Brassica plants resistant to clubroot

09556451 ยท 2017-01-31

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention relates to Brassica oleracea plants resistant to clubroot. The invention further relates to parts of these plants, to seeds and to other propagation material, and to the progeny of these plants.

Claims

1. A Brassica oleracea plant carrying a genetic determinant conferring resistance against Plasmodiophora brassicae, wherein the genetic determinant is present in plants that are grown from seeds which were deposited with the NCIMB under NCIMB accession number 41851, wherein the genetic determinant comprises QTL1 and QTL2, wherein QTL1 is located on chromosome 3 between marker BO00365 (SEQ ID NO:3) and marker BO00403 (SEQ ID NO:4), and is linked to marker BO00812 (SEQ ID NO:1), and wherein QTL2 is located on chromosome 8 between marker BO00829 (SEQ ID NO:5) and marker BO01007 (SEQ ID NO:6), and is linked to marker BO01026 (SEQ ID NO:2).

2. The Brassica plant as claimed in claim 1 wherein QTL1 and QTL2 are in a homozygous state.

3. A Brassica oleracea seed comprising the genetic determinant of claim 1.

4. The seed as claimed in claim 3, wherein the plant that can be grown from the seed is resistant to Plasmodiophora brassicae.

5. A progeny plant of a Brassica oleracea plant as claimed in claim 1, wherein the progeny plant comprises the genetic determinant of claim 1.

6. The progeny plant as claimed in claim 5, wherein the progeny plant is resistant to Plasmodiophora brassicae.

7. A propagation material derived from a plant as claimed in claim 1, wherein the propagation material comprises the genetic determinant of claim 1.

8. A propagation material capable of growing into a plant as claimed in claim 1.

9. The propagation material as claimed in claim 7, wherein the propagation material is selected from the group consisting of microspores, pollen, ovaries, ovules, embryos, embryo sacs, egg cells, cuttings, roots, root tips, hypocotyls, cotyledons, stems, leaves, flowers, anthers, seeds, meristematic cells, protoplasts and cells.

10. A tissue culture of propagation material as claimed in claim 7.

11. A harvested part of a Brassica oleracea plant as claimed in claim 1 which is selected from the group consisting of cabbage head, curd, stem, leaf, sprout, and seed, optionally in processed form, wherein the harvested part comprises the genetic determinant of claim 1.

12. The harvested part as claimed in claim 11, wherein the harvested part is a food product, and wherein the food product comprises the genetic determinant of claim 1.

Description

DETAILED DESCRIPTION OF THE INVENTION

(1) In the research leading to the present invention new Brassica plants, in particular Brassica oleracea plants, were developed which show a resistance to clubroot. It was found that these new plants show an altered resistance pattern to clubroot.

(2) Research that led to the present invention furthermore showed that the genetic determinant of the invention that leads to resistance to Plasmodiophora brassicae may comprise more than one QTL and that those QTLs are located on separate chromosomes of the Brassica genome, in particular the Brassica oleracea genome.

(3) The present invention thus provides a Brassica plant, in particular a Brassica oleracea plant which may comprise a genetic determinant which confers resistance to Plasmodiophora brassicae, wherein said genetic determinant is characterised by the presence of at least: QTL1 or a Plasmodiophora brassicae resistance conferring part thereof, located on chromosome 3 and/or QTL2 or a Plasmodiophora brassicae resistance conferring part thereof, located on chromosome 8

(4) In one embodiment the genetic determinant conferring resistance to Plasmodiophora brassicae is characterised by the presence of at least: QTL1 or a Plasmodiophora brassicae resistance conferring part thereof, or QTL2 or a Plasmodiophora brassicae resistance conferring part thereof, or QTL1 or a Plasmodiophora brassicae resistance conferring part thereof, and QTL2 or a Plasmodiophora brassicae resistance conferring part thereof.

(5) The combination of two resistance-conferring QTLs leads to a higher level of resistance to Plasmodiophora brassicae.

(6) Furthermore, it was found during the research leading to the present invention that in one embodiment, QTL1 or a Plasmodiophora brassicae resistance conferring part thereof, is located on chromosome 3, between marker BO00365 (SEQ ID No. 3) and marker BO00403 (SEQ ID No. 4) and linked to marker BO00812 (SEQ ID No. 1).

(7) In a further embodiment of the present invention, QTL2 or a Plasmodiophora brassicae resistance conferring part thereof, is located on chromosome 8 and located between marker BO00829 (SEQ ID No. 5) and marker BO01007 (SEQ ID No. 6) and linked to marker BO01026 (SEQ ID No. 2).

(8) In one embodiment, a Brassica plant, in particular a Brassica oleracea plant of the invention, may comprise a genetic determinant which confers resistance to Plasmodiophora brassicae, wherein said genetic determinant is characterised by the presence of at least: QTL1 or a Plasmodiophora brassicae resistance conferring part thereof, which in deposit NCIMB 41851 is linked to molecular marker characterized by SEQ ID No. 1, SEQ ID No. 3, and SEQ ID No. 4; and/or QTL2 or a Plasmodiophora brassicae resistance conferring part thereof, which in deposit NCIMB 41851 is linked to molecular marker characterized by SEQ ID No. 2, SEQ ID No. 5, and SEQ ID No. 6

(9) The invention in particular relates to Brassica plants, in particular Brassica oleracea plants, carrying a genetic determinant that comprises QTL1 and/or QTL2, which genetic determinant confers resistance to Plasmodiophora brassicae, in particular to the Plasmodiophora brassicae strain referred to as 16/03/31 according to the ECD differential set (Buczacki et al., Trans Br. Mycol. Soc. 65, 295-303, (1975)).

(10) In another embodiment, the invention relates to Brassica plants, in particular Brassica oleracea plants carrying a genetic determinant that comprises QTL1 and/or QTL2, which genetic determinant confers resistance to Plasmodiophora brassicae, in particular to the Plasmodiophora brassicae strain referred to as 31/31/31 according to the ECD differential set (Buczacki et al., Trans Br. Mycol. Soc. 65, 295-303, (1975)).

