Lyme disease vaccine, genetic construct, recombinant protein, method for designing genetic construct, method for producing vaccine, method for producing recombinant proteins, use of recombinant proteins in the production of lyme disease vaccine

Abstract

The present invention relates to a Lyme disease vaccine, a genetic construct, recombinant protein, method for genetic construct design, method for vaccine delivery, method for recombinant proteins delivery, use of recombinant proteins in the production of Lyme disease vaccine. In particular, the method concerns the use of TROSPA and TROSPA-Salp15 recombinant proteins derived from castor bean tick (Ixodes riccinus) as a component of Lyme disease vaccine for animals. The antibodies present in blood of an immunized vertebrate directed against the TROSPA proteins considerably reduce the chance of infecting new ticks by blocking or hindering the interaction of TROSPA protein with OspA protein of Borrelia burgdorferi sensu lato. The interaction is crucial in the process of the spirochete entering a tick. The antibodies directed against the TROSPA-Salp15 protein protect vertebrates from infection on the stage of Borellia diffusion by destroying their protective coating formed at the surface as a result of the interaction between the Salp15 tick protein and OspC spirochete protein. The vaccine based on TROSPA tick proteins and TROSPA-Salp15 proteins may be used independently or together with the OspA recombinant proteins and OspC protein of Borrelia burgdorferi sensu lato.

Claims

1. An immunogenic composition comprising a recombinant TROSPA protein defined by SEQ ID NO: 3 or a recombinant TROSPA-Salp15 protein defined by SEQ ID NO: 4, wherein the immunogenic composition is administered orally.

2. A method for producing the immunogenic composition of claim 1, comprising the steps of: expression of a genetic construct defined by SEQ ID NO: 1 or SEQ ID NO: 2 in E. coli, isolation and purification of the expressed protein defined by SEQ ID NO: 3 or SEQ ID No: 4, respectively and preparing an immunogenic composition of said protein in a pharmaceutically acceptable buffer.

3. The immunogenic composition of claim 1 further comprising a pharmaceutically acceptable diluent and optionally an adjuvant, carrier and/or vehicle.

4. A kit comprising the immunogenic composition of claim 1.

5. A kit comprising the immunogenic composition of claim 3.

Description

(1) FIG. 1 presents Lyme disease incidence rate in Poland according to the National Institute of Public Health.

(2) To facilitate better understanding of the discussed issues, the solutions are presented in the figures, where:

(3) FIG. 2 presents the selected phases of preparation and expression of the genetic construct coding for the recombinant TROSPA protein. Fig A - DNA electrophoretic analysis: TROSPA gene amplified with PCR on the basis of the DNA isolated from I. ricinus (g), TROSPA cDNA amplified with PCR from RNA isolated from N. benthamiana agroinfiltrated with a construct comprising the TROSPA gene (w). Fig B - electrophoretic analysis of the purified recombinant TROSPA protein produced in E. coli (T), size marker (w). Fig C shows a comparison of a publically available GenBank EUO34646.1 nucleotide sequence of Ixodes ricinus TROSPA mRNA (as mentioned in the Figure description) and the sequence of a genetic construct of SEQ ID NO: 1 coding for the TROSPA recombinant protein. Conservative nucleotides were marked with *, nonconservative nucleotides are put in bold italics;

(4) FIG. 3 shows a comparison of the nucleotide sequence of a genetic construct of SEQ ID NO: 2 coding for the recombinant TROSPA-Salp15 protein and the relevant sequences of Ixodes ricinus Salp15 Iric-1 mRNA, complete cds GenBank: EU128526.1 and Ixodes ricinus TROSPA mRNA complete cds GenBank No. EUO34646.1, the nucleotides identical for the sequences coding the recombinant TROSPA-Salp15 protein and Ixodes ricinus TROSPA mRNA complete cds GenBank No. EUO34646.1 are marked with ,*, the nucleotides identical for the sequences coding the recombinant TROSPA-Salp 15 protein and Ixodes ricinus Salp15 Iric-1 mRNA complete cds GenBank No. EU128526.1 are marked with ,.sup.A, FIG. 3 comprises FIGS. 3A and 3B wherein 3A continues to 3B;

