Aspergillus mutant strain and transformant thereof
09567563 ยท 2017-02-14
Assignee
Inventors
- Satoru Shinkawa (Saitama, JP)
- Shigenobu Mitsuzawa (Saitama, JP)
- Maiko Tanaka (Saitama, JP)
- Tomohiro Imai (Saitama, JP)
Cpc classification
C12Y302/01091
CHEMISTRY; METALLURGY
International classification
Abstract
Provided are an Aspergillus mutant strain which can dramatically enhance production of a heterologous enzyme when a saccharifying enzyme gene is transferred into the strain to perform transformation and a transformant having a saccharifying enzyme gene transferred into the Aspergillus mutant strain. The Aspergillus mutant strain has been completely or partially deficient in three genes of Aspergillus oryzae strain HO2 (accession number: NITE BP-01750): a prtR gene coding for a transcription factor; a pepA gene coding for an extracellular acid protease; and a cpI gene coding for an extracellular acid carboxypeptidase.
Claims
1. An Aspergillus mutant strain wherein the mutant strain is completely or partially deficient in three genes of Aspergillus oryzae strain HO2 (accession number: NITE BP-01750): a prtR gene coding for a transcription factor; a pepA gene coding for an extracellular acid protease; and a cpI gene coding for an extracellular acid carboxypeptidase.
2. The Aspergillus mutant strain according to claim 1, wherein the mutant strain is Aspergillus oryzae strain HO4 (accession number: NITE BP-01980).
3. A transformant wherein the transformant is constructed by transferring a saccharifying enzyme gene into an Aspergillus mutant strain completely or partially deficient in three genes of Aspergillus oryzae strain HO2 (accession number: NITE BP-01750): a prtR gene coding for a transcription factor; a pepA gene coding for an extracellular acid protease; and a cpI gene coding for an extracellular acid carboxypeptidase.
4. The transformant according to claim 3, wherein the saccharifying enzyme gene is at least one gene selected from a group consisting of a cellobiohydrolase gene, a -glucosidase gene, an endoxylanase gene, an arabinofuranosidase gene, a glucuronidase gene, and an endoglucanase gene.
5. The transformant according to claim 4, wherein the saccharifying enzyme gene is at least one gene selected from a group consisting of a cellobiohydrolase gene from Acremonium cellulolyticus, a -glucosidase gene from Acremonium cellulolyticus, an endoxylanase gene from a strain of genus Thermoascus, an arabinofuranosidase gene from Acremonium cellulolyticus, and a glucuronidase gene from Acremonium cellulolyticus.
6. The transformant according to claim 3, wherein the saccharifying enzyme gene is chromosomally integrated.
Description
BRIEF DESCRIPTION OF THE DRAWING
(1)
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
(2) Embodiments of the present invention will now be described in more detail with reference to the accompanying drawing.
(3) The Aspergillus mutant strain of the present embodiment has been completely or partially deficient in each of the three genes of prtR gene coding for a transcription factor, pepA gene coding for an extracellular acid protease, and cpI gene coding for an extracellular acid carboxypeptidase from Aspergillus oryzae strain HO2.
(4) Aspergillus oryzae strain HO2 is a mutant strain that has been further deficient in ligD gene from Aspergillus oryzae strain HO1 which is a uridine auxotrophic mutant completely or partially deficient in pyrG gene from Aspergillus oryzae strain AOK27L (available from AKITA KONNO CO., LTD.).
(5) Aspergillus oryzae strain HO1 and Aspergillus oryzae strain HO2 are deposited by the applicant to the National Institute of Technology and Evaluation Patent Microorganisms Depository (2-5-8-122 Kazusakamatari, Kisarazu-shi, Chiba, Japan) on Nov. 12, 2013. The accession numbers of Aspergillus oryzae strain HO1 and Aspergillus oryzae strain HO2 are NITE BP-01749 and NITE BP-01750, respectively.
(6) A method for completely or partially deleting each of the three genes of prtR gene, pepA gene, and cpI gene from Aspergillus oryzae strain HO2 can be properly selected and used from known techniques used in genetic transformation of microorganisms such as protoplast-PEG method and spontaneous mutation.
