RECOMBINANT ONCOLYTIC NEWCASTLE DISEASE VIRUSES WITH INCREASED ACTIVITY

Abstract

The invention relates to transgene expressing Newcastle Disease Viruses (NDV), which have been demonstrated to possess significant oncolytic activity against mammalian cancers and/or an improved safety profile. The invention provides novel oncolytic viruses through the use of genetic engineering, including the transfer of foreign genes or parts thereof, such as genes encoding Atezolizumab or Bevacizumab. The present invention also provides nucleic acids encoding a reverse genetically engineered (rg-)NDV comprising one or more of these foreign genes and having a mutation in the HN gene, said mutation allowing replication of said rgNDV in a cancer cell to a higher level than replication of an otherwise identical rgNDV not having said mutation in the HN gene.

Claims

1. A recombinant Newcastle Disease Virus (NDV), derived from NDV strain MTH-68/H according to SEQ ID No. 1, wherein the recombinant NDV carries as a foreign gene at least one gene selected from the group consisting of a gene encoding an antibody directed to protein PD-L1 or an antigen-binding part directed to protein PD-L1 (anti-PD-L1), a gene encoding an antibody directed to the growth factor protein VEGF-A or an antigen-binding part directed to the growth factor protein VEGF-A (anti-VEGF-A), a gene encoding an antibody directed to killer-cell immunoglobulin-like receptors (KIRs) or an antigen-binding part directed to killer-cell immunoglobulin-like receptors (KIRs) (anti-KIR), a gene encoding an antibody directed to and inhibiting LAG-3 or an antigen-binding part directed to and inhibiting LAG-3 (anti-LAG-3), a gene encoding an antibody directed to NKG2A or an antigen-binding part directed to NKG2A (anti-NKG2A), a gene encoding an antibody directed to the glucocorticoid-induced TNF-superfamily receptor (GITR) or an antigen-binding part directed to the glucocorticoid-induced TNF-superfamily receptor (GITR) (anti-GITR), a gene encoding an antibody directed to and activating the protein OX40 or an antigen-binding part directed to and activating the protein OX40 (anti-OX40), a gene encoding a membrane protein which is the receptor for the proteins CD28 and CTLA-4, and which membrane protein is involved in the costimulatory signal essential for T-lymphocyte activation or a part of the membrane protein which is the receptor for the proteins CD28 and CTLA-4, and which membrane protein is involved in the costimulatory signal essential for T-lymphocyte activation, a gene encoding a human interleukin 12 (hIL-12) or a part of a human interleukin 12 (hIL-12), a gene encoding a green fluorescent protein or a part of a green fluorescent protein (GFP), and any combination of these genes, parts or variants, wherein said recombinant NDV comprises a mutated hemagglutinin-neuramidase (HN) gene and the encoded hemagglutinin-neuramidase, wherein phenylalanine (F) is substituted to leucine (L) at position 277 of the encoded HN.

2. The recombinant NDV according to claim 1, wherein the NDV further comprises a mutation in the M gene and the thus encoded matrix protein.

3. The recombinant NDV according to claim 2, wherein the matrix protein encoded by the mutated M gene has an amino acid substitution at position 165 to an amino acid with an aromatic side chain.

4. The recombinant NDV according to claim 2, wherein glycine (G) is substituted to tryptophane (W) at position 165 of the matrix protein encoded by the mutated M gene.

5. The recombinant NDV according to claim 1, wherein the recombinant NDV is encoded by and/or comprises a viral genome having a nucleic acid sequence with a sequence identity of at least 75% to the nucleic acid sequence of SEQ ID No. 1 of the sequence listing, wherein the sequence identity is determined after best alignment of the sequence of interest with the respective reference sequence.

6. The recombinant NDV according to claim 1, wherein the recombinant NDV is encoded by and/or comprises at least one of the nucleic acids according to SEQ ID No. 2, SEQ ID NO. 4 to 13 or variants thereof, variants having a sequence identity of at least 75% to the nucleic acid sequence of any one of SEQ. ID. 2 and SEQ. ID NO. 4 to 13, wherein the sequence identity is determined after best alignment of the sequence of interest with the respective reference sequence.