(5) FIG. 4 presents the electrophoretic analysis of purified recombinant TROSPA-Salp15 protein obtained for E. coli;

(6) FIG. 5 presents the amino acid sequences of the recombinant TROSPA protein (SEQ ID NO: 3) and TROSPA-Salp15 protein (SEQ ID NO: 4) (the fragment coding for a protein label of pET200/D-TOPO is bolded and put in lowercase, the fragment coding for the TROSPA sequence is underlined and bolded, the fragment coding for the Salp15 is underlined and put in italics, the site recognized by TEV protease is underlined);

(7) FIG. 6 presents the influence of the recombinant OspA protein concentration on the complex formation between the TROSPA recombinant protein from Ixodes ricinus and OspA recombinant proteins from three different Borrelia species (i.e. B. garinii, B. afzelii and B. burgdorferi sensu stricto); FIG. 6Acomplex formation between TROSPA and OspA proteins of B. garinii, B. afzelii, or B. burgdorferi s. s. The interaction was analyzed on an ELISA microplates coated with recombinant. TROSPA protein and incubated with serial dilutions of recombinant OspA proteins (either from B. garinii, B. afzelii or B. burgdorferi s. s.). As a control, analogous assays with OspC from B. garinii were performed. The detection of the bound protein was carried out using a commercially available primary Borrelia-specific antibodies (rabbit polyclonal IgG) and secondary antibodies (anti-rabbit polyclonal IgG) conjugated with alkaline phosphatase. Absorbance of the soluble product of the alkaline phosphatase reaction was measured by using the Microplate Reader Model 550 (BIORAD);

(8) FIG. 6Bcomparison of the efficiency in complex formation between the recombinant TROSPA and OspA proteins (of B. garinii) in the presence of serum from rabbit immunized with recombinant TROSPA protein. In the control reaction the preimmune rabbit serum was applied. The interaction was analyzed on ELISA microplate coated with recombinant TROSPA protein. The plates were incubated with serial dilutions of immunized and preimmune rabbit serum and, then, with recombinant OspA protein at the concentration of 80 g/ml. The detection of the bound recombinant OspA protein was carried out using the anti-Borrelia antibodies conjugated with FITC, and the fluorescence was measured using the VICTOR X4 2030 Multilabel Reader by PerkinElmer;

(9) FIG. 7 presents the analysis of the specificity of anti-TROSPA antibodies produced in rabbit after parenteral immunization with the recombinant TROSPA protein preparation. The animals were given 100 g of the preparation at four time points: on 0, 14, 28, and 56th day. The serum was taken before immunization (FIG. 7A) and, then, 38 (FIG. 7B), 66 (FIG. 7C), and 87 days (FIG. 7D) after immunization. The presence of antibodies in the serum of the immunized animals was detected by the Western-blot analysis, using the anti-rabbit antibodies conjugated with alkaline phosphatase. T1purified TROSPA protein, T2lysate from bacteria producing TROSPA protein, Klysate from bacteria producing other protein (recombinant OspC protein of B. burgdorferi), Mmass marker;

(10) FIG. 8 presents the level of IgG in the serum of rats immunized with recombinant TROSPA, TROSPA-Salp15 or TROSPA, OspA and OspC proteins; FIG. 8Aa microplate coated with recombinant TROSPA protein was incubated with increasing dilutions of the serum of animals orally immunized with the recombinant TROSPA or TROSPA-Salp15 protein preparation; FIG. 8Ba microplate coated with recombinant Salp15 protein was incubated with increasing dilutions of the serum of animals orally immunized with the TROSPA-Salp15 protein preparation; FIG. 8Ca microplate coated with one of the recombinant proteins: TROSPA, OspA or OspC was incubated with increasing dilutions of rats orally immunized with TROSPA OspA and OspC protein preparation. Next, the detection of the level of the bound rat IgG was carried out using the commercially available anti-rat antibodies conjugated with alkaline phosphatase. Maximum dilution rates of the immunized animals' serum are marked for which statistically significant difference was found in comparison with the control group of the animals immunized with an adjuvant only.

