Indole carboxamide derivatives as P2X7 receptor antagonists
09556117 ยท 2017-01-31
Assignee
Inventors
- Kurt Hilpert (Allschwil, CH)
- Francis Hubler (Allschwil, CH)
- Dorte Renneberg (Allschwil, CH)
- Simon Stamm (Allschwil, CH)
Cpc classification
A61P29/00
HUMAN NECESSITIES
C07D209/18
CHEMISTRY; METALLURGY
C07D209/24
CHEMISTRY; METALLURGY
C07D403/12
CHEMISTRY; METALLURGY
A61P43/00
HUMAN NECESSITIES
C07D401/12
CHEMISTRY; METALLURGY
A61P1/00
HUMAN NECESSITIES
A61P15/00
HUMAN NECESSITIES
C07D209/08
CHEMISTRY; METALLURGY
C07D209/30
CHEMISTRY; METALLURGY
International classification
C07D209/08
CHEMISTRY; METALLURGY
C07D401/12
CHEMISTRY; METALLURGY
C07D403/12
CHEMISTRY; METALLURGY
A61P29/00
HUMAN NECESSITIES
C07D209/18
CHEMISTRY; METALLURGY
C07D209/24
CHEMISTRY; METALLURGY
C07D209/30
CHEMISTRY; METALLURGY
Abstract
The invention relates to indole carboxamide derivatives of formula (I), ##STR00001##
wherein R.sup.1, R.sup.2, R.sup.3, R.sup.4, R.sup.5, R.sup.6, R.sup.7, R.sup.8, R.sup.9, R.sup.10 and n are as defined in the description, their preparation and their use as pharmaceutically active compounds.
Claims
1. A compound of the formula (I), ##STR00017## wherein n represents 1, 2, 3 or 4; R.sup.1 represents hydrogen and R.sup.2 represents hydroxy; hydroxy-(C.sub.1-C.sub.3)alkyl; (C.sub.1-C.sub.3)alkoxy; NHR.sup.11; N(CH.sub.3).sub.2; CN; CONH.sub.2; (C.sub.1-C.sub.4)alkoxy-carbonyl; (C.sub.1-C.sub.4)alkylamino-carbonyl; aryl which is unsubstituted or mono- or di-substituted with (C.sub.1-C.sub.3)fluoroalkyl or halogen; or heteroaryl which is unsubstituted or mono- or di-substituted with (C.sub.1-C.sub.4)alkyl, (C.sub.1-C.sub.3) fluoroalkyl or halogen; or R.sup.1 represents (C.sub.1-C.sub.3)alkyl or hydroxy-(C.sub.1-C.sub.3)alkyl and R.sup.2 represents hydrogen; R.sup.3 represents hydrogen or fluoro; R.sup.4 represents hydrogen or fluoro; R.sup.5 represents hydrogen, (C.sub.1-C.sub.4)alkyl or halogen; R.sup.6 represents hydrogen, (C.sub.1-C.sub.4)alkyl, (C.sub.1-C.sub.4)alkoxy, (C.sub.1-C.sub.4)alkyl-carbonyl, hydroxy-(C.sub.1-C.sub.4)alkyl, hydroxy-(C.sub.2-C.sub.4)alkoxy, (C.sub.1-C.sub.2)alkoxy-(C.sub.1-C.sub.4)alkyl, (C.sub.1-C.sub.4)alkoxy-(C.sub.2-C.sub.4)alkoxy, hydroxy, amino, nitro or halogen; R.sup.7 represents hydrogen or (C.sub.1-C.sub.3)alkyl; R.sup.8 represents hydrogen, (C.sub.1-C.sub.4)alkyl or hydroxy; R.sup.9 represents hydrogen, (C.sub.1-C.sub.4)alkyl, (C.sub.1-C.sub.4)alkylthio, formyl or halogen; R.sup.10 represents fluoro, chloro, methyl, ethyl, (C.sub.1-C.sub.2)fluoroalkyl or methoxy; and R.sup.11 represents hydrogen, benzyl, (C.sub.1-C.sub.4)alkyl-carbonyl, (C.sub.1-C.sub.4)alkoxy-carbonyl or (C.sub.1-C.sub.4)alkyl-sulfonyl which is unsubstituted or mono-substituted with hydroxy or (C.sub.1-C.sub.4)alkoxy-carbonyl; or a salt of such a compound.
2. The compound of formula (I) according to claim 1, wherein n represents 2, 3 or 4; R.sup.1 represents hydrogen; R.sup.2 represents hydroxy; hydroxy-(C.sub.1-C.sub.3)alkyl; NHR.sup.11; CN; or a 5- or 6-membered monocyclic heteroaryl group which group is unsubstituted or mono-substituted with (C.sub.1-C.sub.4)alkyl, (C.sub.1-C.sub.3) fluoroalkyl or halogen; R.sup.3 represents hydrogen or fluoro; R.sup.4 represents hydrogen or fluoro; R.sup.5 represents hydrogen; R.sup.6 represents hydrogen, (C.sub.1-C.sub.4)alkyl, (C.sub.1-C.sub.4)alkoxy or (C.sub.1-C.sub.2)alkoxy-(C.sub.1-C.sub.4)alkyl; R.sup.7 represents hydrogen; R.sup.8 represents hydrogen; R.sup.9 represents hydrogen, (C.sub.1-C.sub.4)alkyl or halogen; R.sup.10 represents chloro or methyl; and R.sup.11 represents (C.sub.1-C.sub.4)alkyl-sulfonyl which is unsubstituted or mono-substituted with hydroxy or (C.sub.1-C.sub.4)alkoxy-carbonyl; or a salt of such a compound.
3. The compound of formula (I) according to claim 1, wherein n represents 2 or 3; or a salt of such a compound.
4. The compound of formula (I) according to claim 1, wherein R.sup.2 represents hydroxy; hydroxy-(C.sub.1-C.sub.3)alkyl; NHR.sup.11; or CN; and R.sup.11 represents methyl-sulfonyl which is unsubstituted or mono-substituted with methoxy-carbonyl; or ethyl-sulfonyl which is mono-substituted with hydroxy; or a salt of such a compound.
5. The compound of formula (I) according to claim 1, wherein R.sup.2 represents a 5- or 6-membered monocyclic heteroaryl group which group is unsubstituted or mono-substituted with (C.sub.1-C.sub.4)alkyl, (C.sub.1-C.sub.3)fluoroalkyl or halogen; or a salt of such a compound.
6. The compound of formula (I) according to claim 1, wherein R.sup.6 represents (C.sub.1-C.sub.4)alkyl, (C.sub.1-C.sub.4)alkoxy or (C.sub.1-C.sub.2)alkoxy-(C.sub.1-C.sub.4)alkyl; or a salt of such a compound.
7. The compound of formula (I) according to claim 1, wherein R.sup.5, R.sup.7, R.sup.8 and R.sup.9 represent hydrogen; or a salt of such a compound.
8. The compound of formula (I) according to claim 1, wherein R.sup.10represents chloro; or a salt of such a compound.
9. The compound of formula (I) according to claim 1, which is also a compound of formula (I.sub.OH) ##STR00018## wherein n represents 2 or 3; R.sup.3 represents hydrogen or fluoro; R.sup.4 represents hydrogen or fluoro; R.sup.6 represents (C.sub.1-C.sub.4)alkyl, (C.sub.1-C.sub.4)alkoxy, hydroxy-(C.sub.1-C.sub.4)alkyl, hydroxy-(C.sub.2-C.sub.4)alkoxy, (C.sub.1 -C.sub.2)alkoxy-(C.sub.1-C.sub.4)alkyl or halogen; and R.sup.10 represents chloro, methyl or trifluoromethyl; or a salt of such a compound.
10. The compound of formula (I) according to claim 1, which is also a compound of formula (I.sub.HET) ##STR00019## wherein n represents 2 or 3; X represents CH or N; .sup.2S represents hydrogen, (C.sub.1-C.sub.4)alkyl, (C.sub.1-C.sub.3)fluoroalkyl or halogen; R.sup.3 represents hydrogen or fluoro; R.sup.4 represents hydrogen or fluoro; and R.sup.6 represents hydrogen or (C.sub.1-C.sub.4)alkyl; or a salt of such a compound.
11. The compound of formula (I) according to claim 1, selected from the group consisting of: 4-Chloro-1H-indole-5-carboxylic acid ((S)-1-cyclohexyl-2-hydroxy-ethyl)-amide; 4-Chloro-1H-indole-5-carboxylic acid (1-hydroxy-cyclohexylmethyl)-amide; 4-Chloro-1H-indole-5-carboxylic acid (1-hydroxy-cycloheptylmethyl)-amide; 4-Chloro-1H-indole-5-carboxylic acid (4,4-difluoro-1-hydroxy-cyclohexylmethyl)-amide; 4-Chloro-1H-indole-5-carboxylic acid [(S)-1-(4,4-difluoro-cyclohexyl)-2-hydroxy-ethyl]-amide; 4-Chloro-l-methyl-1H-indole-5-carboxylic acid (1-hydroxy-cyclohexylmethyl)-amide; 4-Chloro- 1-methyl- 1H-indole-5-carboxylic acid ((S)- 1-cyclohexyl-2-hydroxy-ethyl)-amide; 4-Chloro-3-formyl- 1H-indole-5-carboxylic acid ((S)- 1-cyclohexyl-2-hydroxy-ethyl)-amide; 4-Chloro-3-formyl-1H-indole-5-carboxylic acid (1-hydroxy-cyclohexylmethyl)-amide; 4-Chloro-1H-indole-5-carboxylic acid (1-cycloheptyl-2-hydroxy-ethyl)-amide; 4-Chloro-1H-indole-5-carboxylic acid [1-(2-trifluoromethyl-pyrimidin-5-yl)-cyclohexylmethyl]-amide; 4-Chloro-1H-indole-5-carboxylic acid [1-(6-chloro-pyridin-3-yl)-cyclohexylmethyl]-amide; 4-Chloro-1H-indole-5-carboxylic acid [1-(6-trifluoromethyl-pyridin-3-yl)-cyclohexylmethyl]-amide; 4-Chloro-1H-indole-5-carboxylic acid [1-(6-chloro-pyridin-3-yl)-4,4-difluoro-cyclohexylmethyl ]-amide; 4-Chloro-1H-indole-5-carboxylic acid [1-(4-chloro-phenyl)-cyclohexylmethyl]-amide; 4-Chloro-1H-indole-5-carboxylic acid [1-(4-trifluoromethyl-phenyl)-cyclohexylmethyl]-amide; 4-Chloro-1H-indole-5-carboxylic acid (1-pyridin-3-yl-cyclohexylmethyl)-amide; 4-Chloro-1H-indole-5-carboxylic acid (1-pyridin-3-yl-cyclopentylmethyl)-amide; 4-Chloro-1H-indole-5-carboxylic acid (1-pyridin-3-yl-cycloheptylmethyl)-amide; 4-Chloro-7-methyl-1H-indole-5-carboxylic acid (1-hydroxy-cyclohexylmethyl)-amide; 4-Chloro-2-oxo-2,3-dihydro-1H-indole-5-carboxylic acid (1-hydroxy-cycloheptylmethyl)-amide; 4-Chloro-2-methyl-1H-indole-5-carboxylic acid (1-hydroxy-cyclohexylmethyl)-amide; 4-Chloro-7-iodo-3-methylsulfanyl-1H-indole-5-carboxylic acid (1-hydroxy-cyclohexylmethyl)-amide; 4-Chloro-7-methyl-1H-indole-5-carboxylic acid (4,4-difluoro- l -hydroxy-cyclohexylmethyl)-amide; 4-Chloro-7-methyl-1H-indole-5-carboxylic acid (1-hydroxy-cycloheptylmethyl)-amide; 4-Chloro-3-fluoro-1H-indole-5-carboxylic acid (1-hydroxy-cycloheptylmethyl)-amide; 4-Methoxy-1H-indole-5-carboxylic acid (1-hydroxy-cycloheptylmethyl)-amide; 3,4-Dichloro-1H-indole-5-carboxylic acid (1-hydroxy-cyclohexylmethyl)-amide; 4-Chloro-7-nitro-1H-indole-5-carboxylic acid (1-hydroxy-cyclohexylmethyl)-amide; 1-{[(4-Chloro-1H-indole-5-carbonyl)-amino]-methyl }-cyclohexanecarboxylic acid methyl ester; 4-Chloro-1H-indole-5-carboxylic acid (1-hydroxymethyl-cyclohexylmethyl)-amide; 7-Amino-4-chloro-1H-indole-5-carboxylic acid (1-hydroxy-cyclohexylmethyl)-amide; 4-Chloro-3-methyl-1H-indole-5-carboxylic acid (1-hydroxy-cycloheptylmethyl)-amide; 4-Chloro-1H-indole-5-carboxylic acid (1-carbamoyl-cyclohexylmethyl)-amide; 4-Chloro-1H-indole-5-carboxylic acid (1-methylcarbamoyl-cyclohexylmethyl)-amide; 4-Chloro-1H-indole-5-carboxylic acid (1-cyano-cyclohexylmethyl)-amide; (1-{[(4-Chloro-1H-indole-5-carbonyl)-amino]-methyl }-cyclohexyl)-carbamic acid tert-butyl ester; 4,6-Dichloro-1H-indole-5-carboxylic acid (4,4-difluoro-1-hydroxy-cyclohexylmethyl)-amide; 4-Chloro-1H-indole-5-carboxylic acid (1-amino-cyclohexylmethyl)-amide; 4-Chloro-6-methyl-1H-indole-5-carboxylic acid (1-hydroxy-cyclohexylmethyl)-amide; 4-Chloro-1H-indole-5-carboxylic acid (1-hydroxy-cyclopentylmethyl)-amide; 4-Chloro-1H-indole-5-carboxylic acid (1-hydroxy-cyclooctylmethyl)-amide; 4-Chloro-1H-indole-5-carboxylic acid (1-methoxy-cyclohexylmethyl)-amide; 4-Chloro-1H-indole-5-carboxylic acid ((S)-1-cyclohexyl-ethyl)-amide; 4-Chloro-1H-indole-5-carboxylic acid ((R)- 1 -cyclohexyl-ethyl)-amide; 4-Chloro-1H-indole-5-carboxylic acid (1-acetylamino-cyclohexylmethyl)-amide; 4-Chloro-1H-indole-5-carboxylic acid (1-methanesulfonylamino-cyclohexylmethyl)-amide; 4-Chloro-1H-indole-5-carboxylic acid (1-dimethylamino-cyclohexylmethyl)-amide; 4-Chloro-1H-indole-5-carboxylic acid (1-benzylamino-cyclohexylmethyl)-amide; 3-Bromo-4-chloro-7-methyl-1H-indole-5-carboxylic acid (1-hydroxy-cyclohexylmethyl)-amide; (1-{[(4-Chloro-1H-indole-5-carbonyl)-amino]-methyl }-cyclohexylsulfamoyl)-acetic acid methyl ester; 4-Chloro-7-isobutyl-1H-indole-5-carboxylic acid (1-hydroxy-cycloheptylmethyl)-amide; 4-Chloro-7-(3-methoxy-propyl)-1H-indole-5-carboxylic acid (1-hydroxy-cycloheptylmethyl)-amide; 4-Chloro-7-isobutyl-1H-indole-5-carboxylic acid (4,4-difluoro-l-hydroxy-cyclohexylmethyl)-amide; 4-Chloro-7-(3-methoxy-propyl)-1H-indole-5-carboxylic acid (4,4-difluoro-l-hydroxy-cyclohexylmethyl) -amide; 4-Chloro-1H-indole-5-carboxylic acid [1-(2-hydroxy-ethanesulfonylamino)-cyclohexylmethyl]-amide; 4-Methyl-1H-indole-5-carboxylic acid (1-hydroxy-cyclohexylmethyl)-amide; 4-Chloro-1H-indole-5-carboxylic acid [1-(2-methyl-pyrimidin-5-yl)-cyclohexylmethyl]-amide; 4-Chloro-7-methoxy-1H-indole-5-carboxylic acid (4,4-difluoro-1-hydroxy-cyclohexylmethyl)-amide; 4-Chloro-1H-indole-5-carboxylic acid [4,4-difluoro-1-(2-methyl-pyrimidin-5-yl)-cyclohexylmethyl ]-amide; 4-Chloro-7-methyl-1H-indole-5-carboxylic acid [4,4-difluoro-1-(2-methyl-pyrimidin-5-yl)-cyclohexylmethyl ]-amide; 4-Chloro-7-methyl-1H-indole-5-carboxylic acid [1-(2-methyl-pyrimidin-5-yl)-cyclohexylmethyl ]-amide; 4,7-Dimethyl-1H-indole-5-carboxylic acid (4,4-difluoro-l-hydroxy-cyclohexylmethyl)-amide; 4-Methyl-1H-indole-5-carboxylic acid (4,4-difluoro-l-hydroxy-cyclohexylmethyl)-amide; 4-Ethyl-1H-indole-5-carboxylic acid (4,4-difluoro-l-hydroxy-cyclohexylmethyl)-amide; 7-Acetyl-4-chloro-1H-indole-5-carboxylic acid (4,4-difluoro-1-hydroxy-cyclohexylmethyl)-amide; 4-Chloro-7-(1-hydroxy-ethyl)-1H-indole-5-carboxylic acid (4,4-difluoro- 1 -hydroxy-cyclohexylmethyl) -amide; 4-Chloro-7-(1-hydroxy-l-methyl-ethyl)-1H-indole-5-carboxylic acid (4,4-difluoro- 1-hydroxy-cyclohexylmethyl) -amide; 7-Methyl-4-trifluoromethyl-1H-indole-5-carboxylic acid (1-hydroxy-cyclohexylmethyl)-amide; 7-Methyl-4-trifluoromethyl-1H-indole-5-carboxylic acid (4,4-difluoro-1-hydroxy-cyclohexylmethyl) -amide; 4,7-Dimethyl-1H-indole-5-carboxylic acid (1-hydroxy-cyclohexylmethyl)-amide; 4-Chloro-7-ethyl-1H-indole-5-carboxylic acid (1-hydroxy-cyclohexylmethyl)-amide; 4-Chloro-7-ethyl-1H-indole-5-carboxylic acid (4,4-difluoro-1-hydroxy-cyclohexylmethyl)-amide; 7-Chloro-4-methyl-1H-indole-5-carboxylic acid (1-hydroxy-cyclohexylmethyl)-amide; 7-Chloro-4-methyl- 1H-indole-5-carboxylic acid (4,4-difluoro- 1 -hydro xy-c yclohexylmethyl)-amide; 4-Chloro-7-methoxy-1H-indole-5-carboxylic acid (1-hydroxy-cyclohexylmethyl)-amide; 7-Methoxy-4-methyl- 1H-indole-5-carboxylic acid (4,4-difluoro- 1 -hydroxy-c yclohexylmethyl)-amide; 7-Methoxy-4-methyl- 1H-indole-5-carboxylic acid (1 -hydroxy- cyclohexylmethyl)- amide ; 4-Chloro-7-ethoxy- 1H-indole-5-carboxylic acid (1 -hydroxy- cyclohexylmethyl)- amide ; 4-Chloro-7-hydroxy-1H-indole-5-carboxylic acid (4,4-difluoro-1-hydroxy-cyclohexylmethyl)-amide; 4-Chloro-7-ethoxy- 1H-indole-5-carboxylic acid (4,4-difluoro- 1 -hydroxy-c yclohexylmethyl)-amide; 4-Chloro-7-propyl- 1H-indole-5-carboxylic acid (1 -hydroxy- cyclohexylmethyl)- amide ; 4-Chloro-7-propyl- 1H-indole-5-carboxylic acid (4,4-difluoro- 1 -hydroxy-c yclohexylmethyl)-amide; 7-(2-tert-Butoxy-ethoxy)-4-chloro- 1H-indole-5 -carboxylic acid (1 -hydroxy-c yclohexylmethyl)-amide; 7-(2-tert-Butoxy-ethoxy)-4-chloro- 1H-indole-5 -carboxylic acid (4,4-difluoro- 1 -hydroxy-cyclohexylmethyl) -amide ; 4-Chloro-7-(2-hydroxy-ethoxy)- 1H-indole-5 -carboxylic acid (1 -hydro xy-c yclohexylmethyl)-amide; 4-Chloro-7-(2-hydroxy-ethoxy)- 1H-indole-5 -carboxylic acid (4,4-difluoro- 1 -hydroxy-cyclohexylmethyl) - amide ; 7-Acetyl-4-chloro-1H-indole-5-carboxylic acid (1 -hydroxy- cyclohexylmethyl)- amide ; 4-Chloro-7-(1-hydroxy-1-methyl-ethyl)-1 H-indole-5-carboxylic acid (1-hydroxy-cyclohexylmethyl) -amide; 4,7-Difluoro- 1H-indole-5-carboxylic acid (1 -hydroxy- cyclohexylmethyl)- amide ; 4,7-Difluoro-1H-indole-5-carboxylic acid (4,4-difluoro- l -hydroxy-clohexylmethyl)-amide; 4-Fluoro-7-methoxy-1H-indole-5-carboxylic acid (1-hydroxy-cyclohexylmethyl)-amide; 4-Fluoro-7-methoxy-1H-indole-5-carboxylic acid (4,4-difluoro- 1-hydroxy-cyclohexylmethyl)-amide; 4-Chloro-7-(2-ethoxy-ethyl)-1H-indole-5-carboxylic acid (4,4-difluoro-l-hydroxy-cyclohexylmethyl) -amide; and 4-Chloro-7-(1-methoxy-l-methyl-ethyl)-1H-indole-5-carboxylic acid (4,4-difluoro-l-hydroxy-cyclohexylmethyl) -amide; or a salt of such a compound.
12. A pharmaceutical composition containing, as active principle, a compound of formula (I) according to claim 1 or a pharmaceutically acceptable salt thereof, and at least one therapeutically inert excipient.
13. A method for the treatment of a P2X.sub.7-mediated disease selected from pain; neurodegenerative and neuroinflammatory diseases; bone and joint diseases; obstructive diseases of the airways; cardiovascular diseases; eye diseases; skin diseases; abdominal and gastrointestinal tract diseases; genitourinary diseases; cancer; auto-immune and allergic disorders selected from the group consisting of Hashimoto's thyroiditis, Graves' disease, Addison's disease, diabetes mellitus, idiopathic thrombocytopaenic purpura, eosinophilic fasciitis, hyper-IgE syndrome and antiphospholipid syndrome; and disorders with an inflammatory or immunological component selected from the group consisting of acquired immune deficiency syndrome (AIDS), leprosy, Sezary syndrome and paraneoplastic syndromes comprising administering to a subject a pharmaceutically active amount of the compound of formula (I) according to claim 1 or a pharmaceutically acceptable salt thereof.
14. A method for the treatment of a P2X.sub.7-mediated disease selected from pain; neurodegenerative and neuroinflammatory diseases; bone and joint diseases; obstructive diseases of the airways; cardiovascular diseases; eye diseases; skin diseases; abdominal and gastrointestinal tract diseases; genitourinary diseases; cancer; auto-immune and allergic disorders selected from the group consisting of Hashimoto's thyroiditis, Graves' disease, Addison's disease, diabetes mellitus, idiopathic thrombocytopaenic purpura, eosinophilic fasciitis, hyper-IgE syndrome and antiphospholipid syndrome; and disorders with an inflammatory or immunological component selected from the group consisting of acquired immune deficiency syndrome (AIDS), leprosy, Sezary syndrome and paraneoplastic syndromes component comprising administering to a subject a pharmaceutically active amount of the compound of formula (I.sub.HET) according to claim 10 or a pharmaceutically acceptable salt thereof.
Description
EXPERIMENTAL PART
Abbreviations
(1) Ac acetyl AlBN 2,2-azobis(2-methylpropionitrile) anh. anhydrous aq. aqueous ATP adenosine-5-triphoshate Bn benzyl Boc tert.-butyloxycarbonyl Burgess reagent (methoxycarbonylsulfamoyl)triethylammonium hydroxide, inner salt tBu tert.-butyl CC column chromatography cDNA complementary desoxyribonucleic acid CNS central nervous system DAST diethylaminosulfur trifluoride DCM dichloromethane DIPEA diisopropylethylamine DMEM Dulbecco's modified eagle's medium DMF dimethylformamide DMP Dess Martin periodinane DMSO dimethylsulfoxide DNA desoxyribonucleic acid dppf 1,1-bis(diphenylphosphino)ferrocene EDC.HCl N-(3-dimethylaminopropyl)-N-ethylcarbodiimide hydrochloride eq equivalent Et ethyl FCS fetal calf serum FLIPR fluorescent imaging plate reader h hour(s) HATU 2-(7-aza-1H-benzotriazole-1-yl)-1,1,3,3-tetramethyluronium hexafluorophosphate Hept heptanes HOBt 1-hydroxybenzotriazole hydrate HV high vacuum LC-MS liquid chromatography-mass spectrometry M molar(ity) Me methyl min minute(s) MS mass spectrometry NBS N-bromosuccinimide NCS N-chlorosuccinimide NMR nuclear magnetic resonance ON overnight PBS phosphate buffered saline PEPPSI-IPr [1,3-Bis(2,6-Diisopropylphenyl)imidazol-2-ylidene](3-chloropyridyl)palladium(II) dichloride PG protecting group Ph phenyl PyBOP benzotriazole-1-yl-oxy-tris-pyrrolidino-phosphonium hexafluorophosphate PyCloP chlorotripyrrolidinophosphonium hexafluorophosphate RNA ribonucleic acid RT room temperature sat. saturated TBTU O-(benzotriazol-1-yl)-N,N,N,N-tetramethyluronium tetrafluoroborate TFA trifluoroacetic acid THF tetrahydrofuran TMS trimethylsilyl t.sub.R retention time UV ultra-violet Vis visible Z benzyloxycarbonyl
I. Synthesis of Examples
A. Characterization Methods Used
(2) NMR: Brucker Avance 400, 400 MHz; chemical shifts are given in ppm relative to the solvent used; multiplicities: s=singlet, d=doublet, t=triplet, q=quadruplet, m=multiplet, br=broad, coupling constants are given in Hz.