7. A method of treating cancer in a mammal, the method comprising administering to the mammal the recombinant NDV according to claim 1.

8. The method of claim 7, wherein the cancer is selected from the group consisting of brain tumors, bone tumors, soft tissue tumors, gynecological tumors, gastrointestinal tumors, pancreas tumors, prostate tumors, lung tumors, ear tumors, nose tumors, throat tumors, tongue tumors, and skin tumors.

9. A nucleic acid encoding a recombinant Newcastle Disease Virus (NDV), derived from NDV strain MTH-68/H according to SEQ ID No. 1, the nucleic acid comprising a transgenic construct, wherein said transgenic construct encodes a protein selected from the group consisting of Atezolizumab, an antigen-binding part of Atezolizumab, a variant of Atezolizumab or a variant of an antigen-binding part of Atezolizumab, Bevacizumab, an antigen-binding part of Bevacizumab, a variant of Bevacizumab or a variant of an antigen-binding part of Bevacizumab, Lirilumab, an antigen-binding part of Lirilumab, a variant of Lirilumab or a variant of an antigen-binding part of Lirilumab, Relatlimab, an antigen-binding part of Relatlimab, a variant of Relatlimab or a variant of an antigen-binding part of Relatlimab, Monalizumab, an antigen-binding part of Monalizumab, a variant of Monalizumab or a variant of an antigen-binding part of Monalizumab, TRX518, an antigen-binding part of TRX518, a variant of TRX518 or a variant of an antigen-binding part of TRX518, BMS 986178, an antigen-binding part of BMS 986178, a variant of BMS 986178 or a variant of an antigen-binding part of BMS 986178, CD80, a part of CD80, a variant of CD80 or a variant of a part of CD80, a human interleukin 12 (hIL-12) or a part of a human interleukin 12 (hIL-12), a green fluorescent protein or a part of a green fluorescent protein, and any combination of these proteins, parts or variants, wherein the nucleic acid in addition has a mutation in the HN gene, where the mutated HN gene encodes HN.sup.F277L.

10. The nucleic acid according to claim 9, wherein the sequence encoding the recombinant NDV further comprises a mutation in the M gene, wherein the mutated M gene encodes a matrix protein M with an amino acid substitution at position 165, namely M.sup.G165W.

11. (canceled)

12. The nucleic acid according to claim 9, wherein the nucleic acid consists of or comprises a nucleic acid sequence with a sequence identity of at least 75% to the nucleic acid sequence of SEQ ID No. 1 of the sequence listing, wherein the sequence identity is determined after best alignment of the sequence of interest with the respective reference sequence.

13. The nucleic acid according to claim 9, wherein the nucleic acid consists of or comprises at least one of the nucleic acids according to SEQ ID No. 2, SEQ ID No. 4 to 13 or variants thereof, the variants having a sequence identity of at least 75% to the nucleic acid sequence of any one of SEQ. ID. 2 and SEQ. ID NO. 4 to 13, wherein the sequence identity is determined after best alignment of the sequence of interest with the respective reference sequence.

14. A pharmaceutical formulation comprising particles of the recombinant NDV according to claim 1.

15. A method of oncological treatment in a mammal, the method comprising administering to the mammal the pharmaceutical formulation according to claim 14.

16. The method according to claim 14 wherein the cancer is selected from the group consisting of brain tumors, bone tumors, soft tissue tumors, gynecological tumors, gastrointestinal tumors, pancreas tumors, prostate tumors, lung tumors, ear tumors, nose tumors, throat tumors, tongue tumors, and skin tumors.

17. A pharmaceutical formulation comprising the nucleic acid according to claim 9.

18. A method of oncological treatment in a mammal, the method comprising administering to the mammal the pharmaceutical formulation according to claim 17.

19. The method according to claim 18, wherein the cancer is selected from the group consisting of brain tumors, bone tumors, soft tissue tumors, gynecological tumors, gastrointestinal tumors, pancreas tumors, prostate tumors, lung tumors, ear tumors, nose tumors, throat tumors, tongue tumors, and skin tumors.

