TARGETED MUTATIONS
20170037393 ยท 2017-02-09
Assignee
Inventors
Cpc classification
C12N2830/00
CHEMISTRY; METALLURGY
Y02E50/10
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
C12N15/74
CHEMISTRY; METALLURGY
International classification
C12N15/10
CHEMISTRY; METALLURGY
C12N15/90
CHEMISTRY; METALLURGY
Abstract
The present invention relates to a process for producing and selecting for targeted mutations in bacterial genomes. In particular, the process relates to the transformation of bacteria with a Recombination Element which comprises the desired mutation followed by homologous recombination of the Recombination Element into the bacterial genome; the CRISPR/Cas system is then used to eliminate bacteria which do not have the desired mutation.
Claims
1. A process for producing a mutation in an Intended Mutagenesis Region (IMR) within a bacterial genome, wherein the bacteria comprise a CRISPR/Cas system, and wherein the IMR comprises a CRISPR PAM/Protospacer which is capable of being recognised by the bacteria's CRISPR/Cas systems, the process comprising the steps: (a) transforming a population of said bacteria with a Recombination Vector, wherein the Recombination Vector comprises a Recombination Element, wherein the Recombination Element comprises: (i) a Substitution Element, wherein the Substitution Element comprises the mutation, and (ii) Homology Arms which flank the Substitution Element, wherein the Homology Arms are capable of promoting the replacement of all or part of the IMR in the bacterial genome with an element which comprises the Substitution Element, wherein the Recombination Element does not comprise a CRISPR PAM/Protospacer which is capable of being recognised by a crRNA which recognises the CRISPR/PAM Protospacer in the IMR; (b) culturing the population of bacteria under conditions wherein, in one or more bacteria within the population, all or part of the IMR in the genomes of those bacteria is replaced by an element which comprises the Substitution Element and whereby the CRISPR PAM/Protospacer is removed from the IMR in the genomes of those bacteria or is rendered incapable of being recognised by a crRNA which recognises the CRISPR/PAM Protospacer in the IMR; (c) transforming the population of bacteria with a Killing Vector which is capable of directing production of a crRNA which targets the CRISPR PAM/Protospacer in the IMR of any bacteria in the population from which the CRISPR PAM/Protospacer has not thereby promoting the CAS endonuclease-induced cleavage of those CRISPR PAM/Protospacers in the genomic DNA which are recognised by the crRNA and the subsequent death of those bacteria; and (d) selecting or isolating one or more bacteria from the population whose genomes comprise the Substitution Element comprising the mutation.
2. A process as claimed in claim 1, wherein the bacteria are non-highly recombinogenic bacteria.
3. A process as claimed in claim 1 or claim 2, wherein prior to step (c), one or more transformed bacteria are isolated and sub-cultured further to produce one or more further populations of bacteria which are then transformed with the Killing Vector.
4. A process as claimed in any one of claims 1 to 3, wherein the PAM/Protospacer in the IMR is present within a region of DNA which corresponds in the Recombination Element to: (i) the Substitution Element; (ii) the overlap between the upstream Homology Arm and the Substitution Element; (iii) the overlap between the downstream Homology Arm and the Substitution Element; (iv) the upstream Homology Arm; or (v) the downstream Homology Arm.
5. A process as claimed in claim 4, wherein the PAM/Protospacer in the IMR is present within a region of DNA which corresponds in the Recombination Element to: (i) the Substitution Element; (ii) the overlap between the upstream Homology Arm and the Substitution Element; or (iii) the overlap between the downstream Homology Arm and the Substitution Element.
6. A process as claimed in claim 5, wherein the PAM/Protospacer in the IMR is present within a region of DNA which corresponds to the Substitution Element.
7. A process as claimed in any one of the preceding claims, wherein the Killing Vector comprises: (i) a Cas Leader Element (ii) a first Cas Direct Repeat Element (iii) a Cas Spacer Element which is capable of producing a crRNA which targets the CRISPR PAM/Protospacer in the IMR; and (iv) a second Cas Direct Repeat Element.
8. A process as claimed in any one of the preceding claims, wherein the mutation is a substitution, deletion or insertion of one or more nucleotides, or a combination of one or more substitution, deletion or insertion.
