ANTI-ROR1 MONOCLONAL ANTIBODY, FUNCTIONAL FRAGMENT THEREOF, GENE, DRUG DELIVERY COMPOSITION, AND PHARMACEUTICAL COMPOSITION
20220323598 · 2022-10-13
Inventors
Cpc classification
C07K2317/30
CHEMISTRY; METALLURGY
C07K2317/24
CHEMISTRY; METALLURGY
C07K2317/73
CHEMISTRY; METALLURGY
A61K47/6803
HUMAN NECESSITIES
A61K47/6849
HUMAN NECESSITIES
A61K47/6851
HUMAN NECESSITIES
A61P35/00
HUMAN NECESSITIES
International classification
Abstract
The present invention addresses the problem of providing an anti-ROR1 monoclonal antibody that is taken in a cancer cell with ROR1 during endocytosis of the cancer cell. This problem can be solved by an anti-ROR1 monoclonal antibody that recognizes the amino acid sequence from position 156 to 300 of human ROR1 protein (GenBank accession No. NP_005003.2) as an epitope.
Claims
1. An anti-ROR1 monoclonal antibody that recognizes positions 156 to 300 in the amino acid sequence of a human ROR1 protein (GenBank accession No. NP_005003.2) as an epitope.
2. The anti-ROR1 monoclonal antibody according to claim 1, wherein the anti-ROR1 monoclonal antibody is specifically coupled to an ROR1 of a human cancer cell and endocytosed in a cell by endocytosis.
3. The anti-ROR1 monoclonal antibody according to claim 1, wherein a heavy-chain variable region includes a region consisting of a CDR1 H region consisting of an amino acid sequence of SYGIS (SEQ ID No. 18), a CDR2 H region consisting of an amino acid sequence of EISPRSGYTYYNEKFKG (SEQ ID No. 19), and a CDR3 H region consisting of an amino acid sequence of PHYGDYVGY (SEQ ID No. 20), and wherein a light-chain variable region includes a region consisting of a CDR1 L region consisting of an amino acid sequence of RSSQSLVHSNGNTYLH (SEQ ID No. 23), a CDR2 L region consisting of an amino acid sequence of KVSNRFS (SEQ ID No. 24), and a CDR3 L region consisting of an amino acid sequence of SQSTHVPFT (SEQ ID No. 25).
4. The anti-ROR1 monoclonal antibody according to claim 1, wherein the amino acid sequence of an H-chain variable region is of SEQ ID No. 17, and wherein the amino acid sequence of an L-chain variable region is of SEQ ID No. 22.
5. A functional fragment of the anti-ROR1 monoclonal antibody according to claim 1.
6. A gene having, as an open reading frame region, a gene that encodes the CDR sequence according to claim 3.
7. A drug delivery composition including the anti-ROR1 monoclonal antibody according to claim 1.
8. A pharmaceutical composition including: the anti-ROR1 monoclonal antibody according to claim 1; a linker; and a drug, wherein one terminal of the linker is coupled to the anti-ROR1 monoclonal antibody, and the other terminal of the linker is coupled to the drug.
9. The anti-ROR1 monoclonal antibody according to claim 2, wherein a heavy-chain variable region includes a region consisting of a CDR1 H region consisting of an amino acid sequence of SYGIS (SEQ ID No. 18), a CDR2 H region consisting of an amino acid sequence of EISPRSGYTYYNEKFKG (SEQ ID No. 19), and a CDR3 H region consisting of an amino acid sequence of PHYGDYVGY (SEQ ID No. 20), and wherein a light-chain variable region includes a region consisting of a CDR1 L region consisting of an amino acid sequence of RSSQSLVHSNGNTYLH (SEQ ID No. 23), a CDR2 L region consisting of an amino acid sequence of KVSNRFS (SEQ ID No. 24), and a CDR3 L region consisting of an amino acid sequence of SQSTHVPFT (SEQ ID No. 25).
10. The anti-ROR1 monoclonal antibody according to claim 2, wherein the amino acid sequence of an H-chain variable region is of SEQ ID No. 17, and wherein the amino acid sequence of an L-chain variable region is of SEQ ID No. 22.
11. The anti-ROR1 monoclonal antibody according to claim 3, wherein the amino acid sequence of an H-chain variable region is of SEQ ID No. 17, and wherein the amino acid sequence of an L-chain variable region is of SEQ ID No. 22.