20. The method according to claim 7, wherein the method comprises administering to the subject a combination of recombinants NDVs carring different foreign genes selected from the group consisting of: the gene encoding the antibody directed to protein PD-L1 or the antigen-binding part directed to protein PD-L1 (anti-PD-L1), which gene encodes Atezolizumab, an antigen-binding part of Atezolizumab, a variant of Atezolizumab or a variant of an antigen-binding part of Atezolizumab, the gene encoding the antibody directed to the growth factor protein VEGF-A or the antigen-binding part directed to the growth factor protein VEGF-A (anti-VEGF-A), which gene encodes Bevacizumab, an antigen-binding part of Bevacizumab, a variant of Bevacizumab or a variant of an antigen-binding part of Bevacizumab, the gene encoding the antibody directed to killer-cell immunoglobulin-like receptors (KIRs) or the antigen-binding part directed to killer-cell immunoglobulin-like receptors (KIRs) (anti-KIR), which gene encodes Lirilumab, an antigen-binding part of Lirilumab, a variant of Lirilumab or a variant of an antigen-binding part of Lirilumab, the gene encoding the antibody directed to and inhibiting LAG-3 or the antigen-binding part directed to and inhibiting LAG-3 (anti-LAG-3), which gene encodes Relatlimab, an antigen-binding part of Relatlimab, a variant of Relatlimab or a variant of an antigen-binding part of Relatlimab, the gene encoding the antibody directed to NKG2A or the antigen-binding part directed to NKG2A (anti-NKG2A), which gene encodes Monalizumab, an antigen-binding part of Monalizumab, a variant of Monalizumab or a variant of an antigen-binding part of Monalizumab, the gene encoding the antibody directed to the glucocorticoid-induced TNF-superfamily receptor (GITR) or the antigen-binding part directed to the glucocorticoid-induced TNF-superfamily receptor (GITR) (anti-GITR), which gene encodes TRX518, an antigen-binding part of TRX518, a variant of TRX518 or a variant of an antigen-binding part of TRX518, the gene encoding the antibody directed to and activating the protein OX40 or the antigen-binding part directed to and activating the protein OX40 (anti-OX40), which gene encodes BMS 986178, an antigen-binding part of BMS 986178, a variant of BMS 986178 or a variant of an antigen-binding part of BMS 986178, the gene encoding the membrane protein which is the receptor for the proteins CD28 and CTLA-4, which gene encodes CD80, a part of CD80, a variant of CD80 or a variant of a part of CD80, the gene encoding the human interleukin 12 (hIL-12) or the part of a human interleukin 12 (hIL-12), which gene encodes non-secreting (ns)hIL-12, a part of (ns)hIL-12, a variant of (ns)hIL-12 or a variant of a part of (ns)hIL-12, the gene encoding the green fluorescent protein or the part of a green fluorescent protein (GFP), which gene encodes enhanced GFP (eGFP), a part of eGFP, a variant of eGFP or a variant of a part of eGFP, and any combination of these genes, parts or variants, wherein each of said recombinant NDVs comprise the mutated hemagglutinin-neuramidase (HN) gene and the encoded hemagglutinin-neuramidase, in which encoded HN phenylalanine (F) is substituted to leucine (L) at position 277.