(11) In a preferred embodiment, the invention relates to Brassica plants, in particular Brassica oleracea plants carrying a genetic determinant that may comprise QTL1 and/or QTL2, which genetic determinant confers resistance to Plasmodiophora brassicae, in particular to the Plasmodiophora brassicae strains referred to as 16/03/31 and 31/31/31 according to the ECD differential set (Buczacki et al., Trans Br. Mycol. Soc. 65, 295-303, (1975)).

(12) The present invention also relates to a Brassica plant, in particular a Brassica oleracea plant, which may comprise the genetic determinant heterozygously, and thus showing intermediate resistance against Plasmodiophora brassicae, and which genetic determinant is obtainable from plants grown from seeds of which a representative sample is deposited with the NCIMB under NCIMB accession number 41851.

(13) In a further embodiment, the invention relates to a Brassica plant, in particular a Brassica oleracea plant, which may comprise a genetic determinant that confers resistance to Plasmodiophora brassicae, wherein said genetic determinant is obtainable by introgression from a plant grown from seed that was deposited with the NCIMB, under accession number NCIMB 41851.

(14) The invention further provides a Brassica plant, in particular a Brassica oleracea plant, which may comprise a genetic determinant that confers resistance to Plasmodiophora brassicae, wherein said resistance is introgressed from a plant grown from seed that was deposited with the NCIMB, under accession number NCIMB 41851.

(15) It should be noted that if the selection criterion or criteria is or are clearly defined, the skilled person will be able to identify the descendants that carry the trait in any further generation. For the trait of the invention descendants from a cross between a plant not carrying the genetic determinant that confers resistance to Plasmodiophora brassicae and a plant carrying the genetic determinant that confers resistance to Plasmodiophora brassicae of which representative seeds were deposited under accession number NCIMB 41851 that carry that trait may be found by growing F2 plants from seeds that are the result from the initial cross and a selfing step, and selecting plants that are resistant to clubroot.

(16) According to the invention a Brassica plant is provided, in particular a Brassica oleracea plant, which may comprise a genetic determinant that confers resistance to Plasmodiophora brassicae, which plant is obtainable by: a) growing plants from seeds of the deposit, deposited under accession number NCIMB 41851; b) growing plants in a Plasmodiophora brassicae infested environment; c) selecting plants showing resistance to Plasmodiophora brassicae, by not forming clubs; d) crossing a plant selected in step c) with a plant not resistant to Plasmodiophora brassicae to obtain a F1 population; e) selfing plants from the F1 to obtain a F2 population; and f) repeating steps b) and c) to identify plants showing resistance to clubroot.

(17) Alternatively, the selection step as described in step c) is performed by genotyping the plants by making use of the molecular SNP markers that are disclosed in this application. As a result, also the selection as repeated in step f) may be performed by making use of said molecular markers.

(18) The presence of the genetic information that is responsible for the trait of the invention, i.e. resistance to clubroot, in the genome of a plant showing resistance to clubroot may be determined with the following test. The plant to be tested should be or should be made homozygous for the genetic information responsible for resistance to clubroot.

(19) The invention further relates to a Brassica plant, in particular a Brassica oleracea plant, showing resistance to clubroot, wherein when said plant is homozygous for said resistance and said plant homozygous for said resistance is crossed with a tester plant homozygous for said resistance, plants of the first generation progeny resulting from said cross show a 1:0 segregation for resistance to clubroot.

(20) The tester plant is suitably a plant of deposit NCIMB 41851, or a progeny plant of said line showing resistance to clubroot.

(21) The Brassica plant of the invention is preferably a Brassica oleracea plant, but may also be any other plant of the genus Brassica into which the skilled person may introgress the genetic determinant of the invention, e.g. the following Brassica species: Brassica oleracea, Brassica napus, Brassica campestris, Brassica cretica, Brassica rapa, Brassica juncea, and Brassica nigra. The skilled person knows how to make interspecific crosses with these species, e.g. by means of embryo rescue, protoplast fusion, and other related technologies.

(22) The invention relates to Brassica oleracea plants of the following varieties:

(23) var. acephala DC. (kales)

(24) var. botrytis L. (cauliflower, romanesco)

(25) var. capitata L. (red, white, savoy cabbage)

(26) var. gemmifera DC. (brussels sprouts)

(27) var. gongylodes L. (kohlrabi)

(28) var. italica Plenck. (broccoli, calabrese)

(29) var. sabauda L. (savoy cabbage)

(30) var. sabellica (collards)

(31) var. selensia (borecole)

(32) var. albiflora Sun [=B. alboglabra] (Chinese kale)

(33) var. alboglabra [=B. alboglabra] (Chinese kale)

(34) var. chinensis Prain (burma sarson)

(35) var. fimbriata Mill. (kitchen kale)

(36) var. fruticosa Metz. (thousand-head kale)

(37) var. tronchuda L. H. Bailey (tronchuda cabbage)

(38) var. costata (Portuguese cabbage)

(39) var. medullosa (marrow stem kale)

(40) var. pamifolia (kale, Jersey kale)

(41) var. ramona (thousand-head kale)

(42) According to a further aspect thereof, the invention relates to seed of the Brassica plants, in particular Brassica oleracea plants, that may comprise the genetic determinant causing resistance to Plasmodiophora brassicae as found in seed with deposit accession number NCIMB 41851.

(43) The invention also relates to seed of the Brassica plant, in particular a Brassica oleracea plant, of the invention that is capable of growing into a Brassica oleracea plant of the invention.

(44) The invention, furthermore, relates to hybrid seed and to a method of producing hybrid seeds which may comprise crossing a first parent plant with a second parent plant and harvesting the resultant hybrid seed. In case the trait is recessive, both parents need to be homozygous for the resistance trait in order for the hybrid seed to carry the trait of the invention. They need not necessarily be uniform for other traits. Both parents thus carry the genetic determinant causing the resistance to Plasmodiophora brassicae in homozygous form.

(45) It is clear that a parent Brassica plant, in particular a parent Brassica oleracea plant that provides the genetic determinant of the invention, is not necessarily a plant grown directly from the deposited seeds. The parent may also be a progeny plant from the seed or a progeny plant from seeds that are identified to have or to have acquired the genetic determinant causing the trait of the invention by other means.