9. A process as claimed in claim 8, wherein the mutation is in the PAM/Protospacer.
10. A process as claimed in claim 8 or claim 9, wherein the mutation is a SNP.
11. A process as claimed in any one of the preceding claims, wherein the bacteria have an endogenous CRISPR/Cas system.
12. A process as claimed in any one of the preceding claims, wherein the bacteria have a Type I CRISPR/Cas system.
13. A process as claimed in any one of the preceding claims, wherein the bacteria are Gram positive bacteria.
14. A process as claimed in any one of the preceding claims, wherein the bacteria are of the class Clostridia, preferably of the order Clostridiaceae, more preferably of the genus Clostridium or where the bacteria are of the order Actinomycetales or of the genus Bacillus.
15. A process as claimed in claim 14, wherein the bacteria are selected from the group consisting of C. acetobutylicum, C. arbusti, C. aurantibutyricum, C. beijerinckii, C. cellulovorans, C. cellulolyticum, C. thermocellum, C. thermobutyricum, C. paste urianum, C. kluyveri, C. novyi, C. saccharobutylicum, C. thermosuccinogenes, C. thermopalmarium, C. saccharolyticum, C. saccharoperbutylacetonicum, C. tyrobutyricum, C. tetanomorphum, C. magnum, C. ljungdahlii, C. autoethanogenum, C. butyricum, C. puniceum, C. diolis, C. homopropionicum and C. roseum.
Description
BRIEF DESCRIPTION OF THE FIGURES
[0150]
[0151]
[0152]
[0153]
[0154]
[0155]
[0156]
EXAMPLES
Example 1
Alignment of Direct Repeat sequences from a number of Clostridial
[0157] Species
[0158] Aim: To identify some Direct Repeat sequences that could be used in the process of the invention.
[0159] Method:
[0160] Direct Repeats and the Spacer sequences were found using the CRISPRFinder program Grissa, I., Vergnaud, G., & Pourcel, C. (2007). CRISPRFinder: a web tool to identify clustered regularly interspaced short palindromic repeats. Nucleic Acids Res., 35, W52-7.
[0161] Results:
[0162] A selection of Direct Repeat sequences from a number of clostridial species are displayed in
Example 2
Confirming the PAM sequence in C. saccharoperbutylacetonicum N1-4 (HMT)
[0163] Aim: To demonstrate how to test effectiveness of putative PAM sequences.
[0164] Method:
[0165] The sequence of Spacer_53 from the main Direct Repeat cluster of C. saccharoperbutylacetonicum N1-4 (HMT) was cloned into the clostridial shuttle vector, pMTL83251. Immediately adjacent to the 5 end of this Spacer Element various different trinucleotide combinations were incorporated, including the predicted PAM sequences CCC, CCG, OCT and a non-PAM sequence GAC. When correctly combined with a functional PAM sequence, the Spacer Element functions as a Protospacer.
[0166] The plasmids were transformed into C. saccharoperbutylacetonicum N1-4 (HMT) using standard electroporation protocols followed by an overnight recovery stage in Clostridial Growth Medium (CGM) also containing 5% glucose. The mixture was then spread onto CGM agar plates containing 5% glucose and 40 pg/ml erythromycin and left for at least 48 hours in an anaerobic cabinet at 32 C. Colonies were then counted to determine the change in transformation efficiency compared with transformation of the empty vector.
[0167] CGM medium was prepared by dissolving the following amounts in 750 ml dH.sub.2O: 5.0 g yeast extract, 0.75 g K.sub.2HPO.sub.4, 0.75 g KH.sub.2PO.sub.4, 0.40 g MgSO.sub.4.7H.sub.2O, 0.01 g FeSO.sub.4.7H.sub.2O, 0.01 g MnSO.sub.4.4H.sub.2O, 1.0 g NaCl, 2.0 g (NH.sub.4).sub.2SO.sub.4, 2.0 g asparagine (and 15 g bacteriological agar no.1 if making solid medium) and autoclaved. The pH of the medium was not adjusted (usually in the region of 6.6). A glucose solution (50 g glucose dissolved in 250 ml dH.sub.2O to give a 20% (w/v) solution) was prepared and autoclaved separately. Once cool, the glucose and CGM solutions were combined as needed.
[0168] Results:
[0169] The relative efficiencies of transformation of the different plasmids are presented in
Example 3
Making a SNP replacement in C. saccharoperbutylacetonicum N1-4 (HMT)
[0170] Aim: To show how specific point mutations can be made using the disclosed technique.