21. The recombinant NDV of claim 1, wherein the foreign gene is at least one gene selected from the group consisting of: the gene encoding the antibody directed to protein PD-L1 or the antigen-binding part directed to protein PD-L1 (anti-PD-L1), which is a gene encoding Atezolizumab, an antigen-binding part of Atezolizumab, a variant of Atezolizumab or a variant of an antigen-binding part of Atezolizumab, the gene encoding the antibody directed to the growth factor protein VEGF-A or the antigen-binding part directed to the growth factor protein VEGF-A (anti-VEGF-A), which is a gene encoding Bevacizumab, an antigen-binding part of Bevacizumab, a variant of Bevacizumab or a variant of an antigen-binding part of Bevacizumab, the gene encoding the antibody directed to killer-cell immunoglobulin-like receptors (KIRs) or the antigen-binding part directed to killer-cell immunoglobulin-like receptors (KIRs) (anti-KIR), which is a gene encoding Lirilumab, an antigen-binding part of Lirilumab, a variant of Lirilumab or a variant of an antigen-binding part of Lirilumab, the gene encoding the antibody directed to and inhibiting LAG-3 or the antigen-binding part directed to and inhibiting LAG-3 (anti-LAG-3), which is a gene encoding Relatlimab, an antigen-binding part of Relatlimab, a variant of Relatlimab or a variant of an antigen-binding part of Relatlimab, the gene encoding the antibody directed to NKG2A or the antigen-binding part directed to NKG2A (anti-NKG2A), which is a gene encoding Monalizumab, an antigen-binding part of Monalizumab, a variant of Monalizumab or a variant of an antigen-binding part of Monalizumab, the gene encoding the antibody directed to the glucocorticoid-induced TNF-superfamily receptor (GITR) or the antigen-binding part directed to the glucocorticoid-induced TNF-superfamily receptor (GITR) (anti-GITR), which is a gene encoding TRX518, an antigen-binding part of TRX518, a variant of TRX518 or a variant of an antigen-binding part of TRX518, the gene encoding the antibody directed to and activating the protein OX40 or the antigen-binding part directed to and activating the protein OX40 (anti-OX40), which is a gene encoding BMS 986178, an antigen-binding part of BMS 986178, a variant of BMS 986178 or a variant of an antigen-binding part of BMS 986178, the gene encoding the membrane protein which is the receptor for the proteins CD28 and CTLA-4, which is a gene encoding CD80, a part of CD80, a variant of CD80 or a variant of a part of CD80, the gene encoding the human interleukin 12 (hIL-12) or the part of a human interleukin 12 (hIL-12), which is a gene encoding non-secreting (ns)hIL-12, a part of (ns)hIL-12, a variant of (ns)hIL-12 or a variant of a part of (ns)hIL-12, the gene encoding the green fluorescent protein or the part of a green fluorescent protein (GFP), which is a gene encoding enhanced GFP (eGFP), a part of eGFP, a variant of eGFP or a variant of a part of eGFP, and any combination of these genes.

Description

FIGURES

[0235] FIG. 1 is a schematic presentation of the NDV reverse genetics system. The upper part shows the composition of the full-length cDNA plasmid which contains the full-length NDV cDNA (encoding the nucleocapsid protein (NP), the phosphoprotein (P), the matrix protein (M), the fusion protein (F), the hemagglutinin-neuraminidase (HN), and the RNA-dependent RNA polymerase (L)) cloned behind the bacteriophage T7 RNA Polymerase promoter (T7P; yellow triangle) and followed by a ribozyme sequence (Rz) and T7 transcription termination signal (T7T).

[0236] A suitable host cell (shaded round-cornered box) is infected with a recombinant Fowlpox virus that expresses T7 DNA-dependent RNA polymerase (Fowlpox-T7) and subsequently co-transfected with the full-length cDNA plasmid and three helper plasmids containing the genes encoding the NDV NP, P and L proteins, respectively. Transcription of the full-length cDNA results in the generation of the NDV antigenome RNA which is encapsidated by NP protein then transcribed and replicated by the RNA-leading to the generation of infectious NDV.

[0237] FIG. 2 is a schematic presentation of the genome of the rgNDV-mutants according to the present invention. The figure shows the position of the respective foreign gene which is inserted as extra transcription unit into the rgNDV-mutant genome between the P and M genes.

