KOI HERPESVIRUS VACCINE

20170028057 ยท 2017-02-02

    Inventors

    Cpc classification

    International classification

    Abstract

    The present invention relates to a recombinant Koi herpesvirus (KHV), methods for the production of such KHV, cells comprising such KHV and the use of such KHV as vector and in vaccines for the prevention and/or therapeutic treatment of a disease in fish caused by Koi herpesvirus in carp such as Cyprinus carpio carpio or Cyprinus carpio koi.

    Claims

    1. A live, attenuated recombinant Koi herpesvirus (KHV) comprising a genome in which Open Reading Frame 56 (ORF 56) and Open Reading Frame 57 (ORF 57) are mutated.

    2. The herpesvirus of claim 1 wherein the herpesvirus is capable of replication.

    3. The herpesvirus of claim 1 wherein the mutation is selected from the group consisting of: one or more point mutations, insertions, partial deletions of open reading frames, full deletions of open reading frames, duplications, rearrangements, recombination, inversions and translocations.

    4. The herpesvirus of claim 3 wherein the mutation comprises partial deletions of open reading frames.

    5. The herpesvirus of claim 3 wherein the mutation comprises full mutations of open reading frames.

    6. The herpesvirus of claim 1 which further comprises a bacterial artificial chromosome (BAC) vector sequence.

    7. The herpesvirus of claim 6 wherein the BAC vector sequence is excised from the herpesvirus genome thereby leaving a heterologous DNA fragment at the excision site in the herpesvirus genome.

    8. The herpesvirus of claim 1 further comprising at least one additional mutation in at least one additional gene.

    9. The herpesvirus of claim 8 wherein the at least one additional gene is selected from the group consisting of a thymidine kinase gene, ORF 12: putative tumor necrosis factor (TNF receptor gene), ORF16: putative G-protein coupled receptor (GPCR) gene, ORF134: putative Interleukin 10 homologue gene, and ORF140: putative thymidylate kinase gene.

    10. The herpesvirus of claim 1 further comprising a heterologous DNA fragment.

    11. A vector comprising the recombinant Koi herpesvirus (KHV) of claim 1.

    12. An isolated cell comprising the recombinant Koi herpesvirus of claim 1.

    13. An vaccine comprising either: a. the live recombinant Koi herpesvirus of claim 1; or b. a recombinant Koi herpesvirus DNA comprising the genome of the live recombinant Koi herpesvirus.

    14. The vaccine of claim 13 further comprising a pharmaceutically acceptable carrier.

    15. A method of preventing or therapeutically treating a disease in fish caused by Koi herpesvirus (KHV) comprising administering the vaccine of claim 14.

    16. An immunogenic composition comprising a pharmaceutically acceptable carrier and the live recombinant Koi herpesvirus of claim 1.

    Description

    LEGEND TO THE FIGURES

    [0096] FIG. 1: schematic representation of the CyHV-3 genome region encompassing ORF57. The coordinates of ATG and stop codons of each ORF (according to Genbank accession N NC_009127) are indicated. The coordinates of putative promoters (P) identified by in silico analyses within or close to ORF56 and ORF57 are presented. The number following the letter P identifies the ORF under control of the identified promoter sequence. Selected sequences to be deleted in order to invalidate ORF56 and/or ORF57 are represented at the top. The coordinates of the deletions are indicated.

    [0097] FIGS. 2 and 3: flowchart of stages performed to produce FL BAC galK recombinant plasmids deleted for ORF57 (FIG. 2) or ORF56 (FIG. 3), and to demonstrate the reconstitution of infectious virus from the produced plasmids. The regions of ORF57 or ORF56, as identified in FIG. 1, were replaced by a galK expression cassette using homologous recombination in E. coli. To reconstitute infectious virus with a wild type thymidine kinase (TK) locus (FL BAC revertant strains), the recombinant plasmids were co-transfected in permissive CCB cells with pGEMT-TK plasmid. To reconstitute infectious virus with a truncated form of TK (FL BAC excised strains), the recombinant plasmids were transfected in CCB cells expressing Cre recombinase.