(3) LC-MS (I): Thermo Finnigan MSQ Surveyor MS with Agilent 1100 Binary Pump and DAD. Eluents (acidic conditions): A: H.sub.2O+0.04% TFA; B: CH.sub.3CN; gradient: 5% B.fwdarw.95% B; runtime: 1.5 min; flow: 4.5 mL/min; detection: UV/Vis+MS, t.sub.R is given in min.
(4) LC-MS (A): column Zorbax SB-AQ, 3.5 m, 4.650 mm
(5) LC-MS (B): column Waters XBridge C18, 2.5 m, 4.630 mm
(6) LC-MS (C): column Waters Atlantis T3, 5 m, 4.630 mm;
(7) Eluents (basic conditions): A: H.sub.2O+13 mmol/L NH.sub.4OH; B: CH.sub.3CN; gradient: 5% B.fwdarw.95% B; runtime: 1.5 min; flow: 4.5 mL/min:
(8) LC-MS (D): column Waters XBridge C18, 5 m, 4.650 mm.
(9) LC-MS (D*): column Zorbax Extend C18, 5 m, 4.650 mm.
(10) LC-MS (II): Dionex Ultimate 3000 with Thermo MSQ MS, HPG-3000 pump and photodiode array detector
(11) Eluents (acidic conditions): A: H.sub.2O+0.05% HCOOH; B: CH.sub.3CN+0.05% HCOOH; gradient: 5% B.fwdarw.95% B; runtime: 2.0 min; flow: 1.8 mL/min; detection: UV/Vis+MS, t.sub.R is given in min.
(12) LC-MS (E): column Ascentis Express C18, 2.7 m, 2.150 mm
B. Purification Methods Used
(13) Preparative LC-MS (A): flow: 75 mL/min. Detection: UV/Vis and/or MS.
(14) Additional informations for the purification are summarized in the tables below using following explanations:
(15) XBridge: column Waters XBridge C18, 10 m, 3075 mm
(16) Atlantis: column Waters Atlantis T3, 10 m, 3075 mm
(17) Acidic: eluant: A=H.sub.2O with 0.5% HCOOH, B=CH.sub.3CN
(18) Basic: eluant: A=H.sub.2O with 0.125% NH.sub.4OH, B=CH.sub.3CN
(19) Lipophilic gradient: 30% B.fwdarw.95% B over 4 min then 95% B over 2 min
(20) Normal gradient: 20% B.fwdarw.95% B over 4 min then 95% B over 2 min
(21) Polar gradient: 10% B.fwdarw.95% B over 4 min then 95% B over 2 min
(22) Very polar gradient: 5% B.fwdarw.50% B over 3 min then 50% B.fwdarw.95% B over 1 min and finally 95% B over 2 min
(23) TABLE-US-00001 XBridge Atlantis acidic basic acidic Lipophilic gradient Method III Normal gradient Method II Method IV Method VII Polar gradient Method VI Method V Method VIII Very polar gradient Method I
(24) Preparative LC-MS (B): flow: 40 mL/min. Detection: UV/Vis and MS.
(25) XBridge: column Waters XBridge C18 OBD, 5 m, 1950 mm
(26) Acidic: eluant: A=H.sub.2O with 0.1% HCOOH, B=CH.sub.3CN with 0.1% HCOOH
(27) Method 1 (lipophilic gradient): 40% B over 0.1 min, 40%.fwdarw.50% B over 0.1 min, 50% 80% B over 2.9 min, 80%.fwdarw.95% B over 0.1 min and finally 95% B over 1 min
(28) Method 2 (long normal gradient): 25% B over 0.1 min, 25%.fwdarw.35% B over 0.1 min, 35% 65% B over 4.1 min, 65%.fwdarw.95% B over 0.1 min and finally 95% B over 1.1 min
(29) Method 3 (normal gradient): 25% B over 0.2 min, 25%.fwdarw.35% B over 0.1 min, 35% 65% B over 2.9 min, 65%.fwdarw.95% B over 0.1 min and finally 95% B over 1 min
(30) Method 4 (long polar gradient): 10% B over 0.2 min, 10%.fwdarw.20% B over 0.1 min, 20% 50% B over 4.1 min, 50%.fwdarw.95% B over 0.1 min and finally 95% B over 1.1 min
(31) Method 5 (polar gradient): 10% B over 0.2 min, 10%.fwdarw.20% B over 0.1 min, 20%.fwdarw.50% B over 2.9 min, 50%.fwdarw.95% B over 0.1 min and finally 95% B over 1 min
(32) Column chromatography (CC) was performed using silica gel 60 Merck (0.063-0.200 mm) or using prepacked cartridges (SNAP KP-SIL, SNAP KP-NH, Isolute Silica II, Isolute NH.sub.2 or Isolute C.sup.18) from Biotage. Additional information for the purification are summarized in the table below:
(33) TABLE-US-00002 SNAP SNAP KP-SIL Isolute Silica II KP-NH Hept/EtOAc Method b Method c EtOAc/MeOH Method e Method f DCM/MeOH Method g Method d Method a
(34) The following examples illustrate the invention but do not at all limit the scope thereof.
Preparation of Precursors and Intermediates
A. Synthesis of carboxylic acids
A.1. Synthesis of 4-chloro-1H-indole-5-carboxylic acid
A.1.a. Methyl 4-amino-2-chlorobenzoate
(35) To a solution of 4-amino-2-chlorobenzoic acid (54.2 mmol) in MeOH (325 mL) was added dropwise acetylchloride (163 mmol) and the mixture was refluxed for 5 h. It was concentrated in vacuo and partitioned between EtOAc and a sat. solution of NaHCO.sub.3. The organic phase was washed with a sat. solution of NaHCO.sub.3, dried over MgSO.sub.4 and concentrated in vacuo to give the title compound as beige solid.
(36) LC-MS (B): t.sub.R=0.57 min; [M+CH.sub.3CN+H]+: 227.29
A.1.b. Mixture of methyl 4-amino-2-chloro-3-iodobenzoate and methyl 4-amino-2-chloro-5-iodobenzoate
(37) To a suspension of methyl 4-amino-2-chlorobenzoate (55.8 mmol) in EtOH (558 mL) was added silver sulfate (55.8 mmol) and iodine (58.6 mmol) under argon. The mixture was stirred for 15 min, filtered and the filtrate was concentrated in vacuo. The residue was partitioned between DCM and a 1M aq. solution of NaOH. The organic phase was washed with a 1M aq. solution of NaOH, dried over MgSO.sub.4 and concentrated in vacuo. The crude was purified by CC (SNAP KP-SIL from Biotage) using Hept/EtOAc/MeOH from 89/11/1 to 81/19/1 to give the mixture of regioisomers as salmon solid. The mixture was enriched from 59 to 66% in methyl 4-amino-2-chloro-3-iodobenzoate by recrystallisation in Hept/EtOAc 75/25, separation of the solid methyl 4-amino-2-chloro-5-iodobenzoate by filtration and evaporation of the mother liquid.
(38) LC-MS (B): t.sub.R=0.72 min; [M+CH.sub.3CN+H]+: 352.79
(39) In addition, pure methyl 4-amino-2-chloro-5-iodobenzoate regioisomer was isolated as pink to orange solid.
(40) LC-MS (B): t.sub.R=0.75 min; [M+CH.sub.3CN+H]+: 352.80
A.1.c. Methyl 4-amino-2-chloro-3-((trimethylsilyl)ethynyl)benzoate
(41) A solution of mixture of methyl 4-amino-2-chloro-3-iodobenzoate and methyl 4-amino-2-chloro-5-iodobenzoate from previous step (13.3 mmol) in Et.sub.3N (110 mL) and toluene (110 mL) was heated to 60 C. under argon and treated with PPh.sub.3 (1.33 mmol), CuI (1.33 mmol), Pd(PPh.sub.3).sub.2Cl.sub.2 (0.66 mmol) and trimethylsilylacetylene (19.9 mmol). The mixture was stirred for 30 min at 60 C. and 1 h at 70 C., quenched with a 10% aq. solution of NH.sub.4Cl and extracted with EtOAc. The organic phase was washed with brine, dried over MgSO4 and concentrated in vacuo. The crude was purified by CC (SNAP KP-SIL from Biotage) using Hept/EtOAc from 1/0 to 8/2 to give the title compound (second eluting product) as light yellow solid.
(42) LC-MS (B): t.sub.R=0.93 min; [M+CH.sub.3CN+H]+: 322.70
(43) In addition, methyl 4-amino-2-chloro-5-((tri methylsilyl)ethynyl)benzoate was isolated as orange solid (first eluting product).
(44) LC-MS (B): t.sub.R=0.97 min; [M+CH.sub.3CN+H]+: 323.22
A.1.d. Methyl 4-amino-2-chloro-3-ethynylbenzoate
(45) To a solution of methyl 4-amino-2-chloro-3-((trimethylsilyl)ethynyl)benzoate (8.81 mmol) in MeOH (8.81 mL) was added K.sub.2CO.sub.3 (9.69 mmol). The mixture was stirred for 15 min and the solvent was evaporated off. The residue was partitioned between DCM and water. The organic phase was dried over MgSO.sub.4 and concentrated in vacuo. The crude was purified by CC (Isolute Silica II from Biotage) using DCM to give the title compound as yellowish solid.
(46) LC-MS (B): t.sub.R=0.66 min; [M+H]+: 210.04
A.1.e. Methyl 4-chloro-1H-indole-5-carboxylate
(47) To a mixture of methyl 4-amino-2-chloro-3-ethynylbenzoate (5.57 mmol), chloro(1,5-cyclooctadiene)rhodium(1) dimer (0.28 mmol) and tris(4-fluorophenyl)phosphine (3.34 mmol) was added under argon degassed DMF (28 mL). The mixture was heated to 85 C. for 50 min, cooled to RT and partitioned between Et.sub.2O and water. The organic phase was washed with brine, dried over MgSO.sub.4 and concentrated in vacuo. The crude was purified by CC (SNAP KP-SIL from Biotage) using Hept/DCM 1/0 to 0/1 to give the title compound as brownish solid.
(48) LC-MS (B): t.sub.R=0.69 min; [M+H]+: 210.14
A.1.f. 4-Chloro-1H-indole-5-carboxylic acid (Saponification: general procedure I)
(49) To a suspension of methyl 4-chloro-1H-indole-5-carboxylate (4 mmol) in MeOH (24 mL) was added a 2M aq. solution of LiOH (4 mL). The mixture was stirred for 5 h at 65 C. then ON at 45 C. It was evaporated off and partitioned between EtOAc and H.sub.2O. The aq. phase was acidified with a 25% solution of HCl and extracted 3 times with DCM. The combined organic phases were dried over MgSO.sub.4 and concentrated in vacuo to give the title compound as off-white solid.
(50) LC-MS (A): t.sub.R=0.65 min; [M+H]+: 196.06
A.2. Synthesis of 4-chloro-1-methyl-1H-indole-5-carboxylic acid
(51) To a solution of methyl 4-chloro-1H-indole-5-carboxylate (0.48 mmol) in anh. DMF (1.2 mL) was added at 0 C. NaH as a 60% suspension in mineral oil (1.2 mmol). The mixture was stirred for 5 min and MeI (0.72 mmol) was added dropwise at 0 C. The mixture was stirred for 1 h at RT, quenched with water and partitioned between Et.sub.2O and water. The aq. phase was acidified with a 1M aq. solution of HCl and extracted 3 times with DCM. The combined organic phases were dried over MgSO.sub.4 and concentrated in vacuo to give the title compound as brown solid.
(52) LC-MS (B): t.sub.R=0.61 min; [M+H]+: 210.05
A.3. Synthesis of 4-chloro-3-formyl-1H-indole-5-carboxylic acid
A.3.a. Methyl 4-chloro-3-formyl-1H-indole-5-carboxylate
(53) Phosphoryl chloride (1.43 mmol) was added at 0 C. to anh. DMF (4 mL). To this mixture was added dropwise at 0 C. a solution of methyl 4-chloro-1H-indole-5-carboxylate (0.95 mmol) in anh. DMF (2 mL). The mixture was stirred for 5 min at 0 C., heated to 40 C. and stirred for 4 h 30. It was poured onto ice, treated with a 1M aq. solution of NaOH to adjust pH to 10-11 and heated to 100 C. for 5 min. The mixture was acidified with a 1M solution of HCl and extracted 3 times with DCM. The combined organic phases were dried and concentrated in vacuo. The crude was purified by CC (SNAP KP-SIL from Biotage) using Hept/EtOAc from 1/0 to 35/65 to give the title compound as orange solid.
(54) LC-MS (A): t.sub.R=0.71 min; [M+H]+: 238.05
A.3.b. 4-Chloro-3-formyl-1H-indole-5-carboxylic acid
(55) This compound was prepared using a method analogous to that of 4-chloro-1H-indole-5-carboxylic acid, methyl 4-chloro-3-formyl-1H-indole-5-carboxylate replacing methyl 4-chloro-1H-indole-5-carboxylate.
(56) LC-MS (B): t.sub.R=0.41 min; [M+H]+: 224.07
A.4. Synthesis of 4-chloro-7-methyl-M-indole-5-carboxylic acid
A.4.a. Methyl 4-chloro-7-iodo-3-(methylthio)-1H-indole-5-carboxylate (Gassman indole)
(57) To a suspension of methyl 4-amino-2-chloro-5-iodobenzoate (6.21 mmol) in anh. DCM (29 mL) was added at 60 C. NCS (7.45 mmol) and the mixture was stirred for 10 min. A solution of (methylthio)acetaldehyde dimethyl acetal (7.45 mmol) in anh. DCM (5.8 mL) was added at 60 C. and the mixture was stirred allowing temperature to reach 30 C. A solution of Et.sub.3N (7.45 mmol) in anh. DCM (5 mL) was added at 30 C. and the mixture was stirred allowing temperature to reach RT. It was concentrated in vacuo, PhCl (17.4 mL) and Et.sub.3N (20.5 mmol) were added and the mixture was heated to 125 C. and stirred for 2 h. The volatiles were evaporated off and the residue was taken up in Et.sub.2O (28.7 mL) and treated with a 4M solution of HCl in dioxane (11 mL) for 30 min. It was partitioned between EtOAc and a sat. solution of NaHCO.sub.3, the organic phase was dried over MgSO.sub.4 and concentrated in vacuo. The crude was purified by CC (SNAP KP-SIL from Biotage) using Hept/EtOAc from 9/1 to 65/35 to give the title compound as yellow solid.
(58) LC-MS (A): t.sub.R=0.93 min; [M+H]+: 381.71
A.4.b. Methyl 4-chloro-7-methyl-3-(methylthio)-1H-indole-5-carboxylate
(59) To a solution of methyl 4-chloro-7-iodo-3-(methylthio)-1H-indole-5-carboxylate (0.42 mmol) in dioxane (1 mL) was added under argon a 2M solution of methylzinc chloride in THF (1.04 mmol) and a solution of Pd(dppf)Cl.sub.2.DCM (0.03 mmol) in dioxane (0.5 mL). The mixture was stirred ON at 65 C. in a sealed vial, diluted with EtOAc and washed with a sat. solution of Rochelle salt and brine. The organic phase was dried over MgSO.sub.4 and concentrated in vacuo. The crude was purified by CC (SNAP KP-SIL from Biotage) using DCM to give the title compound as yellow solid.
(60) LC-MS (A): t.sub.R=0.86 min; [M+H]+: 270.11
A.4.c. Methyl 4-chloro-7-methyl-1H-indole-5-carboxylate
(61) To a solution of methyl 4-chloro-7-methyl-3-(methylthio)-1H-indole-5-carboxylate (0.24 mmol) in EtOH (4.11 mL) was added Actimet M Raney Nickel (14 mg). The mixture was stirred for 2 h at RT and filtered over a pad of celite. The filtrate was concentrated in vacuo to give the title compound as white solid.
(62) LC-MS (A): t.sub.R=0.82 min; [M+H]+: 224.16
A.4.d. 4-Chloro-7-methyl-1H-indole-5-carboxylic acid (Saponification II)
(63) To a solution of methyl 4-chloro-7-methyl-1H-indole-5-carboxylate (0.11 mmol) in MeOH (0.4 mL), THF (0.4 mL) and H.sub.2O (0.4 mL) was added LiOH.H.sub.2O (0.44 mmol). The mixture was stirred for 2 h at 60 C. It was evaporated off and partitioned between EtOAc and H.sub.2O. The aq. phase was acidified with a 25% solution of HCl and extracted 3 times with EtOAc. The combined organic phases were dried over MgSO.sub.4 and concentrated in vacuo to give the title compound as pink solid.
(64) LC-MS (A): t.sub.R=0.69 min; [M+H]+: 209.98
A.5. Synthesis of 4-chloro-2-methyl-M-indole-5-carboxylic acid
A.5.a. Methyl 2-chloro-4-hydrazinyl-5-iodobenzoate
(65) To a solution of methyl 4-amino-2-chloro-5-iodobenzoate (6.42 mmol) in 37% HCl (4.40 mL) was added dropwise at 0 C. a solution of sodium nitrite (7.49 mmol) in water (2.15 mL). The mixture was stirred for 15 min at 0 C. and a solution of tin(II) chloride dihydrate (16 mmol) in water (1 mL) and 37% HCl (4.28 mL) was added dropwise at 0 C. The mixture was stirred for 15 min and quenched with consecutive addition of water, a 10% solution of Na.sub.2CO.sub.3 and a 20% solution of NaOH. It was extracted 3 times with DCM, the combined organic phases were dried over MgSO.sub.4 and concentrated in vacuo. The crude was purified by CC (SNAP KP-SIL from Biotage) using Hept/EtOAc from 95/5 to 62/38 to give the title compound as beige solid.
(66) LC-MS (A): t.sub.R=0.73 min; [M+CH.sub.3CN+H]+: 367.75
A.5.b. Methyl 4-chloro-7-iodo-2-methyl-3-(methylthio)-1H-indole-5-carboxylate
(67) To a solution of methyl 2-chloro-4-hydrazinyl-5-iodobenzoate (0.76 mmol) in a 1.25 M solution of HCl in EtOH (1.8 mL) was added 1-methylthio-2-propanone (1.38 mmol). The mixture was stirred for 2 h at 65 C. and filtered. The filtrate was concentrated in vacuo and the crude was purified by preparative LC-MS using method I.
(68) LC-MS (A): t.sub.R=0.96 min; [M+H]+: 395.73
A.5.c. Methyl 4-chloro-2-methyl-1H-indole-5-carboxylate
(69) This compound was prepared using a method analogous to that of methyl 4-chloro-7-methyl-1H-indole-5-carboxylate, methyl 4-chloro-7-iodo-2-methyl-3-(methylthio)-1H-indole-5-carboxylate replacing 4-chloro-7-methyl-3-(methylthio)-1H-indole-5-carboxylate except that the reaction mixture was stirred for 48 h at RT and further additions of Actimet M Raney Nickel was required until completion of the reaction.
(70) LC-MS (A): t.sub.R=0.83 min; [M+H]+: 224.10
A.5.d. 4-Chloro-2-methyl-1H-indole-5-carboxylic acid
(71) This compound was prepared using a method analogous to that of 4-chloro-1H-indole-5-carboxylic acid, methyl 4-chloro-2-methyl-1H-indole-5-carboxylate replacing methyl 4-chloro-1H-indole-5-carboxylate.
(72) LC-MS (A): t.sub.R=0.69 min; [M+H]+: 210.04
A.6. Synthesis of 4-chloro-7-iodo-3-(methylthio)-1H-indole-5-carboxylic acid
(73) To a solution of methyl 4-chloro-7-iodo-3-(methylthio)-1H-indole-5-carboxylate (0.52 mmol) in MeOH (0.45 mL) and H.sub.2O (0.45 mL) was added KOH (1.57 mmol). The mixture was stirred ON at 70 C. It was evaporated off and partitioned between Et.sub.2O and water. The aq. phase was acidified with a 1M solution of HCl and extracted 3 times with EtOAc. The combined organic phases were dried over MgSO.sub.4 and concentrated in vacuo to give the title compound as brownish solid.
(74) LC-MS (A): t.sub.R=0.78 min; [M+H]+: 368.91
A.7. Synthesis of 4-chloro-3-fluoro-1H-indole-5-carboxylic acid
A.7.a. Methyl 4-chloro-3-fluoro-1H-indole-5-carboxylate
(75) To a solution of methyl 4-chloro-1H-indole-5-carboxylate (0.24 mmol) in MeOH (2.09 mL) was added 1-fluoro-2,4,6-trimethylpyridinium triflate (0.31 mmol). The mixture was heated to 65 C. and stirred for 24 h. It was concentrated in vacuo and the residue was purified by CC (SNAP KP-SIL from Biotage) using Hept/EtOAc from 1/0 to 1/1 to give the title compound as beige solid.
(76) LC-MS (A): t.sub.R=0.80 min
(77) .sup.1H NMR ((CD.sub.3).sub.2SO) : 11.54 (s, 1 H), 7.60 (d, J=8.6 Hz, 1 H), 7.57 (t, J=2.5 Hz, 1 H), 7.41 (dd, J.sub.1=8.6 Hz, J.sub.2=2.4 Hz, 1 H), 3.86 (s, 3 H)
A.7.b. 4-Chloro-3-fluoro-1H-indole-5-carboxylic acid
(78) This compound was prepared using a method analogous to that of 4-chloro-7-methyl-1H-indole-5-carboxylic acid, methyl 4-chloro-3-fluoro-1H-indole-5-carboxylate replacing methyl 4-chloro-7-methyl-1H-indole-5-carboxylate.
(79) LC-MS (A): t.sub.R=0.67 min; [M+CH.sub.3CN+H]+: 255.04
A.8. Synthesis of 4-methoxy-1H-indole-5-carboxylic acid
A.8.a. Methyl 7-iodo-4-methoxy-3-(methylthio)-1H-indole-5-carboxylate
(80) This compound was prepared using a method analogous to that of methyl 4-chloro-7-iodo-3-(methylthio)-1H-indole-5-carboxylate, commercially available methyl 4-amino-5-iodo-2-methoxybenzoate replacing methyl 4-amino-2-chloro-5-iodobenzoate.
(81) LC-MS (A): t.sub.R=0.90 min; [M+H]+: 377.76
A.8.b. Methyl 4-methoxy-1H-indole-5-carboxylate
(82) This compound was prepared using a method analogous to that of methyl 4-chloro-7-methyl-1H-indole-5-carboxylate, methyl 7-iodo-4-methoxy-3-(methylthio)-1H-indole-5-carboxylate replacing 4-chloro-7-methyl-3-(methylthio)-1H-indole-5-carboxylate except that the reaction mixture was stirred for 2 h at RT and one further addition of Actimet M Raney Nickel was required until completion of the reaction.
(83) LC-MS (A): t.sub.R=0.69 min; [M+H]+: 206.28
A.8.c. 4-Methoxy-1H-indole-5-carboxylic acid
(84) This compound was prepared using a method analogous to that of 4-chloro-7-methyl-1H-indole-5-carboxylic acid, methyl 4-methoxy-1H-indole-5-carboxylate replacing methyl 4-chloro-7-methyl-1H-indole-5-carboxylate.
(85) LC-MS (A): t.sub.R=0.60 min; [M+H]+: 192.28
A.9. Synthesis of 3,4-dichloro-1H-indole-5-carboxylic acid
A.9.a. Methyl 3,4-dichloro-1H-indole-5-carboxylate
(86) To a solution of methyl 4-chloro-1H-indole-5-carboxylate (0.72 mmol) in DMF (1 mL) was added portionwise at 0 C. NCS (0.79 mmol). The mixture was stirred ON at RT, quenched with a 10% solution of Na.sub.2S.sub.2O.sub.3 and extracted with EtOAc. The organic phase was washed with a 10% solution of Na.sub.2S.sub.2O.sub.3 and brine, dried over MgSO.sub.4 and concentrated in vacuo to give the title compound as light orange solid.
(87) LC-MS (A): t.sub.R=0.83 min
(88) .sup.1H NMR ((CD.sub.3).sub.2SO) : 12.02 (s, 1 H), 7.74 (d, J=2.7 Hz, 1 H), 7.57 (d, J=8.53 Hz, 1 H), 7.47 (d, J=8.53 Hz, 1 H), 3.86 (s, 3 H)
A.9.b. 3,4-Dichloro-1H-indole-5-carboxylic acid
(89) This compound was prepared using a method analogous to that of 4-chloro-7-methyl-1H-indole-5-carboxylic acid, Methyl 3,4-dichloro-1H-indole-5-carboxylate replacing methyl 4-chloro-7-methyl-1H-indole-5-carboxylate except that the reaction mixture was stirred ON at 60 C.