(11) FIG. 9 presents a schematic description of the cloning site of a commercially available pET200/D expression vector by Invitrogen, Carlsbad, California, USA. This vector contains the Xpress epitope and the 6His tag that has been cloned N-terminally in frame with the protein of interest. N-terminal tags can be 20 removed by enterokinase cleavage.

(12) In order to better understand the invention, sample solutions are following.

EXAMPLE 1

(13) The production of recombinant TROSPA tick protein defined by SEQ ID No. 3 and TROSPA-Salp15 defined by SEQ ID No. 4, and recombinant OspA proteins of B. garinii, B. afzelii and B. burgdorferi s. s., and OspC protein of B. garinii; a study of interaction between the recombinant TROSPA tick protein and recombinant OspA proteins of B. garinii, B. afzelii, and B. burgdorferi s. s.

(14) The TROSPA gene was amplified by PCR on the basis of genomic DNA isolated from I. ricinus collected in Poland, using the DNA QIAamp DNA Mini Kit by QIAGEN. For the PCR amplification, the TROSPAF and TROSPAR (Table 1) starters were used, defined by sequence SEQ ID No. 5 and sequence SEQ ID No. 6, and designed based on the sequence available at GenBank No. EU034646.1. As TROSPA gene comprises one intron, it had to be subjected to splicing. Accordingly, the TROSPA gene was cloned in binary vector, and the obtained construct was used for agroinfiltration of N. benthamiana, according to the manufacturer's protocol. Next, the trospa cDNA was amplified and cloned in a pET expression vector, using the TROTOPF and TRORPST starters defined by sequence SEQ ID No. 7 and sequence SEQ ID No. 8. For the cloning and the subsequent expression of the recombinant TROSPA protein defined by sequence SEQ ID No. 3, the Champion pET200 Directional TOPO Expression Kit with BL21 Star (DE3) One Shot (FIG. 9) was used, according to the manufacturer's protocol. As a result of cloning to pET200/D-TOPO vector, a TROSPA genetic construct was formed defined by sequence SEQ ID No. 1, as shown in FIG. 2C, coding for the recombinant TROSPA protein defined by sequence SEQ ID No. 3. FIGS. 2A and 2B present selected stages of the production and expression of TROSPA genetic construct coding for recombinant TROSPA protein. The recombinant TROSPA protein produced in the above-mentioned bacterial system, defined by sequence SEQ ID No. 3 had a his-tag added at its N terminus (FIG. 9), which allowed for protein purification using affinity chromatography with a nickel column. The elution of the recombinant TROSPA protein was carried out at 200 mM concentration of imidazole. Electrophoretic analysis of the purified TROSPA protein is presented in FIG. 2B. The preparation was dialyzed in a 1 PBS buffer. FIG. 5 shows the aminoacid sequence of the recombinant TROSPA protein.

(15) The DNA TROSPA-Salp15 sequence was obtained through DNA synthesis based on the cloned sequence coding for the recombinant TROSPA protein and a sequence coding for Salp15 Iric-1 protein, published in GenBank No. EU128526.1 that was optimized for the expression in a bacterial system. FIG. 3 presents the nucleotide sequence of the TROSPA-Salp15 genetic construct coding for the recombinant TROSPA-Salp15 protein and the comparison of its relevant fragments with the sequences EU034646.1 and EU128526.1. The DNA TROSPA-Salp15 sequence was amplified by PCR with FUS11Af and FUS11Ar starters defined by SEQ ID No. 9 and SEQ ID No. 10 sequences. Next, the cloning and expression of the TROSPA-Salp15 genetic construct defined by SEQ ID No. 2 was carried out, using the Champion pET200 Directional TOPO Expression Kit with BL21 Star (DE3) One Shot (FIG. 9), according to the manufacturer's protocol. The protein did not bind to the nickel column despite the presence of his-tag at its N terminus (FIG. 9). The purified preparation of the recombinant TROSPA-Salp15 protein was obtained through ion-exchange chromatography, using the DEAE-cellulose bed. The elution of the recombinant TROSPA-Salp15 protein was carried out at 200 mM of NaCl concentration. The electrophoretic analysis of the purified protein is presented in FIG. 4. The protein preparation was dialyzed in a 1 PBS buffer.