    [0098] FIG. 4: flowchart of stages performed to produce FL BAC recombinant plasmids deleted for ORF57 and ORF56 (ORF56-57), and to demonstrate the reconstitution of infectious virus from the produced plasmids. The region of ORF56-57, as identified in FIG. 1, was replaced by a galK expression cassette using homologous recombination in E. coli. The galK expression cassette was then removed by homologous recombination with a synthetic DNA sequence corresponding to KHV genome regions flanking the galK expression cassette (ORF56-57 Del cassette). To reconstitute infectious virus with a wild type thymidine kinase (TK) locus (FL BAC revertant strains), the recombinant plasmid was co-transfected in permissive CCB cells with pGEMT-TK plasmid. To reconstitute infectious virus with a truncated form of TK (FL BAC excised strains), the recombinant plasmid was transfected in CCB cells expressing Cre recombinase.

    [0099] FIGS. 5A-5G: safety (Figures A-D) and vaccination/challenge (FIGS. E-G) tests of ORF57 single deleted recombinants. The safety of the FL BAC excised ORF57 Del 1 galK (FIG. A) and the FL BAC excised ORF57 Del 2 galK (FIG. B) strains was tested as described in the examples (Safety tests) on common carp (7 months old, mean weight of 3.74 g, n=20). The FL BAC excised strain (FIG. C) and mock-infection (FIG. D) were used as positive and negative controls, respectively. Percentages of surviving carp are expressed according to days post-infection taking day 0 as the reference. Six weeks post-infection with the ORF57 single deleted recombinants (Figures E and F), fish were challenged as described in the examples (vaccination/challenge). Mock-infected fish were used as controls (FIG. G). Percentages of surviving carp are expressed according to days post-infection taking day 42 as the reference.

    [0100] FIGS. 6A-6D: safety of ORF56 single deleted recombinants.

    [0101] The safety of the FL BAC excised ORF56 Del 1 galK (FIG. A) and the FL BAC excised ORF56 Del 2 galK (FIG. B) strains was tested as described in the examples (Safety tests) on common carp (7 months old, mean weight of 3.74 g, n=20). The FL BAC excised strain (FIG. C) and mock-infection (FIG. D) were used as positive and negative controls, respectively. Percentages of surviving carp are expressed according to days post-infection taking day 0 as the reference.

    [0102] FIGS. 7A-7G: safety (Figures A-C) and vaccination/challenge (Figures D-G) tests of the FL BAC excised ORF56-57 Del strain. The safety of the FL BAC excised ORF56-57 Del strain (FIG. B) was tested as described in the examples (Safety tests) on common carp (7 months old, mean weight of 4.41 g, n=30). The FL BAC excised strain (FIG. A) and mock-infection (FIG. C) were used as positive and negative controls, respectively. Mock-infection was performed on duplicate groups. Percentages of surviving carp are expressed according to days post-infection taking day 0 as the reference. Vaccination/challenge (FIGS. D-G) tests. Fish (n=15) vaccinated with the FL BAC excised ORF56-57 Del strain were challenged with the KHV FL strain at 3 weeks (FIG. D) or 6 weeks (FIG. F) post-vaccination as described in the examples (vaccination/challenge). Duplicate groups of mock-infected fish were used as controls (FIGS. E and G). Percentages of surviving carp are expressed according to days post-infection taking the day of the challenge as the reference.

    [0103] FIGS. 8A-8G: safety (FIGS. A-C) and vaccination/challenge (FIGS. D-G) tests of the FL BAC revertant ORF56-57 Del strain. The safety of the FL BAC revertant ORF56-57 Del strain (FIG. B) was tested as described in the examples (Safety tests) on common carp (7 months old, mean weight of 3.74 g, n=30). The FL BAC revertant strain (FIG. A) and mock-infection (FIG. C) were used as positive and negative controls, respectively. Mock-infection was performed on duplicate groups. Percentages of surviving carp are expressed according to days post-infection taking day 0 as the reference. Vaccination/challenge (FIGS. D-G) tests. Fish (n=15) vaccinated with the FL BAC revertant ORF56-57 Del strain were challenged with the KHV FL strain at 3 weeks (FIG. D) or 6 weeks (FIG. F) post-vaccination as described in the examples (vaccination/challenge). Duplicate groups of mock-infected fish were used as controls (FIGS. E and G). Percentages of surviving carp are expressed according to days post-infection taking the day of the challenge as the reference.