(90) LC-MS (D*): t.sub.R=0.18 min; [MH]: 228.04
A.10. Synthesis of 4-chloro-7-nitro-1H-indole-5-carboxylic acid
A.10.a.4-Amino-2-chloro-5-nitrobenzoic acid
(91) This compound was synthesized according to Helv. Chim. Acta, 1937, 20, 1407-1412.
A.10.b. Methyl 4-amino-2-chloro-5-nitrobenzoate
(92) This compound was prepared using a method analogous to that of methyl 4-amino-2-chlorobenzoate, 4-amino-2-chloro-5-nitrobenzoic acid replacing 4-amino-2-chlorobenzoic acid except that the crude was additionally purified by CC (SNAP KP-SIL from Biotage) using Hept/EtOAc from 3/1 to 0/1.
(93) LC-MS (A): t.sub.R=0.79 min
(94) .sup.1H NMR ((CD.sub.3).sub.2SO) : 8.57 (s, 1 H), 7.96 (s, 2 H), 7.14 (s, 1 H), 3.79 (s, 3 H)
A.10.c. Methyl 4-amino-2-chloro-3-iodo-5-nitrobenzoate
(95) To a solution of methyl 4-amino-2-chloro-5-nitrobenzoate (13.5 mmol) in DCM (33.7 mL) was added bis(pyridine)iodinium tetrafluoroborate (27 mmol) and trifluoromethansulfonic acid (53.9 mmol). The mixture was stirred for 1 h at RT and partitioned between water and DCM. The organic phase was washed with a 10% solution of Na.sub.2S.sub.2O.sub.3, dried over MgSO.sub.4 and concentrated in vacuo. The crude was purified by CC (SNAP KP-SIL from Biotage) using DCM/MeOH from 1/0 to 95/5 to give the title compound as brown solid.
(96) LC-MS (A): t.sub.R=0.88 min
(97) .sup.1H NMR ((CD.sub.3).sub.2SO) : 8.62 (s, 1 H), 7.77 (s broad, 2 H), 3.84 (s, 3 H)
A.10.d. Methyl 4-amino-2-chloro-5-nitro-3-(trimethylsilyl)ethynyl)benzoate
(98) This compound was prepared using a method analogous to that of methyl 4-amino-2-chloro-3-((trimethylsilyl)ethynyl)benzoate, methyl 4-amino-2-chloro-3-iodo-5-nitrobenzoate replacing the mixture of methyl 4-amino-2-chloro-3-iodobenzoate and methyl 4-amino-2-chloro-5-iodobenzoate.
(99) LC-MS (A): t.sub.R=1.03 min
(100) .sup.1H NMR ((CD.sub.3).sub.2SO) : 8.59 (s, 1 H), 7.55 (s very broad, 2 H), 3.84 (s, 3 H), 0.31 (s, 9 H)
A.10.e. Methyl 4-amino-2-chloro-3-ethynyl-5-nitrobenzoate
(101) This compound was prepared using a method analogous to that of methyl 4-amino-2-chloro-3-ethynylbenzoate, methyl 4-amino-2-chloro-5-nitro-3-((trimethylsilyl)ethynyl) benzoate replacing methyl 4-amino-2-chloro-3-((trimethylsilyl)ethynyl)benzoate.
(102) LC-MS (A): t.sub.R=0.85 min
(103) .sup.1H NMR ((CD.sub.3).sub.2SO) : 8.57 (s, 1 H), 7.73 (s very broad, 2 H), 5.17 (s, 1 H), 3.81 (s, 3 H)
A.10.f. Methyl 4-chloro-7-nitro-1H-indole-5-carboxylate
(104) This compound was prepared using a method analogous to that of methyl 4-chloro-1H-indole-5-carboxylate, methyl 4-amino-2-chloro-3-ethynyl-5-nitrobenzoate replacing methyl 4-amino-2-chloro-3-ethynylbenzoate except that the reaction was additionally stirred ON at 45 C. until completion.
(105) LC-MS (A): t.sub.R=0.86 min
(106) .sup.1H NMR ((CD.sub.3).sub.2SO) : 12.52 (s, 1 H), 8.56 (s, 1 H), 7.74 (m, 1 H), 6.91 (dd, J.sub.1=3.2 Hz, J.sub.2=1.9 Hz, 1 H), 3.93 (s, 3 H)
A.10.g. 4-Chloro-7-nitro-1H-indole-5-carboxylic acid
(107) This compound was prepared using a method analogous to that of 4-chloro-7-methyl-1H-indole-5-carboxylic acid, methyl 4-chloro-7-nitro-1H-indole-5-carboxylate replacing methyl 4-chloro-7-methyl-1H-indole-5-carboxylate except that the reaction was stirred for 2 h at RT.
(108) LC-MS (A): t.sub.R=0.71 min
(109) .sup.1H NMR ((CD.sub.3).sub.2SO) : 13.56 (s br, 1 H), 12.47 (s, 1 H), 8.58 (s, 1 H), 7.72 (dd, J.sub.1=J.sub.2=2.6 Hz, 1 H), 6.91 (m, 1 H)
A.11. Synthesis of 4-chloro-3-methyl-1H-indole-5-carboxylic acid
A.11.a. Methyl 4-chloro-3-methyl-1H-indole-5-carboxylate
(110) To a solution of methyl 4-chloro-3-formyl-1H-indole-5-carboxylate (0.21 mmol) in DMF (0.5 mL) was added p-toluenesulfonic acid monohydrate (0.03 mmol), p-toluenesulfonyl hydrazide (0.27 mmol) and sulfolane (0.25 mmol). The mixture was heated for 1 h at 100 C. It was cooled to RT, sodium cyanoborohydride (0.84 mmol) was added and it was heated for 1 h at 100 C. The mixture was quenched with water and extracted 3 times with EtOAc. The combined organic phases were dried over MgSO.sub.4 and concentrated in vacuo. The crude was purified by CC (SNAP KP-SIL from Biotage) using Hept/EtOAc from 1/0 to 6/4 to give the title compound as white solid.
(111) LC-MS (A): t.sub.R=0.83 min; [M+H]+: 224.03
A.11.b. 4-Chloro-3-methyl-1H-indole-5-carboxylic acid
(112) This compound was prepared using a method analogous to that of 4-chloro-7-methyl-1H-indole-5-carboxylic acid, methyl 4-chloro-3-methyl-1H-indole-5-carboxylate replacing methyl 4-chloro-7-methyl-1H-indole-5-carboxylate.
(113) LC-MS (A): t.sub.R=0.69 min; [M+H]+: 210.18
A.12. Synthesis of 4,6-dichloro-1H-indole-5-carboxylic acid
A.12.a.2,6-Dichloro-4-nitrobenzoic acid
(114) A solution of 1,3-dichloro-2-methyl-5-nitrobenzene (4.85 mmol) in pyridine (5 mL) and water (10 mL) was heated to 90 C. and KMnO.sub.4 (29.1 mmol) was added portionwise. The mixture was refluxed for 2 h and stirred ON at RT. It was heated to 90 C., additional amount of KMnO.sub.4 (12.7 mmol) was added and it was refluxed for 7 h. The mixture was filtered, the filtrate was basified with a 1M solution of NaOH until pH 12-13 and washed with EtOAc. The aq. phase was acidified with a 1M solution of HCl until pH 1-2 and extracted 3 times with EtOAc. The combined organic phases were dried over MgSO.sub.4 and concentrated in vacuo to give the crude acid as orange solid.
(115) LC-MS (A): t.sub.R=0.45 min
(116) LC-MS (D*): t.sub.R=0.17 min; [MH]: 234.01
A.12.b. Methyl 2,6-dichloro-4-nitrobenzoate
(117) To a solution of 2,6-dichloro-4-nitrobenzoic acid (1.63 mmol) in DMF (5 mL) was added cesium carbonate (2.44 mmol). The suspension was stirred for 30 min at RT and MeI (1.63 mmol) was added. The mixture was stirred for 2 h, quenched with water and extracted 3 times with EtOAc. The combined organic phases were dried and concentrated in vacuo to give the title compound as yellow solid.
(118) LC-MS (A): t.sub.R=0.88 min
(119) .sup.1H NMR ((CD.sub.3).sub.2SO) : 8.48 (s, 2 H), 3.99 (s, 3 H)
A.12.c. Methyl 4-amino-2,6-dichlorobenzoate
(120) To a solution of methyl 2,6-dichloro-4-nitrobenzoate (1.44 mmol) in DMF (2 mL) was added tin(II) chloride dihydrate (5.04 mmol). The mixture was stirred at 100 C. for 40 min under microwave condition and quenched with water. It was basified with a 1M solution of NaOH until pH 11-12 and extracted 3 times with EtOAc. The combined organic phases were washed with brine, dried over MgSO.sub.4 and concentrated in vacuo. The crude was purified by CC (SNAP KP-NH from Biotage) using Hept/EtOAc from 1/0 to 1/1 to give the title compound as yellow solid.
(121) LC-MS (A): t.sub.R=0.78 min; [M+H]+: 220.07
A.12.d. Methyl 4-amino-2,6-dichloro-3-iodobenzoate
(122) This compound was prepared using a method analogous to that of the mixture of methyl 4-amino-2-chloro-3-iodobenzoate and methyl 4-amino-2-chloro-5-iodobenzoate, methyl 4-amino-2,6-dichlorobenzoate replacing methyl 4-amino-2-chlorobenzoate except that no purification was done.
(123) LC-MS (A): t.sub.R=0.86 min; [M+CH.sub.3CN+H]+: 386.57
A.12.e. Methyl 4-amino-2,6-dichloro-3-(trimethylsilyl)ethynyl)benzoate
(124) This compound was prepared using a method analogous to that of methyl 4-amino-2-chloro-3-((trimethylsilyl)ethynyl)benzoate, methyl 4-amino-2,6-dichloro-3-iodobenzoate replacing the mixture of methyl 4-amino-2-chloro-3-iodobenzoate and methyl 4-amino-2-chloro-5-iodobenzoate.
(125) LC-MS (A): t.sub.R=1.00 min; [M+H]+: 316.07
A.12.f. Methyl 4-amino-2,6-dichloro-3-ethynylbenzoate
(126) This compound was prepared using a method analogous to that of methyl 4-amino-2-chloro-3-ethynylbenzoate, methyl 4-amino-2,6-dichloro-3-((trimethylsilyl)ethynyl)benzoate replacing methyl 4-amino-2-chloro-3-((trimethylsilyl)ethynyl)benzoate.
(127) LC-MS (A): t.sub.R=0.83 min; [M+H]+: 243.91
A.12.g. Methyl 4,6-dichloro-1H-indole-5-carboxylate
(128) This compound was prepared using a method analogous to that of methyl 4-chloro-1H-indole-5-carboxylate, methyl 4-amino-2,6-dichloro-3-ethynylbenzoate replacing methyl 4-amino-2-chloro-3-ethynylbenzoate.
(129) LC-MS (A): t.sub.R=0.84 min
(130) .sup.1H NMR ((CD.sub.3).sub.2SO) : 11.79 (s, 1 H), 7.62 (dd, J.sub.1=2.9 Hz, J.sub.2=2.5 Hz, 1 H), 7.59 (d, J=0.9 Hz, 1 H), 6.58 (m, 1 H), 3.91 (s, 3 H)
A.12.h. 4,6-Dichloro-1H-indole-5-carboxylic acid
(131) This compound was prepared using a method analogous to that of 4-chloro-7-methyl-1H-indole-5-carboxylic acid, methyl 4,6-dichloro-1H-indole-5-carboxylate replacing methyl 4-chloro-7-methyl-1H-indole-5-carboxylate.
(132) LC-MS (A): t.sub.R=0.68 min
(133) LC-MS (D*): t.sub.R=0.15 min; [MH]: 228.06
A.13. Synthesis of 4-chloro-6-methyl-1H-indole-5-carboxylic acid
A.13.a.2-Chloro-6-methyl-4-nitrobenzonitrile
(134) To a solution of copper(I) cyanide (46.4 mmol) in CH.sub.3CN (60 mL) was added tert-butylnitrite (36.3 mmol). The mixture was cooled to 0 C. and a solution of 2-chloro-6-methyl-4-nitroaniline (20.2 mmol) was added dropwise for 10 min. The mixture was heated for 2 h at 70 C., quenched with a 10% solution of Na.sub.2CO.sub.3 and the pH was adjusted to 11 with a 1M solution of NaOH. It was extracted 3 times with EtOAc and the combined organic phases were washed with brine, dried over MgSO.sub.4 and concentrated in vacuo. The crude was purified by CC (SNAP KP-Sil from Biotage) using Hept/EtOAc from 1/0 to 94/6 to give the title compound as yellow solid.
(135) LC-MS (A): t.sub.R=0.85 min
(136) .sup.1H NMR ((CD.sub.3).sub.2SO) : 8.41 (s, 1 H), 8.36 (s, 1 H), 2.66 (s, 3 H)
A.13.b. 2-Chloro-6-methyl-4-nitrobenzoic acid
(137) To a suspension of 2-chloro-6-methyl-4-nitrobenzonitrile (5.09 mmol) in 2-propanol (11 mL) and water (11 mL) was added KOH (25.4 mmol). The mixture was heated for 1 h at 60 C., diluted with water and extracted 3 times with EtOAc. The combined organic phases were washed with brine, dried over MgSO.sub.4 and concentrated in vacuo to give the primary amide intermediate as brown oil (LC-MS (A): t.sub.R=0.58 min).
(138) The crude primary amide was suspended in water (2.54 mL) and H.sub.2SO.sub.4 (7.63 mL) and heated to 80 C. Sodium nitrite (9.16 mmol) was added portionwise and the mixture was stirred for 1 h at 80 C. It was quenched with water, basified with a 32% solution of NaOH until pH 13-14 and washed 3 times with EtOAc. The aqueous phase was acidified with a 24% solution of HCl until pH 1-2 and extracted 3 times with EtOAc. The combined organic phases were dried over MgSO.sub.4 and concentrated in vacuo to give the title compound as brown oil.
(139) LC-MS (A): t.sub.R=0.62 min
(140) .sup.1H NMR ((CD.sub.3).sub.2SO) : 12.07 (s br, 1 H), 8.22 (dd, J.sub.1=2.2 Hz, J.sub.2=0.4 Hz, 1 H), 8.20 (dd, j.sub.1=2.1 Hz, J.sub.2=0.6 Hz, 1 H), 2.43 (s, 3 H)
A.13.c. Methyl 2-chloro-6-methyl-4-nitrobenzoate
(141) This compound was prepared using a method analogous to that of methyl 2,6-dichloro-4-nitrobenzoate, 2-chloro-6-methyl-4-nitrobenzoic acid replacing 2,6-dichloro-4-nitrobenzoic acid.
(142) LC-MS (A): t.sub.R=0.87 min
(143) .sup.1H NMR ((CD.sub.3).sub.2SO) : 8.26 (dd, J.sub.1=2.0 Hz, J.sub.2=0.4 Hz, 1 H), 8.23 (dd, J.sub.1=2.0 Hz, J.sub.2=0.6 Hz, 1 H), 3.96 (s, 3 H), 2.41 (s, 3 H)
A.13.d. Methyl 4-amino-2-chloro-6-methylbenzoate
(144) This compound was prepared using a method analogous to that of methyl 4-amino-2,6-dichlorobenzoate, methyl 2-chloro-6-methyl-4-nitrobenzoate replacing methyl 2,6-dichloro-4-nitrobenzoate except that the mixture was heated for 15 min at 100 C. under microwave conditions.
(145) LC-MS (A): t.sub.R=0.72 min; [M+CH.sub.3CN+H]+: 241.05
A.13.e. Methyl 4-amino-2-chloro-3-iodo-6-methylbenzoate
(146) This compound was prepared using a method analogous to that of the mixture of methyl 4-amino-2-chloro-3-iodobenzoate and methyl 4-amino-2-chloro-5-iodobenzoate, methyl 4-amino-2-chloro-6-methylbenzoate replacing methyl 4-amino-2-chlorobenzoate.
(147) LC-MS (A): t.sub.R=0.84 min; [M+CH.sub.3CN+H]+: 366.86
(148) The other regioisomer, methyl 4-amino-2-chloro-5-iodo-6-methylbenzoate, was additionally isolated.
(149) LC-MS (A): t.sub.R=0.85 min; [M+CH.sub.3CN+H]+: 366.87
A.13.f. Methyl 4-amino-2-chloro-6-methyl-3-(trimethylsilyl)ethynyl)benzoate
(150) This compound was prepared using a method analogous to that of methyl 4-amino-2-chloro-3-((trimethylsilyl)ethynyl)benzoate, methyl 4-amino-2-chloro-3-iodo-6-methyl benzoate replacing the mixture of methyl 4-amino-2-chloro-3-iodobenzoate and methyl 4-amino-2-chloro-5-iodobenzoate.
(151) LC-MS (A): t.sub.R=0.98 min; [M+H]+: 296.12
A.13.g. Methyl 4-amino-2-chloro-3-ethynyl-6-methylbenzoate
(152) This compound was prepared using a method analogous to that of methyl 4-amino-2-chloro-3-ethynylbenzoate, methyl 4-amino-2-chloro-6-methyl-3-((trimethylsilyl)ethynyl) benzoate replacing methyl 4-amino-2-chloro-3-((trimethylsilyl)ethynyl)benzoate.
(153) LC-MS (A): t.sub.R=0.80 min; [M+H]+: 224.09
A.13.h. Methyl 4-chloro-6-methyl-1H-indole-5-carboxylate
(154) This compound was prepared using a method analogous to that of methyl 4-chloro-1H-indole-5-carboxylate, methyl 4-amino-2-chloro-3-ethynyl-6-methylbenzoate replacing methyl 4-amino-2-chloro-3-ethynylbenzoate.
(155) LC-MS (A): t.sub.R=0.82 min; [M+H]+: 224.09
A.13.i. 4-Chloro-6-methyl-1H-indole-5-carboxylic acid
(156) This compound was prepared using a method analogous to that of 4-chloro-7-methyl-1H-indole-5-carboxylic acid, methyl 4,6-dichloro-1H-indole-5-carboxylate replacing methyl 4-chloro-7-methyl-1H-indole-5-carboxylate.
(157) LC-MS (A): t.sub.R=0.66 min
(158) LC-MS (D*): t.sub.R=0.16 min; [MH]: 208.13
A.14. Synthesis of 3-bromo-4-chloro-7-methyl-1H-indole-5-carboxylic acid
A.14.a. Methyl 3-bromo-4-chloro-7-methyl-1H-indole-5-carboxylate
(159) To a solution of methyl 4-chloro-7-methyl-1H-indole-5-carboxylate (0.47 mmol) in chlorobenzene (0.47 mL) was added at 55 C. NBS (0.52 mmol) and AIBN (0.05 mmol). The mixture was stirred for 30 min at 55 C., diluted with DCM and filtered. The filtrate was washed with a 1M solution of HCl, dried over MgSO.sub.4 and concentrated in vacuo. The crude was purified by preparative LC-MS using method II to give the title compound as orange solid.
(160) LC-MS (A): t.sub.R=0.90 min
(161) .sup.1H NMR ((CD.sub.3).sub.2SO) : 12.45 (s br, 1 H), 7.44 (s, 1 H), 6.73 (s, 1 H), 3.85 (s, 3 H), 2.47 (s, 3 H)
A.14.b. 3-Bromo-4-chloro-7-methyl-1H-indole-5-carboxylic acid
(162) This compound was prepared using a method analogous to that of 4-chloro-7-methyl-1H-indole-5-carboxylic acid, methyl 3-bromo-4-chloro-7-methyl-1H-indole-5-carboxylate replacing methyl 4-chloro-7-methyl-1H-indole-5-carboxylate.
(163) LC-MS (A): t.sub.R=0.77 min
(164) LC-MS (D*): t.sub.R=0.43 min; [MH]: 287.94
A.15. Synthesis of 4-chloro-7-isobutyl-1H-indole-5-carboxylic acid
A.15.a. Methyl 4-amino-2-chloro-5-isobutylbenzoate
(165) To a solution of methyl 4-amino-2-chloro-5-iodobenzoate (3.36 mmol) in toluene/water 20/1 (40 mL) was added under argon K.sub.3PO.sub.4 (11.8 mmol), PdCl.sub.2(PPh.sub.3).sub.2 (0.34 mmol) and (2-methylpropyl)boronic acid (6.72 mmol). The mixture was heated ON at 110 C. in a sealed vial, quenched with water and extracted with EtOAc. The organic phase was washed with brine, dried over MgSO.sub.4 and concentrated in vacuo. The crude was purified by CC (SNAP KP-Sil from Biotage) using Hept/EtOAc from 1/0 to 0/1 to give the title compound as yellow oil.
(166) LC-MS (A): t.sub.R=0.90 min; [M+CH.sub.3CN+H]+: 283.06
A.15.b. Methyl 4-amino-2-chloro-3-iodo-5-isobutylbenzoate
(167) This compound was prepared using a method analogous to that of the mixture of methyl 4-amino-2-chloro-3-iodobenzoate and methyl 4-amino-2-chloro-5-iodobenzoate, methyl 4-amino-2-chloro-5-isobutylbenzoate replacing methyl 4-amino-2-chlorobenzoate.
(168) LC-MS (A): t.sub.R=0.97 min; [M+CH.sub.3CN+H]+: 408.77
A.15.c. Methyl 4-amino-2-chloro-5-isobutyl-3-((trimethylsilyl)ethynyl)benzoate
(169) This compound was prepared using a method analogous to that of methyl 4-amino-2-chloro-3-((trimethylsilyl)ethynyl)benzoate, methyl 4-amino-2-chloro-3-iodo-5-isobutylbenzoate replacing the mixture of methyl 4-amino-2-chloro-3-iodobenzoate and methyl 4-amino-2-chloro-5-iodobenzoate.
(170) LC-MS (A): t.sub.R=1.07 min; [M+H]+: 337.90
A.15.d. Methyl 4-amino-2-chloro-3-ethynyl-5-isobutylbenzoate
(171) This compound was prepared using a method analogous to that of methyl 4-amino-2-chloro-3-ethynylbenzoate, methyl 4-amino-2-chloro-5-isobutyl-3-((trimethylsilyl)ethynyl) benzoate replacing methyl 4-amino-2-chloro-3-((trimethylsilyl)ethynyl)benzoate.
(172) LC-MS (A): t.sub.R=0.94 min; [M+H]+: 266.07
A.15.e. Methyl 4-chloro-7-isobutyl-1H-indole-5-carboxylate
(173) This compound was prepared using a method analogous to that of methyl 4-chloro-1H-indole-5-carboxylate, methyl 4-amino-2-chloro-3-ethynyl-5-isobutylbenzoate replacing methyl 4-amino-2-chloro-3-ethynylbenzoate.
(174) LC-MS (A): t.sub.R=0.94 min; [M+H]+: 266.16
A.15.f. 4-Chloro-7-isobutyl-1H-indole-5-carboxylic acid
(175) This compound was prepared using a method analogous to that of 4-chloro-7-methyl-1H-indole-5-carboxylic acid, methyl 4-chloro-7-isobutyl-1H-indole-5-carboxylate replacing methyl 4-chloro-7-methyl-1H-indole-5-carboxylate.
(176) LC-MS (A): t.sub.R=0.82 min, [M+H]+: 252.06
A.16. Synthesis of 4-chloro-7-(3-methoxypropyl)-1H-indole-5-carboxylic acid
A.16.a. Methyl 4-amino-2-chloro-5-(3-methoxyprop-1-yn-1-yl)benzoate
(177) To a mixture of methyl 4-amino-2-chloro-5-iodobenzoate (3.51 mmol), Pd(PPh.sub.3).sub.2Cl.sub.2 (0.18 mmol) and CuI (0.18 mmol) was sequentially added under argon THF (12 mL), Et.sub.3N (14 mmol) and methyl propargyl ether (14 mmol). The mixture was stirred for 1 h at RT, diluted with EtOAc and filtered. The filtrate was concentrated in vacuo and the crude was purified by CC (SNAP KP-Sil from Biotage) using Hept/EtOAc from 85/15 to 40/60 to give the title compound as orange solid.
(178) LC-MS (A): t.sub.R=0.82 min, [M+H]+: 253.99
A.16.b. Methyl 4-amino-2-chloro-5-(3-methoxypropyl)benzoate
(179) To a solution of methyl 4-amino-2-chloro-5-(3-methoxyprop-1-yn-1-yl)benzoate (3.48 mmol) in EtOH (14 mL) was added PtO.sub.2 (0.35 mmol). The mixture was stirred under a hydrogen atmosphere for 2 h. It was filtered over Celite, washed with EtOH and concentrated in vacuo. The crude was purified by CC (SNAP KP-Sil from Biotage) using Hept/EtOAc from 1/0 to 8/2 to give the title compound as yellow oil.
