RECOMBINANT VIRUS PRODUCTS AND METHODS FOR INHIBITION OF EXPRESSION OF DUX4

Abstract

The present invention relates to RNA interference-based methods for inhibiting the expression of the DUX4 gene, a double homeobox gene on human chromosome 4q35. Recombinant adeno-associated viruses of the invention deliver DNAs encoding microRNAs that knock down the expression of DUX4. The methods have application in the treatment of muscular dystrophies such as facioscapulohumeral muscular dystrophy.

Claims

1. A recombinant adeno-associated virus comprising the DUX4 miRNA-encoding DNA set out in SEQ ID NO: 1 or 2, wherein the recombinant adeno-associated virus lacks rep and cap genes.

2. A composition comprising the recombinant adeno-associated virus of claim 1.

3. A method of inhibiting expression of the DUX4 gene in a cell comprising contacting the cell with a recombinant adeno-associated virus of claim 1 or the composition of claim 2.

4. A method of delivering the DUX4 miRNA-encoding DNA set out in SEQ ID NO: 1 to an animal in need thereof, comprising administering to the animal a recombinant adeno-associated virus comprising the DUX4 miRNA-encoding DNA set out in SEQ ID NO: 1, wherein the recombinant adeno-associated virus lacks rep and cap genes.

5. A method of delivering the DUX4 miRNA-encoding DNA set out in SEQ ID NO: 2 to an animal in need thereof, comprising administering to the animal a recombinant adeno-associated virus comprising the DUX4 miRNA-encoding DNA set out in SEQ ID NO: 2, wherein the recombinant adeno-associated virus lacks rep and cap genes.

6. A method of treating facioscapulohumeral muscular dystrophy comprising administering a recombinant adeno-associated virus comprising the DUX4 miRNA-encoding DNA set out in SEQ ID NO: 1, wherein the recombinant adeno-associated virus lacks rep and cap genes.

7. A method of treating facioscapulohumeral muscular dystrophy comprising administering a recombinant adeno-associated virus comprising the DUX4 miRNA-encoding DNA set out in SEQ ID NO: 2, wherein the recombinant adeno-associated virus lacks rep and cap genes.

8. The recombinant adeno-associated virus of claim 1 wherein expression of the miRNA-encoding DNA is under the control of a CMV promoter, a muscle creatine kinase (MCK) promoter, an alpha-myosin heavy chain enhancer-/MCK enhancer-promoter (MHCK7) or a desmin promoter.

9. The composition of claim 2 wherein expression of the miRNA-encoding DNA is under the control of a CMV promoter, a muscle creatine kinase (MCK) promoter, an alpha-myosin heavy chain enhancer-/MCK enhancer-promoter (MHCK7) or a desmin promoter.

10. The method of any one of claims 3-7 wherein expression of the miRNA-encoding DNA is under the control of a CMV promoter, a muscle creatine kinase (MCK) promoter, an alpha-myosin heavy chain enhancer-/MCK enhancer-promoter (MHCK7) or a desmin promoter.

11. A DNA set out in SEQ ID NO: 1 encoding miDUX4.405.

12. A DNA set out in SEQ ID NO: 2 encoding miDUX4.1156.

Description

BRIEF DESCRIPTION OF THE DRAWING

[0043] FIG. 1 shows the human DUX4 DNA sequence.