    EXAMPLES

    a) Cells and Viruses

    [0104] Cyprinus carpio brain cells (CCB) (Neukirch et al., 1999) were cultured in minimum essential medium (MEM, Invitrogen) containing 4.5 g/l glucose (D-glucose monohydrate, Merck) and 10% fetal calf serum (FCS). Cells were cultured at 25 C. in a humid atmosphere containing 5% CO.sub.2. The CyHV-3 FL strain was isolated from the kidney of a fish which died from KHV (CER Marloie, Belgium).

    b) CyHV-3 BAC Plasmid

    [0105] The CyHV-3 FL BAC plasmid was used as parental plasmid to produce CyHV-3 recombinants. This plasmid has been extensively described in Costes et al (2008) and in International Patent Application WO 2009/027412. The CyHV-3 FL BAC plasmid is an infectious bacterial artificial chromosome (BAC) clone of the CyHV-3 FL strain genome. In this plasmid, the loxP-flanked BAC cassette is inserted into the CyHV-3 TK locus (ORF55).

    c) Production of ORF 57 CyHV-3 FL BAC Recombinant Plasmids Using galK Positive Selection in Bacteria

    [0106] Two CyHV-3 FL BAC recombinant plasmids with deletion in the ORF57 locus (see ORF57 Del 1 and ORF57 Del 2 in FIG. 1) were produced using a galK positive selection in bacteria as previously described (Warming et al., 2005) (FIG. 2). The recombination fragment consisted of a galactokinase (galK) gene (1231 bp) flanked by 50 bp sequences homologous to the regions of the CyHV-3 genome flanking the sequence to be deleted (FIG. 1).

    [0107] These fragments were produced by PCR using the pgalK vector as template. The following primers were used for the amplification (see Table 1 for primer sequence): for production of the ORF57 Del 1 deletion: primers ORF57 Del1 fwd and ORF57 Del1 rev leading to the ORF57 Del 1-galK amplicon; for production of the ORF57 Del 2 deletion: primers ORF57 Del2 fwd and ORF57 Del2 rev leading to the ORF57 Del 2-galK amplicon. The amplification product was purified (QIAquick Gel Extraction Kit). Next, electrocompetent SW102 cells containing the CyHV-3 FL BAC plasmid were electroporated with 50 ng of the PCR products described above. Electroporated cells were plated on solid M63 minimal medium supplemented with 20% galactose and chloramphenicol (17 g/ml) to select bacteria in which homologous recombination occurred. Finally, colonies obtained were streaked onto MacConkey indicator plates as described elsewhere to confirm the production of galK positive clones. Recombinant BAC molecules were amplified and purified (QIAGEN Large-Construct Kit), and their molecular structure was controlled using a combined restriction endonuclease-Southern blot approach, PCR and sequencing.

    TABLE-US-00001 TABLE1 OligonucleotidesusedforPCRamplification Coordinatesof underlinedse- quenceaccording toGenbank accession Primer Sequence* bp No.NC_009127 ORF57Del1fw 5-CGTACAGGGTGGCGGTGCACCTGTCCC 77bp 99551-99599 AGAAGGCCTTCACCGCCTGGcustom-character CCT GTTGACAATTAATCATCGGCA-3 ORF57Del1rev 5-CGGCTCATCATCTGCGGGTCCATCCAG 71bp 99743-99694 GCGCCCTTGCCCCACAGCAGAGCTTCAGC ACTGTCCTGCTCCTT-3 ORF57Del2fw 5-CTTTGTGCTGCACAAGGGCTTCAACCAC 74bp 99894-99943 CACTACGCCTTCTGCGATCACCCCTGTTGA CAATTAATCATCGGCA-3 ORF57Del2rev 5-CTGAGCGTTGTTGAAGGCCTCCATCAGG 74bp 100161-100112 TGCTGCCTGATCTGCTTGTGCAcustom-character GCACTGTCCTGCTCCTT-3 *The primers represent sequences homologous to CyHV-3 genome (underlined sequences) and to galK expression cassette.

    d) Reconstitution of Infectious Virus from ORF 57 CyHV-3 FL BAC Recombinant Plasmid

    [0108] CyHV-3 BAC plasmids were transfected (Lipofectamine Plus, Invitrogen) into permissive CCB. To produce BAC plasmid derived strains with a wild type TK locus, CyHV-3 BAC plasmids were co-transfected in CCB cells together with the pGEMT-TK vector (molecular ratio 1:75). Seven days post-transfection, viral plaques negative for EGFP expression (the BAC cassette encodes an EGFP expression cassette) were picked and enriched by three successive rounds of plaque purification. Similarly, to reconstitute virions with excised BAC cassette from the viral genome, BAC plasmids were co-transfected in CCB cells together with the pEFIN3-NLS-Cre vector encoding Cre recombinase fused to a nuclear localization signal (Costes et al; 2008 JVI) (molecular ratio: 1:70).