(180) LC-MS (A): t.sub.R=0.80 min, [M+H]+: 257.90
A.16.c. Methyl 4-amino-2-chloro-3-iodo-5-(3-methoxypropyl)benzoate
(181) This compound was prepared using a method analogous to that of the mixture of methyl 4-amino-2-chloro-3-iodobenzoate and methyl 4-amino-2-chloro-5-iodobenzoate, methyl 4-amino-2-chloro-5-(3-methoxypropyl)benzoate replacing methyl 4-amino-2-chlorobenzoate.
(182) LC-MS (A): t.sub.R=0.90 min; [M+H]+: 383.91
A.16.d. Methyl 4-amino-2-chloro-5-(3-methoxypropyl)-3-(trimethylsilyl)ethynyl)benzoate
(183) This compound was prepared using a method analogous to that of methyl 4-amino-2-chloro-3-((trimethylsilyl)ethynyl)benzoate, methyl 4-amino-2-chloro-3-iodo-5-(3-methoxypropyl)benzoate replacing the mixture of methyl 4-amino-2-chloro-3-iodobenzoate and methyl 4-amino-2-chloro-5-iodobenzoate.
(184) LC-MS (A): t.sub.R=1.00 min; [M+H]+: 353.85
A.16.e. Methyl 4-amino-2-chloro-3-ethynyl-5-(3-methoxypropyl)benzoate
(185) This compound was prepared using a method analogous to that of methyl 4-amino-2-chloro-3-ethynylbenzoate, methyl 4-amino-2-chloro-5-(3-methoxypropyl)-3-((trimethylsilyl) ethynyl)benzoate replacing methyl 4-amino-2-chloro-3-((trimethylsilyl)ethynyl)benzoate.
(186) LC-MS (A): t.sub.R=0.85 min; [M+H]+: 281.83
A.16.f. Methyl 4-chloro-7-(3-methoxypropyl)-1H-indole-5-carboxylate
(187) This compound was prepared using a method analogous to that of methyl 4-chloro-1H-indole-5-carboxylate, methyl 4-amino-2-chloro-3-ethynyl-5-(3-methoxypropyl)benzoate replacing methyl 4-amino-2-chloro-3-ethynylbenzoate.
(188) LC-MS (A): t.sub.R=0.86 min; [M+H]+: 282.07
A.16.g. 4-Chloro-7-(3-methoxypropyl)-1H-indole-5-carboxylic acid
(189) This compound was prepared using a method analogous to that of 4-chloro-7-methyl-1H-indole-5-carboxylic acid, methyl 4-chloro-7-(3-methoxypropyl)-1H-indole-5-carboxylate replacing methyl 4-chloro-7-methyl-1H-indole-5-carboxylate.
(190) LC-MS (A): t.sub.R=0.72 min, [M+H]+: 268.07
A.17. Synthesis of 4-methyl-1H-indole-5-carboxylic acid
A.17.a. Methyl 4-methyl-1H-indole-5-carboxylate
(191) Methyl 4-chloro-1H-indole-5-carboxylate (0.48 mmol), K.sub.2CO.sub.3 (1.91 mmol) and PEPPSI-IPr (0.05 mmol) were placed in a pressure vessel and anh. dioxane (2 mL) and trimethylboroxine (0.23 mL) were added sequentially. The tube was sealed under argon and heated at 115 C. After 17 h, the reaction mixture was cooled to RT, filtered over a pad of Celite and the cake was washed with EtOAc. The filtrate was concentrated in vacuo and the crude was purified by CC (SNAP KP-Sil from Biotage) using Hept/EtOAc from 96/4 to 50/50 to give the title compound as white solid.
(192) LC-MS (A): t.sub.R=0.78 min, [M+H]+: 190.10
A.17.b. 4-Methyl-1H-indole-5-carboxylic acid
(193) This compound was prepared using a method analogous to that of 4-chloro-7-methyl-1H-indole-5-carboxylic acid, methyl 4-methyl-1H-indole-5-carboxylate replacing methyl 4-chloro-7-methyl-1H-indole-5-carboxylate except that the reaction mixture was stirred for 16 h at 60 C.
(194) LC-MS (A): t.sub.R=0.64 min
(195) LC-MS (D*): t.sub.R=0.15 min, [MH]: 173.91
A.18. Synthesis of 4-chloro-7-methoxy-1H-indole-5-carboxylic acid
A.18.a.1-Chloro-4-methoxy-2-methyl-5-nitrobenzene
(196) To a suspension of 4-chloro-5-methyl-2-nitrophenol (5.33 mmol) and K.sub.2CO.sub.3 (10.70 mmol) in DMF (11 mL) was added methyl iodide (5.86 mmol) and the mixture was stirred for 6 h at RT. It was quenched with half saturated NaHCO.sub.3 solution and extracted three times with EtOAc. The organic phases were dried over MgSO.sub.4 and concentrated in vacuo. The crude was purified by CC (Isolute Flash Si II from Biotage) using Hept/EtOAc from 85/15 to 80/20 to give the title compound as yellow solid.
(197) LC-MS (A): t.sub.R=0.88 min
(198) .sup.1H NMR ((CD.sub.3).sub.2SO) : 8.01 (s, 1 H), 7.44 (s, 1 H), 3.93 (s, 3 H), 2.42 (s, 3 H)
A.18.b. 2-Chloro-5-methoxy-4-nitrobenzoic acid
(199) To a suspension of 1-chloro-4-methoxy-2-methyl-5-nitrobenzene (4.32 mmol) in H.sub.2O (207 mL) was added KMnO.sub.4 (17.30 mmol) and the mixture was refluxed for 3 h and filtered to remove solids. The filtrate was quenched with a 40% NaHSO.sub.3 solution, acidified with a 1M HCl solution until pH 1-2 and extracted three times with EtOAc. The organic phases were dried over MgSO.sub.4 and concentrated in vacuo to give the title compound as light yellow solid.
(200) LC-MS (A): t.sub.R=0.69 min
(201) LC-MS (D*): t.sub.R=0.26 min, [MH]: 230.04
A.18.c. 4-Amino-2-chloro-5-methoxybenzoic acid
(202) This compound was prepared using a method analogous to that of methyl 4-amino-2,6-dichlorobenzoate, 2-chloro-5-methoxy-4-nitrobenzoic acid replacing methyl 2,6-dichloro-4-nitrobenzoate except that the mixture was heated for 15 min at 100 C. under microwave conditions.
(203) LC-MS (A): t.sub.R=0.59 min; [M+CH.sub.3CN+H]+: 242.70
A.18.d. Methyl 4-amino-2-chloro-5-methoxybenzoate
(204) This compound was prepared using a method analogous to that of methyl 4-amino-2-chlorobenzoate, 4-amino-2-chloro-5-methoxybenzoic acid replacing 4-amino-2-chlorobenzoic acid.
(205) LC-MS (A): t.sub.R=0.75 min; [M+H]+: 216.14
A.18.e. Methyl 4-amino-2-chloro-3-iodo-5-methoxybenzoate
(206) This compound was prepared using a method analogous to that of the mixture of methyl 4-amino-2-chloro-3-iodobenzoate and methyl 4-amino-2-chloro-5-iodobenzoate, methyl 4-amino-2-chloro-5-methoxybenzoate replacing methyl 4-amino-2-chlorobenzoate.
(207) LC-MS (A): t.sub.R=0.85 min; [M+H]+: 341.67
A.18.f. Methyl 4-amino-2-chloro-5-methoxy-3-(trimethylsilyl)ethynyl)benzoate
(208) This compound was prepared using a method analogous to that of methyl 4-amino-2-chloro-3-((trimethylsilyl)ethynyl)benzoate, methyl 4-amino-2-chloro-3-iodo-5-methoxybenzoate replacing the mixture of methyl 4-amino-2-chloro-3-iodobenzoate and methyl 4-amino-2-chloro-5-iodobenzoate.
(209) LC-MS (A): t.sub.R=0.99 min; [M+H]+: 311.94
A.18.g. Methyl 4-amino-2-chloro-3-ethynyl-5-methoxybenzoate
(210) This compound was prepared using a method analogous to that of methyl 4-amino-2-chloro-3-ethynylbenzoate, methyl 4-amino-2-chloro-5-methoxy-3-((trimethylsilyl)ethynyl)-benzoate replacing methyl 4-amino-2-chloro-3-((trimethylsilyl)ethynyl)benzoate.
(211) LC-MS (A): t.sub.R=0.81 min; [M+H]+: 240.02
A.18.h. Methyl 4-chloro-7-methoxy-1H-indole-5-carboxylate
(212) This compound was prepared using a method analogous to that of methyl 4-chloro-1H-indole-5-carboxylate, methyl 4-amino-2-chloro-3-ethynyl-5-methoxybenzoate replacing methyl 4-amino-2-chloro-3-ethynylbenzoate.
(213) LC-MS (A): t.sub.R=0.82 min; [M+H]+: 239.95
A.18.i. 4-Chloro-7-methoxy-1H-indole-5-carboxylic acid
(214) This compound was prepared using a method analogous to that of 4-chloro-7-methyl-1H-indole-5-carboxylic acid, methyl 4-chloro-7-methoxy-1H-indole-5-carboxylate replacing methyl 4-chloro-7-methyl-1H-indole-5-carboxylate.
(215) LC-MS (A): t.sub.R=0.68 min, [M+H]+: 226.08
A.19. Synthesis of 4,7-dimethyl-1H-indole-5-carboxylic acid
A.19.a.4-Amino-2,5-dimethylbenzonitrile
(216) 4-Bromo-2,5-dimethylaniline (5 mmol), zinc cyanide (6 mmol) and Pd(PPh.sub.3).sub.4 (0.1 mmol) were placed in a pressure vessel and anh. DMF (3 mL) was added. The tube was sealed under argon and heated at 110 C. After 35 h, it was quenched with a 10% Na.sub.2CO.sub.3 solution and extracted three times with EtOAc. The organic phase was washed with a sat. NaHCO.sub.3 solution, dried over MgSO.sub.4 and concentrated in vacuo. The crude was purified by CC (SNAP KP-Sil from Biotage) using Hept/EtOAc from 92/8 to 40/60 to give the title compound as white solid.
(217) LC-MS (A): t.sub.R=0.72 min, [M+H]+: 147.16
A.19.b. 4-Amino-3-iodo-2,5-dimethylbenzonitrile
(218) This compound was prepared using a method analogous to that of the mixture of methyl 4-amino-2-chloro-3-iodobenzoate and methyl 4-amino-2-chloro-5-iodobenzoate, 4-amino-2,5-dimethylbenzonitrile replacing methyl 4-amino-2-chlorobenzoate.
(219) LC-MS (A): t.sub.R=0.85 min; [M+CH.sub.3CN+H]+: 313.83
A.19.c. 4-Amino-2,5-dimethyl-3-(trimethylsilyl)ethynyl)benzonitrile
(220) This compound was prepared using a method analogous to that of methyl 4-amino-2-chloro-3-((trimethylsilyl)ethynyl)benzoate, 4-amino-3-iodo-2,5-dimethylbenzonitrile replacing the mixture of methyl 4-amino-2-chloro-3-iodobenzoate and methyl 4-amino-2-chloro-5-iodobenzoate.
(221) LC-MS (A): t.sub.R=1.00 min; [M+H]+: 243.13
A.19.d. 4-Amino-3-ethynyl-2,5-dimethylbenzonitrile
(222) This compound was prepared using a method analogous to that of methyl 4-amino-2-chloro-3-ethynylbenzoate, 4-amino-2,5-dimethyl-3-((trimethylsilyl)ethynyl)benzonitrile replacing methyl 4-amino-2-chloro-3-((trimethylsilyl)ethynyl)benzoate.
(223) LC-MS (A): t.sub.R=0.81 min; [M+CH.sub.3CN+H]+: 212.12
A.19.e. 4,7-Dimethyl-1H-indole-5-carbonitrile
(224) This compound was prepared using a method analogous to that of methyl 4-chloro-1H-indole-5-carboxylate, 4-amino-3-ethynyl-2,5-dimethylbenzonitrile replacing methyl 4-amino-2-chloro-3-ethynylbenzoate.
(225) LC-MS (A): t.sub.R=0.81 min; [M+CH.sub.3CN+H]+: 212.13
(226) .sup.1H NMR ((CD.sub.3).sub.2SO) : 11.64 (s br, 1 H), 7.52 (dd, J.sub.1=J.sub.2=2.8 Hz, 1 H), 7.17 (s, 1 H), 6.67 (dd, J.sub.1=2.9 Hz, J.sub.2=1.9 Hz, 1 H), 2.63 (s, 3 H), 2.47 (s, 3 H)
A.19.f. 4,7-Dimethyl-1H-indole-5-carboxylic acid
(227) To a solution of 4,7-dimethyl-1H-indole-5-carbonitrile (0.19 mmol) in EtOH (1 mL) was added a 4M KOH solution (3.9 mL) and the mixture was heated for 18 h at 120 C. It was partitioned between water and EtOAc, the aqueous phase was acidified with a 25% HCl solution until pH 1-2 and extracted three times with EtOAc. The organic phases were dried over MgSO.sub.4 and concentrated in vacuo to give the title compound as white solid.
(228) LC-MS (A): t.sub.R=0.68 min; [M+H]+: 190.18
A.20. Synthesis of 4-ethyl-1H-indole-5-carboxylic acid
A.20.a. Methyl 4-ethyl-1H-indole-5-carboxylate
(229) This compound was prepared using a method analogous to that of methyl 4-methyl-1H-indole-5-carboxylate, vinylboronic acid pinacol ester replacing trimethylboroxine.
(230) LC-MS (A): t.sub.R=0.80 min, [M+H]+: 202.20
A.20.b. Methyl 4-ethyl-1H-indole-5-carboxylate
(231) To a solution of methyl 4-vinyl-1H-indole-5-carboxylate (0.21 mmol) in EtOH (2 mL) was added platinum dioxide (0.021 mmol). The mixture was stirred under a hydrogen atmosphere for 2 h, filtered over Celite and concentrated in vacuo to give the title compound as pinkish solid.
(232) LC-MS (A): t.sub.R=0.83 min, [M+H]+: 204.18
A.20.c. 4-Ethyl-1H-indole-5-carboxylic acid
(233) This compound was prepared using a method analogous to that of 4-chloro-7-methyl-1H-indole-5-carboxylic acid, methyl 4-ethyl-1H-indole-5-carboxylate replacing methyl 4-chloro-7-methyl-1H-indole-5-carboxylate.
(234) LC-MS (A): t.sub.R=0.70 min, [M+CH.sub.3CN+H]+: 231.08
A.21. Synthesis of 4-chloro-7-acetyl-1H-indole-5-carboxylic acid
A.21.a. Methyl 4-amino-2-chloro-3,5-diiodobenzoate
(235) To a suspension of methyl 4-amino-2-chlorobenzoate (10.8 mmol) in EtOH (100 mL) was added iodine (23.7 mmol) and silver sulfate (10.8 mmol) under argon. The mixture was stirred for 2 h, filtered and the filtrate was treated with a 10% aq. solution of sodium thiosulfate. After evaporation of EtOH, the residue was partitioned between EtOAc and a 1M aq. solution of NaOH. The organic phase was washed with a 1M aq. solution of NaOH and brine, dried over MgSO.sub.4 and concentrated in vacuo. The crude was purified by CC using DCM and the solid was triturated in CH.sub.3CN and filtered to give the title compound as beige solid.
(236) LC-MS (A): t.sub.R=0.92 min
(237) .sup.1H NMR ((CD.sub.3).sub.2SO) : 8.13 (s, 1 H), 6.02 (s, 2 H), 3.79 (s, 3 H)
A.21.b. Methyl 4-amino-2-chloro-3-iodo-5-(trimethylsilyl)ethynyl)benzoate
(238) A solution of methyl 4-amino-2-chloro-3,5-diiodobenzoate (9.6 mmol) in Et.sub.3N (80 mL) and toluene (80 mL) was treated under argon with PPh.sub.3 (0.96 mmol), CuI (4.80 mmol), Pd(PPh.sub.3).sub.2Cl.sub.2 (0.48 mmol) and trimethylsilylacetylene (10.1 mmol). The mixture was stirred for 2 h at RT, quenched with a 10% aq. solution of NH.sub.4Cl and extracted with EtOAc. The organic phase was washed with brine, dried over MgSO.sub.4 and concentrated in vacuo. The crude was purified by CC (SNAP KP-SIL from Biotage) using Hept/EtOAc from 100/0 to 85/15 to give the title compound as light orange solid.
(239) LC-MS (A): t.sub.R=1.05 min; [M+H]+: 408.02
A.21.c. Methyl 5-acetyl-4-amino-2-chloro-3-iodobenzoate
(240) A solution of methyl 4-amino-2-chloro-3-iodo-5-((trimethylsilyl)ethynyl)benzoate (4.39 mmol) in toluene (20 mL) was treated with 4-toluene sulfonic acid monohydrate (11 mmol). The mixture was stirred for 3 h at 80 C. and poured into water. The aq. phase was basified with a 32% aq. solution of NaOH until pH=12-13 and extracted with EtOAc. The organic phase was washed with brine, dried over MgSO.sub.4 and concentrated in vacuo. The crude was purified by CC (SNAP KP-SIL from Biotage) using Hept/EtOAc from 100/0 to 75/25 to give the title compound as light yellow solid.
(241) LC-MS (A): t.sub.R=0.88 min
(242) .sup.1H NMR ((CD.sub.3).sub.2SO) : 8.37 (s, 1 H), 8.00 (s br, 2 H), 3.83 (s, 3 H), 2.63 (s, 3 H)
A.21.d. Methyl 5-acetyl-4-amino-2-chloro-3-((trimethylsilyl)ethynyl)benzoate
(243) This compound was prepared using a method analogous to that of methyl 4-amino-2-chloro-3-((trimethylsilyl)ethynyl)benzoate, methyl 5-acetyl-4-amino-2-chloro-3-iodobenzoate replacing the mixture of methyl 4-amino-2-chloro-3-iodobenzoate and methyl 4-amino-2-chloro-5-iodobenzoate.
(244) LC-MS (A): t.sub.R=1.03 min; [M+H]+: 324.25
A.21.e. Methyl 5-acetyl-4-amino-2-chloro-3-ethynylbenzoate
(245) This compound was prepared using a method analogous to that of methyl 4-amino-2-chloro-3-ethynylbenzoate, methyl 5-acetyl-4-amino-2-chloro-3-((trimethylsilyl)ethynyl) benzoate replacing methyl 4-amino-2-chloro-3-((trimethylsilyl)ethynyl)benzoate.
(246) LC-MS (A): t.sub.R=0.84 min; [M+H]+: 251.99
A.21.f. Methyl 7-acetyl-4-chloro-1H-indole-5-carboxylate
(247) This compound was prepared using a method analogous to that of methyl 4-chloro-1H-indole-5-carboxylate, methyl 5-acetyl-4-amino-2-chloro-3-ethynylbenzoate replacing methyl 4-amino-2-chloro-3-ethynylbenzoate.
(248) LC-MS (A): t.sub.R=0.83 min
(249) .sup.1H NMR ((CD.sub.3).sub.2SO) : 11.96 (s, 1 H), 8.32 (s, 1 H), 7.56 (dd, J.sub.1=J.sub.2=2.9 Hz, 1 H), 6.74 (dd, J.sub.1=2.1 Hz, J.sub.2=3.2 Hz, 1 H), 3.92 (s, 3 H), 2.72 (s, 3 H)
A.21.g. 7-Acetyl-4-chloro-1H-indole-5-carboxylic acid
(250) This compound was prepared using a method analogous to that of 4-chloro-7-methyl-1H-indole-5-carboxylic acid, methyl 7-acetyl-4-chloro-1H-indole-5-carboxylate replacing methyl 4-chloro-7-methyl-1H-indole-5-carboxylate.
(251) LC-MS (A): t.sub.R=0.69 min
(252) .sup.1H NMR ((CD.sub.3).sub.2SO) : 13.25 (s, 1 H), 11.91 (s, 1 H), 8.34 (s, 1 H), 7.54 (dd, J.sub.1=J.sub.2=2.9 Hz, 1 H), 6.72 (dd, J.sub.1=2.1 Hz, J.sub.2=3.1 Hz, 1 H), 2.72 (s, 3 H)
A.22. Synthesis of 7-methyl-4-(trifluoromethyl)-1H-indole-5-carboxylic acid
A.22.a. Methyl 4-amino-2-(trifluoromethyl)benzoate
(253) This compound was prepared using a method analogous to that of methyl 4-amino-2-chlorobenzoate, 4-amino-2-(trifluoromethyl)benzoic acid replacing 4-amino-2-chlorobenzoic acid.
(254) LC-MS (A): t.sub.R=0.77 min, [M+H]+: 220.04
A.22.b. Methyl 4-amino-5-iodo-2-(trifluoromethyl)benzoate
(255) This compound was prepared using a method analogous to that of the mixture of methyl 4-amino-2-chloro-3-iodobenzoate and methyl 4-amino-2-chloro-5-iodobenzoate, methyl 4-amino-2-(trifluoromethyl)benzoate replacing methyl 4-amino-2-chlorobenzoate except that only the 5-iodo regioisomer was isolated.
(256) LC-MS (A): t.sub.R=0.88 min, [M+H]+: 345.7
A.22.c. Methyl 4-amino-5-methyl-2-(trifluoromethyl)benzoate
(257) To a solution of methyl 4-amino-5-iodo-2-(trifluoromethyl)benzoate (24.6 mmol) in dioxane (49 mL) was added under argon a 2M solution of methylzinc chloride in THF (61.6 mmol) followed by Pd(dppf)Cl.sub.2.DCM (1.72 mmol). The mixture was stirred for 30 min at 65 C. in a sealed vial, diluted with EtOAc and filtered. The filtrate was washed with a sat. solution of Rochelle salt and with brine, dried over MgSO.sub.4 and concentrated in vacuo. The crude was purified by CC (SNAP KP-SIL from Biotage) using DCM to give the title compound as brown solid.
(258) LC-MS (A): t.sub.R=0.81 min; [M+H]+: 234.01
A.22.d. Methyl 4-amino-3-iodo-5-methyl-2-(trifluoromethyl)benzoate
(259) This compound was prepared using a method analogous to that of the mixture of methyl 4-amino-2-chloro-3-iodobenzoate and methyl 4-amino-2-chloro-5-iodobenzoate, methyl 4-amino-5-methyl-2-(trifluoromethyl)benzoate replacing methyl 4-amino-2-chlorobenzoate except that the reaction mixture was stirred for 7 h at 50 C.
(260) LC-MS (A): t.sub.R=0.88 min, [M+H]+: 400.78
A.22.e. Methyl 4-amino-5-methyl-2-(trifluoromethyl)-3-(trimethylsilyl)ethynyl)benzoate
(261) This compound was prepared using a method analogous to that of methyl 4-amino-2-chloro-3-((trimethylsilyl)ethynyl)benzoate, methyl 4-amino-3-iodo-5-methyl-2-(trifluoromethyl)benzoate replacing the mixture of methyl 4-amino-2-chloro-3-iodobenzoate and methyl 4-amino-2-chloro-5-iodobenzoate except that the reaction mixture was stirred for 3 h 30 at 70 C.
(262) LC-MS (A): t.sub.R=1.02 min; [M+H]+: 330.09
A.22.f. Methyl 4-amino-3-ethynyl-5-methyl-2-(trifluoromethyl)benzoate
(263) This compound was prepared using a method analogous to that of methyl 4-amino-2-chloro-3-ethynylbenzoate, methyl 4-amino-5-methyl-2-(trifluoromethyl)-3-((trimethylsilyl) ethynyl)benzoate replacing methyl 4-amino-2-chloro-3-((trimethylsilyl)ethynyl)benzoate.
(264) LC-MS (A): t.sub.R=0.85 min; [M+H]+: 257.90
A.22.g. Methyl 7-methyl-4-(trifluoromethyl)-1H-indole-5-carboxylate
(265) This compound was prepared using a method analogous to that of methyl 4-chloro-1H-indole-5-carboxylate, methyl 4-amino-3-ethynyl-5-methyl-2-(trifluoromethyl)benzoate replacing methyl 4-amino-2-chloro-3-ethynylbenzoate.
(266) LC-MS (A): t.sub.R=0.86 min
(267) .sup.1H NMR ((CD.sub.3).sub.2SO) : 11.87 (s, 1 H), 7.68 (dd, J.sub.1=J.sub.2=2.8 Hz, 1 H), 7.22 (s, 1 H), 6.65 (m, 1 H), 3.85 (s, 3 H), 2.58 (s, 3 H)
A.22.h. 7-Methyl-4-(trifluoromethyl)-1H-indole-5-carboxylic acid
(268) This compound was prepared using a method analogous to that of 4-chloro-7-methyl-1H-indole-5-carboxylic acid, methyl 7-methyl-4-(trifluoromethyl)-1H-indole-5-carboxylate replacing methyl 4-chloro-7-methyl-1H-indole-5-carboxylate except that the reaction mixture was stirred ON at 60 C.