[0044] FIGS. 2A and 2B set out sequences of DUX4 targeted miRNAs. In each panel, the top sequences indicate the DNA templates from which each respective miRNA is transcribed. In the top panel, the DNA template miDUX4.405 is SEQ ID NO: 1. In the bottom panel, the DNA template miDUX4.1156 is SEQ ID NO: 2. The folded miRNA transcripts are shown as hairpin structures. The miDUX4.405 folded miRNA is SEQ ID NO: 8. The miDUX4.1156 folded miRNA is SEQ ID NO: 9. The mature miDUX4.405 and miDUX4.1156 sequences arise following processing in target cells by host miRNA processing machinery (including Drosha. DGCR8, Dicer, and Exportin-5). Sequences shaded in gray indicate restriction sites used for cloning each miRNA into the U6T6 vector. CTCGAG is an XhoI site and ACTAGT is a SpeI site (CUCGAG and ACUAGU in RNA, where the U is a uracil base). The red sequence indicates the mature miRNA antisense guide strand that ultimately helps catalyze cleavage of the DUX4 target mRNA. This sequence is also underlined in the miRNA hairpin portions of this diagram. The gray and black arrowheads indicate Drosha- and Dicer-catalyzed cleavage sites, respectively. The numbers 13, 35, 53, and 75 are provided for orientation. The sequences between (and including) positions 35-53 are derived from the natural human mir-30a sequence, except the A at position 39, which is a G is the normal mir-30a sequence. We changed this nucleotide to an A to facilitate folding of the miRNA loop, based on in silico RNA folding models. The base of the stem (5 of position 13 and 3 of position 75) is also derived from mir-30a structure and sequence with some modifications depending on the primary sequence of the guide strand. Specifically, the nucleotide at position 13 can vary to help facilitate a required mismatched between the position 13 and 75 nucleotides. This bulged structure is hypothesized to facilitate proper Drosha cleavage.

[0045] FIG. 3 relates to a luciferase assay used for initial miDUX4 efficacy screens. FIG. 3A shows the dual luciferase reporter plasmid used for in vitro screens. This vector is modified from a commercially available plasmid (psiCheck2) obtained from Promega. The human DUX4 cDNA was cloned downstream of the Renilla luciferase gene, as shown. This conformation does not produce a Luciferase-DUX4 fusion protein, since the DUX4 sequences are placed after the Renilla luciferase stop codon. Instead, a fusion mRNA is produced, in which the DUX4 sequences are the de facto 3 untranslated region (3 UTR) of Renilla luciferase. As a result, any effective DUX4-targeted miRNA will reduce the Renilla Luciferase-DUX4 fusion mRNA, which subsequently decreases Renilla luciferase protein expression in transfected cells. There is a separate Firefly luciferase gene located on the same plasmid, which does not contain any DUX4 sequences and is therefore unaffected by DUX4-targeted miRNAs. FIG. 3B shows Firefly and Renilla luciferase activity quantified separately in cells using a Dual Luciferase Assay Kit (Promega). DUX4 gene silencing is therefore measured indirectly and indicated by a low ratio of Renilla:Firefly luciferase activity. All samples in this assay are normalized to cells co-transfected with our reporter vector and the U6.miGFP control miRNA. Samples transfected with miDUX4.405 and miDUX4.1156 had consistently lower Renilla luciferase activity, indicating DUX4 gene silencing. Data in B are representative of two independent experiments performed on different days in triplicate. Error bars indicate standard error of the mean (s.e.m.).

[0046] FIG. 4A is a diagram of constructs used in Western blot experiments showing AAV.miDUX4 proviral plasmids reduce DUX4 protein expression in vitro. In the diagram of the constructs, the black rectangles indicate AAV inverted terminal repeats (ITRs), CMV is the cytomegalovirus promoter, hrGFP is a green fluorescent protein coding region, pA is the SV40 polyA signal and V5 refers to the V5 epitope which was inserted in frame at the C terminus of human DUX4 to facilitate detection with commercially available V5 epitope antibodies (Invitrogen). The U6.miDUX4 sequences (405 and 1156) and U6.miGFP control were cloned upstream of the CMV.hrGFP.pA cassette, as shown. Proviral plasmids were co-transfected into HEK293 cells with the CMV.DUX4.V5 expression vector shown at the top of FIG. 4A. FIG. 4B shows Western blots using antibodies targeting the V5 epitope (DUX4) demonstrating DUX4 gene silencing by both miDUX4 sequences, compared to the non-targeting miGFP control. GAPDH antibodies were used to control for equivalent loading of protein extracts for the experiment. The Tint lane contains protein extracts from untransfected HEK293 cells.

[0047] FIG. 5 is a diagram of genomes of rAAV encoding DUX4 miRNAs.

