Recombinant HVT vectors expressing antigens of avian pathogens and uses thereof
09555096 ยท 2017-01-31
Assignee
Inventors
- Michel Bublot (Chaponost, FR)
- Teshome Mebatsion (Watkinsville, GA)
- Joyce Pritchard (Gainesville, GA)
- Perry Linz (Jefferson, GA)
Cpc classification
C12N7/00
CHEMISTRY; METALLURGY
C12N2800/22
CHEMISTRY; METALLURGY
C12N2760/18134
CHEMISTRY; METALLURGY
C12N2720/10034
CHEMISTRY; METALLURGY
C12N2710/16334
CHEMISTRY; METALLURGY
C12N2710/16343
CHEMISTRY; METALLURGY
International classification
C12N7/00
CHEMISTRY; METALLURGY
Abstract
The present invention provides recombinant herpesvirus of turkeys (HVT) vectors that contain and express antigens of avian pathogens, compositions comprising the recombinant HVT vectors, polyvalent vaccines comprising the recombinant HVT vectors and one or more wild type viruses or recombinant vectors. The present invention further provides methods of vaccination against a variety of avian pathogens and method of producing the recombinant HVT vectors.
Claims
1. A composition or vaccine comprising one or more recombinant herpesvirus of turkeys (HVT) vectors, wherein at least one HVT vector comprises two or more heterologous polynucleotides coding for and expressing at least one antigen of an avian pathogen, wherein the at least one polynucleotide encodes a Newcastle Disease Virus F (NDV-F) polypeptide and is operably linked to an SV40 promoter, and wherein the polynucleotide is codon-optimized.
2. The composition or vaccine of claim 1, wherein the HVT vector further comprises a heterologous polynucleotide coding for and expressing one or more Infectious Bursal Disease Virus (IBDV) VP2 polypeptides.
3. The composition or vaccine of claim 2, wherein the NDV-F polypeptide has at least 95% sequence identity to the amino acid sequence as set forth in SEQ ID NO:2, 4, 6, 33, 35, or 37.
4. The composition or vaccine of claim 2, wherein the IBDV VP2 polypeptide has at least 95% sequence identity to the amino acid sequence as set forth in SEQ ID NO:8 or 42.
5. The composition or vaccine of claim 2, wherein the HVT vector comprises a heterologous polynucleotide coding for and expressing an Newcastle NDV-F polypeptide having at least 95% sequence identity to the amino acid sequence as set forth in SEQ ID NO:2, 4, 6, 33, 35, or 37 and one or two heterologous polynucleotides coding for and expressing one or two IBDV VP2 polypeptides having at least 95% sequence identity to the amino acid sequence as set forth in SEQ ID NO:8 or 42.
6. The composition or vaccine of claim 2, wherein the polynucleotide encoding the NDV-F polypeptide is operably linked to a polyA signal selected from the group consisting of an SV40 polyA signal, US10 polyA signal, and a synthetic polyA signal.
7. The composition or vaccine of claim 2, wherein the polynucleotides encoding NDV-F and IBDV VP2 are inserted in a locus selected from the group consisting of IG2 (intergenic region 2), US10, SORF3-US2, and IG1 (intergenic region 1) of HVT genome.
8. The composition or vaccine of claim 5, wherein the one or two polynucleotides encoding the IBDV VP2 polypeptide is operably linked to CMV promoter, guinea pig CMV promoter, or a combination thereof.
9. The composition or vaccine of claim 2, wherein HVT vector is selected from the group consisting of an HVT vector comprising an SV40 promoter and a polynucleotide encoding an NDV-F antigen inserted in the IG2 locus of the HVT vector, an HVT vector comprising an US10 promoter and a polynucleotide encoding an NDV-F antigen inserted in the US10 locus of the HVT vector, an HVT vector comprising an SV40 promoter and a polynucleotide encoding an NDV-F antigen inserted in the SORF3-US2 locus of the HVT vector, and an HVT vector comprising an SV40 promoter and a polynucleotide encoding an NDV-F antigen and a Guinea pig CMV promoter and a polynucleotide encoding an IBDV VP2 antigen inserted in the SORF3-US2 locus of the HVT vector.