(46) The invention also relates to progeny of a Brassica plant, in particular a Brassica oleracea plant, of the invention, which progeny is resistant to Plasmodiophora brassicae. Such progeny may be produced by sexual or vegetative reproduction of a plant of the invention or a progeny plant thereof. The progeny carries the genetic determinant that causes the trait of resistance to Plasmodiophora brassicae and that is as found in seeds with deposit accession number NCIMB 41851, either in homozygous or heterozygous form.

(47) When the genetic determinant of the invention is homozygously present, the progeny plant displays the resistance trait in the same or in a similar way as the plant grown from seeds of which a representative sample was deposited under accession number NCIMB 41851. This means that such progeny has the same Plasmodiophora brassicae resistance characteristics as claimed for the Brassica plant, in particular Brassica oleracea plants of the invention. In addition to this, the plant may be modified in one or more other characteristics. Such additional modifications are for example effected by mutagenesis or by transformation with a transgene.

(48) As used herein the word progeny is intended to mean the offspring or the first and all further descendants from a cross with a plant of the invention that shows the resistance trait and/or carries the genetic determinant underlying the trait. Progeny of the invention may comprise descendants of any cross with a plant of the invention that carries the genetic determinant causing the resistance trait. Such progeny is for example obtainable by crossing a first Brassica plant, in particular a Brassica oleracea plant, with a second Brassica plant, in particular a Brassica oleracea plant, wherein one of the plants was grown from seeds of which a representative sample was deposited under NCIMB accession number 41851, but may also be the progeny of any other Brassica plant, in particular any other Brassica oleracea plant, carrying the genetic determinant as present in NCIMB 41851.

(49) The said progeny plants may comprise a genetic determinant that may comprise one or more QTLs causing the resistance of the invention, wherein the said genetic determinant is obtainable from a Brassica plant, in particular a Brassica oleracea plant grown from seeds of which a representative sample was deposited under NCIMB accession number 41851. The resistance trait thus has a genetic basis in the genome of a Brassica oleracea plant, and for example by using the bioassay described in Example 1 Brassica oleracea plants may be identified as being plants of the invention.

(50) The invention further relates to parts of a Brassica oleracea plant of the invention, that are suitable for sexual and vegetative reproduction, i.e. propagation material, wherein said propagation material comprises the genetic determinant causing resistance to Plasmodiophora brassicae of the invention. Such parts are for example selected from the group consisting of microspores, pollen, ovaries, ovules, embryo sacs and egg cells.

(51) In addition, the invention relates to parts of the Brassica oleracea plant of the invention that are suitable for vegetative reproduction, in particular cuttings, roots, stems, cells, protoplasts, and tissue cultures of the Brassica oleracea plant of the invention. The tissue culture may comprise regenerable cells. Such a tissue culture may be derived from leaves, pollen, embryos, cotyledons, hypocotyls, meristematic cells, root tips, anthers, flowers, seeds and stems. The propagation material carries the genetic determinant that causes the resistance to Plasmodiophora brassicae of the invention, either in homozygous or heterozygous form.

(52) The invention further relates to a Brassica oleracea plant grown or regenerated from the said propagation material of a plant of the invention, which Brassica oleracea plant is resistant to Plasmodiophora brassicae. The resistance phenotype is as found in plants grown from seeds having NCIMB accession number 41851 and the genetic determinant underlying the resistance is as present in the said seeds.

(53) The invention further relates to a cell of a Brassica oleracea plant of the invention, which cell may comprise a genetic determinant which confers resistance to Plasmodiophora brassicae, wherein the said determinant is present in a Brassica oleracea plant grown from seeds of which a representative sample was deposited with the NCIMB under NCIMB accession number 41851. The said cell thus may comprise the genetic information encoding said resistance, in particular genetic information which is substantially identical, preferably completely identical to the genetic information encoding the said resistance trait of the Brassica oleracea plant grown from seeds of which a representative sample was deposited under NCIMB accession number 41851, more in particular the genetic determinant described herein. Preferably, the cell of the invention is part of a plant or plant part, but the cell may also be in isolated form.

(54) In one embodiment, the invention relates to Brassica oleracea plants that may comprise the genetic determinant causing the trait of the invention and that have acquired said genetic determinant by introduction of the genetic information that is responsible for the trait from a suitable source, either by conventional breeding, or genetic modification, in particular by cisgenesis or transgenesis. Cisgenesis is genetic modification of plants with a natural gene, encoding an (agricultural) trait from the crop plant itself or from a sexually compatible donor plant. Transgenesis is genetic modification of a plant with a gene from a non-crossable species or with a synthetic gene.

(55) In one embodiment, the source from which the genetic information is acquired, in particular the genetic determinant, is formed by plants grown from the deposited seeds, or by sexual or vegetative descendants thereof.

(56) The invention also relates to harvested parts of Brassica oleracea plants of the invention or parts thereof, to food products which may comprise harvested parts of Brassica oleracea plants of the invention or parts thereof, either in natural or optionally in processed form.

(57) The harvested part or food product may be or may comprise a cabbage head, a curd, a stem, a leaf, a root, a sprout, a seed, or any other part of a Brassica plant. The harvested part may also be used for the production of bio-fuel. The food product or harvested part, may have undergone one or more processing steps. Such a processing step might comprise but is not limited to any one of the following treatments or combinations thereof: cutting, washing, cooking, steaming, baking, frying, pasteurizing, freezing, grinding, extracting oil, pickling, or fermenting. The processed form that is obtained is also part of this invention.

(58) Another aspect of this invention relates to a nucleic acid molecule which is causative of resistance to Plasmodiophora brassicae. The said DNA molecule comprises a DNA sequence which is positioned on chromosome 3 between markers BO00365 (SEQ ID NO: 3) and BO00403 (SEQ ID NO: 4), more in particular linked to marker BO00812 (SEQ ID NO: 1), or a resistance conferring part thereof.