(7) The applicant named the Aspergillus mutant strain completely or partially deficient in all three gene of prtR gene, pepA gene, and cpI gene from Aspergillus oryzae strain HO2 as Aspergillus oryzae strain HO4 and deposited it to the National Institute of Technology and Evaluation Patent Microorganisms Depository (2-5-8-122 Kazusakamatari, Kisarazu-shi, Chiba, Japan) on Dec. 9, 2014 (accession number: NITE BP-01980).
(8) The saccharifying enzyme gene of the transformant of the present embodiment is chromosomally integrated in Aspergillus oryzae strain HO4.
(9) The saccharifying enzyme gene is at least one gene selected from the group consisting of, for example, a cellobiohydrolase gene, a -glucosidase gene, an endoxylanase gene, an arabinofuranosidase gene, a glucuronidase gene, and an endoglucanase gene.
(10) More specifically, the saccharifying enzyme gene is at least one gene selected from the group consisting of a cellobiohydrolase gene from Acremonium cellulolyticus, a -glucosidase gene from Acremonium cellulolyticus, an endoxylanase gene from a strain of genus Thermoascus, an arabinofuranosidase gene from Acremonium cellulolyticus, and a glucuronidase gene from Acremonium cellulolyticus.
(11) The transformant can be obtained by chromosomally integrating the expression vector including an expression cassette for expressing the saccharifying enzyme gene in Aspergillus oryzae strain HO4. The expression cassette is a combination of DNA which is required for expressing a structural gene and contains a promoter and a terminator which function with the structural gene in a host cell. The expression cassette may further contain either or both of 5-untranslated region and 3-untranslated region.
(12) As expression vectors including the expression cassette, optionally modified vectors properly selected from known vectors available for transformation of Aspergillus strains including Aspergillus oryzae can be used.
(13) A transformation method of chromosomally integrating an expression vector in Aspergillus oryzae strain HO4 is not particularly limited but various methods available for gene transfer into Aspergillus strains including Aspergillus oryzae can be performed. The transformation method can include, for example, protoplast-PEG method, PEG-calcium method (Mol. Gen. Genet., vol. 218, p. 99-104(1989)), electroporation method, and Agrobacterium method or the like.
(14) According to the transformant of the present embodiment, complete or partial deletion of each of the three genes of prtR gene, pepA gene, and cpI gene will suppress expression of a plurality of protease genes including an extracellular acid protease gene and an extracellular acid carboxypeptidase gene. Therefore, the transformant of the present embodiment can reduce degradation of the saccharifying enzyme (heterologous enzyme) produced by the introduced saccharifying enzyme gene, with a plurality of proteases including an extracellular acid protease and an extracellular acid carboxypeptidase, thereby dramatically enhancing production of the saccharifying enzyme.
(15) Examples and Comparative Examples of the present invention will be now described.
Example 1
(16) In this Example, Aspergillus oryzae strain HO4, which is an Aspergillus mutant strain deficient in three genes of prtR gene, pepA gene, and cpI gene, was constructed from Aspergillus oryzae strain HO2 as follows.
(17) The first Aspergillus mutant strain deficient in prtR gene was constructed from Aspergillus oryzae strain HO2 as follows.
(18) A total of four gene fragments were obtained by PCR amplification and purification as described below. In the PCR amplification where a DNA polymerase (manufactured by TOYOBO CO., LTD., product name: KOD FX neo) was utilized, primers 1 and 2; primers 3 and 4; and primers 5 and 6 were used to amplify the upstream sequence of prtR gene, the downstream sequence of prtR gene, and the sequence for marker recycling, respectively, with genomic DNA from Aspergillus oryzae strain HO2 as a template, and primers 7 and 8 were used to amplify the pyrG gene expression cassette with genomic DNA from Aspergillus awamori strain HA1 (accession number: NITE BP-01751) as a template. In the purification, a purification kit (manufactured by QIAGEN, product name: QIAquick PCR purification kit) was utilized.