10. The composition or vaccine of claim 2, wherein the composition or vaccine is a multivalent composition or vaccine further comprising a second recombinant HVT vector comprising a heterologous polynucleotide coding for and expressing IBDV VP2 polypeptide.
11. The composition or vaccine of claim 10, wherein the second recombinant HVT vector is the HVT vector included in VAXXITEK HVT+IBD.
12. The composition or vaccine of claim 2 or 10, wherein the composition further comprises one or more recombinant SB1 vectors or the parental SB1 strain.
13. The composition or vaccine of claim 12, wherein the recombinant SB1 vector comprises one or more heterologous polynucleotides coding for and expressing NDV-F polypeptide or IBDV VP2 polypeptide.
14. The composition or vaccine of claim 2 or 10, wherein the composition or vaccine further optionally comprises a pharmaceutically or veterinarily acceptable carrier, excipient, vehicle or adjuvant.
15. A recombinant HVT vector comprising one or more heterologous polynucleotides coding for and expressing at least one antigen of an avian pathogen, wherein the at least one polynucleotide encodes a Newcastle Disease Virus F (NDV-F) polypeptide and is operably linked to an SV40 promoter, and wherein the polynucleotide is codon-optimized.
16. The recombinant HVT vector of claim 15, wherein HVT vector further comprises, one or more Infectious Bursal Disease Virus (IBDV) VP2 polypeptides.
17. The recombinant HVT vector of claim 15, wherein the HVT vector comprises a first heterologous polynucleotide coding for and expressing an Newcastle NDV-F polypeptide having at least 95% sequence identity to the amino acid sequence as set forth in SEQ ID NO:2, 4, 6, 33, 35, or 37 and one or two heterologous polynucleotides coding for and expressing one or two IBDV VP2 polypeptides having at least 95% sequence identity to the amino acid sequence as set forth in SEQ ID NO:8 or 42.
18. The recombinant HVT vector of claim 15, wherein the polynucleotides encoding NDV-F and IBDV VP2 are inserted in a locus selected from the group consisting of IG2 (intergenic region 2), US10, SORF3-US2, and IG1 (intergenic region 1) of HVT genome.
19. The recombinant HVT vector of claim 15, wherein the one or two polynucleotides encoding the IBDV VP2 antigen is operably linked to CMV promoter, guinea pig CMV promoter, or a combination thereof.
20. The recombinant HVT vector of claim 15, wherein the HVT vector is selected from the group consisting of an HVT vector comprising an SV40 promoter and a polynucleotide encoding an NDV-F antigen inserted in the IG2 locus of the HVT vector, an HVT vector comprising an US10 promoter and a polynucleotide encoding an NDV-F antigen inserted in the US10 locus of the HVT vector, an HVT vector comprising an SV40 promoter and a polynucleotide encoding an NDV-F antigen inserted in the SORF3-US2 locus of the HVT vector, and an HVT vector comprising an SV40 promoter and a polynucleotide encoding an NDV-F antigen and a Guinea pig CMV promoter and a polynucleotide encoding an IBDV VP2 antigen inserted in the SORF3-US2 locus of the HVT vector.
21. A method of vaccinating an animal or inducing an immunogenic or protective response in an animal against one or more avian pathogens comprising at least one administration of the composition of claim 1 or vector of claim 15.
22. The method of claim 21, wherein the avian pathogen is selected from the group consisting of Newcastle Disease Virus (NDV), Infectious Bursal Disease Virus (i.e., IBDV or Gumboro Disease virus), Marek's Disease Virus (MDV), Infectious Laryngotracheitis Virus (ILTV), avian encephalomyelitis virus, avian reovirus, avian paramyxovirus, avian metapneumovirus, avian influenza virus, avian adenovirus, fowl pox virus, avian coronavirus, avian rotavirus, avian parvovirus, avian astrovirus and chick anemia virus coccidiosis (Eimeria sp.), Campylobacter sp., Salmonella sp., Mycoplasma gallisepticum, Mycoplasma synoviae, Pasteurella sp., Avibacterium sp., E. coli and Clostridium sp.