(59) In yet another aspect the invention relates to a nucleic acid molecule which is causative of resistance to Plasmodiophora brassicae. The said DNA molecule comprises a DNA sequence which is positioned on chromosome 8 between markers BO00829 (SEQ ID NO: 5) and BO01007 (SEQ ID NO: 6), more in particular linked to marker BO01026 (SEQ ID NO: 2), or a resistance conferring part thereof.

(60) Linked to the marker is intended to mean that the chance that there is a recombination event between said marker and the QTL is lower than the chance that there is a recombination event between the QTL and any other markers. Preferably, it is intended to mean that said marker is genetically closest to said QTL.

(61) The invention also relates to the use of the markers designated as SEQ ID No. 1, SEQ ID No. 2, SEQ ID No. 3, SEQ ID No. 4, SEQ ID No. 5 and SEQ ID No. 6 to identify or develop Brassica oleracea plants that are resistant to Plasmodiophora brassicae.

(62) In a further embodiment, the invention also relates to the use of the markers designated as SEQ ID No. 1, SEQ ID No. 2, SEQ ID No. 3, SEQ ID No. 4, SEQ ID No. 5 and SEQ ID NO. 6 to develop other markers linked to QTL1 and/or QTL2.

(63) The invention also relates to the germplasm of plants of the invention. The germplasm is constituted by all inherited characteristics of an organism and according to the invention encompasses at least the resistance trait of the invention. The germplasm may be used in a breeding program for the development of Brassica oleracea plants that are resistant to Plasmodiophora brassicae.

(64) The invention further relates to the use of a Brassica oleracea plant of the invention in breeding to confer resistance against Plasmodiophora brassicae.

(65) In one aspect the invention relates to a method for the production of a Brassica plant, in particular a Brassica oleracea plant, which comprises a genetic determinant that confers resistance to Plasmodiophora brassicae and is as found in seeds with deposit accession number NCIMB 41851, which may comprise a) crossing a plant which may comprise the genetic determinant that leads to the trait with another plant; b) selfing the resulting F1 for obtaining F2 plants; c) selecting plants that have the trait in the F2; d) optionally performing one or more additional rounds of selfing or crossing, and subsequently selecting, for a plant which may comprise/showing the trait.

(66) The word trait in the context of this application refers to the phenotype of the plant. The term genetic determinant is used for the genetic information in the genome of the plant that causes the trait. When a plant shows the trait of the invention, its genome may comprise the genetic determinant causing the trait of the invention, in particular the genetic determinant that is as found in seeds with deposit accession number NCIMB 41851 and leads to clubroot resistance as defined herein. The plant thus has the genetic determinant of the invention.

(67) It is clear that the parent that provides the trait of the invention is not necessarily a plant grown directly from the deposited seeds. The parent may also be a progeny plant from the seed or a progeny plant from seeds that are identified to have the trait of the invention by other means.

(68) In one aspect, the invention relates to a method for production of a Brassica plant, in particular a Brassica oleracea plant which may comprise a genetic determinant that confers resistance to Plasmodiophora brassicae, which may comprise a) crossing a plant which may comprise the genetic determinant that leads to the trait with another plant; b) optionally backcrossing the resulting F1 with the preferred parent; c) selecting for plants that have the trait in the F2; d) optionally performing one or more additional rounds of selfing or crossing, and subsequently selecting, for a plant which may comprise the trait.

(69) The invention additionally provides a method of introducing another desired trait into a Brassica plant, in particular a Brassica oleracea plant, which may comprise a genetic determinant that causes resistance to Plasmodiophora brassicae, which may comprise: a) crossing a Brassica plant, in particular a Brassica oleracea plant that may comprise a genetic determinant that causes resistance to Plasmodiophora brassicae, representative seeds of which were deposited under deposit number NCIMB 41851, with a second Brassica plant, in particular a Brassica oleracea plant that may comprise a desired trait to produce F1 progeny; b) selecting an F1 progeny that may comprise the genetic determinant that causes resistance to Plasmodiophora brassicae and the desired trait, preferably by means of molecular markers; c) selfing the F1 progeny and selecting an F2 progeny that may comprise the genetic determinant that causes resistance to Plasmodiophora brassicae and the desired trait; d) crossing the selected F2 progeny with either parent, to produce backcross progeny; e) selecting backcross progeny which may comprise the desired trait and a genetic determinant that causes resistance to Plasmodiophora brassicae; and f) optionally repeating steps c) and d) one or more times in succession to produce selected fourth or higher backcross progeny that may comprise the desired trait and a genetic determinant that causes resistance to Plasmodiophora brassicae. The invention includes a Brassica plant, in particular a Brassica oleracea plant produced by this method.

(70) The selection step as described in step c) is suitably performed by genotyping the plants by making use of the molecular SNP markers that are disclosed in this application. As a result, also the selection steps as repeated in step f) may be performed by making use of said molecular markers.

(71) Selection for plants which may comprise a genetic determinant that causes resistance to Plasmodiophora brassicae is for example done in the F1 by using marker BO00812 and marker BO01026 (SEQ ID No. 1 and SEQ ID No. 2, respectively). In another aspect selection for the trait of the invention is started in the F2 of a cross or alternatively of a backcross. Selection of plants in the F2 may be done phenotypically as well as by using the said marker(s) which directly or indirectly detect the genetic determinant underlying the trait.

(72) In a further embodiment selection for plants which may comprise a genetic determinant that causes resistance to Plasmodiophora brassicae is started in the F3 or a later generation.

(73) The plant which may comprise the genetic determinant may for example be a plant of an inbred line, a hybrid, a doubled haploid, or of a segregating population.

(74) The invention further provides a method for the production of a Brassica plant, in particular a Brassica oleracea plant, which may comprise the genetic determinant that causes resistance to Plasmodiophora brassicae of the invention by using a doubled haploid generation technique to generate a doubled haploid line which may comprise the said trait.

(75) The invention furthermore relates to hybrid seed that may be grown into a plant which may comprise the genetic determinant that causes resistance to Plasmodiophora brassicae of the invention and to a method for producing such hybrid seed which may comprise crossing a first parent plant with a second parent plant and harvesting the resultant hybrid seed, wherein said first parent plant and/or said second parent plant is the plant as claimed.