12. The anti-ROR1 monoclonal antibody according to claim 9, wherein the amino acid sequence of an H-chain variable region is of SEQ ID No. 17, and wherein the amino acid sequence of an L-chain variable region is of SEQ ID No. 22.
13. A functional fragment of the anti-ROR1 monoclonal antibody according to claim 2.
14. A functional fragment of the anti-ROR1 monoclonal antibody according to claim 3.
15. A functional fragment of the anti-ROR1 monoclonal antibody according to claim 4.
16. A functional fragment of the anti-ROR1 monoclonal antibody according to claim 9.
17. A functional fragment of the anti-ROR1 monoclonal antibody according to claim 12.
18. A gene having, as an open reading frame region, a gene that encodes the variable region according to claim 4.
19. A drug delivery composition including the functional fragment of the anti-ROR1 monoclonal antibody according to claim 5.
20. A pharmaceutical composition including: the functional fragment of the anti-ROR1 monoclonal antibody according to claim 5; a linker; and a drug, wherein one terminal of the linker is coupled to the functional fragment, and the other terminal of the linker is coupled to the drug.
Description
BRIEF DESCRIPTION OF DRAWINGS
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
DESCRIPTION OF EMBODIMENTS
[0048] An anti-ROR1 monoclonal antibody (hereafter, which may be simply referred to as “antibody”) and a functional fragment thereof, a gene, a drug delivery composition, and a pharmaceutical composition will be described below in detail.
[0049] The antibody disclosed in the present specification means an antibody that recognizes, as an epitope, positions 156 to 300 in the amino acid sequence of the extracellular region of a human ROR1 and is specifically coupled thereto and that includes a fragment (which may be referred to as a “functional fragment” in the present specification) or a derivative of the antibody exhibiting substantially the same antigen specificity as the original antibody. The functional fragment or the derivative of an antibody includes a functional fragment of the antibody, such as a peptide containing Fab, Fab′, F(ab′).sub.2, a single chain antibody (scFv), a disulfide-stabilized V region fragment (dsFv), or CDR, a derivative such as a humanized antibody (for example, a CDR-implant complete human antibody), or the like. The derivative can be created by a known method by using a gene recombination technology.
[0050] Amino acid sequences, gene information, and the cDNA sequences of a human ROR1 are well known, and information on the sequence or the like is available from the amino acid sequence deposited in GenBank accession No. NP 005003.2, the gene information on GenBank Gene ID: 4919, and the cDNA deposited in GenBank accession No. NM_005012.1, for example. The full length of the amino acid sequence of the human ROR1 is 937, and positions 1 to 403 in the amino acid sequence correspond to the extracellular region.
[0051] Further, in the present specification, when “positions 156 to 300 in the amino acid sequence of the human ROR1 protein (GenBank accession No. NP_005003.2)” is stated, in addition to positions 156 to 300 in the amino acid sequence, the derivatives thereof are included. The term “derivative” as used herein includes one or a plurality of (for example, several (for example, six)) mutated, substituted, deleted, and/or added amino acid residues at positions 156 to 300 in the amino acid sequence and means peptide or polypeptide substantially having the same antigenicity as those of positions 156 to 300 in the amino acid sequence of the human ROR1. The term “substantially” as used herein means that an antibody created from positions 156 to 300 in the amino acid sequence as an epitope is specifically coupled to an ROR1 and has a function of being endocytosed in a cancer cell together with the ROR1 during endocytosis.
[0052] The term “epitope” refers to a part of an antigen recognized by an antibody (in the case of the present specification, positions 156 to 300 in the amino acid sequence of the extracellular region of a human ROR1) and means a site on an antigen to which a region including an antibody variable region disclosed in the present specification is coupled. For example, when polypeptide such as an ROR1 is an antigen, the antibody may recognize a linear amino acid sequence and may recognize a three-dimensional spatial structure, and therefore, the epitope can be defined by an amino acid sequence or antigen structure. Note that the extracellular region of the amino acid sequence of the human ROR1 includes three regions referred to as Ig (amino acid positions: 66 to 148), cysteine-rich domain (CRD, amino acid positions: 166 to 307), and Kringle (amino acid positions: 311 to 393) (see
[0053] The antibody disclosed in the present specification is specifically coupled to an ROR1 of a human cancer cell and endocytosed in the cell by endocytosis as illustrated in Examples described later. Thus, the antibody can be used as an antibody for delivering a drug or the like that damage a cancer cell. Therefore, a composition in which the antibodies disclosed in the present specification are dispersed in a medium or the like can be provided as a drug delivery composition.