(19) A plasmid pRI910 (manufactured by Takara Bio Inc.) was then treated with the restriction enzyme SmaI (manufactured by Takara Bio Inc.) at 30 C. and purified using the above-mentioned purification kit to obtain a linearized plasmid (hereinafter referred to as the first linearized plasmid).
(20) Three gene fragments of the upstream sequence, the pyrG gene expression cassette, and the first linearized plasmid were then transformed into an E. coli strain HST08 (obtained from Takara Bio Inc.) using the cloning kit (manufactured by Takara Bio Inc., product name: In-Fusion (R) HD Cloning Kit) to obtain a plasmid pRI-AoprtR1::pyrG in which the upstream sequence and the pyrG gene expression cassette are inserted at a SmaI site of plasmid pRI910.
(21) The plasmid pRI-AoprtR1::pyrG was then treated with the restriction enzyme NotI (manufactured by Takara Bio Inc.) at 37 C. and purified using the above-mentioned purification kit to obtain a linearized plasmid pRI-AoprtR1::pyrG (hereinafter referred to as the second linearized plasmid).
(22) Three gene fragments of the sequence for marker recycling, the downstream sequence, the second linearized plasmid were then transformed into an E. coli strain HST08 using the above-mentioned cloning kit to obtain a plasmid pRI-AoprtR::pyrGR in which the sequence for marker recycling and the downstream sequence are inserted downstream of the pyrG gene expression cassette in the plasmid pRI-AoprtR1::pyrG.
(23) The plasmid pRI-AoprtR::pyrGR was then used as a template to perform PCR amplification in which primers 9 and 10 were utilized with the above-mentioned DNA polymerase and the amplified products were purified using the above-mentioned purification kit to obtain a gene fragment for transformation of Aspergillus strains.
(24) According to the conventional method of PEG-calcium method, the gene fragment for transformation of Aspergillus strains was then used to transform Aspergillus oryzae strain HO2.
(25) The transformed Aspergillus oryzae strain HO2 was then selected for survival in the CD culture medium to obtain prtR gene deletion strains.
(26) The spore suspension from the resulting prtR gene deletion strains was then inoculated at 110.sup.6 spores/plate onto CD plate media containing 5-fluoroorotic acid monohydrate (manufactured by Wako Pure Chemical Industries, Ltd.) in final concentration of 1 mg/mL and uridine (manufactured by Sigma-Aldrich Corporation) in final concentration of 20 mM. A viable strain was selected to obtain the first Aspergillus mutant strain which is a prtR gene deletion strain from Aspergillus oryzae strain HO2 and is auxotrophic for uridine.
(27) The base sequences of primers 1-10 are shown in Table 1.
(28) TABLE-US-00001 TABLE1 Primer SEQID number Basesequence5.fwdarw.3 NO. Note 1 tcgagctcggtacccgcgcc 1 prtRgene ttgttccttaaagggtctaa upstream tg sequence 2 gatgctcgagcttgcgaata 2 prtRgene atcggcgagtagaacaagct upstream gag sequence 3 tttacatggtctggcgcgtg 3 prtRgene attg downstream sequence 4 aggatccccgcggcctcaac 4 prtRgene gacggaatccccatcatcta downstream c sequence 5 gatgattaggcggccgggta 5 Sequence tgcccgatcacaatcttcaa formarker c recycling 6 gccagaccatgtaaagcggc 6 Sequence cgcgaataatcggcgagtag formarker aacaagctgag recycling 7 gcaagctcgagcatccaact 7 pyrGgene aaactag expression cassette 8 ctctagaggatccccgcggc 8 pyrGgene cgcctaatcatcctgcagct expression ccgtcattg cassette 9 ctcatgatcctggcacgaca 9 Genefragment g fortransfor- mationof Aspergillus strains 10 cgggaaacgacaatctgatc 10 Genefragment ctg fortransfor- mationof Aspergillus strains
(29) The second Aspergillus mutant strain further deficient in pepA gene was then constructed from the first Aspergillus mutant strain as follows.