(76) In one embodiment, the invention relates to a method for producing a hybrid Brassica plant, in particular a Brassica oleracea plant, which may comprise the genetic determinant that causes resistance to Plasmodiophora brassicae of the invention, which may comprise crossing a first parent Brassica plant, in particular a Brassica oleracea parent plant, with a second parent Brassica plant, in particular a Brassica oleracea parent plant, and harvesting the resultant hybrid seed, wherein the first parent plant and/or the second parent plant may comprise the genetic determinant that causes resistance to Plasmodiophora brassicae of the invention, and growing said hybrid seeds into hybrid plants which may comprise a genetic determinant that causes resistance to Plasmodiophora brassicae.

(77) The invention also relates to a method for the production of a Brassica plant, in particular a Brassica oleracea plant, which may comprise the genetic determinant of the invention that causes resistance to Plasmodiophora brassicae by using a seed that may comprise the genetic determinant that causes resistance to Plasmodiophora brassicae for growing the said Brassica plant, in particular said Brassica oleracea plant. The seeds are suitably seeds of which a representative sample was deposited with the NCIMB under deposit number NCIMB 41851.

(78) The invention also relates to a method for seed production which may comprise growing Brassica plants, in particular Brassica oleracea plants, from seeds of which a representative sample was deposited with the NCIMB under deposit number NCIMB 41851, allowing the plants to produce seeds, and harvesting those seeds. Production of the seeds is suitably done by crossing or selfing.

(79) In one embodiment, the invention relates to a method for the production of a Brassica plant, in particular a Brassica oleracea plant, which may comprise a genetic determinant that causes resistance to Plasmodiophora brassicae by using tissue culture.

(80) The invention furthermore relates to a method for the production of a Brassica plant, in particular a Brassica oleracea plant, which may comprise the genetic determinant that causes resistance to Plasmodiophora brassicae of the invention by using vegetative reproduction.

(81) In one embodiment, the invention relates to a method for the production of a Brassica plant, in particular a Brassica oleracea plant, which may comprise a genetic determinant that causes resistance to Plasmodiophora brassicae by using a method for genetic modification to introgress the said trait into the Brassica plant, in particular the Brassica oleracea plant. Genetic modification may comprise transgenic modification or transgenesis, using a gene from a non-crossable species or a synthetic gene, and cisgenic modification or cisgenesis, using a natural gene, coding for an (agricultural) trait, from the crop plant itself or from a sexually compatible donor plant.

(82) The invention also relates to a breeding method for the development of Brassica plants, in particular Brassica oleracea plants, that may comprise the genetic determinant that causes resistance to Plasmodiophora brassicae of the invention wherein germplasm which may comprise said trait is used. Representative seed of said plant which may comprise the genetic determinant and being representative for the germplasm has deposit number NCIMB 41851.

(83) In a further embodiment the invention relates to a method for the production of a Brassica plant, in particular a Brassica oleracea plant, which may comprise the genetic determinant that causes resistance to Plasmodiophora brassicae of the invention wherein progeny or propagation material of a plant which may comprise the genetic determinant conferring said trait is used as a source to introgress the said trait into another Brassica plant, in particular another Brassica oleracea plant. Representative seed of said plant which may comprise the genetic determinant was deposited under deposit number NCIMB 41851.

(84) The invention provides preferably a Brassica plant, in particular a Brassica oleracea plant, which may comprise the genetic determinant that causes resistance to Plasmodiophora brassicae of the invention, which plant is obtainable by any of the methods herein described and/or familiar to the skilled person.

(85) The invention relates to a cell of a Brassica plant, in particular a Brassica oleracea plant, which plant carries the genetic determinant that may comprise QTL1 and/or QTL2 as described herein, which confers resistance to Plasmodiophora brassicae, as present in a Brassica plant, in particular a Brassica oleracea plant, grown from seed deposit accession number 41851.

(86) The invention further relates to a cell of a Brassica plant, in particular a Brassica oleracea plant, which plant carries a genetic determinant that may comprise QTL1 and/or QTL2, which confers resistance to Plasmodiophora brassicae, as present in a Brassica plant, in particular a Brassica oleracea plant, grown from seed as deposited with NCIMB on 27 Jun. 2011 and having the accession number 41851. Said Brassica plant, in particular a Brassica oleracea plant, is obtainable by crossing a Brassica plant, in particular a Brassica oleracea plant, with a second Brassica plant, in particular a Brassica oleracea plant, grown from seed as deposited with NCIMB on 27 Jun. 2011 and having the accession number 41851, and selecting for a Brassica plant, in particular a Brassica oleracea plant that shows a resistance to the pathogen in a disease test, preferably a marker test as present in the Brassica plant, in particular the Brassica oleracea plant of the invention which carries a genetic determinant that may comprise QTL1 and/or QTL2, which confers resistance to Plasmodiophora brassicae.

(87) In one embodiment, the invention relates to the use of seeds with NCIMB accession number 41851, for transferring the genetic determinant that comprises QTL1 and/or QTL2, which confers resistance to Plasmodiophora brassicae, into another Brassica plant, in particular a Brassica oleracea plant.

(88) In another embodiment, the invention relates to the use of a Brassica plant, in particular a Brassica oleracea plant, which plant carries a genetic determinant that may comprise QTL1 and/or QTL2, which confers resistance to Plasmodiophora brassicae, as present in and obtainable from a Brassica plant, in particular a Brassica oleracea plant, grown from seed with NCIMB number 41851, as a crop.

(89) The invention also relates to the use of a Brassica plant, in particular a Brassica oleracea plant, which carries a genetic determinant that may comprise QTL1 and/or QTL2, which confers resistance to Plasmodiophora brassicae, as present in a Brassica plant, in particular a Brassica oleracea plant grown from seed with accession number 41851, as a source of seed.

(90) In yet another embodiment, the invention relates to the use of a Brassica plant, in particular a Brassica oleracea plant, which carries a genetic determinant that may comprise QTL1 and/or QTL2, which confers resistance to Plasmodiophora brassicae, as present in a Brassica plant, in particular a Brassica oleracea plant grown from seed with NCIMB accession number 41851, as a source of propagating material.

