selected. Total 50 clones were selected according to the different concentrations of MSX and the production of the target protein was compared. The control group prepared by introducing the gene encoding the monoclonal antibody into the wild type HEK293 host cell line (HEK293 control), and the 50 clones prepared by introducing the gene encoding each monoclonal antibody protein into the gs gene knockout HEK293 host cells (HEK293_GS-KO) were adhesion-cultured in the selection medium. On the 6.sup.th day of culture, the concentration of the monoclonal antibody was quantified. As a result, the target protein production in the protein production clones prepared from the HEK293_GS-KO was increased MSX dose-dependently. However, the clones prepared from the HEK293 control did not produce the target protein regardless of the concentration of MSX used for the selection (see FIG. 4).

(37) The present inventors further investigated whether or not the target protein production clones selected according to the concentration of MSX could affect the productivity and the growth rate in the serum free suspension culture. Particularly, the target protein production cell lines selected at different concentrations of MSX (Ab-MSX 0 M. Ab-MSX 25 M, and Ab-MSX 50 M) were suspension-cultured in Ex-Cell 293SFM medium (Sigma). When the cells grew to the exponential growth phase, the cells were sub-cultured under the same condition as the above in order for the cells to be adapted to the suspension culture until the cell growth rate recovered and reached the same cell growth rate as shown in adhesion culture. The target protein production cell line which had been adapted to the suspension culture was further cultured in the serum free medium via batch culture. The protein production and the specific production rate of each cell line were measured. After the cells were batch-cultured in the serum free medium, the single cell line displaying a high target protein production rate with increasing the MSX concentration was selected. At last, it was confirmed that the target protein productivity was increased (see FIGS. 5A and 5B).

(38) As confirmed by the above results, in the HEK293_GS-KO host cell line of the present invention, GS protein was not expressed. Therefore, it can be efficiently used for the selection of the cell line demonstrating a high productivity of a target protein by introducing a gene encoding the target protein together with gs gene. The prepared protein production cell line can maintain the productivity even in the serum free medium environment, suggesting that a target protein can be produced with high yield in HEK293 cells.

(39) Therefore, the gs gene knockout novel HEK293 cell line of the present invention can be efficiently used for the production of a target protein.

(40) Practical and presently preferred embodiments of the present invention are illustrative as shown in the following Examples.

(41) However, it will be appreciated that those skilled in the art, on consideration of this disclosure, may make modifications and improvements within the spirit and scope of the present invention.

Example 1

Confirmation of MSX Resistance of HEK293 Cell Line

(42) The cell growth rate and the cell viability were investigated in the course of culture of HEK293 cell line with the addition of different concentrations of MSX.

(43) Particularly, HEK293 host cells were inoculated in 50 ml of the glutamine-free EX-CELL 293 SFM medium (Sigma), and also inoculated in the control medium supplemented with 4 mM glutamine. To the experimental group, MSX, the glutamine synthetase inhibitor, was added at the concentrations of 0 M, 100 M, 300 M, 500 M, and 1000 M, respectively. The cell mixture was inoculated in Erlenmeyer flask at the density of 310.sup.5 cells/ml, followed by suspension culture. 1 ml of the cell culture fluid was taken from each flask every 24 hours, followed by investigation of the cell concentration and the cell viability.

(44) As a result, as shown in FIG. 1, GS protein was highly expressed in the HEK293 cell line, indicating that the HEK293 cell line had high resistance against MSX, the GS inhibitor (FIG. 1).