(30) A total of four gene fragments were obtained by PCR amplification and purification as described below. In the PCR amplification where a DNA polymerase (manufactured by TOYOBO CO., LTD., product name: KOD-plus-neo) was utilized, primers 11 and 12; primers 13 and 14; and primers 15 and 16 were used to amplify the upstream sequence of pepA gene, the downstream sequence of pepA gene, and the sequence for marker recycling, respectively, with genomic DNA from Aspergillus oryzae strain HO2 as a template, and primers 7 and 8 were used to amplify the pyrG gene expression cassette with genomic DNA from Aspergillus awamori strain HA1 (accession number: NITE BP-01751) as a template. In the purification, a purification kit (manufactured by QIAGEN, product name: QIAquick PCR purification kit) was utilized.
(31) The first Aspergillus mutant strain was then transformed in the very same manner as the transformation of Aspergillus oryzae strain HO2 except that the above-mentioned four gene fragments were used.
(32) The transformed first Aspergillus mutant strain was then selected for survival in the CD culture medium to obtain pepA gene deletion strains.
(33) The second Aspergillus mutant strain which is a prtR-pepA double gene deletion strain from Aspergillus oryzae strain HO2 and is auxotrophic for uridine was then obtained in the same manner as the first Aspergillus mutant strain was obtained from the Aspergillus oryzae strain HO2 except that the spore suspension of the resulting pepA gene deletion strains was used.
(34) The base sequences of primers 11-16 are shown in Table 2.
(35) TABLE-US-00002 TABLE2 Primer SEQID number Basesequence5.fwdarw.3 NO. Note 11 tcgagctcggtacccgctaa 11 pepAgene gtggagagcgaccaaaatca upstream g sequence 12 gatgctcgagcttgcagtga 12 pepAgene ttgctctctagacgaaatgt upstream ggag sequence 13 ctgatgcacggcctaagtct 13 pepAgene aatgaac downstream sequence 14 aggatccccgcggcccgcca 14 pepAgene tccgtgtaccacaactac downstream sequence 15 gatgattaggcggcctgata 15 Sequence tggaggtggagatcagcaga formarker ac recycling 16 taggccgtgcatcaggcggc 16 Sequence cgcagtgattgctctctaga formarker cgaaatgtggag recycling
(36) Aspergillus oryzae strain HO4 which is an Aspergillus mutant strain further deficient in cpI gene was then constructed from the second Aspergillus mutant strain as follows.
(37) A total of four gene fragments were obtained by PCR amplification and purification as described below. In the PCR amplification where a DNA polymerase (manufactured by TOYOBO CO., LTD., product name: KOD-plus-neo) was utilized, primers 17 and 18; primers 19 and 20; and primers 21 and 22 were used to amplify the upstream sequence of cpI gene, the downstream sequence of cpI gene, and the sequence for marker recycling, respectively, with genomic DNA from Aspergillus oryzae strain HO2 as a template, and primers 7 and 8 were used to amplify the pyrG gene expression cassette with genomic DNA from Aspergillus awamori strain HA1 (accession number: NITE BP-01751) as a template. In the purification, a purification kit (manufactured by QIAGEN, product name: QIAquick PCR purification kit) was utilized.
(38) The second Aspergillus mutant strains were then transformed in the very same manner as the transformation of Aspergillus oryzae strain HO2 except that the above-mentioned four gene fragments were used.
(39) The transformed second Aspergillus mutant strain was then selected for survival in the CD culture medium to obtain cpI gene deletion strains.
(40) Aspergillus oryzae strain HO4, as an Aspergillus mutant strain, which is a prtR-pepA-cpI triple gene deletion strain from Aspergillus oryzae strain HO2 and is auxotrophic for uridine was then obtained in the same manner as the first Aspergillus mutant strain was obtained from the Aspergillus oryzae strain HO2 except that the spore suspension of the resulting cpI gene deletion strains was used.
(41) The base sequences of primers 17-22 are shown in Table 3.