(16) The amino acid sequences of the recombinant TROSPA and TROSPA-Salp15 proteins are shown in FIG. 5. The amino acid sequences of the recombinant TROSPA and TROSPA-Salp15 proteins produced in E. coli were confirmed by mass spectrometry (MALDI-TOF spectrometer).

(17) The sequences coding for OspA of Borrelia burgdorferi sensu lato (i.e. B. garinii, B. afzelii and B. burgdorferi sensu stricto) and OspC proteins of B. garinii were amplified by PCR on the basis of DNA isolated I. ricinus collected in Poland, using the DNA QIAamp DNA Mini Kit by QIAGEN. For the PCR amplification, the OspAf/OspAr and OspCf/OspCr starter pairs were used (Table 1), designed on the basis of the sequences available at GenBank: B. garinii ospA GenBank: X85441.1, B. afzelii ospA GenBank: X85438.1, B. burgdorferi s. s. ospA GenBank: X16467.1 Borrelia garinii gene for outer surface protein C, complete cds GenBank: D49498.1. The amplified DNA coding for the OspA and OspC proteins (B. garinii, B. afzelii and B. burgdorferi s. s.) was cloned and subjected to expression with the Champion pET200 Directional TOPO Expression Kit with BL21 Star (DE3) One Shot, according to the manufacturer's protocol. In this way, the recombinant OspA and OspC proteins of Borrelia burgdorferi sensu lato were obtained, having protein label at its N-end (supplement 1), which allowed for their purification using affinity chromatography with a nickel column. The elution of the recombinant OspA and OspC proteins was carried out at 200 mM concentration of imidazole. The preparations were dialyzed in a 1 PBS buffer. The amino acid sequences of the recombinant OspA and OspC proteins of Borrelia burgdorferi sensu lato were confirmed by mass spectrometry (MALDI-TOF spectrometer).

(18) Moreover, it was found that the recombinant TROSPA protein defined by sequence SEQ ID No. 3 and the OspA recombinant proteins from three different Borrelia species (i.e. B. garinii, B. afzelii and B. burgdorferi sensu stricto) maintained their innate ability to form a TROSPAOspA complexes. It was confirmed by interaction analysis using ELISA tests. The ELISA microplate was coated with a recombinant TROSPA protein by incubation of the 5 g/ml protein solution in a PBST buffer. Next, the plate was washed five times with a PBSTT buffer and blocked by incubation in 2% BSA solution in a PBSTT buffer. After the blocking, the plate was washed five times with a PBSTT buffer and incubated with serial dilutions of the recombinant OspA protein (either from B. garinii, B. afzelii or B. burgdorferi s. s.) and controlOspC protein of B. garinii. The detection of the bound protein was carried out using a commercially available primary Borrelia-specific antibodies (rabbit polyclonal IgG) and secondary antibodies (anti-rabbit polyclonal IgG) conjugated with alkaline phosphatase. Then, the interaction between the recombinant TROSPA and OspA proteins were compared in the presence of serum of a rabbit immunized with recombinant TROSPA protein. As a control preimmuned rabbit serum was used. For that purpose, the ELISA microplate was coated with recombinant TROSPA protein by incubation of a 5 g/ml protein solution in a PBSTT buffer. Next, the plate was washed five times with a PBSTT buffer and blocked by incubation in a 2% BSA solution in a PBSTT buffer. After the blocking, the plate was washed five times with a PBSTT buffer and incubated with serial dilutions of the preimmuned rabbit serum or serum from the rabbit immunized with TROSPA. Then, the plate was washed five times with a PBSTT buffer and incubated with 80 g/ml recombinant OspA protein. The detection of the bound recombinant OspA protein was carried out using commercially available anti-Borrelia antibodies conjugated with FITC. The results of the experiment, shown in FIG. 6A, confirmed an ability to form a complex between the recombinant