Experimental Example 1

Construction of gs Gene Knockout HEK293 Cell Line

(45) To construct gs gene knockout HEK293 cell line, HEK293 host cells (ATCC, CRL-10852) were first cultured in DMEM (Dulbecco's Modified Eagle's Medium, Gibco, Grand Island, N.Y., USA) supplemented with 1GSEM (glutamine synthetase expression medium, Sigma-Aldrich, St. Louis, Mo., USA), 7% (v/v) FBS, and glutamine via adhesion culture. The adhesion-cultured HEK293 host cells were transfected with the vector encoding sgRNA GGTCTCAACGGACTCACCTTAAA (SEQ. ID. NO: 3) targeting CCAGAGTTGCCTGAGTGGAATTT (SEQ. ID. NO: 2) sequence of gs gene exon 4 and the vector expressing Cas9 protein by using lipofectamine 2000 (Life technology) (FIG. 2A). The cells were inoculated in 5 ml of the medium above in T-25 flask at the density of 410.sup.5 cells/ml. 24 hours later, when the cultured cells reached 90% of confluency in the flask, 5 g of sgRNA vector DNA, 5 g of Cas9 protein vector DNA, and 20 l of lipofectamine complex were added to the OptiMEM medium (Gibco), followed by culture for 24 hours. Exactly 24 hours after the addition of those vectors, cell culture was continued for 2 weeks in a 96 well plate for the selection of single cells. The selected single cells were cultured in a 24 well plate respectively in the conventional culture medium and in the glutamine-free medium (DMEM containing 1GSEM and 10% (v/v) dFBS), during which cell growth was observed. The cells that did not grow in the glutamine-free medium were selected. Western blotting was performed with those selected non-growing cells, and as a result the cells that did not express GS protein were selected. Genomic DNA was taken from the selected cells which did not express GS protein, from which the sequence of gs gene exon 4 was analyzed. Gene mutation was observed in every allele of gs gene, and accordingly gs gene knockout cell line (HEK293_GS-KO) was selected. The wild type HEK293 cell line not-introduced with gs targeting CRISPR (sgRNA and Cas9 protein) was used as the control.

(46) TABLE-US-00001 TABLE 1 Name Sequence exon 4 target sequence CCAGAGTTGCCTGAGTGGAATTT (SEQ. ID. NO: 2) sgRNA GGTCTCAACGGACTCACCTTAAA (SEQ. ID. NO: 3)

(47) As shown in FIG. 2, the expression of 42 KDa GS protein was completely knocked out in the HEK293_GS-KO cell line (FIG. 2B), and gene mutation was observed in every allele of gs gene. Precisely, two types of mutations were observed in three homologous genomic sequences, wherein the addition of A was observed in two of those sequences and 11 nucleotides were deleted in the other sequence. The gene sequences are shown in Table 2 and FIG. 2C. The HEK293_GS-KO cell line was deposited at Korean Collection for Type Cultures (KCTC), Korea Research Institute of Bioscience and Biotechnology (KRIBB) on Feb. 17, 2016 [Accession No: KCTC12978BP, Human Embryonic Kidney 293 EBNA GS-KO (HEK293 cell line)].

(48) TABLE-US-00002 TABLE 2 Name Sequence Control Allele A GAAAGCTCCTGTATGTTTTAAATGTA (SEQ. ID. ATTTTCCCTCTTTTTGCCCCAGAGTTG NO: 4) CCTGAGTGGAATTTCGATGGCTCTAG TACTTTACAGTCTGAGGGTTCCAACA G Allele B GAAAGCTCCTGTATGTTTTAAATGTA (SEQ. ID. ATTTTCCCTCTTTTTGCCCCAGAGTTG NO: 5) CCTGAGTGGAATTTCGATGGCTCCAG TACTTTACAGTCTGAGGGTTCCAACA G HEK293_GS +1 GAAAGCTCCTGTATGTTTTAAATGTA -KO (SEQ. ID. ATTTTCCCTCTTTTTGCCCCAGAGATT NO: 6) GCCTGAGTGGAATTTCGATGGCTCTA GTACTTTACAGTCTGAGGGTTCCAAC AG +1 GAAAGCTCCTGTATGTTTTAAATGTA (SEQ. ID. ATTTTCCCTCTTTTTGCCCCAGAGATT NO: 7) GCCTGAGTGGAATTTCGATGGCTCCA GTACTTTACAGTCTGAGGGTTCCAAC AG 11 GAAAGCTCCTGTATGTTTTAAATGTA (SEQ. ID. ATTTTCCCTCTTTTTGCCTGAGTGGA NO: 8) ATTTCGATGGCTCTAGTACTTTACAG TCTGAGGGTTCCAACAG

Experimental Example 2

Investigation of Glutamine Dependency of gs Knockout HEK293 Cell Line

(49) The adhesion-cultured HEK293 GS-KO cell line obtained in Experimental Example 1 and the wild type HEK293 cell line were adapted to the medium supplemented with glutamine and the glutamine-free medium, followed by measurement of the cell growth and the cell viability.