(269) LC-MS (A): t.sub.R=0.73 min
(270) .sup.1H NMR ((CD.sub.3).sub.2SO) : 13.07 (s br, 1 H), 11.79 (s, 1 H), 7.65 (dd, J.sub.1=J.sub.2=2.7 Hz, 1 H), 7.21 (s, 1 H), 6.63 (m, 1 H), 2.57 (s, 3 H)
A.23. Synthesis of 4-chloro-7-ethyl-1H-indole-5-carboxylic acid
A.23.a. Methyl 4-amino-2-chloro-5-ethynyl-3-iodobenzoate
(271) This compound was prepared using a method analogous to that of methyl 4-amino-2-chloro-3-ethynylbenzoate, methyl 4-amino-2-chloro-3-iodo-5-((trimethylsilyl)ethynyl) benzoate replacing methyl 4-amino-2-chloro-3-((trimethylsilyl)ethynyl)benzoate.
(272) LC-MS (A): t.sub.R=0.88 min
(273) .sup.1H NMR ((CD.sub.3).sub.2SO) : 7.76 (s, 1 H), 6.17 (s, 2 H), 4.65 (s, 1 H), 3.78 (s, 3 H)
A.23.b. Methyl 4-amino-2-chloro-5-ethyl-3-iodobenzoate
(274) To a solution of methyl 4-amino-2-chloro-5-ethynyl-3-iodobenzoate (0.99 mmol) in EtOH (4 mL) was added platinum (IV) oxide (0.099 mmol). The mixture was stirred under a hydrogen atmosphere for 1 h, filtered over Celite and concentrated in vacuo. The crude was purified by CC using DCM to give the title compound as light yellow solid.
(275) LC-MS (A): t.sub.R=0.90 min, [M+H]+: 339.83
A.23.c. Methyl 4-amino-2-chloro-5-ethyl-3-(trimethylsilyl)ethynyl)benzoate
(276) This compound was prepared using a method analogous to that of methyl 4-amino-2-chloro-3-((trimethylsilyl)ethynyl)benzoate, methyl 4-amino-2-chloro-5-ethyl-3-iodobenzoate replacing the mixture of methyl 4-amino-2-chloro-3-iodobenzoate and methyl 4-amino-2-chloro-5-iodobenzoate except that the reaction was stirred for 30 min at 80 C.
(277) LC-MS (A): t.sub.R=1.03 min; [M+H]+: 310.22
A.23.d. Methyl 4-amino-2-chloro-5-ethyl-3-ethynylbenzoate
(278) This compound was prepared using a method analogous to that of methyl 4-amino-2-chloro-3-ethynylbenzoate, methyl 4-amino-2-chloro-5-ethyl-3-((trimethylsilyl)ethynyl) benzoate replacing methyl 4-amino-2-chloro-3-((trimethylsilyl)ethynyl)benzoate.
(279) LC-MS (A): t.sub.R=0.86 min; [M+H]+: 238.21
A.23.e. Methyl 4-chloro-7-ethyl-1H-indole-5-carboxylate
(280) This compound was prepared using a method analogous to that of methyl 4-chloro-1H-indole-5-carboxylate, methyl 4-amino-2-chloro-5-ethyl-3-ethynylbenzoate replacing methyl 4-amino-2-chloro-3-ethynylbenzoate.
(281) LC-MS (A): t.sub.R=0.86 min, [M+H]+: 238.05
A.23.f. 4-Chloro-7-ethyl-1H-indole-5-carboxylic acid
(282) This compound was prepared using a method analogous to that of 4-chloro-7-methyl-1H-indole-5-carboxylic acid, methyl 7-methyl-4-(trifluoromethyl)-1H-indole-5-carboxylate replacing methyl 4-chloro-7-methyl-1H-indole-5-carboxylate.
(283) LC-MS (A): t.sub.R=0.73 min, [M+H]+: 224.20
A.24. Synthesis of 7-chloro-4-methyl-1H-indole-5-carboxylic acid
A.24.a. Methyl 4-acetamido-5-chloro-2-(((trifluoromethyl)sulfonyl) oxy)benzoate
(284) To a solution of methyl 4-acetamido-5-chloro-2-hydroxybenzoate (20.5 mmol) in DCM (100 mL) was added at 0 C. Et.sub.3N (22.6 mmol) and trifluoromethanesulfonic anhydride (22.6 mmol). The mixture was stirred for 1 h at RT, quenched with a sat. solution of NaHCO.sub.3 and extracted with DCM. The organic phase was washed with brine, dried over MgSO.sub.4 and concentrated in vacuo. The crude was purified by CC (SNAP KP-Sil from Biotage) using Hept/EtOAc from 100/0 to 65/35 to give the title compound as light yellow solid.
(285) LC-MS (A): t.sub.R=0.90 min
(286) .sup.1H NMR ((CD.sub.3).sub.2SO) : 9.94 (s, 1 H), 8.35 (s, 1 H), 8.14 (s, 1 H), 3.88 (s, 3 H), 2.23 (s, 3 H)
A.24.b. Methyl 4-acetamido-5-chloro-2-methylbenzoate
(287) A suspension of methyl 4-acetamido-5-chloro-2-(((trifluoromethyl)sulfonyl)oxy)benzoate (2.61 mmol), K.sub.3PO.sub.4 (5.23 mmol), methylboronic acid (5.23 mmol) and Pd(dppf)Cl.sub.2.DCM (0.26 mmol) in THF (26 mL) was stirred under argon for 2 h at 65 C. The reaction mixture was quenched with a sat. solution of NaHCO.sub.3 and extracted three times with EtOAc. The organic phase was washed with brine, dried over MgSO.sub.4 and concentrated in vacuo. The crude was purified by CC (SNAP KP-Sil from Biotage) using Hept/EtOAc from 100/0 to 60/40 to give the title compound as white solid.
(288) LC-MS (A): t.sub.R=0.77 min, [M+H]+: 241.90
A.24.c. Methyl 4-amino-5-chloro-2-methylbenzoate
(289) To a solution of methyl 4-acetamido-5-chloro-2-methylbenzoate (2.25 mmol) in MeOH (14 mL) was added K.sub.2CO.sub.3 (2.48 mmol). The suspension was stirred for 3 days at RT, MeOH was evaporated off and the residue was partitioned between EtOAc and a 1M solution of HCl. The aq. phase was extracted twice with EtOAc and the combined organic phases were washed with brine, dried over MgSO.sub.4 and concentrated in vacuo. The crude was purified by CC (SNAP KP-Sil from Biotage) using Hept/EtOAc from 100/0 to 80/20 to give the title compound as white solid.
(290) LC-MS (A): t.sub.R=0.81 min, [M+H]+: 200.12
A.24.d. Methyl 4-amino-5-chloro-3-iodo-2-methylbenzoate
(291) This compound was prepared using a method analogous to that of the mixture of methyl 4-amino-2-chloro-3-iodobenzoate and methyl 4-amino-2-chloro-5-iodobenzoate, methyl 4-amino-5-chloro-2-methylbenzoate replacing methyl 4-amino-2-chlorobenzoate except that the reaction mixture was stirred for 1 h at RT.
(292) LC-MS (A): t.sub.R=0.91 min
(293) .sup.1H NMR ((CD.sub.3).sub.2SO) : 7.76 (s, 1 H), 6.02 (s, 2 H), 3.77 (s, 3 H), 2.65 (s, 3 H)
A.24.e. Methyl 4-amino-5-chloro-2-methyl-3-(trimethylsilyl)ethynyl)benzoate
(294) This compound was prepared using a method analogous to that of methyl 4-amino-2-chloro-3-((trimethylsilyl)ethynyl)benzoate, methyl 4-amino-5-chloro-3-iodo-2-methyl benzoate replacing the mixture of methyl 4-amino-2-chloro-3-iodobenzoate and methyl 4-amino-2-chloro-5-iodobenzoate.
(295) LC-MS (A): t.sub.R=1.06 min; [M+H]+: 296.14
A.24.f. Methyl 4-amino-5-chloro-3-ethynyl-2-methylbenzoate
(296) This compound was prepared using a method analogous to that of methyl 4-amino-2-chloro-3-ethynylbenzoate, methyl 4-amino-5-chloro-2-methyl-3-((trimethylsilyl)ethynyl)benzoate replacing methyl 4-amino-2-chloro-3-((trimethylsilyl)ethynyl)benzoate.
(297) LC-MS (A): t.sub.R=0.88 min; [M+H]+: 224.03
A.24.g. Methyl 7-chloro-4-methyl-1H-indole-5-carboxylate
(298) This compound was prepared using a method analogous to that of methyl 4-chloro-1H-indole-5-carboxylate, methyl 4-amino-5-chloro-3-ethynyl-2-methylbenzoate replacing methyl 4-amino-2-chloro-3-ethynylbenzoate.
(299) LC-MS (A): t.sub.R=0.86 min, [M+H]+: 223.46
A.24.h. 7-Chloro-4-methyl-1H-indole-5-carboxylic acid
(300) This compound was prepared using a method analogous to that of 4-chloro-7-methyl-1H-indole-5-carboxylic acid, methyl 7-chloro-4-methyl-1H-indole-5-carboxylate replacing methyl 4-chloro-7-methyl-1H-indole-5-carboxylate.
(301) LC-MS (A): t.sub.R=0.72 min
(302) .sup.1H NMR ((CD.sub.3).sub.2SO) : 12.62 (s, 1 H), 11.77 (s, 1 H), 7.67 (s, 1 H), 7.49 (dd, J.sub.1=J.sub.2=2.8 Hz, 1 H), 6.78 (dd, J.sub.1=2.0 Hz, J.sub.2=3.0 Hz, 1 H), 2.75 (s, 3 H)
A.25. Synthesis of 7-methoxy-4-methyl-1H-indole-5-carboxylic acid
A.25.a.5-Methoxy-2-methyl-4-nitrobenzonitrile
(303) This compound was prepared using a method analogous to that of 2-chloro-6-methyl-4-nitrobenzonitrile, 5-methoxy-2-methyl-4-nitroaniline replacing 2-chloro-6-methyl-4-nitroaniline except that the reaction mixture was stirred for 1 h at 85 C. and ON at RT.
(304) LC-MS (A): t.sub.R=0.82 min
(305) .sup.1H NMR ((CD.sub.3).sub.2SO) : 8.00 (s, 1H), 7.88 (s, 1H), 3.95 (s, 3H), 2.47 (s, 3H)
A.25.b. 5-Methoxy-2-methyl-4-nitrobenzoic acid
(306) This compound was prepared using a method analogous to that of 2-chloro-6-methyl-4-nitrobenzoic acid, 5-methoxy-2-methyl-4-nitrobenzonitrile replacing 2-chloro-6-methyl-4-nitrobenzonitrile.
(307) LC-MS (A): t.sub.R=0.82 min
(308) LC-MS (D*): t.sub.R=0.17 min; [MH]: 210.19
A.25.c. Methyl 5-methoxy-2-methyl-4-nitrobenzoate
(309) This compound was prepared using a method analogous to that of methyl 4-amino-2-chlorobenzoate, 5-methoxy-2-methyl-4-nitrobenzoic acid replacing 4-amino-2-chloro-benzoic acid.
(310) LC-MS (A): t.sub.R=0.85 min
(311) .sup.1H NMR ((CD.sub.3).sub.2SO) : 7.87 (s, 1 H), 7.64 (s, 1 H), 3.95 (s, 3 H), 3.89 (s, 3 H), 2.46 (s, 3 H)
A.25.d. Methyl 4-amino-5-methoxy-2-methylbenzoate
(312) To a solution of methyl 5-methoxy-2-methyl-4-nitrobenzoate (2.13 mmol) in MeOH (21 mL) was added zinc dust (21.3 mmol) at RT followed by ammonium formate (21.3 mmol) at 0 C. The mixture was stirred for 1 h at RT, filtered over Celite and the filtrate was concentrated in vacuo. The residue was partitioned between EtOAc and a sat. solution of NaHCO.sub.3. The organic phase was washed with brine, dried over MgSO.sub.4 and concentrated in vacuo. The crude was purified by CC using DCM/MeOH from 100/0 to 99/1 to give the title compound as light yellow solid.
(313) LC-MS (A): t.sub.R=0.71 min; [M+H]+: 196.15
A.25.e. Methyl 4-amino-3-iodo-5-methoxy-2-methylbenzoate
(314) This compound was prepared using a method analogous to that of the mixture of methyl 4-amino-2-chloro-3-iodobenzoate and methyl 4-amino-2-chloro-5-iodobenzoate, methyl 4-amino-5-methoxy-2-methylbenzoate replacing methyl 4-amino-2-chlorobenzoate except that the reaction mixture was stirred for 1 h at RT.
(315) LC-MS (A): t.sub.R=0.87 min, [M+H]+: 321.73
A.25.f. Methyl 4-amino-5-methoxy-2-methyl-3-((trimethylsilyl)ethynyl)benzoate
(316) This compound was prepared using a method analogous to that of methyl 4-amino-2-chloro-3-((trimethylsilyl)ethynyl)benzoate, methyl 4-amino-3-iodo-5-methoxy-2-methyl benzoate replacing the mixture of methyl 4-amino-2-chloro-3-iodobenzoate and methyl 4-amino-2-chloro-5-iodobenzoate.
(317) LC-MS (A): t.sub.R=1.01 min; [M+H]+: 292.21
A.25.g. Methyl 4-amino-3-ethynyl-5-methoxy-2-methylbenzoate
(318) This compound was prepared using a method analogous to that of methyl 4-amino-2-chloro-3-ethynylbenzoate, methyl 4-amino-5-methoxy-2-methyl-3-((trimethylsilyl)ethynyl) benzoate replacing methyl 4-amino-2-chloro-3-((trimethylsilyl)ethynyl)benzoate.
(319) LC-MS (A): t.sub.R=0.83 min; [M+H]+: 220.13
A.25.h. Methyl 7-methoxy-4-methyl-1H-indole-5-carboxylate
(320) This compound was prepared using a method analogous to that of methyl 4-chloro-1H-indole-5-carboxylate, methyl 4-amino-3-ethynyl-5-methoxy-2-methylbenzoate replacing methyl 4-amino-2-chloro-3-ethynylbenzoate.
(321) LC-MS (A): t.sub.R=0.81 min; [M+H]+: 220.07
A.25.i. 7-Methoxy-4-methyl-1H-indole-5-carboxylic acid
(322) This compound was prepared using a method analogous to that of 4-chloro-7-methyl-1H-indole-5-carboxylic acid, methyl 7-methoxy-4-methyl-1H-indole-5-carboxylate replacing methyl 4-chloro-7-methyl-1H-indole-5-carboxylate.
(323) LC-MS (A): t.sub.R=0.67 min; [M+H]+: 206.15
A.26. Synthesis of 4-chloro-7-ethoxy-1H-indole-5-carboxylic acid
A.26.a.4-Amino-2-chloro-5-methoxybenzonitrile
(324) This compound was prepared using a method analogous to that of 4-amino-2,5-dimethylbenzonitrile, 4-bromo-5-chloro-2-methoxyaniline replacing 4-bromo-2,5-dimethyl aniline except that the reaction mixture was stirred ON at 110 C.
(325) LC-MS (A): t.sub.R=0.76 min, [M+H]+: 183.19
A.26.b. 4-Amino-2-chloro-3-iodo-5-methoxybenzonitrile
(326) This compound was prepared using a method analogous to that of the mixture of methyl 4-amino-2-chloro-3-iodobenzoate and methyl 4-amino-2-chloro-5-iodobenzoate, 4-amino-2-chloro-5-methoxybenzonitrile replacing methyl 4-amino-2-chlorobenzoate except that the reaction mixture was stirred for 45 min at RT.
(327) LC-MS (A): t.sub.R=0.86 min
(328) .sup.1H NMR ((CD.sub.3).sub.2SO) : 7.33 (s, 1 H), 6.11 (s, 2 H), 3.85 (s, 3 H)
A.26.c. 4-Amino-2-chloro-5-methoxy-3-((trimethylsilyl)ethynyl)benzonitrile
(329) This compound was prepared using a method analogous to that of methyl 4-amino-2-chloro-3-((trimethylsilyl)ethynyl)benzoate, 4-amino-2-chloro-3-iodo-5-methoxybenzonitrile replacing the mixture of methyl 4-amino-2-chloro-3-iodobenzoate and methyl 4-amino-2-chloro-5-iodobenzoate.
(330) LC-MS (A): t.sub.R=1.00 min; [M+H]+: 279.04
A.26.d. 4-Amino-2-chloro-3-ethynyl-5-methoxybenzonitrile
(331) This compound was prepared using a method analogous to that of methyl 4-amino-2-chloro-3-ethynylbenzoate, 4-amino-2-chloro-5-methoxy-3-((tri methylsilyl)ethynyl) benzonitrile replacing methyl 4-amino-2-chloro-3-((trimethylsilyl)ethynyl)benzoate.
(332) LC-MS (A): t.sub.R=0.82 min; [M+CH.sub.3CN+H]+: 248.23
A.26.e. 4-Chloro-7-methoxy-1H-indole-5-carbonitrile
(333) This compound was prepared using a method analogous to that of methyl 4-chloro-1H-indole-5-carboxylate, 4-amino-2-chloro-3-ethynyl-5-methoxybenzonitrile replacing methyl 4-amino-2-chloro-3-ethynylbenzoate.
(334) LC-MS (A): t.sub.R=0.83 min, [M+CH.sub.3CN+H]+: 248.23
(335) .sup.1H NMR ((CD.sub.3).sub.2SO) : 12.23 (s, 1 H), 7.56 (d, J=3.1 Hz, 1 H), 7.14 (s, 1 H), 6.61 (d, J=3.1 Hz, 1 H), 3.99 (s, 3 H)
A.26.f. 4-Chloro-7-hydroxy-1H-indole-5-carbonitrile
(336) To a solution of 4-chloro-7-methoxy-1H-indole-5-carbonitrile (2.53 mmol) in DCM (106 mL) was added dropwise a 1M solution of BBr.sub.3 in DCM (14.8 mmol) at 78 C. The mixture was allowed to warm up to RT and stirred for 15 h at 45 C. then for 4 h 30 at 55 C. It was quenched with MeOH (40 mL) and concentrated in vacuo. The crude was purified by CC (SNAP KP-Sil from Biotage) using EtOAc/MeOH from 100/0 to 90/10 to give the title compound as brownish solid.
(337) LC-MS (A): t.sub.R=0.75 min
(338) .sup.1H NMR ((CD.sub.3).sub.2SO) : 11.99 (s, 1 H), 10.69 (s, 1 H), 7.54 (dd, J.sub.1=J.sub.2=2.8 Hz, 1 H), 6.80 (s, 1 H), 6.57 (m, 1 H)
A.26.g. 4-Chloro-7-ethoxy-1H-indole-5-carbonitrile
(339) To a solution of 4-chloro-7-hydroxy-1H-indole-5-carbonitrile (1.31 mmol) in DMF (2.6 mL) was added at 0 C. K.sub.2CO.sub.3 (1.58 mmol) and ethyl bromide (1.44 mmol). The mixture was stirred ON at RT, quenched with water and extracted with EtOAc. The organic phase was dried over MgSO.sub.4 and concentrated in vacuo. The crude was purified by CC (SNAP KP-Sil from Biotage) using Hept/EtOAc from 100/0 to 50/50 to give the title compound as white solid.
(340) LC-MS (A): t.sub.R=0.88 min, [M+CH.sub.3CN+H]+: 262.10
A.26.h. 4-Chloro-7-ethoxy-1H-indole-5-carboxylic acid
(341) This compound was prepared using a method analogous to that of 4,7-dimethyl-1H-indole-5-carboxylic acid, 4-chloro-7-ethoxy-1H-indole-5-carbonitrile replacing 4,7-dimethyl-1H-indole-5-carbonitrile.
(342) LC-MS (A): t.sub.R=0.73 min; [M+H]+: 240.05
A.27. Synthesis of 4-chloro-7-hydroxy-1H-indole-5-carboxylic acid
(343) This compound was prepared using a method analogous to that of 4,7-dimethyl-1H-indole-5-carboxylic acid, 4-chloro-7-hydroxy-1H-indole-5-carbonitrile replacing 4,7-dimethyl-1H-indole-5-carbonitrile.
(344) LC-MS (A): t.sub.R=0.60 min; [M+CH.sub.3CN+H]+: 253.02
A.28. Synthesis of 4-chloro-7-propyl-1H-indole-5-carboxylic acid
A.28.a. Methyl 4-amino-2-chloro-5-propylbenzoate
(345) This compound was prepared using a method analogous to that of methyl 4-amino-2-chloro-5-isobutylbenzoate, 1-propylboronic acid replacing (2-methylpropyl)boronic acid.
(346) LC-MS (A): t.sub.R=0.86 min; [M+H]+: 228.15
A.28.b. Methyl 4-amino-2-chloro-3-iodo-5-propylbenzoate
(347) This compound was prepared using a method analogous to that of the mixture of methyl 4-amino-2-chloro-3-iodobenzoate and methyl 4-amino-2-chloro-5-iodobenzoate, methyl 4-amino-2-chloro-5-propylbenzoate replacing methyl 4-amino-2-chlorobenzoate.
(348) LC-MS (A): t.sub.R=0.94 min; [M+H]+: 353.66
A.28.c. Methyl 4-amino-2-chloro-5-propyl-3-(trimethylsilyl)ethynyl)benzoate
(349) This compound was prepared using a method analogous to that of methyl 4-amino-2-chloro-3-((trimethylsilyl)ethynyl)benzoate, methyl 4-amino-2-chloro-3-iodo-5-propylbenzoate replacing the mixture of methyl 4-amino-2-chloro-3-iodobenzoate and methyl 4-amino-2-chloro-5-iodobenzoate.
(350) LC-MS (A): t.sub.R=1.05 min; [M+H]+: 324.10
A.28.d. Methyl 4-amino-2-chloro-3-ethynyl-5-propylbenzoate
(351) This compound was prepared using a method analogous to that of methyl 4-amino-2-chloro-3-ethynylbenzoate, methyl 4-amino-2-chloro-5-propyl-3-((trimethylsilyl)ethynyl) benzoate replacing methyl 4-amino-2-chloro-3-((trimethylsilyl)ethynyl)benzoate.
(352) LC-MS (A): t.sub.R=0.90 min; [M+H]+: 252.25
A.28.e. Methyl 4-chloro-7-propyl-1H-indole-5-carboxylate
(353) This compound was prepared using a method analogous to that of methyl 4-chloro-1H-indole-5-carboxylate, methyl 4-amino-2-chloro-3-ethynyl-5-propylbenzoate replacing methyl 4-amino-2-chloro-3-ethynylbenzoate.
(354) LC-MS (A): t.sub.R=0.91 min; [M+H]+: 252.21
A.28.f. 4-Chloro-7-propyl-1H-indole-5-carboxylic acid
(355) This compound was prepared using a method analogous to that of 4-chloro-7-methyl-1H-indole-5-carboxylic acid, methyl 4-chloro-7-propyl-1H-indole-5-carboxylate replacing methyl 4-chloro-7-methyl-1H-indole-5-carboxylate.
(356) LC-MS (A): t.sub.R=0.78 min, [M+H]+: 238.19
A.29. Synthesis of 7-(2-(tert-butoxy)ethoxy)-4-chloro-1H-indole-5-carboxylic acid
A.29.a.7-(2-(tert-Butoxy)ethoxy)-4-chloro-1H-indole-5-carbonitrile
(357) This compound was prepared using a method analogous to that of 4-chloro-7-ethoxy-1H-indole-5-carbonitrile, 2-(2-bromoethoxy)-2-methylpropane replacing ethyl bromide except that the reaction mixture was stirred for 8 h at 80 C.
(358) LC-MS (A): t.sub.R=0.94 min, [M+CH.sub.3CN+H]+: 334.12
A.29.b. 7-(2-(tert-Butoxy)ethoxy)-4-chloro-1H-indole-5-carboxylic acid
(359) This compound was prepared using a method analogous to that of 4,7-dimethyl-1H-indole-5-carboxylic acid, 7-(2-(tert-butoxy)ethoxy)-4-chloro-1H-indole-5-carbonitrile replacing 4,7-dimethyl-1H-indole-5-carbonitrile.
(360) LC-MS (A): t.sub.R=0.80 min; [M+CH.sub.3CN+H]+: 353.16
(361) .sup.1H NMR ((CD.sub.3).sub.2SO) : 12.86 (s very br, 1 H), 11.74 (s, 1 H), 7.43 (dd, J.sub.1=J.sub.2=2.7 Hz, 1 H), 7.17 (s, 1 H), 6.58 (m, 1 H), 4.26 (m, 2 H), 3.74 (m, 2 H), 1.18 (s, 9 H)
A.30. Synthesis of 4,7-difluoro-1H-indole-5-carboxylic acid
A.30.a. Methyl 2,5-difluoro-4-nitrobenzoate
(362) This compound was prepared using a method analogous to that of methyl 4-amino-2-chlorobenzoate, 2,5-difluoro-4-nitrobenzoic acid replacing 4-amino-2-chlorobenzoic acid.
(363) LC-MS (A): t.sub.R=0.80 min
(364) .sup.1H NMR ((CD.sub.3).sub.2SO) : 8.31 (dd, J.sub.1=6.0 Hz, J.sub.2=9.7 Hz, 1 H), 8.07 (dd, J.sub.1=5.8 Hz, J.sub.2=10.9 Hz, 1 H), 3.92 (s, 3 H)
A.30.b. Methyl 4-amino-2,5-difluorobenzoate
(365) This compound was prepared using a method analogous to that of methyl 4-amino-5-methoxy-2-methylbenzoate, methyl 2,5-difluoro-4-nitrobenzoate replacing methyl 5-methoxy-2-methyl-4-nitrobenzoate.