(19) TROSPA protein defined by sequence SEQ ID No. 3 and recombinant OspA proteins from three different Borrelia species (i.e. B. garinii, B. afzelii and B. burgdorferi sensu stricto). Also, an ability to hinder that interaction by anti-TROSPA antibodies was confirmed (FIG. 6B).

(20) TABLE-US-00001 TABLE1 NucleotidesequencesofthePCRreactionstarters. starter Nucleotidesequence TROSPAF TTTGGTCTCAAGGTATGGCGGCTATGGAGGC (SEQ.ID.No.5) TROSPAR ATATTTAAATTCAACTTCCAGCGGCGC (SEQ.ID.No.6) TROTOPF CACCATGGCGGCTATGGAGGC (SEQ.ID.No.7) TRORPST ATCTGCAGTCAACTTCCAGCGGCGCTCTGGTCGG (SEQ.ID.No.8) FUS11Af CACCATGGCGGCTATGGAGGCTATGGCGG (SEQ.ID.No.9) FUS11Ar ATGGATCCTTAACAACCCGGAATATGACCA (SEQ.ID.No.10) OspAf CACCATGAAAAAATATTTATTGGGAATAGGT (SEQ.ID.No.11) OspAr CCTTATTTTAAAGCGTTTTTA (SEQ.ID.No.12) OspCf CACCATGAAAAAGAATACATTAAGTGC (SEQ.ID.No.13) OspCr TTAAGGTTTTTTTTGGACTTTCTGC (SEQ.ID.No.14)

EXAMPLE 2

(21) Immunization of Animals

(22) A number of studies were performed showing that the recombinant TROSPA protein defined by sequence SEQ ID No. 3 and recombinant TROSPA-Salp15 protein defined by sequence SEQ ID No. 4 have immunogenic properties and may be used as vaccine components. The antibodies present in blood of an immunized vertebrate directed against the recombinant TROSPA protein considerably lower the chance of new ticks infection by blocking or hindering the influence of TROSPAOspA. In this way, the natural reservoir of bacteria is reduced, which results in lowered incidence rate of Lyme disease among humans and animals. What is more, the antibodies present in blood of an immunized vertebrate directed against Salp15 antigen present in recombinant TROSPA-Salp15 protein protect an animal against infection on the spirochetes entering by destroying the protective coating on the bacteria surface formed through the interaction of Salp15 and OspC, as described herein (18). A vaccine based on recombinant TROSPA and TROSPA-Salp15 proteins defined by sequences SEQ ID No. 3 and SEQ ID No 4 may be used separately or combined with the recombinant OspA and OspC proteins of Borrelia burgdorferi sensu lato.

(23) Trademarks Champion pET200 Directional TOPO Expression Kit and BL21 Star(DE3) One Shot are trademarks for a commercially available expression kit owned by Invitrogen, Carlsbad, California, USA. A) Immunization of Animals by Parenteral Administration of the Preparation Comprising a Purified Recombinant TROSPA Protein of Ixodes ricinus Defined by Sequence SEQ ID No. 3.