(42) TABLE-US-00003 TABLE3 Primer SEQID number Basesequence5.fwdarw.3 NO. Note 17 tcgagctcggtacccggtat 17 cpIgene gtacaggatggcgcatcatg upstream sequence 18 gatgctcgagcttgcgttta 18 cpIgene caagtgcagtccacttctgg upstream ttc sequence 19 cacatgacgagacggttgaa 19 cpIgene acaatatgac downstream sequence 20 aggatccccgcggccggacc 20 cpIgene gttcacgtgtcattgtcatg downstream sequence 21 gatgattaggcggcctcatc 21 Sequence ttgccgatcctctccattct formarker g recycling 22 ccgtctcgtcatgtggcggc 22 Sequence cgcgtttacaagtgcagtcc formarker acttctggttc recycling
Comparative Example 1
(43) In this Comparative Example, the third Aspergillus mutant strain deficient in three genes of prtR gene, pepA gene, and tppA gene was constructed from Aspergillus oryzae strain HO2 as follows.
(44) The second Aspergillus mutant strain deficient in two genes of prtR gene and pepA gene from Aspergillus oryzae strain HO2 was obtained in the same manner as Example 1. The third Aspergillus mutant strain further deficient in tppA gene was then constructed from the second Aspergillus mutant strain as follows.
(45) A total of four gene fragments were obtained by PCR amplification and purification as described below. In the PCR amplification where a DNA polymerase (manufactured by TOYOBO CO., LTD., product name: KOD-plus-neo) was utilized, primers 23 and 24; primers 25 and 26; and primers 27 and 28 were used to amplify the upstream sequence of tppA gene, the downstream sequence of tppA gene, and the sequence for marker recycling, respectively, with genomic DNA from Aspergillus oryzae strain HO2 as a template, and primers 7 and 8 were used to amplify the pyrG gene expression cassette with genomic DNA from Aspergillus awamori strain HA1 (accession number: NITE BP-01751) as a template. In the purification, a purification kit (manufactured by QIAGEN, product name: QIAquick PCR purification kit) was utilized.
(46) The second Aspergillus mutant strain was then transformed in the same manner as the first Aspergillus mutant strain was obtained from Aspergillus oryzae strain HO2 except that the above-mentioned four gene fragments were used.
(47) The transformed second Aspergillus mutant strain was then selected for survival in the CD culture medium to obtain tppA gene deletion strains.
(48) The third Aspergillus mutant strain which is a prtR-pepA-tppA triple gene deletion strain from Aspergillus oryzae strain HO2 and is auxotrophic for uridine was then obtained in the same manner as the first Aspergillus mutant strain was obtained from the Aspergillus oryzae strain HO2 except that the spore suspension of the resulting tppA gene deletion strains was used.
(49) The base sequences of primers 23-28 are shown in Table 4.
(50) TABLE-US-00004 TABLE4 Primer SEQID number Basesequence5.fwdarw.3 NO. Note 23 tcgagctcggtacccctgga 23 tppAgene ccaaccgccaaggttag upstream sequence 24 gatgctcgagcttgcactga 24 tppAgene attgcaattaatggcggaca upstream atg sequence 25 gtgtcttagatgcgactcaa 25 tppAgene tacaactgttc downstream sequence 26 aggatccccgcggccttgag 26 tppAgene gctgaagacttaaatacgac downstream attgc sequence 27 gatgattaggcggcccgtgc 27 Sequence aaaccaagcaaacaagcatc formarker recycling 28 tcgcatctaagacacgcggc 28 Sequence cgcactgaattgcaattaat formarker ggcggacaatg recycling
Comparative Example 2
(51) In this Comparative Example, the fourth Aspergillus mutant strain deficient in three genes of prtR gene, cpI gene, and tppA gene was constructed from Aspergillus oryzae strain HO2 as follows.
(52) The first Aspergillus mutant strain deficient in prtR gene was obtained from Aspergillus oryzae strain HO2 in the same manner as Example 1. The fifth Aspergillus mutant strain further deficient in cpI gene was then obtained from the first Aspergillus mutant strain in the same manner as Example 1 except that the first Aspergillus mutant strain was used in place of the second Aspergillus mutant strain.