    e) Production of ORF 56 CyHV-3 FL BAC Recombinant Plasmids Using galK Positive Selection in Bacteria

    [0109] Two CyHV-3 FL BAC recombinant plasmids with deletion in the ORF56 locus (see ORF56 Del 1 and ORF56 Del 2 in FIG. 1) were produced using a galK positive selection in bacteria as previously described (Warming et al., 2005) (FIG. 3). The recombination fragment consisted of a galactokinase (galK) gene (1231 bp) flanked by 50 bp sequences homologous to the regions of the CyHV-3 genome flanking the sequence to be deleted (FIG. 1). These fragments were produced by PCR using the pgalK vector as template. The following primers were used for the amplification (see Table 2 for primer sequence): for production of the ORF56 Del 1 deletion: primers ORF56 Del1 fwd and ORF56 Del1 rev leading to the ORF56 Del 1-galK amplicon; for production of the ORF56 Del 2 deletion: primers ORF56 Del2 fwd and ORF56 Del2 rev leading to the ORF56 Del 2-galK amplicon. The amplification product was purified (QIAquick Gel Extraction Kit). Next, electrocompetent SW102 cells containing the CyHV-3 FL BAC plasmid were electroporated with 50 ng of the PCR products described above. Electroporated cells were plated on solid M63 minimal medium supplemented with 20% galactose and chloramphenicol (17 g/ml) to select bacteria in which homologous recombination occurred. Finally, colonies obtained were streaked onto MacConkey indicator plates as described elsewhere to confirm the production of galK positive clones. Recombinant BAC molecules were amplified and purified (QIAGEN Large-Construct Kit), and their molecular structure was controlled using a combined restriction endonuclease-Southern blot approach, PCR and sequencing.

    TABLE-US-00002 TABLE2 OligonucleotidesusedforPCRamplification Coordinatesof underlinedse- quenceaccording toGenbank accession Primer Sequence* bp No.NC_009127 ORF56Del1fwd 5-TCAGGATCGAGGTCACCAGCTTGAGCTT 74bp 97475-97524 CTCGGGCATGTACTCGCGCCACCCTGTTG ACAATTAATCATCGGCA-3 ORF56Del1rev 5-CGGCGAGGTGATTTCGGTCATGAGCAA 70bp 98361-98312 ATCGATTGCGGCCGAACAGCAGCTCAGCA CTGTCCTGCTCCTT-3 ORF56Del2fwd 5-GATCGGGTACGTCGGCGTGCGCCACTT 74bp 97275-97324 GACCTTCCTCAACGTCCCCGTCACCTGTT GACAATTAATCATCGGCA-3 ORF56Del2rev 5-GCGCACACCATCACCATCTGTCCCATGT 70bp 98561-98512 CTCCCCAACGCTACACCGTGACTCAGCAC TGTCCTGCTCCTT-3 *The primers represent sequences homologous to CyHV-3 genome (underlined sequences) and to galK expression cassette.

    f) Reconstitution of Infectious Virus from ORF 56 CyHV-3 FL BAC Recombinant Plasmid

    [0110] CyHV-3 BAC plasmids were transfected (Lipofectamine Plus, Invitrogen) into permissive CCB. To produce BAC plasmid derived strains with a wild type TK locus, CyHV-3 BAC plasmids were co-transfected in CCB cells together with the pGEMT-TK vector (molecular ratio 1:75). Seven days post-transfection, viral plaques negative for EGFP expression (the BAC cassette encodes an EGFP expression cassette) were picked and enriched by three successive rounds of plaque purification. Similarly, to reconstitute virions with excised BAC cassette from the viral genome, BAC plasmids were co-transfected in CCB cells together with the pEFIN3-NLS-Cre vector encoding Cre recombinase fused to a nuclear localization signal (Costes et al; 2008 JVI) (molecular ratio: 1:70).

    g) Production of ORF56-57 CyHV-3 FL BAC Recombinant Plasmids Using galK Positive and Negative Selections in Bacteria