EXAMPLES

[0048] The role of DUX4 in FSHD pathogenesis can be explained as follows. First, D4Z4 repeats are not pseudogenes. The DUX4 locus produces 1.7 kb and 2.0 kb full-length mRNAs with identical coding regions, and D4Z4 repeats also harbor smaller sense and antisense transcripts, including some resembling microRNAs. Over-expressed DUX4 transcripts and a 50 kDa full-length DUX4 protein are found in biopsies and cell lines from FSHD patients. These data are consistent with a transcriptional de-repression model of FSHD pathogenesis. In addition, unlike pseudogenes, D4Z4 repeats and DUX4 likely have functional importance, since tandemly-arrayed D4Z4 repeats are conserved in at least eleven different placental mammalian species (non-placental animals lack D4Z4 repeats), with the greatest sequence conservation occurring within the DUX4 ORF. Second, over-expressed DUX4 is toxic to tissue culture cells and embryonic progenitors of developing lower organisms in vivo. This toxicity occurs at least partly through a pro-apoptotic mechanism, indicated by Caspase-3 activation in DUX4 transfected cells, and presence of TUNEL-positive nuclei in developmentally arrested Xenopus embryos injected with DUX4 mRNA at the two-cell stage. These findings are consistent with studies showing some pro-apoptotic proteins, including Caspase-3, are present in FSHD patient muscles. In addition to stimulating apoptosis, DUX4 may negatively regulate myogenesis. Human DUX4 inhibits differentiation of mouse C2C12 myoblasts in vitro, potentially by interfering with PAX3 and/or PAX7, and causes developmental arrest and reduced staining of some muscle markers when delivered to progenitor cells of zebrafish or Xenopus embryos. Finally, aberrant DUX4 function is directly associated with potentially important molecular changes seen in FSHD patient muscles. Specifically, full-length human DUX4 encodes an approximately 50 kDa double homeodomain transcription factor, and its only known target, Pitx1, was elevated in DUX4 over-expressing FSHD patient muscles. These data support that DUX4 catalyzes numerous downstream molecular changes that are incompatible with maintaining normal muscle integrity.

[0049] Thus, aspects and embodiments of the invention are illustrated by the following examples. Example 1 describes miRNAs specific for the DUX4 gene. Example 2 describes the effect of the miRNAs on the expression of DUX4 as measured by luciferase assay. Example 3 describes the in vitro effect of proviral plasmids expressing the miRNAs on the expression of DUX4 as measured by Western blot. Example 4 describes rAAV vectors encoding DUX4 miRNAs. Example 5 describes mitigation of DUX4-induced myopathy by AAV6.miDUX4.405 vectors. Example 6 describes protection of muscles from pathological muscles changes associated with FSHD. Example 7 describes the protection of mice from DUX4-associated grip strength deficits.

Example 1

MicroRNAs Specific for the DUX4 Gene

[0050] Two miRNAs specific for the DUX4 gene were generated by PCR. Four PCR primers were used that had the following sequences.

TABLE-US-00001 Primer662(miDUX4hum405F): (SEQIDNO:3) AAAACTCGAGTGAGCGATCCAGGATTCAGATCTGGTTTCTGAAAGCCACA GATGGG Primer663(miDUX4hum405R): (SEQIDNO:4) TTTTACTAGTAGGCAGTCCAGGATTCAGATCTGGTTTCCCATCTGTGGCT TTCAG Primer665(miDUX4hum1156F): (SEQIDNO:5) AAAACTCGAGTGAGCGAAGGCGCAACCTCTCCTAGAAACTGAAAGCCACA GATGGG Primer667(miDUX4hum1156R): (SEQIDNO:6) TTTTACTAGTAGGCACAGGCGCAACCTCTCCTAGAAACCCATCTGTGGCT TTCAG

[0051] DNA encoding a miRNA designated hDux.mi405 was generated using primers 662 and 663. DNA encoding miRNA designated hDux.mi1156 was generated using primers 665 and 667.

[0052] One g of each primer was added to a 1 cycle primer extension reaction: 95 C. for 5 min.; 94 C. for 2 min.; 52 C. for 1 min.; 72 C. for 15 min.; and then holding at 4 C. The PCR products were cleaned up with the Qiagen QIAquick PCR Purification kit before being digested overnight with XHOI and SPEI restriction enzymes. The digestion product was then run on a 1.5% TBE gel and the band excised and purified using the Qiagen QIAquick Gel Extraction Kit. The sequences of the miRNAs are set out below and in FIGS. 2A and 2B, respectively.