(91) Further, the invention relates to the use of a Brassica plant, in particular a Brassica oleracea plant, which carries a genetic determinant that may comprise QTL1 and/or QTL2, which confers resistance to Plasmodiophora brassicae, as present in a Brassica plant, in particular a Brassica oleracea plant grown from seed with NCIMB accession number 41851, for consumption.

(92) In another embodiment, the invention relates to the use of a Brassica plant, in particular a Brassica oleracea plant, which carries a genetic determinant that may comprise QTL1 and/or QTL2, which confers resistance to Plasmodiophora brassicae, alleles as present in seeds with NCIMB accession number 41851, for conferring a genetic determinant that may comprise QTL1 and/or QTL2, which confers resistance to Plasmodiophora brassicae, on a Brassica plant, in particular a Brassica oleracea plant.

(93) In yet another embodiment, the invention relates to the use of a Brassica plant, in particular a Brassica oleracea plant, as a recipient of resistance alleles as present in seeds with NCIMB accession number 41851.

(94) Definitions

(95) Introgression as used in this application is intended to mean introduction of a trait into a plant not carrying the trait by means of crossing and selection.

(96) Progeny as used in this application is intended to mean the first and all further descendants from a cross with a plant of the invention that shows resistance to clubroot. Progeny of the invention are descendants of any cross with a plant of the invention that carries the trait that leads to resistance to clubroot.

(97) Progeny also encompasses plants that carry the trait of the invention and are obtained from other plants of the invention by vegetative propagation or multiplication. Progeny is not only the first, but also all further generations as long as resistance to clubroot is retained. Progeny typically has an ancestor that is a plant having the ability to show resistance to clubroot, when grown in a field under clubroot infested conditions, or in a greenhouse inoculation test as described herein, as is found in plants grown from seed as deposited. An ancestor is intended to encompass not only the generation immediately prior to the plant but also multiple generations before that. More in particular, the ancestor is a plant from the deposited seed or a further generation descendant therefrom.

(98) The term genetic determinant as used herein encompasses one or more QTLs, genes, or alleles. These terms are used interchangeably. A genetic determinant may be identified by the use of a molecular marker. A genetic determinant may alternatively be identified by the position on a genetic map, or by indication of the location on a linkage group or chromosome. When a genetic determinant is not linked to a specific molecular marker any longer, but its position on a chromosome as defined on a genetic map is unaltered, this genetic determinant is still the same as when it was linked to the molecular marker. The genetic trait that it confers is therefore also still the same. The genetic trait is the trait or characteristic that is conferred by the genetic determinant. The genetic trait may be identified phenotypically, for example by performing a bio-assay. However, also plant stages for which no phenotypic assay may be performed do carry the genetic information that leads to the genetic trait. Trait or phenotypic trait may be used instead of genetic trait.

(99) Although the present invention and its advantages have been described in detail, it should be understood that various changes, substitutions and alterations can be made herein without departing from the spirit and scope of the invention as defined in the appended claims.

(100) The present invention will be further illustrated in the following Examples which are given for illustration purposes only and are not intended to limit the invention in any way.

EXAMPLES

Example 1

(101) QTL Mapping and Marker Development

(102) A large population consisting of 172 F2 Brassica oleracea plants was used for mapping the resistance to Plasmodiophora brassicae. These F2 plants were the result of a first cross between line 82 and the clubroot susceptible plant EA2479 (Rijk Zwaan), and a subsequent selfing cross. The population was inoculated according to the protocol as described in Example 2. In total 163 SNP markers were analysed, of which 154 markers were found to be polymorphic.

(103) Remarkably, 2 QTLs were identified that contribute to the resistance, both positioned on different chromosomes. The molecular SNP markers that correlated most closely to the QTLs are presented in Table 1.

(104) SEQ ID No.1 comprises the presence of a SNP from nucleotide C (wild type) to A at chromosome 3. The position may also be indicated as the 42.sup.nd position (bold) in the nucleotide sequence shown in Table 1.

(105) SEQ ID No.2 comprises the presence of a SNP from nucleotide G (wild type) to C at chromosome 8. The position may also be indicated as the 40.sup.th position (bold) in the nucleotide sequence shown in Table 1.

(106) SEQ ID No.3 comprises the presence of a SNP from nucleotide C (wild type) to G at chromosome 3. The position may also be indicated as the 42.sup.nd position (bold) in the nucleotide sequence shown in Table 1.

(107) SEQ ID No.4 comprises the presence of a SNP from nucleotide T (wild type) to C at chromosome 3. The position may also be indicated as the 41.sup.st position (bold) in the nucleotide sequence shown in Table 1.

(108) SEQ ID No.5 comprises the presence of a SNP from nucleotide C (wild type) to A at chromosome 8. The position may also be indicated as the 43.sup.rd position (bold) in the nucleotide sequence shown in Table 1.

(109) SEQ ID No.6 comprises the presence of a SNP from nucleotide A (wild type) to G at chromosome 8. The position may also be indicated as the 40.sup.th position (bold) in the nucleotide sequence shown in Table 1.

(110) A first QTL which explained 18.5% of the variation was located on chromosome 3, having a LOD score of 10.24. The position of the QTL was determined to be between the markers designated as SEQ ID No 3 and SEQ ID No 4, the sequence of which is found in Table 1. In the F2 population and subsequent progeny this QTL was linked most closely to a SNP marker designated SEQ ID No.1, the sequence of which is found in Table 1. The borders of the preferred QTL region may be determined by the presence of SEQ ID No. 3 and SEQ ID No. 4.

(111) A second QTL which explained 17.0% of the variation was located on chromosome 8, having a LOD score of 9.51. The position of the QTL was determined to be between the markers designated as SEQ ID No. 5 and SEQ ID No. 6, the sequence of which is found in Table 1. In the F2 population and subsequent progeny this QTL was linked most closely to a SNP marker designated as SEQ ID No. 2, the sequence of which is found in Table 1. The borders of the preferred QTL region may be determined by the presence of SEQ ID No. 5 and SEQ ID No. 6.