[0054] Further, it is possible to provide a pharmaceutical composition using the antibody disclosed in the present specification by coupling one end of a linker to the antibody disclosed in the present specification and coupling a drug to the other end of the linker. Any of cleavage type linkers and non-cleavage type linkers may be used for the linker. Further, the drug is not particularly limited as long as it is a drug for cancer therapy such as killing a cancer cell or suppressing proliferation of cancer cells and can be coupled to a linker. Note that, when coupling a linker to an antibody, it is preferable to couple a linker to a site other than the H-chain variable region and the L-chain variable region so as not to inhibit coupling of the antibody to an ROR1.
[0055] The cancer cell is not particularly limited as long as an ROR1 has expressed therein and may be a cell of cancer such as, but not limited thereto, lung cancer (including lung adenocarcinoma, small cell lung cancer, squamous cell lung cancer, and large-cell lung cancer), pancreatic cancer, malignant mesothelioma, breast cancer, stomach cancer, colorectal cancer, oral cancer, esophageal cancer, uterine cancer, kidney cancer, bladder cancer, ovarian cancer, testicular cancer, and the like, for example. The biological species from which a cancer cell is derived may be, but not limited to, human, monkey, mouse, rat, guinea pig, pig, cow, sheep, goat, and the like, for example.
[0056] While Examples will be presented below and embodiments will be specifically described, these Examples and embodiments are not intended to limit or restrict the scope of the invention disclosed in the present specification.
EXAMPLES
[0057] (1) Construction of Various Expression Construct of Human ROR1
[0058] A cDNA sequence (NM_005012.1) of the full length of a human ROR1 was cut out from pCMV6-KL6-ROR1 (OriGene Technologies, Rockville, MDs) and introduced in pCMVpuro to create pCMVpuro-ROR1. Furthermore, animal cells that are controlled by a CMV promotor and cause the full length of a human ROR1 (amino acid positions 1 to 937) or the full length of a human ROR1 extracellular region (amino acid positions 1 to 403) to express at the same time as a puromycin-EGFP fusion protein in the downstream of the IRES sequence were obtained by the method below.
<Full Length of Human ROR1>
[0059] A PCR product amplified by using 5′ Primer including a NotI site
TABLE-US-00001 (SEQ ID No. 1: 5′-AATAGCGGCCGCACCATGCACCGGCCGCGCC-3′
the underline indicates the NotI site, and an underline part indicates a site to be cut by a restriction enzyme, though the repeated description will be omitted in the sequences below) and 3′ Primer including an XhoI site (SEQ ID No. 2: 5′-GCGGCTCGAGCAGTTCTGCAGAAA TCATAGATTCG-3′) was digested with restriction enzymes NotI and XhoI, and thereby a fragment was obtained. The obtained fragment was introduced in a NotI-XhoI site of pQCXIPG, and an expression vector pQCXIPG-full was constructed.
<Full Length of Human ROR1 Extracellular Region>
[0060] A PCR product obtained by using 5′ Primer including a NotI site (SEQ ID No. 1) and 3′ Primer including a BamHI site (SEQ ID No. 3: 5′-CCGCGGATCCTTCCATTTTATTCTTCTCCTTGG-3′) was digested with NotI and BamHI, and thereby a fragment was obtained. The obtained fragment is introduced in a NotI-BamHI site of pQCXIPG, and an expression vector pQCXIPG-EC was constructed.
[0061] On the other hand, a secretory signal sequence of chicken egg white lysozyme (amino acid sequence: MRSLLILVLCFLPLAALGIAAA (SEQ ID No. 46), gene sequence: ATGAGGTCTTTGCTAATCTTGGTGCTTTGCTTCC TGCCCCTGGCTGCTCTGGGG|GCGGCCGCC (SEQ ID No. 47)) was added to the upstream of a multicloning site of the pQCXIPG described above, and a vector (lyssig-pQCXIPG) that enables forced secretion of a translation product of an introduced gene outside the cell was used for a vector used for causing a partial length of a human ROR1 including the human CDR region and the Kringle region (amino acid positions 156 to 403) and a partial length of a human ROR1 including the human CDR region (amino acid positions 156 to 300) to express in an animal cell.