TABLE-US-00002 miDux4.405 (SEQIDNO:1) CTCGAGTGAGCGATCCAGGATTCAGATCTGGTTTCTGAAAGCCACAGATG GGAAACCAGATCTGAATCCTGGACTGCCTACTAGT miDux4.1156 (SEQIDNO:2) CTCGAGTGAGCGAAGGCGCAACCTCTCCTAGAAACTGAAAGCCACAGATG GGTTTCTAGGAGAGGTTGCGCCTGTGCCTACTAGT

[0053] The two PCR products were ligated overnight to a U6T6 vector (via XhoI and XbaI) that contains a mouse U6 promoter and an RNA polymerase III termination signal (six thymidine nucleotides). MiRNAs are cloned into XhoI and XbaI restriction sites located between the 3 end of the U6 promoter and termination signal (SpeI site on the 3 end of the DNA template for each miRNA has complementary cohesive ends with the XbaI site). The ligation product was transformed into chemically competent E-coli cells with a 42 C. heat shock and incubated at 37 C. shaking for 1 hour before being plated on kanamycin selection plates. The colonies were allowed to grow overnight at 37. The following day they were mini-prepped and sequenced for accuracy.

Example 2

Luciferase Assay for Effect of Expression of DUX4 miRNAs

[0054] Expression of the DUX4 target sequence in the presence of the DUX4 miRNAs was assayed. A lipofectamine 2000 transfection was done in 293 cells in a 96-well, white-walled assay plate. 140,000 cells were transfected with 20 ng of a Renilla-firefly plasmid containing the DUX4 target sequence (FIG. 3A) and 180 ng of various DUX4 miRNA-encoding vectors, including U6T6-driven miDux4.405 or miDux4.1156 vectors from Example 1. A luciferase assay was performed 24 hours later.

[0055] The media was removed from the cells and 20 l of lysis buffer was added per well. The plate was put on a shaker for 15 minutes at room temperature before adding 50 l of luciferase substrate. The first reading was taken 10 minutes later. Next, 50 l of Stop and Glo luciferase substrate was added and the second reading was taken 10 minutes later. The Renilla expression was divided by the firefly expression to calculate the relative expression. The relative expression was then normalized to the expression of cells that were transfected with a control miRNA that targets eGFP. Results are shown in FIG. 3B. The DUX4 miRNAs miDUX4.405 and miDUX4.1156 were the most effective at reducing luciferase protein expression in transfected cells.

Example 3

Western Blot Assay for Effect of Expression of DUX4 miRNAs from rAAV

[0056] Next, the U6T6.miDUX4 miRNA expression cassettes were cloned into AAV.CMV.hrGFP proviral plasmids as shown in the FIG. 4A. The proviral plasmids were then co-transfected with a DUX4.V5 expression plasmid into 293 cells and the effect of expression of DUX4 miRNAs from the proviral plasmids was assayed by Western blot. A U6.miGFP sequence, which does not target DUX4, was used as a negative control for gene silencing.

[0057] One day before transfection, 293 cells were plated in a 24-well plate at 1.510.sup.5 cells/well. The cells were then transfected with AAV-CMV-DUX4-V5 and AAV-CMV-miDUX4 (405 or 1156) using Lipofectamine 2000 (Invitrogen, Cat. No. 11668-019):

Group 1: AAV-CMV-DUX4-V5 50 ng+AAV-CMV-miDUX4 800 ng (1:16)
Group 2: AAV-CMV-DUX4-V5 100 ng+AAV-CMV-miDUX4 800 ng (1:8)

[0058] Thirty-six h after transfection, cells were collected and washed with cold PBS once. Seventy l lysis buffer (137 mM NaCl, 10 mM Tris pH=7.4, 1% NP40) were then added. The cells were resuspended completely and incubated on ice for 30 min. The samples were centrifuged for 20 min at 13,000 rpm at 4 C. and the supernatant was collected. The cell lysate was diluted 5-fold for the Lowry protein concentration assay (Bio-Rad Dc Protein Assay Reagent A, B. S; Cat. No. 500-0113, 500-0114, 500-115). Twenty-three g of each sample was taken and 2 sample buffer (100 mM Tris pH=6.8, 100 mM DTT, 10% glycerol, 2% SDS, 0.006% bromophenol blue) was added. The samples were boiled for 10 min and then put on ice.