    [0111] CyHV-3 FL BAC recombinant plasmids with deletion in the ORF56 and ORF57 loci (FIG. 1) were produced using galK positive and negative selections in bacteria as previously described (Warming et al., 2005) (FIG. 4). The first recombination process (galK positive selection) was to replace the identified sequence of ORF56 and ORF57 by the galactokinase (galK) gene (1231 bp). The recombination fragment consisted of the galK gene flanked by 50 bp sequences homologous to the regions of the CyHV-3 genome flanking the sequence to be deleted (FIG. 1) (ORF56-57 Del galK, FIG. 4). This fragment was produced by PCR using the primers ORF56-ORF57 Del fw and ORF56-ORF57 Del rev (Table 3) and the pgalK vector as template. The amplification product was purified (QIAquick Gel Extraction Kit). Next, electrocompetent SW102 cells containing the CyHV-3 FL BAC plasmid were electroporated with 50 ng of the PCR product described above. Electroporated cells were plated on solid M63 minimal medium supplemented with 20% galactose and chloramphenicol (17 g/ml) to select bacteria in which homologous recombination occurred. Finally, colonies obtained were streaked onto MacConkey indicator plates as described elsewhere to confirm the production of galK positive clones. Recombinant BAC molecules were amplified and purified (QIAGEN Large-Construct Kit), and their molecular structure was controlled using a combined restriction endonuclease-Southern blot approach, PCR and sequencing. The second recombination process (galK negative selection) was to remove the galK cassette from the FL BAC ORF56-57 Del galK plasmid. A synthetic 499 bp DNA fragment (ORF56-57 Del cassette, vide infra) was used to reach this goal. It consists of sequences homologous to the regions of the CyHV-3 genome flanking the sequence to be deleted: 250 bp (from coordinates 96751 to 9700, Genbank accession N NC_009127) upstream of the galK gene and 249 bp (from coordinates 99751 to 100000 with deletion of base 99760, Genbank accession N NC_009127) downstream on the galKgene. Electrocompetent SW102 cells containing the FL BAC ORF56-57 Del galK plasmid were electroporated with 50 ng of the PCR product described above. Electroporated cells were plated on solid minimal medium supplemented with 2-deoxy-galactose to select bacteria in which homologous recombination occurred (digestion of 2-deoxy-galactose by galK produce toxic products). Recombinant BAC molecules were amplified and purified (QIAGEN Large-Construct Kit), and their molecular structure was controlled using a combined restriction endonuclease-Southern blot approach, PCR and sequencing.

    ORF56-57 Del Cassette:

    [0112]

    TABLE-US-00003 5- tttgtcaaccagtcctccagggtcggtttggcgctggcctccttgccctt ggtcacggcgatggcagacgccacaatcctcgcgacgggttccgtcagag cagagttcttaaacatttcgacgcctcctccgacggtgaaccactctgac caattcaggtcggagggccacgtctgcctgtgcatcatcgtctgcacagc gtccctcgacagccccagcccgcacagcagtcgccactcttccctgttga gtgcacgactcgtcaagatcaagctgcttgagcgcgtcgtgtacgggttc atgatggccctgcagaaggcgctgcgcattcagaagcagggctgcaggat ggtggggctcgaggacccggagaaggtggaggatatgaagaactttgtgc tgcacaagggcttcaaccaccactacgccttctgcgatcaccactggcag cactgggccctgggccgctccttcgagggcgagctgcccgacgtggtgg- 3

    TABLE-US-00004 TABLE3 OligonucleotidesusedforPCRamplification Coordinatesof underlinedse- quenceaccording toGenbank accession Primer Sequence* bp No.NC_009127 ORF56-ORF57 5-GTCCCTCGACAGCCCCAGCCCGCACAG 70bp 96951-97000 Delfwd CAGTCGCCACTCTTCCCTGTTGATCAGCAC TGTCCTGCTCCTT-3 ORF56-ORF57 5-AACCCGTACACGACGCGCTCAAGCAGC 74bp 99800-99751 Delrev TTGATCTTGACGACGTCGTGCACCCTGTTG ACAATTAATCATCGGCA-3 *The primers represent sequences homologous to CyHV-3 genome (underlined sequences) and to galK expression cassette.

    h) Reconstitution of Infectious Virus from ORF56-57 CyHV-3 FL BAC Recombinant Plasmid