[0238] FIG. 3 shows growth kinetics in HeLa cells. HeLa cells were infected at a multiplicity of infection (MOI) of 0.01 with the indicated viruses. At 0 h, 8 h, 24 h and 48 h after infection, the amount of infectious virus in the supernatant was determined by end-point titration on QM5 cells. MTH68: NDV strain MTH-68/H; MutHu: NDV-Mut HN(F277L)/M(G165W); rgMTH68: NDV strain MTH-68/H derived by reverse genetics from cloned full-length cDNA; rgMutHu: NDV strain NDV-Mut HN(F277L)/M(G165W) derived by reverse genetics from cloned full-length cDNA; rgMutHu(HNL277F): rgMutHu in which the amino acid mutation at position 277 in the HN gene was converted from L back to F; rgMutHu(MVV165G): rgMutHu in which the amino acid mutation at position 165 in the M gene was converted from W back to G.

[0239] FIG. 4 shows a calibration curve of a human IgG ELISA used for determining and quantifying the expression of Atezolizumab and Bevacizumab from a recombinant NDV strain according to the present invention.

EXAMPLES

Example 1

Nucleotide Sequence Analysis of Mutant NDV-Mut HN(F277L)/M(G165W)

[0240] We identified a spontaneous mutant of an oncolytic NDV strain MTH-68/H (Csatary et al., 1999, Anticancer Res. 19:635-638.; further called MTH68). The replication capacity of the mutant strain (designated NDV-Mut HN(F277L)/M(G165W) in a variety of human neoplastic cell lines, as well as autologous primary tumors, is greatly enhanced as compared to the original MTH-68/H strain (also referred to as MTH68 strain). We analyzed its nucleotide sequence and found that, compared to MTH68, NDV-HN(F277L)/M(G165W) has two nucleotide mutations, one leading to an amino acid substitution in the M protein (G165W) and the other in the HN protein (F277L).

Example 2

A Reverse Genetics System that Allows Genetic Modification of NDV-Strains

[0241] 2.1 Reverse Genetics

[0242] In order to be able to genetically modify the genome of an RNA virus such as NDV, a manipulatable genetic system must be developed that uses a copy of the full viral RNA (vRNA) genome in the form of DNA. This full-length cDNA is amenable to genetic modification by using recombinant DNA techniques. The authentic or modified cDNA can be converted back into vRNA in cells, which in the presence of the viral replication proteins results in the production of a new modified infectious virus. Such ‘reverse genetics systems’ have been developed in the last few decades for different classes of RNA viruses. This system enables the rapid and facile introduction of mutations and deletions and the insertion of a transgene transcriptional unit, thereby enabling the changing of the biological properties of the virus.

[0243] Reverse genetics systems for several NDV strains, including lentogenic as well as velogenic strains, were developed by the Central Veterinary Institute (CVI), part of Wageningen University and Research, currently Wageningen Bioveterinary Research (WBVR) under the supervision of Dr. Ben Peeters (Peeters et al., 1999, J. Virol. 73:5001-9; de Leeuw et al., 2005, J. Gen. Virol. 86:1759-69; Dortmans et al., 2009, J. Gen. Virol. 90:2746-50). In order to generate a reverse genetics system for providing the NDV nucleic acids and strains according to the present invention, a similar approach was used. Details of the procedure can be found in the above cited papers and in the paragraphs below. Briefly, the system consists of 4 components, i.e., a transcription plasmid containing the full-length (either authentic or genetically modified) cDNA of the virus, which is used to generate the vRNA, and 3 expression plasmids (‘helper plasmids’) containing the NP, P and L genes of NDV respectively, which are used to generate the vRNA-replication complex (consisting of NP, P and L proteins). Transcription of the cDNA (i.e. conversion of the cDNA into vRNA) and expression of the NP, P and L genes by the helper plasmids is driven by a T7 promoter. The corresponding T7 DNA-dependent RNA polymerase (T7-RNAPol) is provided by a helper-virus (Fowlpox-T7).

[0244] In order to rescue virus, the 4 plasmids are co-transfected into Fowlpox-T7 infected cells (FIG. 1). Three to five days after transfection, the supernatant is inoculated into specific-pathogen-free embryonated chicken eggs (ECE) and incubated for 3 days. Infectious virus that is produced by transfected cells will replicate in the ECE and progeny virus can be harvested from the allantois fluid.