[0059] The samples were loaded onto 10% polyacrylamide gels (based on 37.5:1 acrylamide:bis acrylamide ratio, Bio-Rad, Cat. No. 161-0158), 3.5 g and 18 g on two gels for each sample. Proteins were transferred to PVDF membranes at 15 V for 1 h using semi-dry transfer (Trans-Blot SD Semi-Dry Transfer Cell, Bio-Rad, Cat. No. 170-3940). The blots were placed into blocking buffer (5% non-fat dry milk, 30 mM Tris pH=7.5, 150 mM NaCl, 0.05% Tween-20) and agitated for 1 h at room temperature. The blocking buffer was decanted and anti-DUX4 primary antibody solution (DUX4 p12, Santa Cruz, Cat. No. sc-79927, 1:1,000) was added and incubated with agitation overnight at 4 C. The membranes were then washed for 30 min, changing the wash buffer (150 mM NaCl, 30 mM Tris pH=7.5, 0.05% Tween-20) every 10 min. Peroxidase-conjugated Donkey Anti-Goat Antibody (Jackson ImmunoReserch, Cat. No. 705-035-003, 1:100,000) was added and incubated at room temperature for 2 h. The membranes were then washed for 30 min, changing the wash buffer every 10 min. The blots were placed in chemiluminescent working solution (Immobilon Western Chemiluminescent HRP Substrate, Millipore, Cat. No. WBKLS0500), incubated with agitation for 5 mm at room temperature, and then exposed to X-ray film.

[0060] The membranes were washed for 20 min, changing the wash buffer every 10 min. Next, stripping buffer (2% SDS, 62.5 mM Tris pH=6.7, 100 mM b-ME) was added to the blots and incubated at 50 C. for 30 mm. The membranes were washed again for 30 min, changing the wash buffer every 10 mm. Then, the membranes were blocked again and re-probed with Anti-GAPDH primary antibody solution (Chemicon, Cat. No. MAB374, 1:200) and peroxidase-conjugated Goat Anti-Mouse Antibody (Jackson ImmunoReserch, Cat. No. 115-035-146, 1:100,000) was used as secondary antibody.

[0061] Finally, the membranes were stripped again and re-probed with anti-V5 antibody (Invitrogen, Cat. No. R960-25, 1:5,000).

[0062] The AAV.miDUX4 proviral plasmids reduced DUX4 protein expression in vitro. AAV-CMV-miDUX4.405 was the most effective at knocking down DUX4 expression.

Example 4

Production of rAAV Encoding DUX4 MicroRNAs

[0063] Vector was produced by co-transfection in HEK293 cells of three plasmids (pAdhelper, AAV helper, and the rAAV genome containing miDUX4; described in detail below), followed by cell-harvesting, vector purification, titration, and quality control assays.

[0064] Plasmids:

[0065] pAdhelper contains the adenovirus genes E2A, E4 ORF6, and VA I/II; AAV helper plasmids contain AAV rep2 and cap6 (for example, for an AAV serotype 6 preparation, the capsid gene would be called cap6); the rAAV plasmid contains AAV inverted terminal repeat (ITRs) sequences flanking the genetic elements to be packaged into the vector. For the AAV.miDUX4, this includes the U6.miDUX4 cloned upstream of the CMV.eGFP reporter gene.

[0066] Transfection: Plasmids were transfected into 293 cells (Corning 10-Stack) using CaPO.sub.4 at a 4:4:1 ratio (20 g pAd helper:20 g AAV helper:5 g rAAV vector plasmid per plate.

[0067] Cell Harvesting:

[0068] Forty-eight hr post-transfection, cells were harvested and resuspended in 20 mM Tris (pH 8.0), 1 mM MgCl.sub.2 and 150 mM NaCl (T20M1N150) at a density of 510.sup.6 cells/ml. Cells were lysed by four sequential freeze/thaw cycles and Benzonase nuclease (AIC, Stock: 250 U/ul) added to a final concentration of 90 U/ml before cell lysate clarification.