(50) Particularly, DMEM with or without glutamine was added with 1GSEM and 10% (v/v) dFBS, resulting in the preparation of each medium with or without glutamine. The wild type HEK293 cell line and the HEK293_GS-KO cell line were inoculated in 3 ml of each medium with or without glutamine in a 6 well flask at the density of 110.sup.5 cells/ml. The cell concentration and the cell viability were measured in each well every 24 hours.

(51) As shown in FIG. 3, the wild type HEK293 cell line demonstrated a similar cell growth and viability either in the presence or in the absence of glutamine. However, the HEK293_GS-KO cell line did not grow in the absence of glutamine and the cell viability dropped rapidly under 50% on day 2, despite it maintained as normal cell growth and viability as those of the wild type in the presence of glutamine (FIG. 3). Therefore, it was confirmed that the HEK293_GS-KO cell line had glutamine dependency, which is the cell line did not grow normally in the glutamine-free medium because the expression of GS protein was knocked out.

Experimental Example 3

Production of a Target Protein Using the gs Gene Knockout HEK293 Cell Line

(52) The following experiment was performed to confirm whether or not the gs gene knockout HEK293 host cell line obtained in Experimental Example 1 could be used for the production of a target protein.

(53) First, the cells were inoculated in T-25 flask containing 5 ml of DMEM supplemented with 1GSEM, 7% (v/v) FBS and glutamine at the density of 410.sup.5 cells/ml. 24 hours later, when the cultured cells reached 90% of confluency in the flask, the vector containing a target protein gene mixed with liposome was additionally added to the gs gene knockout HEK293 cell line prepared in Experimental Example 1. 24 hours later, the selection marker protein (GS) inhibitor MSX was treated to the selection medium (glutamine-free DMEM supplemented with 1GSEM and 10% (v/v) dFBS) at the concentrations of 0 M, 25 M, 50 M, and 100 M. The cells introduced with the vector were inoculated in the 96 well plate by 200 l/well. The wild type HEK293 host cell line was also introduced with a target protein gene by the same manner as described above, followed by the selection from the 96 well plate. The cell concentration for the inoculation into the 96 well plate was determined by the concentration at which only one clone would survive after 3 weeks of selection period. To select the MSX resistant cell line (transformed cell line), the cells showing MSX resistance could be collected as a pool or prepared as each individual clone and herein the cell line was collected as an individual clone.

(54) As a result of the cell line selection, as shown in Table 3, the wild type HEK293 cell line transfected with a target protein gene had to be inoculated one cell per each well in order to obtain one clone from each well and the cell survival rate was high in general. However, in order to obtain a clone, the gs knockout HEK293 cell line introduced with a target protein gene had to be inoculated at the density of 2000 cells per each well and the cell survival rate was low. Unlike the wild type HEK293 cell line, the HEK293 GS-KO displayed as low cell survival rate as 0.5% in the presence of 100 M of MSX, so that this cell line was excluded in the next clone selection process.

(55) [Table 3]

(56) Selection condition of the target protein production cell line from the wild type HEK293 and the gs gene knockout HEK293 host cells using MSX

(57) TABLE-US-00003 MSX conc. Inoculation conc. Survival rate Host cell line (M) (cells/96 well) (%) Wild type 0 1 27.1 HEK293 host 25 1 22.9 cell line 50 10 28.1 100 500 75.8 HEK293_GS-KO 0 10 16.0 Host cell line 25 2000 11.9 50 2000 2.3 100 5000 0.5

(58) In the table above, survival rate was obtained by dividing the number of all the wells containing the cell by the number of the total inoculated wells.

(59) The cells inoculated in a 96 well plate were observed under microscope and the medium was replaced every 57 days. About 2 weeks later, when a well was confirmed to have one clone growing at least 50%, the well was treated with trypsin (Gibco) to collect the cells. The collected cells were inoculated in a 48 well plate (500 l). When the cells were grown in the well, the cells were inoculated again in a 24 well plate (1 ml). When the cells were fully grown in the 24 well plate, the cells were collected and inoculated in another 24 well plate containing 1 ml of culture medium at the density of 110.sup.5 cells/ml. To quantify the production of the target protein, batch culture was performed for 6 days. On the 6.sup.th day, the medium was collected and ELISA was performed with the target protein to measure the productivity of each clone. By the method above, 50 clones originated from the gs knockout HEK93 cell line were constructed each in the presence of 0 M, 25 M, and 50 M of MSX. 50 control clones originated from the wild type HEK293 cell line were also constructed for comparison.