(112) TABLE-US-00001 TABLE1 MolecularSNPmarkersbasedonthepopulation-specificgeneticmap,thatindeposit numbersNCIMB41815arelinkedtoQTL1andQTL2,whichconferresistanceto PlasmodiophorabrassicaeinBrassicaplants,inparticularBrassicaoleraceaplants. Related Designation Sequence QTL SEQIDNo.1 ACAGAGTCTTCAAACATTTCATAGCACGAAGCTGAGTTGCTAGTGTGGTTTCAGGTGCTGCT QTL1 ACTAACATTGTTGGGATG SEQIDNo.2 GTTAGTCTCATAGTTTACATACATACTCTGCTGGTAATACTCATGGGACGTTGGTGCTGAGT QTL2 CCATCACGACCGTGTTG SEQIDNo.3 TCAGATTCTCTGAAGTCAATCTTGTGTTCAACACCAGCTTTGTTTATAATTGGCAATCCTAC QTL1 CTCTTCGTATGAGCCTCT SEQIDNo.4 ATCATCTTCCATAGCTTTCACATGCTTTGTGGCTCCCACGCTCACTCCAGTTCTGAGAACTT QTL1 GCGTAACCAACTTCTCG SEQIDNo.5 CTGCTTCCCTTTCCCAAACAAACCTCCAAACCAAGAYCCCGAACCTGCCTCCGAAGCAGATG QTL2 AAGTCTCCGGCACAGGC SEQIDNo.6 AATGAGCGAGGACGTGAGCGGGAACAAGTTCTTCGACGAGGCAATGATGGTGGAGCTAGCGC QTL2 AGCAGACGGGTGATCTG

(113) The SNP sequences are linked to the respective QTLs in NCIMB 41851. The SNP sequences may be used as molecular markers for resistance to Plasmodiophora brassicae in Brassica oleracea plants of said deposit.

Example 2

(114) Identification of Brassica oleracea Plants which have Obtained the Resistance to Clubroot

(115) In this example, inoculation tests are described. The general protocol is provided, together with the results of experiments using plants of the invention and commercially available varieties.

(116) In Table 2, an overview of infection symptoms and classification stadia of Plasmodiophora brassicae infected Brassica plants is given. Such an overview is used by phenotypically identifying clubroot resistant plants. In addition, it submitted that scores 2 and 3 are sometimes taken together, representing an intermediate infection phenotype.

(117) TABLE-US-00002 TABLE 2 Overview of infection symptoms and classification stadia of Plasmodiophora brassicae infected Brassica plants Score Symptoms Classification 0 No symptoms, clean roots Highly resistant 1 Small clubs, only present on lateral roots Intermediate resistant 2 Moderately sized clubs, also present on Intermediate main root susceptible 3 Complete root system is heavily infested Highly susceptible with large clubs

(118) In order to test whether plants are resistant to clubroot or not, about 20 seeds per line are sown in peat soil with a height of 8 cm with approximately 2 cm of sowing soil on top. Two to seven days after sowing, the plants are inoculated with 2 ml of the inoculant containing spores of the Plasmodiophora brassicae isolates of interest. This may be a mixture of isolates or a single isolate. In this example, disease tests with an inoculant containing a single Plasmodiophora brassicae isolate. After inoculation, the plants are not watered for 2 to 3 days to prevent the spores from being flushed away. Successively, the inoculated plants are grown for 5 to 6 weeks under Dutch greenhouse conditions at a temperature of 23 to 25 C.

(119) During a clubroot disease test known susceptible and resistant varieties are also sown to test whether the general conditions for a successful and reliable disease test are met. In this example the two isolates were tested with the ECD (European Clubroot Differential) set. This set consists out of 5 cultivars, selected out of each of the three Brassica species B. rapa, B. napus and B. oleracea.

(120) So, in total 15 cultivars are taken into account. These are referred to in Table 3 with the numbers 1 to 15 in the column Differential numbers. If in a disease test, such a cultivar is found susceptible for a tested isolate, the corresponding denary number is added up with the denary numbers of other susceptible cultivars of this specific Brassica species. In this way, three numbers for the three Brassica species may be calculated.

(121) In Table 3 the results of a disease test are given. In this test a specific isolate designated PLA-DE1145, was tested on plants of the invention and plants of the variety Janin. In the column designated PLA-DE1145 the results are listed in the following order of scores: 0-1/2-3. So, in this experiment the scores 1 and 2 are taken together in one group. Also cultivars of the ECD set were tested. The differential test showed that the variety Janin is susceptible for the isolate designated PLA-DE1145, which is assigned the code 31/31/31 under the ECD set. Plants of the invention are shown to be resistant.

(122) TABLE-US-00003 TABLE 3 Overview of the results of a clubroot differential test using the Plasmodiophora brassicae isolate PLA-DE1145 Differential Denary PLA- number Brassica Accession number DE1145 Code 1 rapa var. aaBBCC 1 2-0-12 31 pekinensis 2 rapa var. AabbCC 2 2-0-11 pekinensis 3 rapa var. AABBcc 4 2-4-5 pekinensis 4 rapa var. AABBCC 8 2-1-10 pekinensis 5 rapa var. Granaat 16 0-0-15 pekinensis 6 napus Nevin 1 0-0-14 31 7 napus Giant Rape 2 0-0-13 8 napus Line Dc126 4 0-0-15 9 napus Clubroot 8 0-0-13 Resistant 10 napus Wilhelmsburger 16 0-0-15 11 oleracea var. Badger Snipper 1 0-0-13 31 capitata 12 oleracea var. Sachsener 2 0-4-8 capitata 13 oleracea var. Jersey Queen 4 0-0-15 capitata 14 oleracea var. Septa 8 0-0-13 capitata 15 oleracea var. Verheul 16 0-0-10 fimbriata t1 line 82 10-1-2 t2 Janin 0-0-15

(123) In Table 4, the results of an inoculation experiment with Plasmodiophora brassicae strain 31/31/31 are given. In this test the commercially available strains Clarify and Clapton are tested with the clubroot isolate that was designated 31/31/31 according to the ECD test mentioned in Table 3. From Table 4, it follows that Clapton and Clarify may be considered to be susceptible for this clubroot isolate.