23. The method of claim 21, wherein the animal is avian.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1) The following detailed description, given by way of example, and which is not intended to limit the invention to specific embodiments described, may be understood in conjunction with the accompanying figures, incorporated herein by reference, in which:
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
DETAILED DESCRIPTION OF THE INVENTION
(16) It is noted that in this disclosure and particularly in the claims, terms such as comprises, comprised, comprising and the like can have the meaning attributed to it in U.S. patent law; e.g., they can mean includes, included, including, and the like; and that terms such as consisting essentially of and consists essentially of have the meaning ascribed to them in U.S. patent law, e.g., they allow for elements not explicitly recited, but exclude elements that are found in the prior art or that affect a basic or novel characteristic of the invention.
(17) Unless otherwise noted, technical terms are used according to conventional usage. Definitions of common terms in molecular biology may be found in Benjamin Lewin, Genes V. published by Oxford University Press, 1994 (ISBN 0-19-854287-9); Kendrew et al. (eds.), The Encyclopedia of Molecular Biology, published by Blackwell Science Ltd., 1994 (ISBN 0-632-02182-9); and Robert A. Meyers (ed.), Molecular Biology and Biotechnology: a Comprehensive Desk Reference, published by VCH Publishers, Inc., 1995 (ISBN 1-56081-569-8).
(18) The singular terms a, an, and the include plural referents unless context clearly indicates otherwise. Similarly, the word or is intended to include and unless the context clearly indicate otherwise. The word or means any one member of a particular list and also includes any combination of members of that list.
(19) The term animal is used herein to include all mammals, birds and fish. The animal as used herein may be selected from the group consisting of equine (e.g., horse), canine (e.g., dogs, wolves, foxes, coyotes, jackals), feline (e.g., lions, tigers, domestic cats, wild cats, other big cats, and other felines including cheetahs and lynx), bovine (e.g., cattle), swine (e.g., pig), ovine (e.g., sheep, goats, lamas, bisons), avian (e.g., chicken, duck, goose, turkey, quail, pheasant, parrot, finches, hawk, crow, ostrich, emu and cassowary), primate (e.g., prosimian, tarsier, monkey, gibbon, ape), humans, and fish. The term animal also includes an individual animal in all stages of development, including embryonic and fetal stages.
(20) The terms polypeptide and protein are used interchangeably herein to refer to a polymer of consecutive amino acid residues.
(21) The term nucleic acid, nucleotide, and polynucleotide are used interchangeably and refer to RNA, DNA, cDNA, or cRNA and derivatives thereof, such as those containing modified backbones. It should be appreciated that the invention provides polynucleotides comprising sequences complementary to those described herein. The polynucleotide contemplated in the present invention includes both the forward strand (5 to 3) and reverse complementary strand (3 to 5). Polynucleotides according to the invention can be prepared in different ways (e.g. by chemical synthesis, by gene cloning etc.) and can take various forms (e.g. linear or branched, single or double stranded, or a hybrid thereof, primers, probes etc.).
(22) The term genomic DNA or genome is used interchangeably and refers to the heritable genetic information of a host organism. The genomic DNA comprises the DNA of the nucleus (also referred to as chromosomal DNA) but also the DNA of the plastids (e.g., chloroplasts) and other cellular organelles (e.g., mitochondria). The genomic DNA or genome contemplated in the present invention also refers to the RNA of a virus. The RNA may be a positive strand or a negative strand RNA. The term genomic DNA contemplated in the present invention includes the genomic DNA containing sequences complementary to those described herein. The term genomic DNA also refers to messenger RNA (mRNA), complementary DNA (cDNA), and complementary RNA (cRNA).