<Partial Length of Human ROR1 Including Human CDR Region and Kringle Region>
[0062] A PCR product amplified by using 5′ Primer including a NotI site
TABLE-US-00002 (SEQ ID No. 4: 5′-AATAGCGGCCGCAAGTCCAGGATACTCAGATGA-3′)
and 3′ Primer including a BamHI site (SEQ ID No. 3) was digested with restriction enzymes NotI and BamHI, and thereby a fragment was obtained. The obtained fragment was introduced in a NotI-BamHI site of lyssig-pQCXIPG, and an expression vector pQCXIPG-CK was constructed. Note that pQCXIPG and lyssig-pQCXIPG are vectors modified based on pQCXIP of BD Retro-XTM Q Vectors.
<Partial Length of Human ROR1 Including Human CDR Region>
[0063] A PCR product amplified by using 5′
TABLE-US-00003 Primer (5′-AATAGCGGCCGCAAGTCCAGGATACTCAGATGA-3′ (SEQ ID No. 4))
and 3′ Primer including a BamHI site (SEQ ID No. 5: 5′-AGCAGGATCCAATCCGGATACAGTTCGCA-3′) was digested with restriction enzymes NotI and BamHI, and thereby a fragment was obtained. The obtained fragment was introduced in a NotI-BamHI site of lyssig-pQCXIPG, and an expression vector pQCXIPG-CDR was constructed.
(2) Establishment of Cell Line Causing Expression of Human ROR1
[0064] To establish an antigen expressing cell line, Pantropic Retroviral Expression System (Clontech; K1063-1) was used. A GP2-293 (Clontech; K1063-1) in an 80 to 90% confluent state was provided in a collagen-coated 100 mm dish, and 11.2 μg of an expression vector constructed as described above (pQCXIPG-full, pQCXIPG-EC, pQCXIPG-CK, pQCXIPG-CDR) using Lipofectamine 2000 and 11.2 μg of pVSV-G (Clontech; K1063-1) are co-transfected. After 48 hours, the supernatant containing virus particles was collected, and virus was precipitated by super centrifuge (18,000 rpm, 1.5 hours, 4 degrees Celsius). The precipitate was suspended with 30 μL of THE (50 mM, Tris-HCl [pH 7.8], 130 mM NaCl, 1 mM EDTA), and a retroviral vector concentrated solution was prepared.
[0065] Then, 5 μL of the retroviral vector concentrated solution was diluted with 150 μL of DMEM (SIGMA; D5796)-10% FBS containing 8 μg/ml of hexadimethrine bromide (SIGMA; H-9268) to prepare a culture medium containing virus particles. A 293T culture medium provided so as to be in a state of around 40% confluent in a 96-well microplate was replaced with the prepared culture medium containing the virus particles, and thereby pQCXIPG-full, pQCXIPG-EC, pQCXIPG-CK, and pQCXIPG-CDR were genetically introduced. After the genetic introduction, the resultant was amplified and cultured with DMEM (SIGMA; D5796)-10% FBS containing 5 μg/ml of puromycin (SIGMA; P-8833) to establish an antigen expressing cell line (hROR1-full/293T, hROR1-EC/293T, hROR1-CK/293T, hROR1-CDR/293T).
(3) Preparation of Antigen for Immunization
[0066] Around 1 L of a supernatant obtained by culturing the above established expressing cell line (hROR1-EC/293T, hROR1-CK/293T, hROR1-CDR/293T) with DMEM-10% FBS (5 μg/ml puromycin) or CD293 (Invitrogen) was collected, a myc-His tagged recombinant protein was purified from the collected supernatant by using an affinity column filled with carries chemically modified from a myc-tag antibody or a TALON Purification Kit (Clontech; K1253-1) and then dialyzed with PBS, and a purified protein was observed by using SDS-PAGE and western blot. A protein assay kit II (BioRad; 500-0002JA) was used to determine the protein concentration, and the antigen for immunization was prepared.
(4) Immunization
[0067] A purified protein of a human ROR1 extracellular region (hROR1-EC), a purified protein of a partial length including the human ROR1 CDR-Kringle region (hROR1-CK), or a purified protein of a partial length including the human ROR1 CDR region (hROR1-CDR) were mixed with the same amount of complete adjuvant (SIGMA; F5881) to obtain an emulsion, and BALB/c mice (female) were immunized with the emulsion at 5 to 50 μg/head for several times every three to seven days. Further, in a case of immunization with the cell hROR1-full/293T in which the full length of a human ROR1 expressed, mice were immunized at 1×10.sup.5 cells/head for several times every three to seven days. Lymphocyte cells were extracted from the mice after three to five days from the final immunization, and cell fusion of the extracted lymphocyte cells with mouse myeloma cells P3U1 (P3-X63Ag8U1) was performed.