(24) An expression of a TROSPA gene construct defined by sequence SEQ ID No. 1 was performed in a bacterial system, using the Champion pET200 Directional TOPO Expression Kit with BL21 Star (DE3) One Shot, according to the manufacturer's protocol. Next, the recombinant TROSPA protein defined by sequence SEQ ID No. 3 was purified using the affinity chromatography with a nickel column. The elution of the recombinant TROSPA protein was carried out at 200 mM concentration of imidazole. The electrophoretic anaysis of the recombinant TROSPA protein is presented in FIG. 2B. The preparation was dialyzed in a 1 PBS buffer. The 800 g/ml preparation was used for parenteral immunization of rabbits. The animals were given 100 g of the preparation at four time points: on 0, 14, 28, and 56th day. The serum was taken before the immunization and, then, 38, 66, and 87 days after the initial immunization. The presence of the antibodies in serum of the immunized animals was detected by the Western-blot (FIG. 7). For that purpose, the preparations of the recombinant TROSPA protein were electrophoretically separated and transferred onto a PVDF membrane. The membrane was blocked with 1% BSA solution and, then, incubated with a rabbit serum diluted 10 000 times in a TBSTT buffer. The detection of the bound antibodies was carried out using commercially available anti-rabbit antibodies conjugated with alkaline phosphatase. B) Immunization of Animals by Oral Administration of the Composition Comprising a Purified Recombinant TROSPA Protein of Ixodes ricinus Defined by Sequence SEQ ID No. 3 or Purified Recombinant TROSPA-Salp15 Protein Defined by Sequence SEQ ID No. 4.

(25) An expression of TROSPA genetic construct defined by sequence SEQ ID No. 1 and TROSPA-Salp15 genetic construct defined by sequence SEQ ID No. 2 was performed in a bacterial system, using the Champion pET200 Directional TOPO Expression Kit with BL21 Star (DE3) One Shot, according to the manufacturer's protocol. The recombinant TROSPA protein defined by sequence SEQ ID No. 3 was purified by affinity chromatography with a nickel column. The elution of the protein was carried out at 200 mM concentration of imidazole. The purified preparation of the recombinant TROSPA-Salp15 protein defined by SEQ ID No. 4 was obtained by ion-exchange chromatography, using the DEAE cellulose bed. The elution of the protein was carried out at 200 mM concentration of NaCl. The electrophoretic analysis of the purified recombinant TROSPA protein is presented in FIG. 2B. The electrophoretic analysis of the purified recombinant TROSPA-Salp15 protein in shown in FIG. 4. The protein preparations were dialyzed in a 1 PBS buffer. The 1 mg/ml preparation was used for oral immunization of rats. Using an intragastric probe, the animals were given a composition comprising 200 g of one of the proteins or a composition comprising 200 g of one of the proteins and an adjuvant (GEM, 22). The preparations were administered at three time points: on 0, 14, and 28.sup.th day. The serum was taken after 42 days of initial immunization. The presence of the antibodies in the serum of the immunized animals was detected by ELISA. The ELISA microplate was coated with a recombinant TROSPA protein or recombinant Salp15 protein by incubation of a 5 g/ml protein solution in a PBSTT buffer. Next, the plate was washed five times with a PBSTT buffer and blocked by incubation in 2% BSA solution in a PBSTT buffer. After the blocking, the plate was washed five times with a PBSTT buffer and incubated by serial dilutions of the sera of the immunized animals or those immunized with an adjuvant only. The detection of the bound antibodies was carried out using commercially available anti-rat secondary antibodies conjugated with alkaline phosphatase, and the product absorbance was measured with Microplate Reader Model 550 by BIORAD. The level of the antibodies was determined using reciprocal serum dilution method (FIGS. 8A and B, 23). C) Immunization of Animals by Oral Administration of the Composition Comprising Purified TROSPA Proteins of Ixodes ricinus Defined by Sequence SEQ ID No. 3, OspA and OspC of Borrelia burgdorferi sensu lato.