(23) The term gene is used broadly to refer to any segment of polynucleotide associated with a biological function. Thus, genes or polynucleotides include introns and exons as in genomic sequence, or just the coding sequences as in cDNAs, such as an open reading frame (ORF), starting from the start codon (methionine codon) and ending with a termination signal (stop codon). Genes and polynucleotides can also include regions that regulate their expression, such as transcription initiation, translation and transcription termination. Thus, also included are promoters and ribosome binding regions (in general these regulatory elements lie approximately between 60 and 250 nucleotides upstream of the start codon of the coding sequence or gene; Doree S M et al.; Pandher K et al.; Chung J Y et al.), transcription terminators (in general the terminator is located within approximately 50 nucleotides downstream of the stop codon of the coding sequence or gene; Ward C K et al.). Gene or polynucleotide also refers to a nucleic acid fragment that expresses mRNA or functional RNA, or encodes a specific protein, and which includes regulatory sequences.
(24) The term heterologous DNA as used herein refers to the DNA derived from a different organism, such as a different cell type or a different species from the recipient. The term also refers a DNA or fragment thereof on the same genome of the host DNA wherein the heterologous DNA is inserted into a region of the genome which is different from its original location.
(25) As used herein, the term antigen or immunogen means a substance that induces a specific immune response in a host animal. The antigen may comprise a whole organism, killed, attenuated or live; a subunit or portion of an organism; a recombinant vector containing an insert with immunogenic properties; a piece or fragment of DNA capable of inducing an immune response upon presentation to a host animal; a polypeptide, an epitope, a hapten, or any combination thereof. Alternately, the immunogen or antigen may comprise a toxin or antitoxin.
(26) The term immunogenic protein or peptide as used herein includes polypeptides that are immunologically active in the sense that once administered to the host, it is able to evoke an immune response of the humoral and/or cellular type directed against the protein. Preferably the protein fragment is such that it has substantially the same immunological activity as the total protein. Thus, a protein fragment according to the invention comprises or consists essentially of or consists of at least one epitope or antigenic determinant. An immunogenic protein or polypeptide, as used herein, includes the full-length sequence of the protein, analogs thereof, or immunogenic fragments thereof. By immunogenic fragment is meant a fragment of a protein which includes one or more epitopes and thus elicits the immunological response described above. Such fragments can be identified using any number of epitope mapping techniques, well known in the art. For example, linear epitopes may be determined by e.g., concurrently synthesizing large numbers of peptides on solid supports, the peptides corresponding to portions of the protein molecule, and reacting the peptides with antibodies while the peptides are still attached to the supports. Similarly, conformational epitopes are readily identified by determining spatial conformation of amino acids such as by, e.g., x-ray crystallography and 2-dimensional nuclear magnetic resonance.
(27) The term immunogenic protein or peptide further contemplates deletions, additions and substitutions to the sequence, so long as the polypeptide functions to produce an immunological response as defined herein. The term conservative variation denotes the replacement of an amino acid residue by another biologically similar residue, or the replacement of a nucleotide in a nucleic acid sequence such that the encoded amino acid residue does not change or is another biologically similar residue. In this regard, particularly preferred substitutions will generally be conservative in nature, i.e., those substitutions that take place within a family of amino acids. For example, amino acids are generally divided into four families: (1) acidicaspartate and glutamate; (2) basiclysine, arginine, histidine; (3) non-polaralanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan; and (4) uncharged polarglycine, asparagine, glutamine, cysteine, serine, threonine, tyrosine. Phenylalanine, tryptophan, and tyrosine are sometimes classified as aromatic amino acids. Examples of conservative variations include the substitution of one hydrophobic residue such as isoleucine, valine, leucine or methionine for another hydrophobic residue, or the substitution of one polar residue for another polar residue, such as the substitution of arginine for lysine, glutamic acid for aspartic acid, or glutamine for asparagine, and the like; or a similar conservative replacement of an amino acid with a structurally related amino acid that will not have a major effect on the biological activity. Proteins having substantially the same amino acid sequence as the reference molecule but possessing minor amino acid substitutions that do not substantially affect the immunogenicity of the protein are, therefore, within the definition of the reference polypeptide. All of the polypeptides produced by these modifications are included herein. The term conservative variation also includes the use of a substituted amino acid in place of an unsubstituted parent amino acid provided that antibodies raised to the substituted polypeptide also immunoreact with the unsubstituted polypeptide.