(5) Cell Fusion and Selection and Acquisition of Monoclonal Antibody-Producing Cell
[0068] Cell fusion was performed based on a general method illustrated below. For the fetal bovine serum (FBS) in all the culture media, a serum inactivated by a process of maintaining the temperature at 56 degrees Celsius for 30 minutes was used. The P3U1 was provided by being cultured with RPMI1640-10% FBS (containing penicillin, streptomycin). The extracted mouse lymphocyte cells and the P3U1 were mixed at a ratio of 10:1 to 2:1 and centrifuged. Then, 50% polyethylene glycol 4000 (Merck; 1.09727.0100) was gradually added as a fusion accelerating agent to the precipitated cells and gently mixed to perform cell fusion. Furthermore, after the RPMI1640 was gradually added and gently mixed, the mixture was centrifuged. The precipitated fused cells were diluted as appropriate with a HAT culture medium containing 15% FBS (containing RPMI1640, HAT-supplement (Invitrogen; 11067-030), penicillin, streptomycin) and seeded on a 96-well microplate at 200 μL/well.
[0069] The fused cells were cultured in a CO.sub.2 incubator (5% CO.sub.2, 37 degrees Celsius), and after a colony was sufficiently formed, a cultured supernatant was sampled and screened. In the screening, from those found to be positive in ELISA performed on a 96-well plate on which the ROR1 antigen used for immunization was sensitized, hybridomas were sorted with which response was observed by flow cytometry performed on the 293T in which the full length of the ROR1 was forcedly caused to express (hROR1-full/293T). After these hybridomas were amplified and cultured with an HT culture medium containing 15% FBS (containing RPMI1640, HT-supplement (Invitrogen; 21060-017), penicillin, streptomycin) and mono-cloned by a limiting dilution method. In such a way, 45 types of hybridoma clones (
(6) Response of Antibody to Human ROR1 Expressing Cell (FACS)
[0070] To inspect response of the antibodies obtained as described above to an endogenous human ROR1, response to an ROR1 high expressing cell NCI-H358 (ATCC accession No. CRL-5807) line was observed as below. The antibodies were purified from the culture supernatant of each hybridoma clone by a general affinity purification method using Protein A-Sepharose, respectively. The obtained purified antibodies were analyzed for the average fluorescence intensity of flow cytometry under the same condition (the same number of NCI-H358 (1×10.sup.5), the same concentration of respective purified antibodies, and the same concentration of secondary (detected) antibodies). Further, data was acquired also for the average fluorescence intensity that depends on the antibody concentration, the detection limit at a low concentration was analyzed, and thereby relative affinity was evaluated.
(7) Isolation of VH Gene and VL Gene of Antibody and Identification of CDR
[0071] Next, two types of hybridomas were selected from hybridomas that produce antibodies which recognize the Ig region illustrated in
[0072] After the VH gene and the VL gene were subcloned to a pT7Blue vector, respectively, an auto-sequencer (by Applied Biosystem) or a fluorescent auto-sequencer was used to analyze the sequence. Amino acids encoded by the resultant VH sequence and the resultant VL sequence and each CDR sequence were determined.
[0073] Respective identified sequences are indicated below. The details of the amino acid sequences are indicated in Table 1, and the details of the base sequences are indicated in Table 2 and Table 3.