[0245] In order to develop a reverse genetics system for NDV the following steps were followed: [0246] Generation of sub-genomic NDV and foreign gene cDNA's by RT-PCR [0247] Assembly of full-length cDNA in a transcription vector [0248] Cloning of each of the NP, P and L genes into an expression vector [0249] Verify nucleotide sequence of full-length cDNA and helper-plasmids [0250] Repair nucleotide differences resulting from the cloning procedure, if necessary [0251] Rescue of infectious virus from cDNA using co-transfection (FIG. 1)

[0252] 2.2 Construction of Full-Length NDV-Mut HN(F277L)/M(G165W) cDNA and Helper Plasmids

[0253] NDV-Mut HN(F277L)/M(G165W) (passage 28 HeLa cells) was used for the isolation of vRNA using standard procedures. The vRNA was used to generate first-strand cDNA by means of Reverse Transcriptase followed by PCR to generate 4 sub-genomic cDNA fragments (designated C1, C2, C3 and C8). The full-length cDNA of NDV-MutHu was assembled from these fragments and cloned in the transcription vector pOLTV5 (Peeters et al., 1999, J. Virol. 73:5001-5009) by a combination of In-Fusion® cloning and classical cloning using restriction enzymes. An overview of the procedure is shown in FIG. 2, and further details can be found in Appendix 1 of this reference. The NP, P and L-genes of NDV-MutHu were obtained by RT-PCR (Appendix 1) and cloned in the expression plasmid pCVI which was derived by deletion of a ClaI restriction fragment from pCI-neo (Promega).

[0254] 2.3 Nucleotide Sequence Analysis

[0255] Nucleotide sequence analysis was used to verify that the sequence of pFL-NDV Mut HN(F277L)/M(G165W) was correct. A few nucleotides which differed from the Reference sequence were repaired. Silent mutations (i.e., not leading to an amino acid change) may be left unchanged.

[0256] 2.4 Rescue of Infectious Virus from pFL-NDV Mut HN(F277L)/M(G165W)

[0257] In order to generate infectious virus, we used the co-transfection system described above (and illustrated in FIG. 1) to transfect QM5 cells (derived from Quail) using plasmid pFL-NDV_Mut HN(F277L)/M(G165W) and the helper plasmids pCVI-NP.sup.Mut HN(F277L)/M(G165W), pCVI-P.sup.Mut HN(F277L)/M(G165W) and pCVI-L.sup.Mut HN(F277L)/M(G165W). Rescue of infectious virus was successful as demonstrated by the presence of infectious virus in the allantoic fluid of ECE that were inoculated with the transfection supernatant (data not shown). The identity of the rescued virus was determined by RT-PCR followed by sequencing. The rescued virus was designated rgMut HN(F277L)/M(G165W). NDV-Mut HN(F277L)/M(G165W) and rgMut HN(F277L)/M(G165W) have similar growth kinetics in HeLa cells.

Example 3

Identify Whether One or Both of the Amino Acid Substitutions in Mut HN(F277L)/M(G165W) are Responsible for the Difference in Growth Kinetics Between Mut HN(F277L)/M(G165W) and the Parent Strain MTH68

[0258] 3.1 Growth Kinetics in HeLa Cells

[0259] The rescued rg-viruses (Table 1) as well as the original Mut HN(F277L)/M(G165W) and MTH68 viruses were used to determine their growth-kinetics in HeLa cells. Briefly, 4×10.sup.6 HeLa cells were seeded in 25 cm.sup.2 cell culture flasks and grown overnight. The cells were infected using a MOI of 0.01 (i.e., 1 infectious virus particle per 100 cells), and at 8, 24 and 48 hours after infection the virus titer in the supernatant was determined by end-point titration on QM5 cells.