(366) LC-MS (A): t.sub.R=0.70 min, [M+H]+: 188.22
A.30.c. Methyl 4-amino-2,5-difluoro-3-iodobenzoate
(367) This compound was prepared using a method analogous to that of the mixture of methyl 4-amino-2-chloro-3-iodobenzoate and methyl 4-amino-2-chloro-5-iodobenzoate, methyl 4-amino-2,5-difluorobenzoate replacing methyl 4-amino-2-chlorobenzoate except that the reaction mixture was stirred for 1 h at RT.
(368) LC-MS (A): t.sub.R=0.81 min
(369) .sup.1H NMR ((CD.sub.3).sub.2SO) : 7.52 (dd, J.sub.1=6.7 Hz, J.sub.2=11.7 Hz, 1 H), 6.43 (s, 2 H), 3.78 (s, 3 H)
A.30.d. Methyl 4-amino-2,5-difluoro-3-(trimethylsilyl)ethynyl)benzoate
(370) This compound was prepared using a method analogous to that of methyl 4-amino-2-chloro-3-((trimethylsilyl)ethynyl)benzoate, methyl 4-amino-2,5-difluoro-3-iodobenzoate replacing the mixture of methyl 4-amino-2-chloro-3-iodobenzoate and methyl 4-amino-2-chloro-5-iodobenzoate.
(371) LC-MS (A): t.sub.R=0.98 min; [M+H]+: 284.22
A.30.e. Methyl 4-amino-3-ethynyl-2,5-difluorobenzoate
(372) This compound was prepared using a method analogous to that of methyl 4-amino-2-chloro-3-ethynylbenzoate, methyl 4-amino-2,5-difluoro-3-((trimethylsilyl)ethynyl)benzoate replacing methyl 4-amino-2-chloro-3-((trimethylsilyl)ethynyl)benzoate.
(373) LC-MS (A): t.sub.R=0.78 min
(374) .sup.1H NMR ((CD.sub.3).sub.2SO) : 7.48 (dd, J.sub.1=6.6 Hz, J.sub.2=11.8 Hz, 1 H), 6.66 (s, 2 H), 4.80 (s, 1 H), 3.78 (s, 3 H)
A.30.f. Methyl 4,7-difluoro-1H-indole-5-carboxylate
(375) This compound was prepared using a method analogous to that of methyl 4-chloro-1H-indole-5-carboxylate, methyl 4-amino-3-ethynyl-2,5-difluorobenzoate replacing methyl 4-amino-2-chloro-3-ethynylbenzoate.
(376) LC-MS (A): t.sub.R=0.79 min, [M+H]+: 212.21
A.30.g. 4,7-Difluoro-1H-indole-5-carboxylic acid
(377) This compound was prepared using a method analogous to that of 4-chloro-7-methyl-1H-indole-5-carboxylic acid, methyl 4,7-difluoro-1H-indole-5-carboxylate replacing methyl 4-chloro-7-methyl-1H-indole-5-carboxylate.
(378) LC-MS (A): t.sub.R=0.64 min
(379) .sup.1H NMR ((CD.sub.3).sub.2SO) : 12.96 (s, 1 H), 12.29 (s, 1 H), 7.56 (dd, J.sub.1=J.sub.2=2.6 Hz, 1 H), 7.32 (dd, J.sub.1=4.9 Hz, J.sub.2=11.3 Hz, 1 H), 6.73 (m, 1 H)
A.31. Synthesis of 4-fluoro-7-methoxy-1H-indole-5-carboxylic acid
A.31.a.2-Fluoro-5-methoxy-4-nitrobenzoic acid
(380) To a suspension of 2,5-difluoro-4-nitrobenzoic acid (2.46 mmol) and Cs.sub.2CO.sub.3 (12.3 mmol) in DMF was added MeOH (16.5 mmol) and the mixture was stirred for 3 h 30 at RT. It was diluted with water, acidified with a 1M solution of HCl until pH=1-2 and extracted three times with EtOAc. The organic phases were washed with brine, dried over MgSO.sub.4 and concentrated in vacuo to give the title compound as light yellow solid.
(381) LC-MS (A): t.sub.R=0.67 min
(382) .sup.1H NMR ((CD.sub.3).sub.2SO) : 13.96 (s br, 1 H), 8.03 (d, J=9.6 Hz, 1 H), 7.68 (d, J=5.8 Hz, 1 H), 3.97 (s, 3 H)
A.31.b. Methyl 2-fluoro-5-methoxy-4-nitrobenzoate
(383) This compound was prepared using a method analogous to that of methyl 4-amino-2-chlorobenzoate, 2-fluoro-5-methoxy-4-nitrobenzoic acid replacing 4-amino-2-chlorobenzoic acid.
(384) LC-MS (A): t.sub.R=0.81 min
(385) .sup.1H NMR ((CD.sub.3).sub.2SO) : 8.09 (d, J=9.7 Hz, 1 H), 7.70 (d, J=5.7 Hz, 1 H), 3.98 (s, 3 H), 3.92 (s, 3 H)
A.31.c. Methyl 4-amino-2-fluoro-5-methoxybenzoate
(386) This compound was prepared using a method analogous to that of methyl 4-amino-5-methoxy-2-methylbenzoate, methyl 2-fluoro-5-methoxy-4-nitrobenzoate replacing methyl 5-methoxy-2-methyl-4-nitrobenzoate.
(387) LC-MS (A): t.sub.R=0.70 min, [M+H]+: 200.19
A.31.d. Methyl 4-amino-2-fluoro-3-iodo-5-methoxybenzoate
(388) This compound was prepared using a method analogous to that of the mixture of methyl 4-amino-2-chloro-3-iodobenzoate and methyl 4-amino-2-chloro-5-iodobenzoate, methyl 4-amino-2-fluoro-5-methoxybenzoate replacing methyl 4-amino-2-chlorobenzoate except that the reaction mixture was stirred for 2 h at RT.
(389) LC-MS (A): t.sub.R=0.83 min, [M+H]+: 325.97
A.31.e. Methyl 4-amino-2-fluoro-5-methoxy-3-((trimethylsilyl)ethynyl)benzoate
(390) This compound was prepared using a method analogous to that of methyl 4-amino-2-chloro-3-((trimethylsilyl)ethynyl)benzoate, methyl 4-amino-2-fluoro-3-iodo-5-methoxy benzoate replacing the mixture of methyl 4-amino-2-chloro-3-iodobenzoate and methyl 4-amino-2-chloro-5-iodobenzoate.
(391) LC-MS (A): t.sub.R=0.97 min; [M+H]+: 296.03
A.31.f. Methyl 4-amino-3-ethynyl-2-fluoro-5-methoxybenzoate
(392) This compound was prepared using a method analogous to that of methyl 4-amino-2-chloro-3-ethynylbenzoate, methyl 4-amino-2-fluoro-5-methoxy-3-((trimethylsilyl)ethynyl) benzoate replacing methyl 4-amino-2-chloro-3-((trimethylsilyl)ethynyl)benzoate.
(393) LC-MS (A): t.sub.R=0.78 min; [M+H]+: 223.92
A.31.g. Methyl 4-fluoro-7-methoxy-1H-indole-5-carboxylate
(394) This compound was prepared using a method analogous to that of methyl 4-chloro-1H-indole-5-carboxylate, methyl 4-amino-3-ethynyl-2-fluoro-5-methoxybenzoate replacing methyl 4-amino-2-chloro-3-ethynylbenzoate.
(395) LC-MS (A): t.sub.R=0.78 min, [M+H]+: 223.76
(396) .sup.1H NMR ((CD.sub.3).sub.2SO) : 11.96 (s, 1 H), 7.41 (dd, J.sub.1=J.sub.2=2.6 Hz, 1 H), 6.99 (d, J=4.9 Hz, 1 H), 6.62 (m, 1 H), 3.95 (s, 3 H), 3.85 (s, 3 H)
A.31.h. 4-Fluoro-7-methoxy-1H-indole-5-carboxylic acid
(397) This compound was prepared using a method analogous to that of 4-chloro-7-methyl-1H-indole-5-carboxylic acid, methyl 4-fluoro-7-methoxy-1H-indole-5-carboxylate replacing methyl 4-chloro-7-methyl-1H-indole-5-carboxylate.
(398) LC-MS (A): t.sub.R=0.64 min, [M+H]+: 210.15
A.32. Synthesis of 4-chloro-7-(2-ethoxyethyl)-1H-indole-5-carboxylic acid
A.32.a. Methyl 4-amino-2-chloro-5-(2-ethoxyvinyl)benzoate
(399) To a mixture of methyl 4-amino-2-chloro-5-iodobenzoate (1.05 mmol), KOH (2.1 mmol) Pd(OAc).sub.2 (0.03 mmol) and 2-dicyclohexylphosphino-2,6-dimethoxybiphenyl (0.08 mmol) was added under argon CH.sub.3CN (10 mL) and trans-2-ethoxyvinylboronic acid pinacol ester (2.1 mmol). The mixture was stirred for 1 h at 70 C. in a sealed vial, quenched with a 10% solution of NH.sub.4Cl and extracted three times with DCM. The organic phases were dried over MgSO.sub.4 and concentrated in vacuo. The crude was purified by CC (SNAP KP-Sil from Biotage) using Hept/EtOAc from 100/0 to 27/63 to give the title compound as brown oil.
(400) LC-MS (A): t.sub.R=0.85 min; [M+CH.sub.3CN+H]+: 297.04
A.32.b. Methyl 4-amino-2-chloro-5-(2-ethoxyethyl)benzoate
(401) To a solution of methyl 4-amino-2-chloro-5-(2-ethoxyvinyl)benzoate (0.63 mmol) in EtOH (4.2 mL) was added platinum (IV) oxide (0.13 mmol). The mixture was stirred under a hydrogen atmosphere for 3 h, filtered over Celite and concentrated in vacuo. The crude was purified by CC (SNAP KP-Sil from Biotage) using Hept/EtOAc from 100/0 to 63/37 to give the title compound as brownish oil.
(402) LC-MS (A): t.sub.R=0.81 min, [M+H]+: 257.95
A.32.c. Methyl 4-amino-2-chloro-5-(2-ethoxyethyl)-3-iodobenzoate
(403) This compound was prepared using a method analogous to that of the mixture of methyl 4-amino-2-chloro-3-iodobenzoate and methyl 4-amino-2-chloro-5-iodobenzoate, methyl 4-amino-2-chloro-5-(2-ethoxyethyl)benzoate replacing methyl 4-amino-2-chlorobenzoate except that the reaction mixture was stirred for 1 h at RT.
(404) LC-MS (A): t.sub.R=0.91 min, [M+H]+: 384.10
A.32.d. Methyl 4-amino-2-chloro-5-(2-ethoxyethyl)-3-(trimethylsilyl)ethynyl)benzoate
(405) This compound was prepared using a method analogous to that of methyl 4-amino-2-chloro-3-((trimethylsilyl)ethynyl)benzoate, methyl 4-amino-2-chloro-5-(2-ethoxyethyl)-3-iodobenzoate replacing the mixture of methyl 4-amino-2-chloro-3-iodobenzoate and methyl 4-amino-2-chloro-5-iodobenzoate.
(406) LC-MS (A): t.sub.R=1.05 min; [M+H]+: 353.87
A.32.e. Methyl 4-amino-2-chloro-5-(2-ethoxyethyl)-3-ethynylbenzoate
(407) This compound was prepared using a method analogous to that of methyl 4-amino-2-chloro-3-ethynylbenzoate, methyl 4-amino-2-chloro-5-(2-ethoxyethyl)-3-((trimethylsilyl)ethynyl)benzoate replacing methyl 4-amino-2-chloro-3-((trimethylsilyl)ethynyl)benzoate.
(408) LC-MS (A): t.sub.R=0.87 min; [M+H]+: 282.15
A.32.f. Methyl 4-chloro-7-(2-ethoxyethyl)-1H-indole-5-carboxylate
(409) This compound was prepared using a method analogous to that of methyl 4-chloro-1H-indole-5-carboxylate, methyl 4-amino-2-chloro-5-(2-ethoxyethyl)-3-ethynylbenzoate replacing methyl 4-amino-2-chloro-3-ethynylbenzoate.
(410) LC-MS (A): t.sub.R=0.87 min, [M+H]+: 282.14
(411) .sup.1H NMR ((CD.sub.3).sub.2SO) : 11.77 (s, 1 H), 7.55 (dd, J.sub.1=J.sub.2=2.8 Hz, 1 H), 7.49 (s, 1 H), 6.63 (dd, =2.0 Hz, J.sub.2=3.1 Hz, 1 H), 3.85 (s, 3 H), 3.66 (t, J=7.0 Hz, 2 H), 3.45 (q, J=7.0 Hz, 2 H), 3.12 (t, J=6.9 Hz, 2 H), 1.09 (t, J=7.0 Hz, 3 H)
A.32.g. 4-Chloro-7-(2-ethoxyethyl)-1H-indole-5-carboxylic acid
(412) This compound was prepared using a method analogous to that of 4-chloro-7-methyl-1H-indole-5-carboxylic acid, methyl 4-chloro-7-(2-ethoxyethyl)-1H-indole-5-carboxylate replacing methyl 4-chloro-7-methyl-1H-indole-5-carboxylate.
(413) LC-MS (A): t.sub.R=0.74 min, [M+H]+: 268.03
A.33. Synthesis of 4-chloro-7-(2-methoxypropan-2-yl)-1H-indole-5-carboxylic acid
A.33.a. Methyl 4-chloro-7-(2-hydroxypropan-2-yl)-1H-indole-5-carboxylate
(414) To a solution of methyl 7-acetyl-4-chloro-1H-indole-5-carboxylate (0.56 mmol) in THF (11 mL) was added dropwise at 10 C. a 3M solution of methylmagnesium bromide in diethyl ether (1.12 mmol). The mixture was stirred for 1 h at RT and an additional amount of a 3M solution of methylmagnesium bromide in diethyl ether (1.12 mmol) was added at 10 C. The mixture was further stirred for 1 h at RT and cooled to 0 C. It was quenched with a sat. solution of NH.sub.4Cl and extracted three times with EtOAc. The organic phases were washed with brine, dried over MgSO.sub.4 and concentrated in vacuo. The crude was purified by CC (Isolute Silica II from Biotage) using DCM/MeOH from 100/0 to 99/1 to give the title compound as grey solid.
(415) LC-MS (A): t.sub.R=0.79 min; [M+H]+: 268.15
A.33.b. Methyl 4-chloro-7-(2-methoxypropan-2-yl)-1H-indole-5-carboxylate
(416) To a solution of methyl 4-chloro-7-(2-hydroxypropan-2-yl)-1H-indole-5-carboxylate (0.39 mmol) in THF (1 mL) was added at 0 C. a 60% suspension of NaH in mineral oil (1.18 mmol) followed by methyl iodide (0.39 mmol). The mixture was stirred for 10 min at 0 C., ON at RT and cooled to 0 C. It was quenched with a sat. solution of NaHCO.sub.3 and extracted three times with EtOAc. The organic phases were washed with brine, dried over MgSO.sub.4 and concentrated in vacuo. The crude was purified by preparative LC-MS using method II to give the title compound as white solid.
(417) LC-MS (A): t.sub.R=0.88 min
(418) .sup.1H NMR ((CD.sub.3).sub.2SO) : 11.25 (s br, 1 H), 7.47 (s, 1 H), 7.45 (dd, J.sub.1=J.sub.2=2.9 Hz, 1 H), 6.64 (m, 1 H), 3.86 (s, 3 H), 2.97 (s, 3 H), 1.61 (s, 6 H)
A.33.c. 4-Chloro-7-(2-methoxypropan-2-yl)-1H-indole-5-carboxylic acid
(419) This compound was prepared using a method analogous to that of 4-chloro-7-methyl-1H-indole-5-carboxylic acid, methyl 4-chloro-7-(2-methoxypropan-2-yl)-1H-indole-5-carboxylate replacing methyl 4-chloro-7-methyl-1H-indole-5-carboxylate.
(420) LC-MS (A): t.sub.R=0.75 min
B. Synthesis of Amines
B.1. Synthesis of (1-aminomethyl)cycloheptanol
(421) This compound was synthesized according to WO2012/114268.
B.2. Synthesis of 1-(aminomethyl)-4,4-difluorocyclohexanol
(422) This compound was synthesized according to WO2012/114268.
B.3. Synthesis of (5)-2-amino-2-(4,4-difluorocyclohexyl)ethanol hydrochloride
B.3.a. (S)-methyl 2-((tert-butoxycarbonynamino)-2-(4-hydroxycyclohexyl)acetate
(423) This compound was synthesized according to Bioorg. Med. Chem. Lett., 2004, 14(1), 43-46.
B.3.b. (S)-methyl 2-((tert-butoxycarbonynamino)-2-(4-oxocyclohexyl)acetate
(424) To a solution of (S)-methyl 2-((tert-butoxycarbonyl)amino)-2-(4-hydroxycyclohexyl)acetate (4.7 g) in DCM (45 mL) was added dropwise a 15% solution of DMP in DCM (51 mL, 1.5 eq). The mixture was stirred ON at RT, diluted with DCM and washed with a sat. solution of NaHCO.sub.3 and water. The organic phase was dried over MgSO.sub.4 and concentrated in vacuo. The crude was purified by CC (Hept/EtOAc 1/1) to give 4.6 g of the title compound as colorless oil.
(425) LC-MS (B): t.sub.R=0.64 min; [M+H]+: 286.03
B.3.c. (S)-methyl 2-((tert-butoxycarbonyl)amino)-2-(4,4-difluorocyclohexyl)acetate
(426) To a solution of (S)-methyl 2-((tert-butoxycarbonyl)amino)-2-(4-oxocyclohexyl)acetate (4.6 g) in DCM (45 mL) was slowly added at 0 C. a 50% solution of bis(2-methoxyethyl)aminosulfur trifluoride in THF (26 mL). The mixture was stirred for 30 min at 0 C. and ON at RT and quenched at 0 C. with a sat. solution of NaHCO.sub.3. It was extracted with DCM and washed with water. The organic phase was dried over MgSO.sub.4 and concentrated in vacuo. The crude was purified by CC (Hept/EtOAc 2/1) to give 4.0 g of the title compound as light yellow oil.
(427) LC-MS (B): t.sub.R=0.81 min; [M+H]+: 308.08
B.3.d. (S)-tert-butyl (1-(4,4-difluorocyclohexyl)-2-hydroxyethyl)carbamate
(428) To a solution of (S)-methyl 2-((tert-butoxycarbonyl)amino)-2-(4,4-difluorocyclohexyl) acetate (4.1 g) in EtOH (54 mL) was slowly added at 0 C. CaCl.sub.2 (27 mg), THF (18 mL) and NaBH.sub.4 (2 g). The mixture was stirred for 3 h at 0 C. and quenched with a citric acid solution. It was extracted with DCM and washed with water. The organic phase was dried over MgSO.sub.4 and concentrated in vacuo. The crude was purified by CC (Hept/EtOAc 1/1) to give 1.8 g of the title compound as white solid.
(429) LC-MS (B): t.sub.R=0.69 min; [M+H]+: 280.01
B.3.e. (S)-2-amino-2-(4,4-difluorocyclohexyl)ethanol hydrochloride
(430) To a solution of (S)-tert-butyl (1-(4,4-difluorocyclohexyl)-2-hydroxyethyl)carbamate (1.8 g) in EtOAc (25 mL) was added a 4M solution of HCl in dioxane (6.5 mL). The mixture was stirred for 24 h at RT, concentrated in vacuo and dried at HV to give the title compound as white solid.
(431) LC-MS (B): t.sub.R=0.31 min; [M+H]+: 180.18
B.4. Synthesis of 2-amino-2-cycloheptylethanol
(432) B.4.a. 2-Amino-2-cycloheptylacetic acid tert-butyl ester
(433) To a solution of N-(diphenylmethylene)glycerine tert-butyl ester (6.83 mmol) and (R)-4,4-dibutyl-2,6-bis(3,4,5-trifluorophenyl)-4,5-dihydro-3H-dinaphthol[7,6,1,2-cde]azepinium bromide (6.84 mol) in 45 mL toluene were sequentially added cycloheptyl bromide (8.2 mmol) and CsOH H.sub.2O (34.2 mmol) at 10 C. The reaction mixture was stirred at 10 C. for 10 min and then at RT for 4 days. Another portion of (R)-4,4-dibutyl-2,6-bis(3,4,5-trifluorophenyl)-4,5-dihydro-3H-dinaphthol[7,6,1,2-cde]azepinium bromide (6.84 mol) was added and stirring was continued at RT for another 24 h. The reaction was quenched with water and extracted 3 times with DCM. The combined organic layers were combined, concentrated and the residue was redissolved in 100 mL THF. A solution of 100 mL aq. 0.5M citric acid solution was added and the mixture was stirred at RT for 4 h. The mixture was concentrated to half of its volume and extracted twice with Et.sub.2O. The aqueous layer was basified with solid NaHCO.sub.3 and extracted 3 times with DCM. The combined organic layers were dried over MgSO.sub.4 and concentrated in vacuo to obtain the desired product as yellow oil.
(434) LC-MS (B): t.sub.R=0.61 min; [M+H]+: 228.29
B.4.b. 2-Amino-2-cycloheptylethanol
(435) To a solution of 3.43 mL LiAlH.sub.4 (1M in THF) in 8 mL THF was added a solution of 2-amino-2-cycloheptylacetic acid tert-butyl ester (1.72 mmol) in 3 mL THF at 0 C. The ice bath was removed and stirring was continued at RT for 1 h. The reaction mixture was cooled to 0 C., quenched with water and a 1M NaOH solution, filtered over a pad of celite and washed with EtOAc. The filtrate was basified with a 1M NaOH solution to pH 8-9 and extracted 3 times with EtOAc. The combined organic layers were dried over MgSO4 and concentrated in vacuo to obtain the crude product as yellow oil. The crude was dissolved in 3 mL Et.sub.2O and a solution of 4M HCl in dioxane was dropwise added at 0 C. The resulting precipitate was separated by filtration and dried in vacuo to give the corresponding HCl salt as yellow solid.
(436) LC-MS (B): t.sub.R=0.39 min; [M+H]+: 158.14
B.5. Synthesis of (1-(hetero)aryl)cycloalkyl)methanamine
B.5.a. Synthesis of 2-(hetero)arylcyanoacetate
(437) These compounds were synthesized according to J. Org. Chem., 2008, 73 (4), 1643-1645.
B.5.a.1. Methyl 2-cyano-2-(2-(trifluoromethyl)pyrimidin-5-yl)acetate
(438) To a suspension of KO.sup.tBu (618 mg) in dioxane (10 mL) were added methylcyanoacetate (0.194 mL), 5-bromo-2-(trifluoromethyl)pyrimidine (500 mg) followed by a solution of Pd(OAc).sub.2 (30 mg) and dppf (98 mg) in dioxane (2 mL). The mixture was flushed with argon and the vial sealed and heated ON at 90 C. It was quenched with a 2M aq. solution of AcOH and extracted with EtOAc. The organic phase was washed with brine, dried over MgSO.sub.4 and concentrated in vacuo. The crude was purified by CC (KP-Sil from Biotage) using EtOAc/MeOH from 1/0 to 8/2 to give the title compound as brown oil (303 mg).
(439) .sup.1H NMR (CDCl.sub.3) : 9.04 (s, 2 H), 4.90 (s, 1 H), 3.92 (s, 3 H)
B.5.a.2. Methyl 2-cyano-2-(6-(trifluoromethyl)pyridin-3-yl)acetate
(440) This compound was prepared using a method analogous to that of methyl 2-cyano-2-(2-(trifluoromethyl)pyrimidin-5-yl)acetate, 5-bromo-2(trifluoromethyl)pyridine replacing 5-bromo-2-(trifluoromethyl)pyrimidine except that the mixture was heated for 1 h at 70 C.
(441) LC-MS (B): t.sub.R=0.66 min; [M+H]+: 245.13
(442) .sup.1H NMR (CDCl.sub.3) : 8.81 (d, J=2.1 Hz, 1 H), 8.05 (m, 1 H), 7.79 (dd, J.sub.1=8.2 Hz, J.sub.2=0.6 Hz, 1 H), 4.88 (s, 1 H), 3.87 (s, 3 H)
B.5.b. Synthesis of 2-(hetero)arylacetonitrile
B.5.b.1. 2-(2-(Trifluoromethyl)pyrimidin-5-yl)acetonitrile
(443) To a solution of methyl 2-cyano-2-(2-(trifluoromethyl)pyrimidin-5-yl)acetate (330 mg) in DMSO/water 9/1 (1.5 mL) was added LiCl (231 mg). The mixture was heated to 140 C. for 30 min under microwave conditions, poured onto water and extracted 2 times with EtOAc. The combined organic phases were dried over MgSO.sub.4 and concentrated in vacuo. The crude was purified by CC (KP-NH from Biotage) using DCM/MeOH from 99/1 to 95/5 to give the title compound as yellow solid (96 mg).