<2DC_5-2: Recognize the Ig Region>
(Amino Acid Sequences)
[0074] VH CDR1: SEQ ID No.: amino acid sequence indicated in No. 8 [0075] VH CDR2: SEQ ID No.: amino acid sequence indicated in No. 9 [0076] VH CDR3: SEQ ID No.: amino acid sequence indicated in No. 10 [0077] VL CDR1: SEQ ID No.: amino acid sequence indicated in No. 13 [0078] VL CDR2: SEQ ID No.: amino acid sequence indicated in No. 14 [0079] VL CDR3: SEQ ID No.: amino acid sequence indicated in No. 15 [0080] VH: SEQ ID No.: amino acid sequence indicated in No. 7 [0081] VL: SEQ ID No.: amino acid sequence indicated in No. 12
(Base Sequence)
[0082] VH: SEQ ID No.: base sequence indicated in No. 6 [0083] VL: SEQ ID No.: base sequence indicated in No. 11
<6 AM_69-2: Recognize the CDR Region>
(Amino Acid Sequences)
[0084] VH CDR1: SEQ ID No.: amino acid sequence indicated in No. 18 [0085] VH CDR2: SEQ ID No.: amino acid sequence indicated in No. 19 [0086] VH CDR3: SEQ ID No.: amino acid sequence indicated in No. 20 [0087] VL CDR1: SEQ ID No.: amino acid sequence indicated in No. 23 [0088] VL CDR2: SEQ ID No.: amino acid sequence indicated in No. 24 [0089] VL CDR3: SEQ ID No.: amino acid sequence indicated in No. 25 [0090] VH: SEQ ID No.: amino acid sequence indicated in No. 17 [0091] VL: SEQ ID No.: amino acid sequence indicated in No. 22
(Base Sequences)
[0092] VH: SEQ ID No.: base sequence indicated in No. 16 [0093] VL: SEQ ID No.: base sequence indicated in No. 21
<6 AM_120-2: Recognize the Kringle Region>
(Amino Acid Sequences)
[0094] VH CDR1: SEQ ID No.: amino acid sequence indicated in No. 28 [0095] VH CDR2: SEQ ID No.: amino acid sequence indicated in No. 29 [0096] VH CDR3: SEQ ID No.: amino acid sequence indicated in No. 30 [0097] VL CDR1: SEQ ID No.: amino acid sequence indicated in No. 33 [0098] VL CDR2: SEQ ID No.: amino acid sequence indicated in No. 34 [0099] VL CDR3: SEQ ID No.: amino acid sequence indicated in No. 35 [0100] VH: SEQ ID No.: amino acid sequence indicated in No. 27 [0101] VL: SEQ ID No.: amino acid sequence indicated in No. 32 (Base Sequence) [0102] VH: SEQ ID No.: base sequence indicated in No. 26 [0103] VL: SEQ ID No.: base sequence indicated in No. 31
<2 AM_1M17: Recognize the Ig Region>
(Amino Acid Sequences)
[0104] VH CDR1: SEQ ID No.: amino acid sequence indicated in No. 38 [0105] VH CDR2: SEQ ID No.: amino acid sequence indicated in No. 39 [0106] VH CDR3: SEQ ID No.: amino acid sequence indicated in No. 40 [0107] VL CDR1: SEQ ID No.: amino acid sequence indicated in No. 43 [0108] VL CDR2: SEQ ID No.: amino acid sequence indicated in No. 44 [0109] VL CDR3: SEQ ID No.: amino acid sequence indicated in No. 45 [0110] VH: SEQ ID No.: amino acid sequence indicated in No. 37 [0111] VL: SEQ ID No.: amino acid sequence indicated in No. 42
(Base Sequences)
[0112] VH: SEQ ID No.: base sequence indicated in No. 36 [0113] VL: SEQ ID No.: base sequence indicated in No. 41
TABLE-US-00004 TABLE 1 SEQ Clone ID name No. amino acid sequences 2DC_5-2 7 VH EVKLVESGGGLVKPGGSLKLSCAASGFT FSSYAMSWVRQTPEKRLEWVAAINTKGG STYYPDTVKDRFTISRDNAKNILYLQMS SLRSEDTALYYCARHEPVYDYAMDYWGQ GTSVTVSS 8 VH CDR1 SYAMS 9 VH CDR2 AINTKGGSTYYPDTVKD 10 VH CDR3 HEPVYDYAMDY 12 VL DIKMTQSPSSMYASLGERVTITCKASQD INSYLSWFQQKPGKSPKTLIYRANRLVD GVPSRFSGSGSGQDYSLTISSLECGDMG IYYCLQYDEFPYTFGGGTKLEIK 13 VL CDR1 KASQDINSYLS 14 VL CDR2 RANRLVD 15 VL CDR3 LQYDEFPYT 6AM_69-2 17 VH QVQLQQSGAELARPGASVKLSCKASGYT FTSYGISWVKQRTGQQLEWIGEISPRSG YTYYNEKFKGKATLTADKSSSTAYMQLS SLTSEDSAVYFCARPHYGDYVGYWGQGT TLTVSS 18 VH CDR1 SYGIS 19 VH CDR2 EISPRSGYTYYNEKFKG 20 VH CDR3 PHYGDYVGY 22 VL DVVMTQTPLSLPVSLGDQASISCRSSQS LVHSNGNTYLHWYLQKPGQSPKLLIYKV SNRFSGVPDRFSGSGSGTDFTLKISRVE AEDLGVYFCSQSTHVPFTFGTGTKLEIK 23 VL CDR1 RSSQSLVHSNGNTYLH 24 VL CDR2 KVSNRFS 25 VL CDR3 SQSTHVPFT 6AM_120-2 27 VH EIQLQQSGAELVKPGASVKISCKASGYS