(124) TABLE-US-00004 TABLE 4 Results from an inoculation experiment with Plasmodiophora brassicae strain 31/31/31 Variety Plot Result Clarify 86 4/0/0/25 Clarify 150 0/0/0/28 Clarify 253 0/0/2/27 Clarify 11 0/7/0/17 Clarify 165 0/0/8/16 Clapton 71 2/0/0/20 Clapton 92 0/0/0/22 Clapton 12 1/5/0/18 Clapton 166 1/2/5/18

Example 3

(125) Heritability of the Resistance to Clubroot

(126) In the research leading to the present invention, broccoli plants (Brassica oleracea var. italica) present in the breeding material of the applicant, showing strong resistance to Plasmodiophora brassicae were crossed with susceptible broccoli plants to transfer the resistance. All plants resulting from this cross were reported susceptible upon infection with Plasmodiophora brassicae.

(127) Subsequently, this F1 was selfed resulting in an F2 generation which was tested phenotypically by growing plants under clubroot infested conditions. In total 793 plants were phenotyped, of which 274 plants showed resistance to Plasmodiophora brassicae. The remaining 519 plants were found susceptible.

(128) Data of a specific F2 population resulting from a cross between line 82EA2749 are described below.

(129) Phenotypic data of a total of 184 individual plants were collected, based on their resistance pattern upon Plasmodiophora brassicae infection. In Table 5, the number of Brassica oleracea plants scored in the respective classes are given.

(130) TABLE-US-00005 TABLE 5 Number of plants scored in respective classes Material 0 1 2 3 RZ909104 41 18 15 110

(131) In this way, it is shown that resistance to clubroot may be transferred from resistant plant to susceptible plants. From Table 5 it may be concluded that the two QTLs conferring resistance to Plasmodiophora brassicae are inherited in a recessive way.

(132) The invention is further described by the following numbered paragraphs:

(133) 1. A Brassica plant, in particular a Brassica oleracea plant carrying a genetic determinant that comprises QTL1 and/or QTL2, which confer resistance against Plasmodiophora brassicae, and which genetic determinant is present in plants that are grown from seeds which were deposited with the NCIMB under NCIMB accession number 41851.

(134) 2. The Brassica plant of paragraph 1 which comprises at least one of QTL1 and QTL2 in homozygous state and is resistant to Plasmodiophora brassicae.

(135) 3. The Brassica plant of paragraph 1 or 2, wherein the said genetic determinant as present in plants that are grown from the seeds of NCIMB deposit 41851 comprises: QTL1, located on chromosome 3 and linked to marker BO00812 (SEQ ID NO: 1) or a Plasmodiophora brassicae resistant part thereof and/or QTL2, located on chromosome 8 between marker and marker, and linked to marker BO01026 (SEQ ID NO: 2) or a Plasmodiophora brassicae resistant part thereof

(136) 4. The Brassica plant of paragraph 3, wherein QTL1 is located on chromosome 3, between marker BO00365 (SEQ ID No. 3) and marker BO00403 (SEQ ID No. 4) and linked to marker BO00812 (SEQ ID No. 1); QTL2 is located on chromosome 8 and located between marker BO00829 (SEQ ID No. 5) and marker BO01007 (SEQ ID No. 6) and linked to marker BO01026 (SEQ ID No. 2)

(137) 5. Seed comprising the genetic determinant as defined in any one of the paragraphs 1-4.

(138) 6. Seed of paragraph 5, wherein the plant that can be grown from the seed is resistant to Plasmodiophora brassicae.

(139) 7. Progeny plant of a Brassica plant of any one of the paragraphs 1-4, or progeny of plants grown from seeds of paragraph 5 or paragraph 6, wherein the plant comprises the genetic determinant as defined in any one of the paragraphs 1-4.

(140) 8. Progeny plant of paragraph 7, wherein the progeny plant is resistant to Plasmodiophora brassicae.

(141) 9. Propagation material derived from a plant of any one of the paragraphs 1-4, wherein the propagation material comprises the genetic determinant as defined in any one of the paragraphs 1-4.

(142) 10. Propagation material capable of growing into a plant of any one of the paragraphs 1-4.

(143) 11. Propagation material of paragraph 9 or 10, wherein the propagation material is selected from a group consisting of microspores, pollen, ovaries, ovules, embryos, embryo sacs, egg cells, cuttings, roots, root tips, hypocotyls, cotyledons, stems, leaves, flowers, anthers, seeds, meristematic cells, protoplasts and cells.

(144) 12. Tissue culture of propagation material of any one of the paragraphs 9-11.

(145) 13. Harvested part of a Brassica plant of any one of paragraphs 1-4, 7 or 8 which is in particular selected from the group consisting of cabbage head, curd, stem, leaf, sprout, seed, optionally in processed form.

(146) 14. Harvested part of paragraph 13, wherein the harvested part is a food product.

(147) 15. A nucleic acid molecule causative of resistance against Plasmodiophora brassicae, comprising a DNA sequence, which is linked to marker BO00812 (SEQ ID No. 1) located on chromosome 3, in particular located on chromosome 3 between marker BO00365 (SEQ ID No: 3) and marker BO00403 (SEQ ID No: 4), or a resistance conferring part of said nucleic acid molecule.

(148) 16. A nucleic acid molecule causative of resistance against Plasmodiophora brassicae, comprising a DNA sequence, which is linked to marker BO01026 (SEQ ID No. 2) located on chromosome 8, in particular located on chromosome 8 between marker BO00829 (SEQ ID No. 5) and marker BO01007 (SEQ ID No. 6), or a resistance conferring part of said nucleic acid molecule.

(149) 17. Use of the markers as defined in paragraph 3 and 4, and/or use of the nucleic acid molecules of paragraph 15 and/or 16, to identify or develop Plasmodiophora brassicae resistant plants, or develop other markers linked to the genetic determinant as defined in any one of the paragraphs 1 to 3.

* * *

(150) Having thus described in detail preferred embodiments of the present invention, it is to be understood that the invention defined by the above paragraphs is not to be limited to particular details set forth in the above description as many apparent variations thereof are possible without departing from the spirit or scope of the present invention.