(444) LC-MS (B): t.sub.R=0.51 min
(445) .sup.1H NMR (CDCl.sub.3) : 8.94 (s, 2 H), 3.89 (s, 2 H)
B.5.b.2. 2-(6-(Trifluoromethyl)pyridin-3-yl)acetonitrile
(446) This compound was prepared using a method analogous to that of 2-(2-(trifluoromethyl)pyrimidin-5-yl)acetonitrile, methyl 2-cyano-2-(6-(trifluoromethyl)pyridin-3-yl)acetate replacing methyl 2-cyano-2-(2-(trifluoromethyl)pyrimidin-5-yl)acetate except that the mixture was heated for 1 h at 70 C.
(447) LC-MS (B): t.sub.R=0.57 min; [M+CH.sub.3CN+H]+: 228.17
A.1.a.1 2-(2-Methypyrimidin-5-yl)acetonitrile
(448) This compound was synthesized according to J. Am. Chem. Soc., 2011, 133, 6948-6951.
(449) To a solution of 5-bromo-2-methylpyrimidine (5.78 mmol) and 4-isoxazoleboronic acid pinacol ester (6.07 mmol) in DMSO (40 mL) was added a solution of potassium fluoride (17.30 mmol) in water (17 mL). The mixture was flushed with argon, Pd(dppf)Cl.sub.2.DCM (0.58 mmol) was added and the mixture was heated for 48 h at 130 C. It was filtered over a pad of Celite and washed with EtOAc. The filtrate was partitioned between water and EtOAc and the aqueous phase was extracted twice with EtOAc. The combined organic phases were dried over MgSO.sub.4 and concentrated in vacuo. The crude was purified by CC using DCM/MeOH from 1/0 to 95/5 to give the title compound as brown oil.
(450) LC-MS (A): t.sub.R=0.43 min; [M+H]+: 134.10
B.5.c. Alkylation (general procedure III)
(451) To a solution of 2-(hetero)arylacetonitrile (0.51 mmol) and ,-dibromoalkane (0.51 mmol) in THF/DMSO 1/1 (6 mL) was added portionwise at 0 C. a 60% suspension of NaH in mineral oil (1.07 mmol). The mixture was allowed to warm to RT and stirred for 2 h. It was poured onto water and extracted with EtOAc. The combined organic phases were washed with brine, dried over MgSO.sub.4 and concentrated in vacuo. The crude was purified by CC (KP-NH from Biotage) using DCM/MeOH from 99/1 to 90/10 to give the desired 1-(hetero)arylcycloalkylcarbonitriles which are listed in the table below.
(452) TABLE-US-00003 LC-MS Name type tR (min) [M + H]+ 1-(2-(trifluoromethyl)pyrimidin-5-yl)cyclohexanecarbonitrile B 0.80 no ionisation 1-(6-chloropyridin-3-yl)cyclohexanecarbonitrile B 0.78 221.20 1-(6-(trifluoromethyl)pyridin-3-yl)cyclohexanecarbonitrile B 0.83 255.20 1-(4-(trifluoromethyl)phenyl)cyclohexanecarbonitrile B 0.95 no ionisation 1-(pyridin-3-yl)cyclohexanecarbonitrile B 0.44 187.29 1-(pyridin-3-yl)cyclopentanecarbonitrile B 0.35 173.07 1-(pyridin-3-yl)cycloheptanecarbonitrile B 0.50 201.20 1-(2-methylpyrimidin-5-yl)cyclohexanecarbonitrile A 0.73 202.08
B.5.d. Hydrogenation of nitrile (general procedure IV)
(453) To a solution of the 1-(hetero)arylcycloalkylcarbonitrile (0.47 mmol) from the previous step in a 7M solution of NH.sub.3 in MeOH (0.57 mL) was added Actimet M Raney nickel. The mixture was stirred under a hydrogen atmosphere for 2 h. It was filtered over Celite, washed with MeOH and concentrated in vacuo to give the desired (1-(hetero)arylcycloalkyl)methanamines which are listed in the table below
(454) TABLE-US-00004 LC-MS tR Name type (min) [M + H]+ (1-(2-(trifluoromethyl)pyrimidin-5- B 0.51 [M + CH.sub.3CN + H]+: yl)cyclohexyl)methanamine 301.09 (1-(6-chloropyridin-3-yl)cyclohexyl)methanamine B 0.47 225.27 (1-(6-(trifluoromethyl)pyridin-3- B 0.53 259.22 yl)cyclohexyl)methanamine (1-(4-(trifluoromethyl)phenyl)cyclohexyl)methanamine B 0.65 257.96 (1-(pyridin-3-yl)cyclohexyl)methanamine B 0.26 191.31 (1-(pyridin-3-yl)cyclopentyl)methanamine B 0.20 177.32 (1-(pyridin-3-yl)cycloheptyl)methanamine B 0.32 205.28 (1-(2-methylpyrimidin-5-yl)cyclohexyl)methanamine A 0.45 206.13
B.5.e. Synthesis of (4,4-difluoro-1-(6-chloropyridin-3-yl)cyclohexyl)methanamine
B.5.e.1. Methyl 5-(6-chloropyridin-3-yl)-5-cyano-2-hydroxycyclohex-1-enecarboxylate
(455) To a solution of 2-(6-chloro-3-pyridinyl)acetonitrile (13.1 mmol) in 35 mL THF were added methylacrylate (26.2 mmol) and KOtBu (15.7 mmol). The reaction mixture was stirred at RT for 1 h. The mixture was acidifed with 1N HCl solution and then extracted with DCM. The combined organic layers were washed with brine, dried over MgSO4 and concentrated in vacuo. Purification with CC (KP-SIL from Biotage) using Hept/EtOAc (90/10 to 50/50) gives the desired compound as white solid.
(456) LC-MS (B): t.sub.R=0.74 min; [M+CH.sub.3CN+H]+: 334.03
B.5.e.2. 1-(6-Chloropyridin-3-yl)-4-oxocyclohexanecarbonitrile
(457) A mixture of methyl 5-(6-chloropyridin-3-yl)-5-cyano-2-hydroxycyclohex-1-enecarboxylate (10.6 mmol) and LiCl (21.1 mmol) in 15 mL wet DMSO was heated to 120 C. under microwave conditions for 2 h. The reaction mixture was diluted with water and extracted with EtOAc. The combined organic layers were washed with brine, dried over MgSO4 and concentrated in vacuo. Purification with CC (KP-SIL from Biotage) using Hept/EtOAc (95/5 to 20/80) gives the desired compound as yellow solid.
(458) LC-MS (B): t.sub.R=0.56 min; [M+CH.sub.3CN+H]+: 276.12
B.5.e.3. 1-(6-Chloropyridin-3-yl)-4,4-difluorocyclohexanecarbonitrile
(459) A solution of 1-(6-chloropyridin-3-yl)-4-oxocyclohexanecarbonitrile (3.89 mmol) in 4 mL DCM was cooled to 78 C., (diethylamino)sulfur trifluoride (7.78 mmol) was dropwise added and the mixture was stirred for 24 h allowing to reach slowly RT. The reaction mixture was quenched with sat. aq. NaHCO.sub.3 solution under ice cooling and diluted with DCM. The organic phase was washed with brine, dried over MgSO4 and concentrated in vacuo. Purification with CC (KP-SIL from Biotage) using Hept/EtOAc (90/10 to 50/50) gives the desired compound as beige solid.
(460) LC-MS (B): t.sub.R=0.74 min; [M+CH.sub.3CN+H]+: 298.00
B.5.e.4. (4,4-Difluoro-1-(6-chloropyridin-3-yl)cyclohexyl)methanamine
(461) A solution of 1-(6-chloropyridin-3-yl)-4,4-difluorocyclohexanecarbonitrile (2.02 mmol) in 20 mL THF was added to a solution of BH.sub.3 in THF (6.07 mmol, 1M). After heating to reflux for 1 h, the reaction mixture was cooled in an ice bath before a 2N HCl solution was slowly added. The mixture was then heated to reflux for another 20 min. The reaction mixture was washed with DCM, basified with 1N NaOH solution and extracted 3 times with DCM. The combined organic layers were washed with brine, dried over MgSO4 and concentrated in vacuo to give the desired product as yellow oil.
(462) LC-MS (B): t.sub.R=0.46 min; [M+CH.sub.3CN+H]+: 302.03
B.5.f Synthesis of (1-(4-chlorophenyl)cyclohexyl)methanamine
(463) To a 1M solution of BH.sub.3.THF complex (6.8 mL) was added a solution of 1-(4-chlorophenyl)-1-cyclohexanecarbonitrile (500 mg) in anh. THF (23 mL). The mixture was refluxed for 1 h, acidified at RT with a 2M solution of HCl (14 mL) and refluxed for 20 min. It was washed with DCM, basified with 1M NaOH and extracted 3 times with DCM. The combined organic phases were dried and concentrated in vacuo to give the title compound as yellow oil (275 mg).
(464) LC-MS (B): t.sub.R=0.61 min; [M+H]+: 224.24
B.5.g. Synthesis of (4,4-difluoro-1-(2-methylpyrimidin-5-yl)cyclohexyl)methanamine
B.5.g.1. Methyl 5-cyano-2-hydroxy-5-(2-methylpyrimidin-5-yl)cyclohex-1-enecarboxylate
(465) This compound was prepared using a method analogous to that of methyl 5-(6-chloropyridin-3-yl)-5-cyano-2-hydroxycyclohex-1-enecarboxylate, 2-(2-methylpyrimidin-5-yl)acetonitrile replacing 2-(6-chloro-3-pyridinyl)acetonitrile.
(466) LC-MS (A): t.sub.R=0.73 min; [M+H]+: 273.93
B.5.g.2. 1-(2-Methylpyrimidin-5-yl)-4-oxocyclohexanecarbonitrile
(467) This compound was prepared using a method analogous to that of 1-(6-chloropyridin-3-yl)-4-oxocyclohexanecarbonitrile, methyl 5-cyano-2-hydroxy-5-(2-methylpyrimidin-5-yl)cyclohex-1-enecarboxylate replacing methyl 5-(6-chloropyridin-3-yl)-5-cyano-2-hydroxycyclohex-1-enecarboxylate.
(468) LC-MS (A): t.sub.R=0.53 min; [M+H]+: 216.16
B.5.g.3. 4,4-Difluoro-1-(2-methylpyrimidin-5-yl)cyclohexanecarbonitrile
(469) This compound was prepared using a method analogous to that of 1-(6-chloropyridin-3-yl)-4,4-difluorocyclohexanecarbonitrile, 1-(2-methylpyrimidin-5-yl)-4-oxocyclohexane-carbonitrile replacing 1-(6-chloropyridin-3-yl)-4-oxocyclohexanecarbonitrile.
(470) LC-MS (A): t.sub.R=0.71 min; [M+H]+: 238.11
B.5.g.4. (4,4-Difluoro-1-(2-methylpyrimidin-5-yl)cyclohexyl)methanamine
(471) This compound was prepared according the general procedure IV (hydrogenation of nitriles) engaging 4,4-difluoro-1-(2-methylpyrimidin-5-yl)cyclohexanecarbonitrile.
(472) LC-MS (A): t.sub.R=0.45 min; [M+CH.sub.3CN+H]+: 283.14
B.6. Synthesis of (1-aminomethyl)cyclopentanol
(473) This compound was synthesized according to WO2012/114268.
B.7. Synthesis of (1-aminomethyl)cyclooctanol
(474) This compound was synthesized according to WO2012/114268.
B.8. Synthesis of (1-methoxycyclohexyl)methanamine
(475) This compound was synthesized according to WO2012/114268.
PREPARATION OF EXAMPLES
A. Synthesis of compounds of formula I (general procedure V)
(476) To a solution of the respective carboxylic acid precursor (II) (0.23 mmol) in a mixture of DCM/DMF (0.4 mL) were consecutively added DIPEA (0.69 mmol), HOBt (0.28 mmol) and EDC.HCl (0.28 mmol) followed by a solution of the respective amine precursor (III) (0.25 mmol) in DCM (0.1 mL). The mixture was stirred ON at RT, diluted with DCM and washed twice with a 5% solution of KHSO.sub.4 (for non basic product), with a sat. solution of NaHCO.sub.3 and with brine. The organic phase was dried over MgSO.sub.4 and concentrated in vacuo. The crude was purified using conditions which are detailed in the table below. All compounds in the following table were synthesized according to the aforementioned general procedure except compounds which are marked with see below under section B; such compounds were synthesized according to the specific procedures given in section B. Post amide coupling steps below.
(477) TABLE-US-00005 LC-MS Purification tR Compound Name method type (min) [M + H]+ Example 1 4-Chloro-1H-indole-5-carboxylic a B 0.69 321.11 acid ((S)-1-cyclohexyl-2- hydroxy-ethyl)-amide Example 2 4-Chloro-1H-indole-5-carboxylic precipitate B 0.62 307.14 acid (1-hydroxy- from DCM cyclohexylmethyl)-amide Example 3 4-Chloro-1H-indole-5-carboxylic a B 0.68 321.00 acid (1-hydroxy- cycloheptylmethyl)-amide Example 4 4-Chloro-1H-indole-5-carboxylic b B 0.62 343.11 acid (4,4-difluoro-1-hydroxy- cyclohexylmethyl)-amide Example 5 4-Chloro-1H-indole-5-carboxylic a B 0.63 357.11 acid [(S)-1-(4,4-difluoro- cyclohexyl)-2-hydroxy-ethyl]- amide Example 6 4-Chloro-1-methyl-1H-indole-5- a B 0.68 321.10 carboxylic acid (1-hydroxy- cyclohexylmethyl)-amide Example 7 4-Chloro-1-methyl-1H-indole-5- a B 0.74 335.04 carboxylic acid ((S)-1- cyclohexyl-2-hydroxy-ethyl)- amide Example 8 4-Chloro-3-formyl-1H-indole-5- I B 0.59 349.19 carboxylic acid ((S)-1- cyclohexyl-2-hydroxy-ethyl)- amide Example 9 4-Chloro-3-formyl-1H-indole-5- I B 0.53 335.12 carboxylic acid (1-hydroxy- cyclohexylmethyl)-amide Example 10 rac-4-Chloro-1H-indole-5- c B 0.74 335.19 carboxylic acid (1-cycloheptyl-2- hydroxy-ethyl)-amide Example 11 4-Chloro-1H-indole-5-carboxylic d + II C 0.90 436.90 acid [1-(2-trifluoromethyl- pyrimidin-5-yl)- cyclohexylmethyl]-amide Example 12 4-Chloro-1H-indole-5-carboxylic d + precipitate C 0.89 401.65 acid [1-(6-chloro-pyridin-3-yl)- from MeCN cyclohexylmethyl]-amide Example 13 4-Chloro-1H-indole-5-carboxylic d + II B 0.87 436.29 acid [1-(6-trifluoromethyl-pyridin- 3-yl)-cyclohexylmethyl]-amide Example 14 4-Chloro-1H-indole-5-carboxylic II B 0.78 437.86 acid [1-(6-chloro-pyridin-3-yl)- 4,4-difluoro-cyclohexylmethyl]- amide Example 15 4-Chloro-1H-indole-5-carboxylic III B 0.97 400.91 acid [1-(4-chloro-phenyl)- cyclohexylmethyl]-amide Example 16 4-Chloro-1H-indole-5-carboxylic III B 0.97 434.86 acid [1-(4-trifluoromethyl- phenyl)-cyclohexylmethyl]-amide Example 17 4-Chloro-1H-indole-5-carboxylic IV B 0.54 367.99 acid (1-pyridin-3-yl- cyclohexylmethyl)-amide Example 18 4-Chloro-1H-indole-5-carboxylic VI B 0.51 353.77 acid (1-pyridin-3-yl- cyclopentylmethyl)-amide Example 19 4-Chloro-1H-indole-5-carboxylic e B 0.58 381.98 acid (1-pyridin-3-yl- cycloheptylmethyl)-amide Example 20 4-Chloro-7-methyl-1H-indole-5- a + VII A 0.76 321.18 carboxylic acid (1-hydroxy- cyclohexylmethyl)-amide Example 21 4-Chloro-2-oxo-2,3-dihydro-1H- see below under section B indole-5-carboxylic acid (1- hydroxy-cycloheptylmethyl)- amide Example 22 4-Chloro-2-methyl-1H-indole-5- a A 0.76 321.25 carboxylic acid (1-hydroxy- cyclohexylmethyl)-amide Example 23 4-Chloro-7-iodo-3- VII A 0.84 478.78 methylsulfanyl-1H-indole-5- carboxylic acid (1-hydroxy- cyclohexylmethyl)-amide Example 24 4-Chloro-7-methyl-1H-indole-5- a + VII A 0.76 357.10 carboxylic acid (4,4-difluoro-1- hydroxy-cyclohexylmethyl)- amide Example 25 4-Chloro-7-methyl-1H-indole-5- precipitate A 0.80 335.04 carboxylic acid (1-hydroxy- from MeCN cycloheptylmethyl)-amide Example 26 4-Chloro-3-fluoro-1H-indole-5- VII + c A 0.78 338.99 carboxylic acid (1-hydroxy- cycloheptylmethyl)-amide Example 27 4-Methoxy-1H-indole-5- a A 0.76 317.29 carboxylic acid (1-hydroxy- cycloheptylmethyl)-amide Example 28 3,4-Dichloro-1H-indole-5- e A 0.77 340.90 carboxylic acid (1-hydroxy- cyclohexylmethyl)-amide Example 29 4-Chloro-7-nitro-1H-indole-5- VI A 0.77 351.91 carboxylic acid (1-hydroxy- cyclohexylmethyl)-amide Example 30 1-{[(4-Chloro-1H-indole-5- a A 0.85 348.94 carbonyl)-amino]-methyl}- cyclohexanecarboxylic acid methyl ester Example 31 4-Chloro-1H-indole-5-carboxylic see below under section B acid (1-hydroxymethyl- cyclohexylmethyl)-amide Example 32 7-Amino-4-chloro-1H-indole-5- see below under section B carboxylic acid (1-hydroxy- cyclohexylmethyl)-amide Example 33 4-Chloro-3-methyl-1H-indole-5- c A 0.80 335.15 carboxylic acid (1-hydroxy- cycloheptylmethyl)-amide Example 34 4-Chloro-1H-indole-5-carboxylic see below under section B acid (1-carbamoyl- cyclohexylmethyl)-amide Example 35 4-Chloro-1H-indole-5-carboxylic see below under section B acid (1-methylcarbamoyl- cyclohexylmethyl)-amide Example 36 4-Chloro-1H-indole-5-carboxylic see below under section B acid (1-cyano- cyclohexylmethyl)-amide Example 37 (1-{[(4-Chloro-1H-indole-5- precipitate A 0.90 406.08 carbonyl)-amino]-methyl}- from MeCN cyclohexyl)-carbamic acid tert- butyl ester Example 38 4,6-Dichloro-1H-indole-5- VI + c A 0.76 376.92 carboxylic acid (4,4-difluoro-1- hydroxy-cyclohexylmethyl)- amide Example 39 4-Chloro-1H-indole-5-carboxylic see below under section B acid (1-amino- cyclohexylmethyl)-amide hydrochloride Example 40 4-Chloro-6-methyl-1H-indole-5- e + c + VI A 0.74 321.16 carboxylic acid (1-hydroxy- cyclohexylmethyl)-amide Example 41 4-Chloro-1H-indole-5-carboxylic 5 E 0.78 292.99 acid (1-hydroxy- cyclopentylmethyl)-amide Example 42 4-Chloro-1H-indole-5-carboxylic 2 E 1.06 335.04 acid (1-hydroxy- cyclooctylmethyl)-amide Example 43 4-Chloro-1H-indole-5-carboxylic 2 E 1.12 321.02 acid (1-methoxy- cyclohexylmethyl)-amide Example 44 4-Chloro-1H-indole-5-carboxylic 3 E 1.28 305.02 acid ((S)-1-cyclohexyl-ethyl)- amide Example 45 4-Chloro-1H-indole-5-carboxylic 3 E 1.28 305.01 acid ((R)-1-cyclohexyl-ethyl)- amide Example 46 4-Chloro-1H-indole-5-carboxylic see below under section B acid (1-acetylamino- cyclohexylmethyl)-amide Example 47 4-Chloro-1H-indole-5-carboxylic see below under section B acid (1-methanesulfonylamino- cyclohexylmethyl)-amide Example 48 4-Chloro-1H-indole-5-carboxylic see below under section B acid (1-dimethylamino- cyclohexylmethyl)-amide Example 49 4-Chloro-1H-indole-5-carboxylic see below under section B acid (1-benzylamino- cyclohexylmethyl)-amide Example 50 3-Bromo-4-chloro-7-methyl-1H- VII A 0.83 398.78 indole-5-carboxylic acid (1- hydroxy-cyclohexylmethyl)- amide Example 51 (1-{[(4-Chloro-1H-indole-5- see below under section B carbonyl)-amino]-methyl}- cyclohexylsulfamoyl)-acetic acid methyl ester Example 52 4-Chloro-7-isobutyl-1H-indol-5- II A 0.90 376.94 carboxylic acid (1-hydroxy- cycloheptylmethyl)-amide Example 53 4-Chloro-7-(3-methoxy-propyl)- b A 0.83 393.05 1H-indole-5-carboxylic acid (1- hydroxy-cycloheptylmethyl)- amide Example 54 4-Chloro-7-isobutyl-1H-indole-5- b A 0.87 398.97 carboxylic acid (4,4-difluoro-1- hydroxy-cyclohexylmethyl)- amide Example 55 4-Chloro-7-(3-methoxy-propyl)- b A 0.80 415.03 1H-indole-5-carboxylic acid (4,4- difluoro-1-hydroxy- cyclohexylmethyl)-amide Example 56 4-Chloro-1H-indole-5-carboxylic see below under section B acid [1-(2-hydroxy- ethanesulfonylamino)- cyclohexylmethyl]-amide Example 57 4-Methyl-1H-indole-5-carboxylic d A 0.70 287.18 acid (1-hydroxy- cyclohexylmethyl)-amide Example 58 4-Chloro-1H-indole-5-carboxylic precipitate A 0.76 382.98 acid [1-(2-methyl-pyrimidin-5-yl)- from MeCN cyclohexylmethyl]-amide Example 59 4-Chloro-7-methoxy-1H-indole- b A 0.76 372.88 5-carboxylic acid (4,4-difluoro-1- hydroxy-cyclohexylmethyl)- amide Example 60 4-Chloro-1H-indole-5-carboxylic b + e A 0.76 418.89 acid [4,4-difluoro-1-(2-methyl- pyrimidin-5-yl)- cyclohexylmethyl]-amide Example 61 4-Chloro-7-methyl-1H-indole-5- c A 0.79 432.90 carboxylic acid [4,4-difluoro-1- (2-methyl-pyrimidin-5-yl)- cyclohexylmethyl]-amide Example 62 4-Chloro-7-methyl-1H-indole-5- b A 0.79 397.01 carboxylic acid [1-(2-methyl- pyrimidin-5-yl)- cyclohexylmethyl]-amide Example 63 4,7-Dimethyl-1H-indole-5- b A 0.75 336.98 carboxylic acid (4,4-difluoro-1- hydroxy-cyclohexylmethyl)- amide Example 64 4-Methyl-1H-indole-5-carboxylic b + a A 0.72 322.95 acid (4,4-difluoro-1-hydroxy- cyclohexylmethyl)-amide Example 65 4-Ethyl-1H-indole-5-carboxylic d A 0.76 337.08 acid (4,4-difluoro-1-hydroxy- cyclohexylmethyl)-amide Example 66 7-Acetyl-4-chloro-1H-indole-5- b A 0.77 384.97 carboxylic acid (4,4-difluoro-1- hydroxy-cyclohexylmethyl)- amide Example 67 rac-4-Chloro-7-(1-hydroxy- see below under section B ethyl)-1H-indole-5-carboxylic acid (4,4-difluoro-1-hydroxy- cyclohexylmethyl)-amide Example 68 4-Chloro-7-(1-hydroxy-1-methyl- see below under section B ethyl)-1H-indole-5-carboxylic acid (4,4-difluoro-1-hydroxy- cyclohexylmethyl)-amide Example 69 7-Methyl-4-trifluoromethyl-1H- b A 0.79 354.96 indole-5-carboxylic acid (1- hydroxy-cyclohexylmethyl)- amide Example 70 7-Methyl-4-trifluoromethyl-1H- b A 0.80 391.02 indole-5-carboxylic acid (4,4- difluoro-1-hydroxy- cyclohexylmethyl)-amide Example 71 4,7-Dimethyl-1H-indole-5- b A 0.74 301.13 carboxylic acid (1-hydroxy- cyclohexylmethyl)-amide Example 72 4-Chloro-7-ethyl-1H-indole-5- b A 0.80 335.02 carboxylic acid (1-hydroxy- cyclohexylmethyl)-amide Example 73 4-Chloro-7-ethyl-1H-indole-5- b A 0.80 370.94 carboxylic acid (4,4-difluoro-1- hydroxy-cyclohexylmethyl)- amide Example 74 7-Chloro-4-methyl-1H-indole-5- b A 0.77 321.04 carboxylic acid (1-hydroxy- cyclohexylmethyl)-amide Example 75 7-Chloro-4-methyl-1H-indole-5- b A 0.78 356.95 carboxylic acid (4,4-difluoro-1- hydroxy-cyclohexylmethyl)- amide Example 76 4-Chloro-7-methoxy-1H-indole- b A 0.76 336.98 5-carboxylic acid (1-hydroxy- cyclohexylmethyl)-amide Example 77 7-Methoxy-4-methyl-1H-indole- b e A 0.74 353.14 5-carboxylic acid (4,4-difluoro-1- hydroxy-cyclohexylmethyl)- amide Example 78 7-Methoxy-4-methyl-1H-indole- b e A 0.73 317.09 5-carboxylic acid (1-hydroxy- cyclohexylmethyl)-amide Example 79 4-Chloro-7-ethoxy-1H-indole-5- b A 0.80 350.92 carboxylic acid (1-hydroxy- cyclohexylmethyl)-amide Example 80 4-Chloro-7-hydroxy-1H-indole-5- VIII A 0.71 359.03 carboxylic acid (4,4-difluoro-1- hydroxy-cyclohexylmethyl)- amide Example 81 4-Chloro-7-ethoxy-1H-indole-5- precipitate A 0.80 387.27 carboxylic acid (4,4-difluoro-1- from DCM hydroxy-cyclohexylmethyl)- amide Example 82 4-Chloro-7-propyl-1H-indole-5- b A 0.84 349.21 carboxylic acid (1-hydroxy- cyclohexylmethyl)-amide Example 83 4-Chloro-7-propyl-1H-indole-5- b A 0.84 385.19 carboxylic acid (4,4-difluoro-1- hydroxy-cyclohexylmethyl)- amide Example 84 7-(2-tert-Butoxy-ethoxy)-4- b A 0.86 423.07 chloro-1H-indole-5-carboxylic acid (1-hydroxy- cyclohexylmethyl)-amide Example 85 7-(2-tert-Butoxy-ethoxy)-4- VII A 0.86 459.03 chloro-1H-indole-5-carboxylic acid (4,4-difluoro-1-hydroxy- cyclohexylmethyl)-amide Example 86 4-Chloro-7-(2-hydroxy-ethoxy)- see below under section B 1H-indole-5-carboxylic acid (1- hydroxy-cyclohexylmethyl)- amide Example 87 4-Chloro-7-(2-hydroxy-ethoxy)- see below under section B 1H-indole-5-carboxylic acid (4,4- difluoro-1-hydroxy- cyclohexylmethyl)-amide Example 88 7-Acetyl-4-chloro-1H-indole-5- d A 0.76 349.20 carboxylic acid (1-hydroxy- cyclohexylmethyl)-amide Example 89 4-Chloro-7-(1-hydroxy-1-methyl- see below under section B ethyl)-1H-indole-5-carboxylic acid (1-hydroxy- cyclohexylmethyl)-amide Example 90 4,7-Difluoro-1H-indole-5- b A 0.76 309.21 carboxylic acid (1-hydroxy- cyclohexylmethyl)-amide Example 91 4,7-Difluoro-1H-indole-5- b A 0.77 345.23 carboxylic acid (4,4-difluoro-1- hydroxy-cyclohexylmethyl)- amide Example 92 4-Fluoro-7-methoxy-1H-indole- b A 0.76 321.09 5-carboxylic acid (1-hydroxy- cyclohexylmethyl)-amide Example 93 4-Fluoro-7-methoxy-1H-indole- b A 0.77 357.04 5-carboxylic acid (4,4-difluoro-1- hydroxy-cyclohexylmethyl)- amide Example 94 4-Chloro-7-(2-ethoxy-ethyl)-1H- g A 0.81 415.23 indole-5-carboxylic acid (4,4- difluoro-1-hydroxy- cyclohexylmethyl)-amide Example 95 4-Chloro-7-(1-methoxy-1- d A 0.82 415.21 methyl-ethyl)-1H-indole-5- carboxylic acid (4,4-difluoro-1- hydroxy-cyclohexylmethyl)- amide
B. Post Amide Coupling Steps
Example 21
4-Chloro-2-hydroxy-1H-indole-5-carboxylic acid (1-hydroxy-cycloheptylmethyl)-amide
21.1 3,3-Dibromo-4-chloro-N-((1-hydroxycycloheptyl)methyl)-2-oxoindoline-5-carboxamide
(478) To a suspension of 4-chloro-1H-indole-5-carboxylic acid (1-hydroxy-cycloheptylmethyl)-amide (Example 3) (0.143 mmol) in tert-butanol (0.3 mL) was added pyridinium tribromide (0.456 mmol). The mixture was stirred for 30 min at RT, concentrated in vacuo and partitioned between EtOAc and water. The organic phase was dried over MgSO.sub.4 and concentrated in vacuo. The crude was precipitated from CH.sub.3CN/DMF and the solid washed with EtOH to give the title compound as yellowish solid.