FTGYNMNWVKQSHGKSLEWIGNINPYYG NTSYNQKFKGKATLTVDKSSSTAYMQLN SLTSEDSAVYYCAREGFEYFDYWGQGTT LTVSS 28 VH CDR1 GYNMN 29 VH CDR2 NINPYYGNTSYNQKFKG 30 VH CDR3 EGFEYFDY 32 VL DIQMTQSPASLSASVGETVTITCRASEN IYSYLAWYQQKQGKSPQLLVYNVKTLAE GVPSRFSGSGSGTQFSLKINSLQPEDFG SYYCQHHYGIPYTFGSGTKLEIK 33 VL CDR1 RASENIYSYLA 34 VL CDR2 NVKTLAE 35 VL CDR3 QHHYGIPYT 2AM_1M17 37 VH EVQLVESGGGLVKPGGSLKLSCAASGFT FSSYAMSWGRQTPEKRLEWVAAINSKGG STYYPDTVKDRFTISRDNAKNTLYLQMS SLRSEDTALVYCARHDERIDYAMDYWGQ GTSVTVSS 38 VH CDR1 SYAMS 39 VH CDR2 AINSKGGSTYYPDTVKD 40 VH CDR3 HDERIDYAMDY 42 VL DIKMTQSPSSMYASLGERVTITCKASQD INSYLSWFQQKPGKSPKTLIYRANRLVD GVPSRFSGSGSGQDYSLTISSLEYEDMG IYYCLQYDEFPYTFGSGTKLEIK 43 VL CDR1 KASQDINSYLS 44 VL CDR2 RANRLVD 45 VL CDR3 LQYDEFPYT
TABLE-US-00005 TABLE 2 SEQ Clone ID name No base sequences 2DC_5-2 6 VH 11 VL
6AM_69-2 16 VH
21 VL
indicates data missing or illegible when filed
TABLE-US-00006 TABLE 3 SEQ Clone ID name No base sequences 6AM_120-2 26 VH 31 VL
2AM_1M17 36 VH
41 VL
indicates data missing or illegible when filed
(8) Creation of Chimerized Antibody
[0114] The VH region and the VL region were amplified by a PCR based on the identified gene sequence, and the PCR products were introduced in an antibody-producing vector in which the constant region of human IgG1 is incorporated by a conventional method. Then, 100 μl at 0.4 μg/μ1 of these expression vectors digested with a restriction enzyme ScaI and 1×10.sup.7 CHO cells (Chinese hamster ovary) were mixed in a cuvette, and transformed by an electroporation method. The mixture was suspended in a Ham F-12 culture medium containing 10% FBS (Thermo Fisher Scientific; 11765054) and dispensed on a 96-well microplate by 100 μl each, puromycin was added to have the final concentration of 20 μg/ml, and the resultant was cultured at 37 degrees Celsius for 12 days. The supernatants were fractionated from the wells forming a single colony, the clones having high activity with a sandwich ELISA method using an anti-human IgG antibody were sorted, the sorted clones were amplified and cultured into a 10 cm dish, the amplified and cultured clones were then acclimatized to an EX-CELL (registered trademark) CD-CHO Fusion culture medium (SAFC; 14365C) to which 4 mM of L-Alanyl-L-Glutamine (Wako; 016-21841) was added, and chimeric antibody-producing cell lines were established. The obtained cell lines were mass-cultured at 37 degrees Celsius with 5% CO.sub.2 for 10 days by using the EX-CELL CD-CHO Fusion culture medium to which 4 mM of L-Alanyl-L-Glutamine was added, and purified antibodies of chimerized antibodies were obtained from the cultured supernatants by using Protein A Sepharose. As illustrated in
(9) Evaluation of Response of Chimeric Antibody to Human ROR1
Expressing Cell
[0115] To inspect response of antibodies obtained as described above to an endogenous human ROR1, the response to the ROR1 high expressing cell line (NCI-H1975, PC-9) and the ROR1 low expressing cell line (A427, NCI-H460) was observed as follows. Note that NCI-H1975 (ATCC accession No. CRL-5908), A427 (ATCC accession No. HTB-53), and NCI-H460 (ATCC accession No. HTB-177) were purchased from American Type Culture Collection. The PC-9 cell line (RCB 4455) was obtained from RIKEN cell bank. Various cell lines were seeded on 6-well dishes to have 2×10.sup.5/well, cultured at 37 degrees Celsius for 24 hours, and collected after PBS washing. After chimerized antibodies labeled by using Alexa Fluor (registered trademark) 488 Antibody Labeling Kit (Thermo Fisher Scientific; A20181) were diluted to 1 μg/ml and reacted on ice for one hour, the resultant was washed with a PBS, and the reaction intensity was analyzed by flow cytometry. As a control, isotype control IgG1 against an antigen that does not exist in mammal cells was used.