(28) The term epitope refers to the site on an antigen or hapten to which specific B cells and/or T cells respond. The term is also used interchangeably with antigenic determinant or antigenic determinant site. Antibodies that recognize the same epitope can be identified in a simple immunoassay showing the ability of one antibody to block the binding of another antibody to a target antigen.
(29) An immunological response to a composition or vaccine is the development in the host of a cellular and/or antibody-mediated immune response to a composition or vaccine of interest. Usually, an immunological response includes but is not limited to one or more of the following effects: the production of antibodies, B cells, helper T cells, and/or cytotoxic T cells, directed specifically to an antigen or antigens included in the composition or vaccine of interest. Preferably, the host will display either a therapeutic or protective immunological response such that resistance to new infection will be enhanced and/or the clinical severity of the disease reduced. Such protection will be demonstrated by either a reduction or lack of symptoms normally displayed by an infected host, a quicker recovery time and/or a lowered viral titer in the infected host.
(30) The terms recombinant and genetically modified are used interchangeably and refer to any modification, alteration or engineering of a polynucleotide or protein in its native form or structure, or any modification, alteration or engineering of a polynucleotide or protein in its native environment or surrounding. The modification, alteration or engineering of a polynucleotide or protein may include, but is not limited to, deletion of one ore more nucleotides or amino acids, deletion of an entire gene, codon-optimization of a gene, conservative substitution of amino acids, insertion of one or more heterologous polynucleotides.
(31) The term double HVT construct or double HVT vector refers to an HVT viral vector comprising two heterologous polynucleotides.
(32) The terms polyvalent vaccine or composition, combination or combo vaccine or composition and multivalent vaccine or composition are used interchangeably to refer to a composition or vaccine containing more than one composition or vaccines. The polyvalent vaccine or composition may contain two, three, four or more compositions or vaccines. The polyvalent vaccine or composition may comprise recombinant viral vectors, active or attenuated or killed wild-type viruses, or a mixture of recombinant viral vectors and wild-type viruses in active or attenuated or killed forms.
(33) One embodiment of the invention provides a recombinant HVT viral vector comprising one or more heterologous polynucleotides coding for and expressing at least one antigen or polypeptide of an avian pathogen. The HVT strains used for the recombinant viral vector may be any HVT strains, including, but not limited to, the HVT strain FC126 (Igarashi T. et al., J. Gen. Virol. 70, 1789-1804, 1989).
(34) Another embodiment of the invention provides a recombinant SB-1 viral vector comprising one or more heterologous polynucleotides coding for and expressing at least one antigen or polypeptide of an avian pathogen. The SB-1 strains may be any SB-1 strains, including, but not limited to, the commercial Marek's Disease Vaccine (SB-1 vaccine) (Merial Select Inc., Gainesville, Ga. 30503, USA), the SB-1 strain having the genome sequence as defined by GenBank Accession Number HQ840738.1.
(35) The genes coding for antigen or polypeptide may be those coding for Newcastle Disease Virus fusion protein (NDV-F), Newcastle Disease Virus hemagglutinin neuraminidase (NDV-HN), Marek's Disease Virus glycoprotein C (gC), Marek's Disease Virus glycoprotein B (gB), Marek's Disease Virus glycoprotein E (gE), Marek's Disease Virus glycoprotein I (gI), Marek's Disease Virus glycoprotein H (gH) or Marek's Disease Virus glycoprotein L (gL), Infectious Bursal Disease Virus (IBDV) VP2, IBDV VPX, IBDV VP3, IBDV VP4, ILTV glycoprotein B, ILTV glycoprotein I, ILTV UL32, ILTV glycoprotein D, ILTV glycoprotein E, ILTV glycoprotein C, influenza hemaglutinin (HA), influenza neuraminidase (NA), protective genes derived from Mycoplasma gallisepticum (MG), or Mycoplasma synoviae (MS), or combinations thereof. The antigen or polypeptide may be any antigen from the poultry pathogen selected form the group consisting of avian encephalomyelitis virus, avian reovirus, avian paramyxovirus, avian metapneumovirus, avian influenza virus, avian adenovirus, fowl pox virus, avian coronavirus, avian rotavirus, chick anemia virus, avian astrovirus, avian parvovirus, coccidiosis (Eimeria sp.), Campylobacter sp., Salmonella sp., Pasteurella sp., Avibacterium sp., Mycoplasma gallisepticum, Mycoplasma synoviae, Clostridium sp., and E. coli.