(26) The expressions of the TROSPA genetic construct defined by sequence SEQ ID No. 1 were carried out in a bacterial system using the Champion pET200 Directional TOPO Expression Kit with BL21 Star (DE3) One Shot, according to the manufacturer's protocol. The recombinant TROSPA proteins defined by sequence SEQ ID No. 3, OspA, and OspC were purified by affinity chromatography with a nickel column. The elution of the proteins was carried out at 200 mM concentration of imidazole. The proteins preparations were dialyzed in a 1 PBS buffer. The 1 mg/ml preparation was used for oral immunization of rats. Using an intragastric probe, the animals were given a composition comprising 200 g of each protein or a composition of each protein and an adjuvant (GEM, 22). The preparations were given at three time points: on 0, 14, and 28th day. The sera were taken 42 days after the initial immunization. The presence of the antibodies in the sera of the immunized animals was detected using ELISA. The ELISA microplate was coated with the recombinant TROSPA, OspA or OspC protein by incubation of the 5 g/ml protein solution in a PBSTT buffer. Next, the plate was washed five times with a PBSTT buffer and blocked by incubation in 2% BSA solution in a PBSTT buffer. After the blocking, the plate was washed five times with a PBSTT buffer and incubated with serial dilutions of the sera of the immunized rats or the rats immunized with an adjuvant only. The detection of the bound proteins was carried out using commercially available secondary anti-rat antibodies conjugated with alkaline phosphatase, and the product absorbance was measured using the Microplate Reader Model 550 by BIORAD. The level of the antibodies was determined using reciprocal serum dilution method (FIG. 8C, 23).

(27) The obtained results substantiate the statement that obtained recombinant TROSPA protein defined by sequence SEQ ID No. 3 and TROSPA-Salpl5 protein defined by sequence SEQ ID No. 4 administered into an animal organism via oral or parenteral way are capable of inducing immunological response. Furthermore, the proteins maintain their native structure, which is confirmed by the analysis of the interaction between a recombinant TROSPA protein defined by sequence SEQ ID No. 3 with an OspA proteins from three different Borrelia species (i.e. B. garinii, B. afzelii and B. burgdorferi sensu stricto), presented herein. The antibodies produced in an animal organism after immunization with a recombinant TROSPA protein defined by sequence SEQ ID No. 3 disturb the TROSPA-OspA interaction. Moreover, the antibodies in blood of an immunized vertebrate directed against SalplS antigen present in a recombinant TROSPA-Salp15 protein defined by sequence SEQ ID No. 4 protect an animal against infection on the spirochetes diffusion by destroying the protective coating on the bacteria surface formed by the Salp15OspC interaction. The observations indicate that the recombinant TROSPA proteins defined by sequence SEQ ID No. 3 and recombinant TROSPA-Salp 15 proteins defined by sequence SEQ ID No. 4 may be the components of Lyme disease vaccine to protect animals against infection with Borrelia burgdorferi and minimize the chance of infecting new ticks with Borrelia burgdorferi, which, consequently, reduces the pool of spirochetes present in the environment.