[0260] The data (FIG. 3) indicate that strains Mut HN(F277L)/M(G165W) and rgMut HN(F277L)/M(G165W) yield at least 10-fold higher virus titers than MTH68. Furthermore, the data indicate that the mutation at amino acid position 277 in the HN gene is responsible for this effect. The M mutation does not seem to have an effect. This can be best seen when looking at the virus titers 24 h after infection, or even better when comparing the increase in virus titer between 8 h and 24 h (the exponential growth phase). The virus titer shows an increase of 3.5 (log 10) for Mut HN(F277L)/M(G165W), rgMut HN(F277L)/M(G165W) and rgMut HN(F277L)/M(W165G), whereas this is 2.5 for MTH68, 2.7 for rgMut HN(L277F) and 3.0 for rgMTH68 (Table 3).

[0261] rgMut HN(F277L)/M(W165G) is a strain in which the mutation in the M gene has been restored in accordance with the NDV MTH-68/H.

TABLE-US-00005 TABLE 1 Virus titers (log10 TCID50/ml) Time after infection (h) Virus 0 h 8 h 24 h 48 h MTH68 4.8 4.5 7.0 7.0 Mut HN(F277L)/ 5.0 4.3 7.8 8.3 M(G165W) rgMTH68 5.0 4.0 7.0 7.5 rgMut HN(L277F) 5.0 4.3 7.0 7.3 rgMut M(W165G) 4.8 4.3 7.8 7.5 rgMutHu 5.3 4.5 8.0 8.0

Example 4

Generation of Recombinant NDV-Strains with Enhanced Oncolytic and Immune Stimulating Properties Due to the Expression of Different Therapeutic Proteins

[0262] To this end, three different rgMut HN(F277L)/M(G165W)/F(F117S)/F(F190L)/L(V757I)/L(F1551S)/L(R1700L) strains were generated, expressing the genes for:

[0263] 1) Atezolizumab

[0264] 2) Bevacizumab

[0265] 4.1 Generation of Recombinant Viruses

[0266] Recombinant NDV-Mut HN(F277L)/M(G165W)/F(F117S)/F(F190L)/L(V7571)/L(F1551S)/L(R1700L) viruses (rgNDV-Mut HN(F277L)/M(G165W/F(F117S)/F(F190L)/L(V757I)/L(F1551S)/L(R1700L)) expressing Atezolizumab or Bevacizumab were generated by means of the previously established reverse genetics system described above. The genes encoding the heavy- and light-chain of Atezolizumab or the genes encoding the heavy- and light-chain of Bevacizumab were inserted into the full-length cDNA of NDV-Mut HN(F277L)/M(G165W)/F(F117S)/F(F190L)/L(V757I)/L(F1551S)/L(R1700L) between the P and the M genes. To this end the open reading frames of the foreign genes were fused via a 2A sequence. The genes were provided with the necessary NDV gene-start and gene-end sequences in order to allow transcription by the vRNA polymerase.

[0267] FIG. 2 shows the final constellation of the recombinant virus that was rescued from cloned full-length cDNA by means of the NDV reverse-genetics systems.

[0268] Infectious virus was rescued for both constructs, and virus stocks were prepared by two passages in HeLa cells. The nucleotide sequences of the inserted genes in the different recombinant viruses were verified by means of nucleotide sequence analysis and found to be correct.

[0269] Expression of Atezolizumab and Bevacizumab was determined and quantified by using a total human IgG ELISA (Invitrogen). The amount of Atezolizumab and Bevacizumab, respectively that is secreted into the medium of HeLa cells infected with the above mentioned recombinant NDV strains encoding Atezolizumab or Bevacizumab was determined by analyzing the culture supernatant of the 2.sup.nd passage on HeLa cells.

[0270] As can be seen from the OD450 values given in Table 2 below, the production of Atezolizumab reached approximately 15.3 μg/ml and the production of Bevacizumab reached approximately 155.7 μg/ml.

TABLE-US-00006 TABLE 2 OD450 values of a human IgG ELISA. As negative control the respectively mutated NDV-strain without an inserted foreign gene has been used. rgMutHu2- rgMutHu2- Calibration Negative Ate- Beva- IgG ng/ml control zolizumab cizumab Dilution 100 1.565 0.071 2.192 3.51 1:5   50 0.923 0.081 1.657 3.441 1:50  25 0.665 0.079 0.636 1.573 1:500  12.5 0.401 0.078 0.307 0.644 1:5000 6.25 0.258 3.12 0.186 0 0.081 0 0.082

REFERENCES

[0271] Blach-Olszewska et al., (1977) Why HeLa cells do not produce interferon? Arch Immunol Ther Exp (Warsz) 25:683-91.