[0171] Method:
[0172] An IMR sequence was chosen for mutation in the genomic DNA of C. saccharoperbutylacetonicum N1-4 (HMT). From the sequence, a candidate Protospacer Element was identified adjacent to a PAM (in this example CCA). The sequence of this PAM/Protospacer Element is given in Table 1. A Recombination Vector was designed comprising a Substitution Element flanked by a pair of Homology Arms, each arm being approximately 800 bp long. The Substitution Element (Table 1) carries three SNPs relative to the original genomic sequence of the PAM/Protospacer Element. One of the three SNPs was incorporated to mutate the PAM sequence to CTA; the other two were designed to remove a restriction site (uppercase and underlined).
[0173] The Recombination Vector was based on the clostridial shuttle vector pMTL82154. It was transformed into C. saccharoperbutylacetonicum N1-4 (HMT) using standard electroporation protocols. Successful transformants were selected for based on resistance to chloramphenicol (50 pg/ml). Single colonies were picked and transferred into liquid Reinforced Clostridial Medium (RCM) containing chloramphenicol. They were subcultured four or more times in order to promote the double crossover event and loop out of the WT sequence.
[0174] RCM semi-solid medium was prepared as follows: 3 g.L.sup.1 yeast extract, 10 g.L.sup.1 Lab-Lemco powder, 10 g.L.sup.1 peptone, 5 g.L.sup.1 glucose, 1 gL.sup.1 soluble starch, 5 g.L.sup.1 sodium chloride, 3 g.L.sup.1 sodium acetate, 0.5 g.L.sup.1 cysteine hydrochloride, 0.5 g.L.sup.1 agar, pH adjusted to 6.80.2, then sterilised by autoclaving at 121 C.
[0175] These cultures were then transformed with a Killing Vector comprising the Leader sequence and a Spacer Element corresponding to the candidate Protospacer identified above, the Spacer Element being flanked by direct repeat sequences on a pMTL83251 plasmid backbone. Cells were allowed to recover overnight in CGM with 5% glucose before being plated onto CGM-agar containing 5% glucose plus 40 g/ml erythromycin.
[0176] The Spacer Element (Table 1) present on the Killing Vector effectively turns the corresponding sequence in the genome into a functional Protospacer Element. This Spacer carried by the Killing Vector targets the WT sequence only and the bacterium's own Cas system perceives its own genomic DNA as invading DNA and cleaves it resulting in cell death. The only cells that recover after transformation with the Killing Vector must therefore have recombined the Substitution Element into their genomic DNA.
TABLE-US-00001 TABLE1 SequencesofthePAM/ProtospacerElement,the SpacerElementandtheSubstitutionElementused inExample3 PAM/ProtospacerElementsequence: CCActtgctgctccagcgtttcctaggggaccatatagattcatatagat tt(SEQIDNO:1) SpacerElementsequenceinKillingVector: cttgctgctccagcgtttcctaggggaccatatagat (SEQIDNO:2) PartialsequenceofRecombinationVectorshowing SubstitutionElementsequence(boxed):
[0177] High Resolution Melt Curve Analysis (HRM)
[0178] Colonies selected by the above process were screened using high resolution melt curve analysis to identify the presence of SNPs compared to WT sequence. A 1.1 kb region containing the intended location of the SNPs was amplified using primers that would only amplify products from the bacterial chromosome. A second PCR was then carried out on this product to amplify a shorter fragment (85 bp) covering the intended SNP region using Precision Melt supermix (BioRad). After the PCR, a melt curve was run from 70 C. to 80 C. with 0.2 C. increments to give a melt curve for each of the colonies tested.
[0179] The 1.1 kb PCR products from the genomic DNA specific PCRs were also screened for the target mutations by restriction enzyme digest (as two of the SNPs destroyed an AvrlI site) and then by DNA sequencing.
[0180] Results:
[0181] Two promising colonies were obtained after transformation with the Killing Vector, named A and B. This method therefore significantly reduces the number of colonies that need to be screened to identify the required mutations.
[0182] Colonies A and B were analysed by HRM and compared to both the WT and a control strain (carrying one of the three mutations being incorporated), as shown in
[0183] Sanger Sequencing
[0184] Sequencing results for the 1.1 kb PCR products from the genomic specific PCRs generated for the above HRM analysis are shown in
[0185] It confirms that the changes in the HRM curves were due to the three SNPs which had been introduced.
[0186] Subsequent sequencing over this entire region showed no additional mutations had been introduced (data not shown).
Example 4
Making a Precise Deletion in C. saccharoperbutylacetonicum N1-4 (HMT)
[0187] Aim: To show how the process of the invention can be used to make precise deletions within the genome.