(10) Evaluation of Endocytosis of Chimeric Antibody into Cell
[0116] Next, to examine endocytosis activity of chimeric antibodies reacted with the human ROR1 into cells, the chimeric antibodies M1 to M4 were recognized by an acid pH-sensitive dye by using pHrodo (registered trademark) Red Microscale Labeling Kit (Thermo Fisher Scientific; P35363). For the ROR1 high expressing cell line PC-9 and the ROR1 low expressing cell line A427, cells at 1×10.sup.5/well were seeded on a 6-well dish having a cover glass therein, pHrodo labeled chimeric antibodies at 5 μg/ml were exposed, reacted at 37 degrees Celsius for 72 hours, and collected after PBS washing, and the fluorescence intensity was measured by flow cytometry.
(11) Evaluation of Cell Proliferation Suppression Effect Using Secondary Antibody Having Coupled Chimeric Antibody and Cytotoxic Drug
[0117] (a) To examine the effect of suppressing cell proliferation using endocytosis activity of chimeric antibodies into cells, a suppressing effect caused by a co-process with chimeric antibodies against cell proliferation was evaluated by using a secondary antibody in which monomethyl auristatin F (MMAF) that is a cytotoxic drug is coupled by a non-cleavage type linker. PC-9 lung adenocarcinoma cell lines were seeded on a 96-well dish at 1×10.sup.3 cells/well, a secondary antibody αHFc-NC-MMAF (Moradec; AH-101AF) in which 0.1 μg/ml or 1.0 μg/ml of the chimeric antibodies M1 to M4 and the MMAF were coupled by a non-cleavage type linker was added in the next day and cultured at 37 degrees Celsius. After five days from the start of the antibody addition process, influence on cell proliferation was studied by using the MTT assay method.
[0118] (b) Next, to further examine the cell proliferation suppression effect of the chimeric antibody M2 that inhibited cell proliferation the most intensively in (a) described above, αHFc-CL-MMAF (Moradec; AH-102AF) in which the cytotoxic drug MMAF is coupled to the secondary antibody by a cleavage type linker was used to perform a co-process of the chimeric antibody M2 and the MMAF-coupled secondary antibody, and influence on the cell proliferation was evaluated. The ROR1 high expressing cell line, namely, the PC-9 cell line and the ROR1 low expressing cell line, namely, the A427 cell line were seeded on a 96-well dish at 1×10.sup.3 cells/well, and 0.1 μg/ml or 1.0 μg/ml of the chimeric antibody M2 and the αHFc-CL-MMAF were added together in the next day, and cultured at 37 degrees Celsius for five days, and suppression activity against cell proliferation was then measured by an MTT assay method.
[0119] As illustrated in
[0120] From the above results, it was revealed that:
[0121] (1) Any antibodies that recognize the extracellular region of the human ROR1 are specifically coupled to the human ROR1;
[0122] (2) However, antibodies that recognize positions 156 to 300 in the amino acid sequence as an epitope exhibit more significant endocytosis into cancer cells than antibodies that recognize other regions as an epitope; and
[0123] (3) Therefore, antibodies that recognize positions 156 to 300 in the amino acid sequence as an epitope can be used as an antibody for delivering a drug into a cancer cell and a pharmaceutical composition when coupled with a drug.
INDUSTRIAL APPLICABILITY
[0124] An antibody that recognizes positions 156 to 300 in the amino acid sequence as an epitope is endocytosed in a cell and thus can be used as a drug delivery antibody or a pharmaceutical composition. Therefore, such an antibody is useful in pharmaceutical industries.