(53) The fourth Aspergillus mutant strain further deficient in tppA gene was then obtained from the fifth Aspergillus mutant strain in the same manner as Comparative Example 1 except that the fifth Aspergillus mutant strain was used in place of the second Aspergillus mutant strain.
(54) The fourth Aspergillus mutant strain is an Aspergillus mutant strain which is prtR-cpI-tppA triple gene deletion strain from Aspergillus oryzae strain HO2 and is auxotrophic for uridine.
Comparative Example 3
(55) In this Comparative Example, the sixth Aspergillus mutant strain deficient in four genes of prtR gene, pepA gene, cpI gene, and tppA gene was constructed from Aspergillus oryzae strain HO2 as follows.
(56) Aspergillus oryzae strain HO4 as an Aspergillus mutant strain deficient in three genes of prtR gene, pepA gene, and cpI gene from Aspergillus oryzae strain HO2 was obtained in the same manner as Example 1.
(57) The sixth Aspergillus mutant strain further deficient in tppA gene was then obtained from Aspergillus oryzae strain HO4 in the same manner as Comparative Example 1 except that Aspergillus oryzae strain HO4 was used in place of the second Aspergillus mutant strain.
(58) The sixth Aspergillus mutant strain is an Aspergillus mutant strain which is a prtR-pepA-cpI-tppA quadruplex gene deletion strain from Aspergillus oryzae strain HO2 and is auxotrophic for uridine.
(59) [Construction of Transformants]
(60) A method of constructing transformants will be now described by illustrating the transfer of a cellobiohydrolase (cbh1) gene.
(61) A total of six gene fragments were obtained by PCR amplification and purification as described below. In the PCR amplification where a DNA polymerase (manufactured by TOYOBO CO., LTD., product name: KOD-plus-neo) was utilized, primers 29 and 30; primers 31 and 32; primers 33 and 34; and primers 35 and 36 were used to amplify the upstream sequence of pyrG gene, the downstream sequence of pyrG gene, tefl promoter gene, and agdA terminator gene, respectively, with genomic DNA from Aspergillus oryzae strain HO2 as a template, primers 37 and 38 were used to amplify a cellobiohydrolase (cbh1) gene with genomic DNA from Acremonium cellulolyticus strain H1 (accession number: NITE BP-11508) as a template, and primers 39 and 40 were used to amplify the pyrG gene expression cassette with genomic DNA from Aspergillus awamori strain HA1 (accession number: NITE BP-01751) as a template. In the purification, a purification kit (manufactured by QIAGEN, product name: QIAquick PCR purification kit) was utilized.
(62) A plasmid pMD20 (manufactured by Takara Bio Inc.) was then treated with the restriction enzyme SmaI (manufactured by Takara Bio Inc.) at 30 C. and purified using the above-mentioned purification kit to obtain plasmid restriction products (gene fragments).
(63) Each of the gene fragments thus obtained was sequentially transformed into an E. coli strain HST08 (manufactured by Takara Bio Inc.) using a cloning kit (manufactured by Takara Bio Inc., product name: In-Fusion (R) HD Cloning Kit) to obtain a plasmid pPPT1-CBH1.
(64) The resulting plasmid pPPT1-CBH1 was then used as a template to perform PCR amplification in which primers 41 and 42 were utilized with the above-mentioned DNA polymerase and the amplified products were purified using the above-mentioned purification kit to obtain a gene fragment for transformation of Aspergillus strains (pyrG-CBH1 fragment).
(65) According to the conventional method of PEG-calcium method, the gene fragment for transformation of Aspergillus strains (pyrG-CBH1 fragment) was then used to transform Aspergillus oryzae strain HO2 (Reference Example), Aspergillus oryzae strain HO4 (Example 1), the third Aspergillus mutant strain (Comparative Example 1), the fourth Aspergillus mutant strain (Comparative Example 2), and the sixth Aspergillus mutant strain (Comparative Example 3) to obtain respective transformants.