[0069] Vector Purification and Titration:

[0070] Clarified lysates were subjected to iodixanol step gradient purification as previously described (Xiao, X, et al. J. Virol 72:2224-32). The 40% iodixanol layer (containing rAAV) was diluted 5-fold with a no-salt dilution buffer (pH varying depending on serotype) and applied to a Hi-Trap HP-Q/S column. Upon elution with a NaCl salt gradient, peak 1 ml fractions (typically 3-5) were pooled, dialyzed with T20MIN200 (pH 8.0), then sterile filtered and supplemented with 0.001% Pluronic F68. Vector was stored at 80 C. Purified virus was titered for vg using Q-PCR as previously described [Schnepp and Clark, Methods Mol. Med., 69:427-443 (2002)].

[0071] Schematic diagrams of the rAAV genomes are shown in FIG. 5.

Example 5

AAV6.miDUX4s Mitigated DUX4-Associated Muscle Toxicity In Vivo

[0072] Adult wild-type male C57BL/6 mice were co-injected with 1) 310.sup.9 DNase resistant particles (DRP) of AAV.CMV.DUX4.V5 or were sham injected, and 2) 310.sup.10 DRP of AAV.miDUX4 or control AAV.CMV.GFP into the tibialis anterior muscle. Animals were sacrificed two weeks later. Muscles were cryopreserved and cut into 10 mm cryosections, then stained with hematoxylin and eosion (H&E).

[0073] Animals that received DUX4 and eGFP vectors showed histological indicators of muscle damage. Specifically, these muscle sections contained abundant myofibers with centrally-located nuclei, small-bore myofibers (both of which indicate newly regenerated muscle), and deposition of fibrotic tissue. At 4 weeks, miDUX4-treated animals were indistinguishable from sham-injected normal wild-type muscles.

[0074] MiDUX4-treatment significantly mitigated DUX4-induced muscle degeneration, compared to control GFP-injected muscles.

Example 6

AAV6.miDUX4s Protected Muscles from Pathological Molecular Changes Associated with FSHD

[0075] Caspase-3 is expressed in myofibers of FSHD patients and is activated by DUX4 expression in mouse muscle. The effect of expression of DUX4 in the presence and absence of AAV6.miDUX4 was examined.

[0076] Eight-week-old C57BL/6 female mice received 50 l direct intramuscular injections into the tibialis anterior. Premixed virus cocktails contained 810.sup.8 DNAse resistant particles of AAV6.DUX4 and 310.sup.10 of either AAV6.miDUX4 or AAV6.eGFP. Muscle samples were prepared as described in Example 5 and stained with cleaved Caspase-3 (Cell Signaling Technology, Danvers, Mass.) polyclonal antibodies by standard methods.

[0077] Uninhibited DUX4 expression was associated with caspase-3 positive lesions in AAV6.DUX4-transduced control muscles in mice. In contrast, there were no caspase-3 positive myofibers in muscles coinjected with AAV6.DUX4 and AAV.miDUX4 vectors.

Example 7

AAV6.miDUX4s Protect Mice from DUX4-Associated Grip Strength Deficits

[0078] The effects of AAV6.miDUX4 on DUX4-associated hindlimb grip strength deficits in mice were measured.

[0079] Grip strength was measured in forelimbs and hindlimbs of C57BL/6 mice (n=8 animals) one week before injection to establish a baseline, and then weekly up to 4 weeks postinjection as previously described in Wallace et al., Ann. Neural., 69: 540-552 (2011). By two weeks, mice injected with AAV6.DUX4 alone or AAV6.DUX4 with control AAV.eGFP showed significantly reduced grip strength compared to all other groups. This timepoint is consistent with the onset of degeneration in muscle cryosections. Weakness resolved in three weeks, as regenerative processes were underway. In contrast, animals coinjected with AAV6.DUX4 and AAV6.miDUX4 were not significantly weaker than saline-injected wild type mice at any timepoint following injection. Mice that received AAV6.miDUX4 alone were unaffected, indicating miDUX4 expression was well-tolerated by normal muscles.

[0080] While the present invention has been described in terms of specific embodiments, it is understood that variations and modifications will occur to those skilled in the art. Accordingly, only such limitations as appear in the claims should be placed on the invention.

[0081] All documents referred to in this application are hereby incorporated by reference in their entirety.