(60) As shown in FIG. 4 and Table 4, those target protein production clones selected from the wild type HEK293 did not produce the target protein regardless of the concentration of MSX. Therefore, the selection efficiency of the protein production clone was 0% actually. However, the target protein production clones selected from the gs knockout HEK293 cell line did produce the target protein and accordingly the production efficiency was increased in proportion to the concentration of MSX. The protein concentration in the highly productive clone was also increased MSX dose-dependently as follows: 3.4 g/ml in the presence of 0 M of MSX, 5.0 g/ml in the presence of 25 M of MSX, and 5.3 g/ml in the presence of 50 M of MSX. In the gs knockout HEK293 cell line, endogenously highly expressed GS was eliminated, unlike in the wild type HEK293, so that gs could work efficiently in the MSX selection as a selection marker gene, resulting in the increase of the production cell line selection efficiency and the productivity of the same.

(61) TABLE-US-00004 TABLE 4 Selection efficiency of the target protein production cell line from wild type HEK293 and the gs gene knockout HEK293 host cells using MSX Selection High production clone/ MSX conc. efficiency 50 (total selected clone Host cell line (M) (%) number) Wild type 0 0 0/50 HEK293 host cell 25 0 0/50 line 50 0 0/50 100 0 0/50 HEK293_GS-KO 0 16% 8/50 Host cell line 25 20% 10/50 50 36% 18/50

(62) In the Table above, selection efficiency indicates the portion of high production clones (those clones that could produce a target protein at least 1 g/l until the 6.sup.th day) in 50 constructed clones at each condition.

Experimental Example 4

Investigation of the Target Protein Production in the Suspension Culture of the Clones Selected from the gs Knockout HEK293 Host Cell Line

(63) MSX was treated to the gs knockout HEK293 host cell line at the concentrations of 0 M, 25 M, and 50 M, followed by the selection of target protein production clones. These clones (Ab-MSX 0 M. Ab-MSX 25 M, Ab-MSX 50 M) were suspension-cultured in a serum-free medium. The viable cell concentration, the protein productivity, and the specific production rate were measured.

(64) Particularly, the adhesion-cultured cells were inoculated in 25 ml of glutamine-free EX-CELL 293 SFM (Sigma) supplemented with 1GSEM and different concentrations of MSX at the density of 510.sup.5 cells/ml and then suspension-cultured in Erlenmeyer flask. Three days later, when the cells reached the exponential phase, sub-culture was performed under the same condition as the above. On the third day of the sub-culture, suspension-culture was performed until the cell density reached 110.sup.6 cells/ml, leading to the adaptation of the cells in the serum free suspension culture. The target protein production clones (Ab-MSX 0 M. Ab-MSX 25 M, Ab-MSX 50 M) adapted to the serum free suspension culture were batch-cultured and the cell growth and the target protein productivity were measured.

(65) As a result, the target protein production clones constructed from the gs knockout HEK293 host cell line could be able to produce the target protein as much in the serum-free suspension culture condition (FIG. 5A) and the specific production rate was increased MSX dose-dependently (FIG. 5B). Therefore, it can be said that the gs knockout HEK293 host cell line can increase the selection efficiency of the production cell line in the course of the production cell line selection process using GS/MSX system and the productivity of the target protein by the cell line. The production cell line constructed thereby can be easily adapted to the serum-free suspension culture and accordingly be useful for the culture in a large scale, indicating that the cell line can be efficiently used for the high concentration target protein production in HEK293 cells.

(66) Those skilled in the art will appreciate that the conceptions and specific embodiments disclosed in the foregoing description may be readily utilized as a basis for modifying or designing other embodiments for carrying out the same purposes of the present invention. Those skilled in the art will also appreciate that such equivalent embodiments do not depart from the spirit and scope of the invention as set forth in the appended claims.

(67) All publications referred to herein are incorporated herein to the extent not inconsistent herewith. References cited herein are incorporated by reference herein in their entirety to indicate the state of the art as of their filing date and it is intended that this information can be employed herein, if needed, to exclude specific embodiments that are in the prior art.