(66) The resulting transformants were then selected for survival on the CD plate media to obtain the respective transformants corresponding to Reference Example, Example 1, and Comparative Examples 1-3. The transformants can produce a cellobiohydrolase (cbh1) because the cellobiohydrolase gene is chromosomally integrated in the transformants. The transformant into which a cellobiohydrolase (cbh1) gene was transferred and which can produce a cellobiohydrolase is referred to as CBH1-producing strain hereinafter.
(67) The base sequences of primers 29-42 are shown in Table 5.
(68) TABLE-US-00005 TABLE5 Primer SEQID number Basesequence5.fwdarw.3 NO. Note 29 ggatatcggatccccccaga 29 pyrGgene ggtgactttatccaagattc upstream cttc sequence 30 caattgccgcgaaaaattaa 30 pyrGgene attgaatctatg upstream sequence 31 ttttcgcggcaattgcccgg 31 pyrGgene ggtagtggtggatacgtact downstream ccttttatgg sequence 32 tcgagctcggtacccttcag 32 pyrGgene gtcacgttctaagcttatca downstream gctg sequence 33 ctaatcatcctgcagctccg 33 tef1 tcattg promoter gene 34 tcgcggcaattgcccgcaag 34 tef1 ctcgagcatccaactaaact promoter ag gene 35 ccaccactaccccgggaagc 35 agdA gtaacaggatagcctagacc terminator gene 36 ctgcaggatgattagagtaa 36 agdA cccattcccggttctctagc terminator tg gene 37 atgtctgccttgaactcttt 37 Cellobio- caatatgtacaag hydrolase gene 38 atcctgttacgcttcctaca 38 Cellobio- aacattgagagtagtaaggg hydrolase ttcacg gene 39 atccaccactaccccgtaag 39 pyrGgene gtccgagacagtaagggatt expression g cassette 40 gttcaaggcagacattttga 40 pyrGgene aggtggtgcgaactttgtag expression ttc cassette 41 cagtgagcgcaacgcaatta 41 Gene atgtgagttag fragmentfor transformation ofAspergillus strains 42 gggatgtgctgcaaggcgat 42 Gene taagttg fragmentfor transformation ofAspergillus strains
(69) [Measurement of Cellobiohydrolase Production]
(70) A method of measuring cellobiohydrolase production from respective CBH1-producing strains corresponding to Aspergillus mutant strains of Reference Example, Example 1, and Comparative Examples 1-3 will now be described.
(71) To measure cellobiohydrolase production from the CBH1-producing strains, each of the CBH1-producing strains was cultured on the CD plate media for a week to form spores and collected using 0.01% POLYSORBATE 20 (manufactured by Wako Pure Chemical Industries, Ltd.) to obtain spore suspension.
(72) A 100 mL Erlenmeyer flask was charged with 30 mL of PD liquid medium (2 (w/v) % dextrin, 1 (w/v) % polypeptone, 0.1 (w/v) % casamino acids, 0.5 (w/v) % monobasic potassium phosphate, 0.05 (w/v) % magnesium sulfate, and 0.1 (w/v) % sodium nitrate). The spore was inoculated to the flask at the final concentration of 110.sup.4 spores/mL and liquid-cultured at 30 C. for 6 days to obtain cultures of CBH1-producing strains that secreted and provided cellobiohydrolase (CBH1), which is the enzyme of interest, into the liquid culture medium.
(73) CBH1 concentration in each liquid culture was then confirmed by SDS-PAGE analysis. 0.25 g, 0.5 g, and 2 g of BSA were run simultaneously as a standard of protein concentration. CBH1 concentration in 10 L of enzyme sample was calculated from image analysis using ChemiDoc (R) XRS+ system.
(74) The results are shown in
(75) TABLE-US-00006 TABLE 6 CBH1 Production (mg/L) Relative value Reference Example 19.54 1.0 Example 1 24.23 1.24 Comparative Example 1 21.30 1.09 Comparative Example 2 22.08 1.13 Comparative Example 3 19.93 1.02
(76) As shown in
(77)
(78) Therefore, it is obvious that the transformants of Aspergillus oryzae strain HO4 in Example 1 can dramatically enhance production of a saccharifying enzyme CBH1.