[0272] Chng et al., (2015) Cleavage efficient 2A peptides for high level monoclonal antibody expression in CHO cells, mAbs, 7:2, 403-412; http://dx.doi.org/10.1080/19420862.2015.1008351.

[0273] Enoch et al., (1986) Activation of the Human beta-Interferon Gene Requires an Interferon-Inducible Factor, Mol. Cell. Biol. 6:801-10.

[0274] Haryadi et al., (2015) Optimization of Heavy Chain and Light Chain Signal Peptides for High Level Expression of Therapeutic Antibodies in CHO Cells. PLoS ONE 10(2): e0116878. doi:10.1371/journal.pone.0116878.

[0275] Schirrmacher, (2015) Oncolytic Newcastle disease virus as a prospective anti-cancer therapy. A biologic agent with potential to break therapy resistance. Expert Opin. Biol. Ther. 15:17 57-71

[0276] Zamarin et al., (2014) Localized oncolytic virotherapy overcomes systemic tumor resistance to immune checkpoint blockade immunotherapy. Sci. Transl. Med. 6(226).

[0277] Zamarin & Palese, (2017) Oncolytic Newcastle Disease Virus for cancer therapy: old challenges and new directions. Future Microbiol. 7: 347-67.

TABLE-US-00007 APPENDIX 1 primers used for the generation of cDNA fragments and helper-plasmids cDNA fragments Fragment Size Primer Sequence (5’-3’) C1 3.6 kb Noss-09 ACGACTCACTATAGGaccaaacagagaatccgtgag (SEQ ID No. 28) Noss-121 CCGGGAAGATCCAGGgcactcttcttgcatgttac (SEQ ID No. 29) C2 3.7 kb Noss-122 GGGCCTGCCTCACTAtggtggtaacatgcaagaag (SEQ ID No. 30) Noss-123 TGCATGTTACCACCAatgtgtcattgtatcgcttg (SEQ ID No. 31) C3 5.7 kb Noss-125 CAAGAAGGGAGATACgtaatatacaagcgatacaatg (SEQ ID No. 32) Noss-126 TCGCTTGTATATTACttgttgtagcaaagagcacc (SEQ ID No. 33) C8 2.0 kb Noss-133 GGCCTGGATCTTCCCattatgctgtctgtatacggtgc (SEQ ID No. 34) Noss-10 ATGCCATGCCGACCCaccaaacaaagacttggtgaatg (SEQ ID No. 35) iPCR 2.5 kb Noss-17 CCTATAGTGAGTCGTATTAATTTC pOLTV5 (SEQ ID (StuI) No. 36) Noss-128 CCTGGATCTTCCCGGGTCGG (SEQ ID No. 37) iPCR 2.5 kb Noss-137 GGGTCGGCATGGCATCTCCACC pOLTV5 (SEQ ID (SmaI) No. 38) Noss-138 GGGAAGATCCAGGCCTATAGTG (SEQ ID No. 39) Helper-plasmides (generated by In-Fusion ® cloning in pCVI) Gene primer sequence NP Noss-22 CTCTAGAGTCGACCCttctgccaacatgtcttccg (SEQ ID No. 40) Noss-23 GGGAAGCGGCCGCCCgtcggtcagtatccccagtc (SEQ ID No. 41) P Noss-24 CTCTAGAGTCGACCCcagagtgaagatggccaccttc (SEQ ID No. 42) Noss- GGGAAGCGGCCGCCCgtagtagtgatcagccattc 25n (SEQ ID No. 43) L Noss-26 CTCTAGAGTCGACCCgggtaggacatggcgggctc (SEQ ID No. 44) Noss-27 GGGAAGCGGCCGCCCtgcctttaagagtcacagttac (SEQ ID No. 45)