(36) Moreover, homologs of aforementioned antigen or polynucleotides are intended to be within the scope of the present invention. As used herein, the term homologs includes orthologs, analogs and paralogs. The term analogs refers to two polynucleotides or polypeptides that have the same or similar function, but that have evolved separately in unrelated organisms. The term orthologs refers to two polynucleotides or polypeptides from different species, but that have evolved from a common ancestral gene by speciation. Normally, orthologs encode polypeptides having the same or similar functions. The term paralogs refers to two polynucleotides or polypeptides that are related by duplication within a genome. Paralogs usually have different functions, but these functions may be related. Analogs, orthologs, and paralogs of a wild-type polypeptide can differ from the wild-type polypeptide by post-translational modifications, by amino acid sequence differences, or by both. In particular, homologs of the invention will generally exhibit at least 80-85%, 85-90%, 90-95%, or 95%, 96%, 97%, 98%, 99% sequence identity, with all or part of the polynucleotide or polypeptide sequences of antigens described above, and will exhibit a similar function.
(37) In one embodiment, the present invention provides a recombinant HVT or SB-1 viral vector comprising one or more heterologous polynucleotides coding for and expressing the NDV-F antigen or polypeptide. In one aspect of the embodiment, the NDV-F antigen or polypeptide has at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity to a polypeptide having the sequence as set forth in SEQ ID NO:2, 4, or 6, or a conservative variant, an allelic variant, a homolog or an immunogenic fragment comprising at least eight or at least ten consecutive amino acids of one of these polypeptides, or a combination of these polypeptides. In another aspect of the embodiment, the heterologous polynucleotide encoding an NDV-F antigen or polypeptide having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity to a polypeptide having the sequence as set forth in SEQ ID NO:2, 4, or 6. In yet another aspect of the embodiment, the heterologous polynucleotide has at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity to a polynucleotide having the sequence as set forth in SEQ ID NO:1, 3, or 5.
(38) Variants include allelic variants. The term allelic variant refers to a polynucleotide or a polypeptide containing polymorphisms that lead to changes in the amino acid sequences of a protein and that exist within a natural population (e.g., a virus species or variety). Such natural allelic variations can typically result in 1-5% variance in a polynucleotide or a polypeptide. Allelic variants can be identified by sequencing the nucleic acid sequence of interest in a number of different species, which can be readily carried out by using hybridization probes to identify the same gene genetic locus in those species. Any and all such nucleic acid variations and resulting amino acid polymorphisms or variations that are the result of natural allelic variation and that do not alter the functional activity of gene of interest, are intended to be within the scope of the invention.
(39) The term identity with respect to sequences can refer to, for example, the number of positions with identical nucleotides or amino acids divided by the number of nucleotides or amino acids in the shorter of the two sequences wherein alignment of the two sequences can be determined in accordance with the Wilbur and Lipman algorithm (Wilbur and Lipman). The sequence identity or sequence similarity of two amino acid sequences, or the sequence identity between two nucleotide sequences can be determined using Vector NTI software package (Invitrogen, 1600 Faraday Ave., Carlsbad, Calif.). When RNA sequences are said to be similar, or have a degree of sequence identity or homology with DNA sequences, thymidine (T) in the DNA sequence is considered equal to uracil (U) in the RNA sequence. Thus, RNA sequences are within the scope of the invention and can be derived from DNA sequences, by thymidine (T) in the DNA sequence being considered equal to uracil (U) in RNA sequences.