(479) LC-MS (A): t.sub.R=0.78 min; [M+H]+: 494.94
21.2 4-Chloro-2-hydroxy-1H-indole-5-carboxylic acid (1-hydroxy-cycloheptylmethyl)-amide
(480) To a suspension of 3,3-dibromo-4-chloro-N4(1-hydroxycycloheptyl)methyl)-2-oxoindoline-5-carboxamide (intermediate 21.1) (0.036 mmol) in AcOH (0.33 mL) was added portionwise zinc dust (0.364 mmol). The mixture was stirred for 15 min at RT, filtered over a pad of celite and the cake washed with EtOAc. The filtrate was concentrated in vacuo and the crude was purified by CC using EtOAc to give the title compound as white solid.
(481) LC-MS (A): t.sub.R=0.65 min; [M+H]+: 337.04
Example 31
4-Chloro-1H-indole-5-carboxylic acid (1-hydroxymethyl-cyclohexyl methyl)-amide
(482) To a suspension of lithium aluminum hydride (0.172 mmol of a 1M solution in THF) in THF (0.5 mL) was added dropwise at 0 C. a solution of 1-{[(4-chloro-1H-indole-5-carbonyl)-amino]-methyl}-cyclohexanecarboxylic acid methyl ester (Example 30) (0.086 mmol) in THF (0.2 mL). The mixture was stirred for 5 min at 0 C. and 1 h at RT, cooled to 0 C. and quenched by the consecutive addition of water (0.043 mL) and of a 1M aqueous solution of NaOH (0.043 mL). It was extracted 3 times with EtOAc and washed with brine. The organic phases were dried over MgSO.sub.4 and concentrated in vacuo. The crude was purified by CC using DCM/MeOH 95/5 to give the title compound as white solid.
(483) LC-MS (A): t.sub.R=0.79 min; [M+H]+: 321.17
Example 32
7-Amino-4-chloro-1H-indole-5-carboxylic acid (1-hydroxy-cyclohexyl methyl)-amide
(484) To a solution of 4-chloro-7-nitro-1H-indole-5-carboxylic acid (1-hydroxy-cyclohexylmethyl)-amide (Example 29) (0.043 mmol) in DMF (0.085 mL) was added tin (II) chloride dihydrate (0.128 mmol). The mixture was stirred ON at RT and quenched with water. It was basified with a 1M solution of NaOH and extracted with DCM. The organic phase was dried over MgSO.sub.4 and concentrated in vacuo. The crude was purified by preparative LC-MS using method IV to give the title compound as white solid.
(485) LC-MS (A): t.sub.R=0.64 min; [M+H]+: 321.90
Example 34
4-Chloro-1H-indole-5-carboxylic acid (1-carbamoyl-cyclohexylmethyl)-amide
34.1 1-{[(4-Chloro-1H-indole-5-carbonyl)-amino]-methyl}-cyclohexanecarboxylic acid
(486) This compound was prepared using a method analogous to that of 4-chloro-1H-indole-5-carboxylic acid, 1-{[(4-chloro-1H-indole-5-carbonyl)-amino]-methyl}-cyclohexane carboxylic acid methyl ester (Example 30) replacing methyl 4-chloro-1H-indole-5-carboxylate.
(487) LC-MS (A): t.sub.R=0.75 min; [M+H]+: 335.11
34.1 4-Chloro-1H-indole-5-carboxylic acid (1-carbamoyl-cyclohexylmethyl)-amide
(488) This compound was prepared according to the general procedure V for amide coupling engaging 1-{[(4-chloro-1H-indole-5-carbonyl)-amino]-methyl}-cyclohexanecarboxylic acid as carboxylic acid and ammonium hydroxide as amine.
(489) LC-MS (A): t.sub.R=0.68 min; [M+H]+: 334.20
Example 35
4-Chloro-1H-indole-5-carboxylic acid (1-methylcarbamoyl-cyclohexylmethyl)-amide
(490) This compound was prepared according to the general procedure V for amide coupling engaging 1-{[(4-chloro-1H-indole-5-carbonyl)-amino]-methyl}-cyclohexanecarboxylic acid as carboxylic acid and methylamine (as a 2M solution in THF) as amine.
(491) LC-MS (A): t.sub.R=0.71 min; [M+H]+: 348.16
Example 36
4-Chloro-1H-indole-5-carboxylic acid (1-cyano-cyclohexylmethyl)-amide
(492) To a solution of 4-chloro-1H-indole-5-carboxylic acid (1-carbamoyl-cyclohexylmethyl)-amide (Example 34) (0.090 mmol) in DCM (1 mL) was added under argon Burgess reagent (0.180 mmol). The mixture was stirred for 1 h 30 at RT and for 3 h at 50 C. and quenched with water. It was extracted 3 times with DCM and the combined organic phases were dried over MgSO.sub.4 and concentrated in vacuo. The crude was purified by CC using DCM/MeOH from 100/0 to 97/3 to give the title compound as white solid.
(493) LC-MS (A): t.sub.R=0.80 min; [M+H]+: 316.19
Example 39
4-Chloro-1H-indole-5-carboxylic acid (1-amino-cyclohexylmethyl)-amide hydrochloride
(494) To a solution of (1-{[(4-chloro-1H-indole-5-carbonyl)-amino]-methyl}-cyclohexyl)-carbamic acid tert-butyl ester (Example 37) (1.42 mmol) in EtOAc (10 mL) was added dropwise a 4M solution of HCl in dioxane (14.2 mmol). The mixture was stirred ON at RT and concentrated in vacuo. The residue was precipitated from Et.sub.2O/CH.sub.3CN to give the title compound as light pink solid.
(495) LC-MS (A): t.sub.R=0.58 min; [M+H]+: 306.00
Example 46
4-Chloro-1H-indole-5-carboxylic acid (1-acetylamino-cyclohexylmethyl)-amide
(496) To a suspension of 4-chloro-1H-indole-5-carboxylic acid (1-amino-cyclohexylmethyl)-amide hydrochloride (Example 39) (0.116 mmol) and Et.sub.3N (0.578 mmol) in DCM (1 mL) was added at 0 C. acetyl chloride (0.139 mmol). The mixture was stirred for 40 min at 0 C., quenched with a sat. solution of NaHCO.sub.3 and extracted 3 times with EtOAc. The combined organic phases were washed with brine, dried over MgSO.sub.4 and concentrated in vacuo. The crude was purified by CC (SNAP KP-SIL from Biotage) using Hept./EtOAc/MeOH from 100/0/0 to 20/76/4 to give the title compound as white solid.
(497) LC-MS (A): t.sub.R=0.73 min; [M+H]+: 348.08
Example 47
4-Chloro-1H-indole-5-carboxylic acid (1-methanesulfonylamino-cyclohexylmethyl)-amide
(498) To a suspension of 4-chloro-1H-indole-5-carboxylic acid (1-amino-cyclohexylmethyl)-amide hydrochloride (Example 39) (0.116 mmol) and Et.sub.3N (0.578 mmol) in DCM (1 mL) was added at 0 C. methanesulfonyl chloride (0.139 mmol). The mixture was stirred for 40 min at 0 C., quenched with a sat. solution of NaHCO.sub.3 and extracted 3 times with EtOAc. The combined organic phases were washed with brine, dried over MgSO.sub.4 and concentrated in vacuo. The crude was purified by CC (SNAP KP-SIL from Biotage) using Hept./EtOAc/MeOH from 100/0/0 to 20/76/4 to give the title compound as light beige solid.
(499) LC-MS (A): t.sub.R=0.75 min; [M+H]+: 383.93
Example 48
4-Chloro-1H-indole-5-carboxylic acid (1-dimethylamino-cyclohexylmethyl)-amide
(500) To a solution of 4-chloro-1H-indole-5-carboxylic acid (1-amino-cyclohexylmethyl)-amide hydrochloride (Example 39) (0.433 mmol) in DCM (4 mL) and MeOH (6 mL) was added AcOH (0.520 mmol) followed by a 37% aqueous solution of formaldehyde (0.477 mmol) and by sodium triacetoxyborohydride (0.607 mmol). The mixture was stirred for 2 h at RT and an additional amount of a 37% aqueous solution of formaldehyde (0.200 mmol) was added. It was stirred for 1 h at RT, quenched with a sat. solution of NaHCO.sub.3 and extracted 3 times with EtOAc. The combined organic phases were dried over MgSO.sub.4 and concentrated in vacuo. The crude was purified by CC (SNAP KP-NH from Biotage) using Hept./EtOAc/MeOH from 100/0/0 to 0/95/5 to give the title compound as white solid.
(501) LC-MS (A): t.sub.R=0.60 min; [M+H]+: 334.18
Example 49
4-Chloro-1H-indole-5-carboxylic acid (1-benzylamino-cyclohexylmethyl)-amide
(502) To a solution of 4-chloro-1H-indole-5-carboxylic acid (1-amino-cyclohexylmethyl)-amide hydrochloride (Example 39) (0.144 mmol) in DCM (1 mL) was added AcOH (0.159 mmol) followed by benzaldehyde (0.173 mmol) and by sodium triacetoxyborohydride (0.296 mmol). The mixture was stirred for 2 h at RT and ON at 60 C. Additional amounts of sodium triacetoxyborohydride (20.471 mmol) was added and the mixture stirred for 5 h at 60 C. and ON at RT. It was quenched with a sat. solution of NaHCO.sub.3 and extracted 3 times with EtOAc. The combined organic phases were dried over MgSO.sub.4 and concentrated in vacuo. The crude was purified by preparative LC-MS using method VI and additionally by CC (Isolute NH.sub.2 from Biotage) using EtOAc to give the title compound as white solid.
(503) LC-MS (A): t.sub.R=0.73 min; [M+H]+: 396.05
Example 51
(1-{[(4-Chloro-1H-indole-5-carbonyl)-amino]-methyl}-cyclohexylsulfamoyl)-acetic acid methyl ester
(504) This compound was prepared using a method analogous to that of Example 47, methyl chlorosulfonylacetate replacing methanesulfonyl chloride except that the mixture was stirred for 1.5 h at 0 C.
(505) LC-MS (A): t.sub.R=0.80 min; [M+H]+: 441.90
Example 56
4-Chloro-1H-indole-5-carboxylic acid [1-(2-hydroxy-ethanesulfonylamino)-cyclohexylmethyl]-amide
(506) This compound was prepared using a method analogous to that of Example 31, (1-{[(4-chloro-1H-indole-5-carbonyl)-amino]-methyl}-cyclohexylsulfamoyl)-acetic acid methyl ester (Example 51) replacing 1-{[(4-chloro-1H-indole-5-carbonyl)-amino]-methyl}-cyclohexanecarboxylic acid methyl ester (Example 30).
(507) LC-MS (A): t.sub.R=0.70 min; [M+H]+: 413.97
Example 67
rac-4-Chloro-7-(1-hydroxy-ethyl)-1H-indole-5-carboxylic acid (4,4-difluoro-1-hydroxy-cyclohexylmethyl)-amide
(508) To as suspension of 7-acetyl-4-chloro-1H-indole-5-carboxylic acid (4,4-difluoro-1-hydroxy-cyclohexylmethyl)-amide (example 66) (0.08 mmol) in MeOH (1 mL) was added sodium borohydride (0.18 mmol). The mixture was stirred for 5 h at RT, quenched with water and extracted three times with EtOAc. The organic phases were washed with brine, dried over MgSO.sub.4 and concentrated in vacuo. The crude was purified by CC (Isolute Silica II from Biotage) using DCM/MeOH from 95/5 to 93/7 to give the title compound as white solid.
(509) LC-MS (A): t.sub.R=0.71 min; [M+H]+: 387.23
Example 68
4-Chloro-7-(1-hydroxy-1-methyl-ethyl)-1H-indole-5-carboxylic acid (4,4-difluoro-1-hydroxy-cyclohexylmethyl)-amide
(510) To a solution of 7-acetyl-4-chloro-1H-indole-5-carboxylic acid (4,4-difluoro-1-hydroxy-cyclohexylmethyl)-amide (example 66) (0.08 mmol) in THF (1.5 mL) was added dropwise at 10 C. a 3M solution of methylmagnesium bromide in diethyl ether (0.15 mmol). The mixture was stirred for 5 h at RT and an additional amount of a 3M solution of methylmagnesium bromide in diethyl ether (0.60 mmol) was added at RT. The mixture was further stirred ON at RT and cooled to 0 C. It was quenched with a sat. solution of NH.sub.4Cl and extracted three times with EtOAc. The organic phases were washed with brine, dried over MgSO.sub.4 and concentrated in vacuo. The crude was purified by CC (Isolute Silica II from Biotage) using DCM/MeOH 95/5 to 93/7 to give the title compound as light yellow solid.
(511) LC-MS (A): t.sub.R=0.74 min; [M+H]+: 401.18
Example 86
4-Chloro-7-(2-hydroxy-ethoxy)-1H-indole-5-carboxylic acid (1-hydroxy-cyclohexylmethyl)-amide
(512) A solution of 7-(2-tert-butoxy-ethoxy)-4-chloro-1H-indole-5-carboxylic acid (1-hydroxy-cyclohexylmethyl)-amide (example 84) (0.08 mmol) in DCM (0.33 mL) was treated with TFA (4.14 mmol). The mixture was stirred for 2 h 30 min at RT, concentrated in vacuo and coevaporated with toluene. The crude was purified by preparative LC-MS using method VIII to give the title compound as white solid.
(513) LC-MS (A): t.sub.R=0.69 min; [M+H]+: 367.03
Example 87
4-Chloro-7-(2-hydroxy-ethoxy)-1H-indole-5-carboxylic acid (4,4-difluoro-1-hydroxy-cyclohexylmethyl)-amide
(514) This compound was prepared using a method analogous to that of example 86, 7-(2-tert-butoxy-ethoxy)-4-chloro-1H-indole-5-carboxylic acid (4,4-difluoro-1-hydroxy-cyclohexylmethyl)-amide (example 85) replacing 7-(2-tert-butoxy-ethoxy)-4-chloro-1H-indole-5-carboxylic acid (1-hydroxy-cyclohexylmethyl)-amide (example 84).
(515) LC-MS (A): t.sub.R=0.70 min; [M+H]+: 403.02
Example 89
4-Chloro-7-(1-hydroxy-1-methyl-ethyl)-1H-indole-5-carboxylic acid (1-hydroxy-cyclohexylmethyl)-amide
(516) This compound was prepared using a method analogous to that of example 68, 7-acetyl-4-chloro-1H-indole-5-carboxylic acid (1-hydroxy-cyclohexylmethyl)-amide (example 88) replacing 7-acetyl-4-chloro-1H-indole-5-carboxylic acid (4,4-difluoro-1-hydroxy-cyclohexylmethyl)-amide (example 66).
(517) LC-MS (A): t.sub.R=0.73 min, [M+H]+: 365.27
II. BIOLOGICAL ASSAYS
A. In Vitro Assay
(518) The P2X.sub.7 receptor antagonistic activity of the compounds of formula (I) is determined in accordance with the following experimental method.
B. Experimental Method
(519) Cell line generation and YO-PRO assay
(520) Cell line generation was performed in general according to established molecular cloning protocols. Specifically, RNA was extracted from human whole blood using the Qiagen RNeasy kit (Qiagen, CH) according to the manufacturer's instructions. Subsequently cDNA was made (Superscript II, Invitrogen AG, CH) and the human P2X7 gene (genbank ref. BC011913) was amplified with the following primers:
(521) TABLE-US-00006 ATCGCGGCCGCTCAGTAAGGACTCTTGAAGCCACT and CGCCGCTAGCACCACCATGCCGGCCTGCTGCAGCTGCA.
The amplified sequence was subsequently ligated into a pcDNA3.1 (+) NotI, NheI digested plasmid. Human embryonic kidney (HEK) cells (ATCC CRL-1573, Manassas, Va., USA) were transfected with the pcDNA3.1 (+).hP2X7 plasmid using lipofectamine 2000 (Invitrogen AG, CH) according to the manufacturer's instructions. Following a 24 h exposure to DNA, cells were trypsinized and re-seeded at low density in the presence of 250 g Geneticin. Geneticin resistant cells were then selected during two consecutive rounds of cloning by serial limiting dilution with visual inspection. Individual clones were screened for P2X7 expression by applying ATP and recording the resultant uptake of YO-PRO1. Specific cell clones were chosen based on RNA and protein expression. HEK cells stably expressing P2X7 were used to screen drugs using the YO-PRO1 assay. Cells were grown to confluency in adherent culture at 37 C. in a humidified 5% CO.sub.2 incubator (split 1/5 every 3-4 days with DMEM, 10% FCS, 1% Penicillin/Streptomycin, 250 g/ml Geneticin). Adherent cells were detached by incubation with Trypsine (1 ml per 165 cm.sup.2 dish) for 2 minutes, then washed off with 10 ml PBS (without Mg.sup.2+ and Ca.sup.2+), and resuspended in DMEM, 10% FCS, 1% Penicillin/Streptomycin, no Geneticin. 10000 cells per well (48 hours before the assay) or 25000 cells per well (Vi-cell XR (Beckman Coulter) (24 hours before the assay) in 50 l full medium were seeded on 384-well black-wall, clear bottom plates, that were coated before with 10 l per well Poly-L-Lysine, incubated for 30-60 minutes at 37 C. and washed once with PBS. Medium was removed from cells and 50 l of assay buffer containing 0.5 M YO-PRO-1 was added into the wells. Solutions of antagonist compounds were prepared by serial dilutions of a 10 mM DMSO solution of the antagonist into PBS using a BioMek (Beckman Coulter). Each concentration was performed in duplicate. For IC.sub.50 measurements 10 concentration points were measured (10 M being the highest concentration followed by 9 serial dilution steps 1/3). The cells were incubated with the antagonists of the present invention together with ATP at a final concentration of 250 M for 90 minutes. During this time period, four time points were taken. Each time point comprised the average of several measurements made within a few seconds. Fluorescence was measured in the FLIPR tetra (Molecular Devices) using the filters appropriate for YO-PRO-1 fluorescence (excitation485/20, emission 530/25). The FLIPR tetra was equipped with Molecular Devices Screen Works system control software to define and run experimental protocols. For antagonist activity measurements, the maximal intensity was expressed as a percentage of that induced by the EC.sub.50 value for agonist activation (0.25 mM ATP for HEK-293 cells expressing human recombinant P2X7 receptor). For IC50 measurements the maximum intensity is plotted against the concentration of compound to determine IC50 values.
(522) Antagonistic activities with respect to the P2X.sub.7 receptor (IC.sub.50 values) of exemplified compounds are displayed in Table 1.
(523) TABLE-US-00007 TABLE 1 IC.sub.50 IC.sub.50 IC.sub.50 Compound [nM] Compound [nM] Compound [nM] Example 1 13 Example 2 35 Example 3 12 Example 4 42 Example 5 77 Example 6 211 Example 7 50 Example 8 198 Example 9 1152 Example 10 57 Example 11 4.1 Example 12 3.2 Example 13 17 Example 14 4.5 Example 15 238 Example 16 442 Example 17 14 Example 18 178 Example 19 18 Example 20 6.1 Example 21 302 Example 22 1183 Example 23 1147 Example 24 4.7 Example 25 2.9 Example 26 11.4 Example 27 682 Example 28 151 Example 29 20 Example 30 221 Example 31 38 Example 32 11 Example 33 44 Example 34 130 Example 35 666 Example 36 27 Example 37 420 Example 38 1315 Example 39 1558 Example 40 1600 Example 41 264 Example 42 14 Example 43 218 Example 44 1427 Example 45 81 Example 46 209 Example 47 21 Example 48 1083 Example 49 497 Example 50 246 Example 51 24 Example 52 5.9 Example 53 4.4 Example 54 13 Example 55 6.7 Example 56 9.0 Example 57 68 Example 58 6.4 Example 59 5.4 Example 60 6.3 Example 61 4.0 Example 62 4.1 Example 63 4.0 Example 64 51 Example 65 79 Example 66 24 Example 67 4.7 Example 68 7.2 Example 69 10 Example 70 10 Example 71 12 Example 72 4.1 Example 73 4.2 Example 74 17 Example 75 9.5 Example 76 2.9 Example 77 21 Example 78 21 Example 79 6.1 Example 80 100 Example 81 5.4 Example 82 3.8 Example 83 3.3 Example 84 25 Example 85 30 Example 86 6.7 Example 87 7.3 Example 88 25 Example 89 8.3 Example 90 563 Example 91 701 Example 92 45 Example 93 70 Example 94 9.4 Example 95 9.3