    [0113] CyHV-3 BAC plasmids were transfected (Lipofectamine Plus, Invitrogen) into permissive CCB. To produce BAC plasmid derived strains with a wild type TK locus, CyHV-3 BAC plasmids were co-transfected in CCB cells together with the pGEMT-TK vector (molecular ratio 1:75). Seven days post-transfection, viral plaques negative for EGFP expression (the BAC cassette encodes an EGFP expression cassette) were picked and enriched by three successive rounds of plaque purification. Similarly, to reconstitute virions with excised BAC cassette from the viral genome, BAC plasmids were co-transfected in CCB cells together with the pEFIN3-NLS-Cre vector encoding Cre recombinase fused to a nuclear localization signal (Costes et al; 2008 JVI) (molecular ratio: 1:70).

    i) Safety Tests

    [0114] Common carp were acclimatized in 60-liter tanks at 24 C. for 10 days. Carp (biomass of 50 g of fish/l) were immersed for 2 h in water containing 4, 40 or 400 PFU/ml of the KHV strain to be tested. The control group (mock-infected) was immersed in water in which an equal volume of culture medium has been added. At the end of the incubation period, the fish were returned to the larger tank. The viral inoculums were titrated before inoculation and back-titrated after inoculation to ensure that the doses were equivalent between groups. Fishes were examined daily for clinical signs of KHV disease and dead fishes were removed.

    j) Vaccination/Challenge

    [0115] Common carp were acclimatized in 60-liter tanks at 24 C. for 10 days. For vaccination, carp (biomass of 50 g of fish/l) were immersed for 2 h in water containing 4, 40 or 400 PFU/ml of the KHV strain to be tested. At the end of the incubation period, the fish were returned to the larger tank. At 3 weeks or 6 weeks post-vaccination, fish were challenged with virulent KHV by co-habitation with nave fish infected just before their release in the tank of vaccinated fish. These fish were inoculated by immersion in water containing 300 PFU/ml of the virulent parental FL strain for 2 h. Two infected fish were added to each tank containing vaccinated fish.

    k) Safety and Challenge Results

    [0116] The safety of the FL BAC excised ORF57 Del 1 galK (FIG. 5A) and the FL BAC excised ORF57 Del 2 galK (FIG. 5B) strains was tested as described in the examples (Safety tests) on common carp (7 months old, mean weight of 3.74 g, n=20). The FL BAC excised strain (FIG. 5C) and mock-infection (FIG. 5D) were used as positive and negative controls, respectively. Percentages of surviving carp were expressed according to day's post-infection taking day 0 as the reference. Six weeks post-infection with the ORF57 single deleted recombinants (FIGS. 5E and F), fish were challenged as described in the examples (vaccination/challenge). Mock-infected fish were used as controls (FIG. 5G). Percentages of surviving carp are expressed according to day's post-infection taking day 42 as the reference.

    [0117] It is clear from FIGS. 5A and B that an ORF57 deletion mutant according to the invention is safe, even when applied to small fish.

    [0118] It also becomes clear from FIGS. 5E and F that a KHV ORF57 deletion mutant according to the invention is very suitable as an efficacious vaccine, especially when administered in a dose of 40 pfu/ml or higher.

    [0119] The safety of the FL BAC excised ORF56 Del 1 galK (FIG. 6A) and the FL BAC excised ORF56 Del 2 galK (FIG. 6B) strains was tested as described in the examples (Safety tests) on common carp (7 months old, mean weight of 3.74 g, n=20). The FL BAC excised strain (FIG. 6C) and mock-infection (FIG. 6D) were used as positive and negative controls, respectively. Percentages of surviving carp are expressed according to days post-infection taking day 0 as the reference. As becomes clear from FIGS. 6A and B, ORF56 deletion mutants show a virulence that is roughly comparable with that of the control wild-type virus (Compare panels A and B to panel C).

    [0120] As can be seen in FIGS. 7 and 8, a KHV carrying a deletion in both ORF57 and ORF56 shows a safety and efficacy profile that is comparable to that of KHV carrying a single ORF57 deletion.