LITERATURE

(28) 1. Chmielewska-Badera J. 1998. Seroepidemioligic study of Lyme boreliosis in the Lublin Region. Ann. Agric. Environ. Med. 5: 183-186. 2. Cisak E., Chmielewska-Badora J., Zwoliski J., Wjcik-Fatla A., Polak J., Dutkiewicz J. 2005. Risk of tick-borne bacterial dieseases among workers of Rortocze National Park (South-Eastern Poland). Ann. Agric. Environ. Med. 12: 127-132. 3. Derdkov M., Len{hacek over (c)}kov. 2005. Association of genetic variability within the Borrelia burgdorferi sensu lato with the ecology, epidemiology of Lyme borreliosis in Europe. Ann. Agric. Environ. Med. 12: 165-172 4. piewak R. 2004. Zawodowe choroby skry u rolnikw indywidualnych. Post Dermatol. Alergol. 21: 278-285. 5. Wodecka B., Skotarczak B. 2000. Genetyczna zmienno Borrelia burgdorferi s. l. U kleszczy Ixodes ricinus zebranych w plnocnozachodniej Polsce. Wiadomoci parazytologiczne. 46: 475-485. 6. Vazquez M., Muehlenbein C., Cartter M., Hayes E. B., Ertel S., Shapiro E. D. 2008. Effectiveness of personal protective measures to prevent Lyme disease. Emerg. Infect. Dis. 14: 210-216. 7. Connally N. P., Durante A. J., Yousey-Hindes K. M., Meek J. I., Nelson R. S., Heimer R. 2009. Peridomestic Lyme disease prevention: results of a population-based case-control study. Am. J. Prey. Med. 37: 201-216. 8. Corapi K. M., White M. I., Phillips C. B., Daltroy L. H., Shadick N. A., Liang M. H. 2007. Strategies for primary and secondary prevention of Lyme disease. Nat. Clin. Pract. Rheumatol. 3: 20-25. 9. Steere A. C. 2008. Lyme disease vaccines. In Plotkin S. A., Orenstein W. A., Offit P. A. eds. Vaccines. Philadelphia: Saunders-Elsevier, 1253-66. 10. Sigal L. H., Zahradnik J. M., Lavin P., et al. 1998. A vaccine consisting of recombinant Borrelia burgdorferi outer-surface protein A to prevent Lyme disease. Recombinant Outer-Surface Protein A Lyme Disease Vaccine Study Consortium. N. Engl. J. Med. 339: 216-22. 11. Abbott A. 2006. Lyme disease: uphill struggle. Nature 439,524-525. 12. Croke C. L., Munson E. L., Lovrich S. D., et al. 2000. Occurrence of severe destructive Lyme arthritis in hamsters vaccinated with outer surface protein A and challenged with Borrelia burgdorferi. Infect. Immun.68: 658-63. 13. Nardelli D. T., Munson E. L., Callister S. M., Schell R. F. 2009. Human Lyme disease vaccines: past and future concerns. Future Microbiol 4: 457-69. 14. Drouin E. E, Glickstein L., Kwok W. W., Nepom G. T., Steere A. C. 2008. Human homologues of a Borrelia T cell epitope associated with antibioticrefractory Lyme arthritis. Mol. Immunol. 45: 180-9. 15. Earnhart, C. G., Buckles, E. L., and. Marconi, R. T. 2007. Development of an OspC-based tetravalent, recombinant, chimeric vaccinogen that elicits bactericidal antibody against diverse Lyme disease spirochete strains. Vaccine 25: 466-480. 16. Bhattacharyaa D., Bensacib M., Lukerc K. E., et. al. 2011. Development of a baited oral vaccine for use in reservoir-targeted strategies against Lyme disease. Vaccine, 29: 7818- 7825. 18. Dai J., Wang P., Adusumilli S., et. al., 2009. Antibodies against a Tick Protein, Salp15, Protect Mice from the Lyme Disease Agent. Cell Host & Microbe, 6: 482-492. 19. Pal U., Li X., Wang T., Montgomery R. R. et al. 2004. TROSPA, an Ixodes scapularis receptor for Borrelia burgdorferi. Cell, 119: 457-468. 20. Hovius J. W., Ramamoorthi N., Van't Veer C. et al. 2007. Identification of Salp15 homologues in Ixodes ricinus ticks. Vector Borne Zoonotic Dis. 7: 296-303. 21. Dai J., Wang P., Adusumilli S., et. al., 2009. Antibodies against a Tick Protein, Salp15, Protect Mice from the Lyme Disease Agent. Cell Host & Microbe, 6: 482-492. 22. Saluja V., Visser M. R., van. Roosmalen M. L. et al. 2010. Gastro-intestinal delivery of influenza subunit vaccine formulation adjuvanted with Gram-positive enhancer matrix (GEM) particles. Eur. J. Pharm. Biopharm. 76: 470-474. 23. Frey A., Di Canzio J. i Zurakowski D. 1998. A statistically defined endpoint titer determination method for immunoassays. J. Immunol. Meth. 221:35-41