(40) The polynucleotides of the disclosure include sequences that are degenerate as a result of the genetic code, e.g., optimized codon usage for a specific host. As used herein, optimized refers to a polynucleotide that is genetically engineered to increase its expression in a given species. To provide optimized polynucleotides coding for NDV-F polypeptides, the DNA sequence of the NDV-F protein gene can be modified to 1) comprise codons preferred by highly expressed genes in a particular species; 2) comprise an A+T or G+C content in nucleotide base composition to that substantially found in said species; 3) form an initiation sequence of said species; or 4) eliminate sequences that cause destabilization, inappropriate polyadenylation, degradation and termination of RNA, or that form secondary structure hairpins or RNA splice sites. Increased expression of NDV F protein in said species can be achieved by utilizing the distribution frequency of codon usage in eukaryotes and prokaryotes, or in a particular species. The term frequency of preferred codon usage refers to the preference exhibited by a specific host cell in usage of nucleotide codons to specify a given amino acid. There are 20 natural amino acids, most of which are specified by more than one codon. Therefore, all degenerate nucleotide sequences are included in the disclosure as long as the amino acid sequence of the NDV-F polypeptide encoded by the nucleotide sequence is functionally unchanged.
(41) Successful expression of the heterologous polynucleotides by the recombinant/modified infectious virus requires two conditions. First, the heterologous polynucleotides must be inserted or introduced into a region of the genome of the virus in order that the modified virus remains viable. The second condition for expression of inserted heterologous polynucleotides is the presence of a regulatory sequences allowing expression of the gene in the viral background (for instance: promoter, enhancer, donor and acceptor splicing sites and intron, Kozak translation initiation consensus sequence, polyadenylation signals, untranslated sequence elements).
(42) The insertion site may be any non-essential region of the HVT genome, including, but not limited to, the region between the ATG of ORF UL55 and the junction of UL with the adjacent repeat region (U.S. Pat. No. 5,980,906), the IG1 locus, the IG2 locus, the IG3 locus, the UL43 locus, the US10 locus, the SORF3/US2 locus (see
(43) In general, it is advantageous to employ a strong promoter functional in eukaryotic cells. The promoters include, but are not limited to, an immediate early cytomegalovirus (CMV) promoter, an SV40 promoter, Pseudorabies Virus promoters such as that of glycoprotein X promoter, Herpes Simplex Virus-1 such as the alpha 4 promoter, Marek's Disease Viruses (including MDV-1, MDV-2 and HVT) promoters such as those driving glycoproteins gC, gB, gE, or gI expression, Infectious Laryngotracheitis Virus promoters such as those of glycoprotein gB, gE, gI, gD genes, or other herpesvirus promoters.
(44) One embodiment of the invention provides a recombinant HVT vector comprising a heterologous polynucleotide coding for and expressing the NDV-F antigen or polypeptide. In one aspect of the embodiment, the polynucleotide encoding the NDV-F polypeptide is operably linked to the SV40 promoter having the sequence as set forth in SEQ ID NO:9 and therefore the expression of the NDV-F antigen or polypeptide is regulated by the SV40 promoter. In another aspect of the embodiment, the expression of NDV-F antigen or polypeptide is regulated by the SV40 polyA signal having the sequence as set forth in SEQ ID NO:11.