[0188] Method:
[0189] An N-terminal deletion mutant was designed in which 12 amino acids were removed from the start of a selected gene and a new start codon added, resulting in an in-frame truncation of the sequence in C. saccharoperbutylacetonicum N1-4 (HMT), named Nt. Two additional SNPs were also incorporated to remove an Awll restriction site. Within this WT region a candidate Protospacer Element was identified adjacent to a PAM (in this example CCA). The sequence of this region with the PAM/Protospacer Element and the region for deletion highlighted is given in Table 2. A Recombination Vector was designed comprising a Substitution Element flanked by a pair of Homology Arms, each arm being approximately 800 bp long. The Substitution Element (Table 2) carries the 36 base pair deletion and new start codon relative to the original genomic sequence.
[0190] The Recombination Vector was based on the clostridial shuttle vector pMTL82154. It was transformed into C. saccharoperbutylacetonicum N1-4 (HMT) using standard electroporation protocols and was selected for based on resistance to chloramphenicol (50 g/ml). Single colonies were picked and transferred into liquid Reinforced Clostridial Medium (RCM) containing chloramphenicol. They were subcultured three or more times to promote the double crossover event to loop out the WT sequence.
[0191] These cultures were then transformed with a Killing Vector comprising the Leader sequence and a Spacer Element corresponding to the candidate Protospacer identified above, the Spacer Element being flanked by direct repeat sequences on a pMTL83251 plasmid backbone. Cells were allowed to recover overnight in CGM with 5% glucose before being plated onto CGM-agar containing 5% glucose plus 40 pg/ml erythromycin.
[0192] The only cells that recover after transformation with the Killing Vector must therefore have recombined the Substitution Element into their genomic DNA resulting in precise deletion of the targeted 12 amino acids at the N-terminus of the gene.
TABLE-US-00002 TABLE2 SequencesofthePAM/ProtospacerElement,the SpacerElementandtheSubstitutionElementused inExample4 WTDNAsequenceinthegenomicDNAshowingthe regionfordeletion(i.e.tobereplacedwiththe SubstitutionElement),boxed,andthePAM/Proto- spacerinitalics:
[0193] Results:
[0194] Approximately 30 promising colonies were screened after transformation with the Killing Vector and of these 21 showed a different HRM curve to the WT control (
Example 5
Integration of new DNA into the C. saccharoperbutylacetonicum N1-4 (HMT) Genome
[0195] Aim: To detail how to use the process of the invention to integrate new DNA into genomic DNA.
[0196] Method:
[0197] A Recombination Vector was designed based on the pMTL82154 backbone. It carries approx. 800 bp up and downstream from a region in the C. saccharoperbutylacetonicum N1-4 (HMT) genome chosen for its absence of coding sequence. A promoter based on the thiolase promoter sequence has been cloned between the two Homology Arms and genes for insertion will be cloned downstream of this promoter, as the Substitution Element, for expression in C. saccharoperbutylacetonicum N1-4 (HMT). At the 5 end of the 3 Homology Arm, the PAM/Protospacer Element sequence (in the IMR) that will be recognised in the WT cell by the Killing Vector carries a single SNP in the PAM sequence. This will ensure that only cells carrying the integrated DNA will survive when the Killing Vector is transformed into the cells.
[0198] The Killing Vector has been constructed based on pMTL83251. It carries the leader sequence and two Direct Repeats flanking a Spacer Element designed from within the intergenic region chosen as the integration site. The Killing Vector has been tested in C. saccharoperbutylacetonicum N1-4 (HMT) and has been shown to kill WT cells. (Transformation of this vector into C. saccharoperbutylacetonicum N1-4 (HMT) resulted in no colonies being recovered.)
[0199] The integration vector has been transformed into C. saccharoperbutylacetonicum N1-4 (HMT) using electroporation and transformants were selected for based on chloramphenicol resistance. After subculturing 3 or more times, the Killing Vector will then be introduced to remove any WT cells from the population, leaving only those cells that have integrated the new DNA into their genomes.
SEQUENCE LISTING FREE TEXT
[0200] SEQ ID NO: 3 <223>Partial sequence of Recombination Vector with Substitution Element
[0201] SEQ ID NO: 5 <223>Partial sequence of Recombination Vector with Substitution Element
[0202] SEQ ID NO: 18 <223>Clostridium saccharoperbutylacetonicum sequence with mutated PAM site
[0203] SEQ ID NO: 19 <223>Mutated Clostridium saccharoperbutylacetonicum sequence
[0204] SEQ ID NO: 20 <223>Mutated Clostridium saccharoperbutylacetonicum sequence
[0205] SEQ ID NO: 21 <223>Clostridium saccharoperbutylacetonicum sequence with deletion