    REFERENCES

    [0121] Aoki, T., Hirono, I., Kurokawa, K., Fukuda, H., Nahary, R., Eldar, A., Davison, A. J., Waltzek, T. B., Bercovier, H. & Hedrick, R. P. (2007). Genome sequences of three Koi herpesvirus isolates representing the expanding distribution of an emerging disease threatening Koi and common carp worldwide. J Virol 81, 5058-65. [0122] Babic, N., Klupp, B. G., Makoschey, B., Karger, A., Flamand, A., Mettenleiter, T. C., 1996. Glycoprotein gH of pseudorabies virus is essential for penetration and propagation in cell culture and in the nervous system of mice. The Journal of general virology 77 (Pt 9), 2277-2285. [0123] Borst, E. M., Hahn, G., Koszinowski, U. H. & Messerle, M. (1999). Cloning of the human cytomegalovirus (HCMV) genome as an infectious bacterial artificial chromosome in Escherichia coli: a new approach for construction of HCMV mutants. J Virol 73, 8320-9. [0124] Costes, B., Fournier, G., Michel, B., Delforge, C., Raj, V. S., Dewals, B., Gillet, L., Drion, P., Body, A., Schynts, F., Lieffrig, F., Vanderplasschen, A., 2008. Cloning of the Koi herpesvirus genome as an infectious bacterial artificial chromosome demonstrates that disruption of the thymidine kinase locus induces partial attenuation in Cyprinus carpio koi. J Virol 82, 4955-4964. [0125] Dewals, B., Boudry, C., Gillet, L., Markine-Goriaynoff, N., de Leval, L., Haig, D. M. & Vanderplasschen, A. (2006). Cloning of the genome of Alcelaphine herpesvirus 1 as an infectious and pathogenic bacterial artificial chromosome. J Gen Virol 87, 509-17. [0126] Gillet, L., Daix, V., Donofrio, G., Wagner, M., Koszinowski, U. H., China, B., Ackermann, M., Markine-Goriaynoff, N. & Vanderplasschen, A. (2005). Development of bovine herpesvirus 4 as an expression vector using bacterial artificial chromosome cloning. J Gen Virol 86, 907-17. [0127] Hedrick, R. P., Gilad, O., Yun, S. C., MCdowell, T. S., Waltzek, T. B., Kelley, G. O., Adkison, M. A. (2005). Initial isolation and characterization of a herpes-like virus (KHV) from Koi and common carp. Bull. Fish. Res. Agen. Supplement 2, 1-7. [0128] Ilouze, M., Dishon, A. & Kotler, M. (2006). Characterization of a novel virus causing a lethal disease in carp and Koi. Microbiol Mol Biol Rev 70, 147-56. [0129] Markine-Goriaynoff, N., Gillet, L., Karlsen, O. A., Haarr, L., Minner, F., Pastoret, P. P., Fukuda, M. & Vanderplasschen, A. (2004). The core 2 beta-1,6-N-acetylglucosaminyltransferase-M encoded by bovine herpesvirus 4 is not essential for virus replication despite contributing to post-translational modifications of structural proteins. J Gen Virol 85, 355-67. [0130] Messerle, M., Crnkovic, I., Hammerschmidt, W., Ziegler, H. & Koszinowski, U. H. (1997). Cloning and mutagenesis of a herpesvirus genome as an infectious bacterial artificial chromosome. Proc Natl Acad Sci USA 94, 14759-63. [0131] Morgan, R. W., Cantello, J. L. & McDermott, C. H. (1990). Transfection of chicken embryo fibroblasts with Marek's disease virus DNA. Avian Dis 34, 345-51. [0132] Neukirch, M., Bttcher, K., Bunnajrakul, S. (1999). Isolation of a virus from Koi with altered gills. Bull. Eur. Ass. Fish. Pathol. 19, 221-224. [0133] Ronen, A., Perelberg, A., Abramowitz, J., Hutoran, M., Tinman, S, Bejerano, I., Steinitz, M. & Kotler, M. (2003). Efficient vaccine against the virus causing a lethal disease in cultured Cyprinus carpio. Vaccine 21, 4677-84. [0134] Schroder, C., Keil, G. M., 1999. Bovine herpesvirus 1 requires glycoprotein H for infectivity and direct spreading and glycoproteins gH(W450) and gB for glycoprotein D-independent cell-to-cell spread. The Journal of general virology 80 (Pt 1), 57-61. [0135] Wagner, M., Ruzsics, Z. & Koszinowski, U. H. (2002). herpesvirus genetics has come of age. Trends Microbiol 10, 318-24. [0136] Warden, C., Tang, Q., Zhu, H., 2011. Herpesvirus BACs: past, present, and future. Journal of biomedicine & biotechnology 2011, 124595. [0137] Warming, S., Costantino, N., Court, D. L., Jenkins, N. A. & Copeland, N. G. (2005). Simple and highly efficient BAC recombineering using galK selection. Nucleic Acids Res 33, e36.