(45) Another embodiment of the invention provides a recombinant double HVT vector comprising a first heterologous polynucleotide coding for and expressing the NDV-F antigen or polypeptide and a second polynucleotide coding for and expressing the IBDV VP2 antigen or polypeptide. In one aspect of the embodiment, the NDV-F antigen or polypeptide has at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity to a polypeptide having the sequence as set forth in SEQ ID NO:2, 4, or 6. In another aspect of the embodiment, the IBDV VP2 antigen or polypeptide has at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity to a polypeptide having the sequence as set forth in SEQ ID NO:8. In another aspect, the polynucleotide encoding the NDV-F polypeptide is operably linked to the SV40 promoter having the sequence as set forth in SEQ ID NO:9 and the expression of NDV-F antigen or polypeptide is regulated by the SV40 promoter. In yet another aspect, the expression of NDV-F antigen or polypeptide is regulated by the SV40 polyA signal having the sequence as set forth in SEQ ID NO:11, or the synthetic polyA singal having the sequence as set forth in SEQ ID NO:12. In another aspect, the expression of IBDV VP2 antigen or polypeptide is regulated by the CMV-IE promoter having the sequence as set forth in SEQ ID NO:10 and the SV40 polyA signal having the sequence as set forth in SEQ ID NO:11.
(46) In one embodiment, the present invention relates to a pharmaceutical composition or vaccine comprising one or more recombinant HVT or SB-1 rival vectors of the present invention and a pharmaceutically or veterinarily acceptable carrier, excipient, vehicle or adjuvant.
(47) In another embodiment, the present invention provides a composition or vaccine comprising an HVT viral vector comprising a polynucleotide encoding an NDV-F antigen, an SV40 promoter, and optionally a pharmaceutically or veterinarily acceptable carrier, excipient, vehicle or adjuvant. In another embodiment, the present invention provides a pharmaceutical composition or vaccine comprising a first HVT vector comprising a polynucleotide encoding an NDV-F antigen, a second HVT vector comprising a polynucleotide encoding an IBDV VP2 antigen, and optionally a pharmaceutically or veterinarily acceptable carrier, excipient, vehicle or adjuvant. In another embodiment, the present invention provides a pharmaceutical composition or vaccine comprising an HVT vector comprising a polynucleotide encoding an NDV-F antigen, an SB-1 vector comprising a polynucleotide encoding an NDV-F antigen, optionally a pharmaceutically or veterinarily acceptable carrier, excipient, vehicle or adjuvant. The pharmaceutical composition or vaccine of the present invention may comprise a first HVT vector comprising a polynucleotide encoding an NDV-F antigen, a second HVT vector comprising a polynucleotide encoding an IBDV VP2 antigen, an SB-1 vector comprising a polynucleotide encoding an NDV-F antigen, optionally a pharmaceutically or veterinarily acceptable carrier, excipient, vehicle or adjuvant.
(48) In yet another embodiment, the present invention provides a composition or vaccine comprising a double HVT viral vector comprising: i) a first heterologous polynucleotide coding for and expressing an NDV-F antigen or polypeptide; ii) a second polynucleotide coding for and expressing an IBDV VP2 antigen or polypeptide; and iii) optionally a pharmaceutically or veterinarily acceptable carrier, excipient, vehicle or adjuvant. In yet another embodiment, the composition comprising the double HVT viral vector further comprises an HVT vector comprising a polynucleotide encoding an IBDV VP2 antigen, or an SB-1 vector comprising a polynucleotide encoding an NDV-F antigen, or a combination thereof.
(49) The pharmaceutically or veterinarily acceptable carriers or adjuvant or vehicles or excipients are well known to the one skilled in the art. For example, a pharmaceutically or veterinarily acceptable carrier or adjuvant or vehicle or excipient can be Marek's disease vaccine diluent used for MD vaccines. Other pharmaceutically or veterinarily acceptable carrier or adjuvant or vehicle or excipients that can be used for methods of this invention include, but are not limited to, 0.9% NaCl (e.g., saline) solution or a phosphate buffer, poly-(L-glutamate) or polyvinylpyrrolidone. The pharmaceutically or veterinarily acceptable carrier or vehicle or excipients may be any compound or combination of compounds facilitating the administration of the vector (or protein expressed from an inventive vector in vitro), or facilitating transfection or infection and/or improve preservation of the vector (or protein). Doses and dose volumes are herein discussed in the general description and can also be determined by the skilled artisan from this disclosure read in conjunction with the knowledge in the art, without any undue experimentation.
(50) Optionally other compounds may be added as pharmaceutically or veterinarily acceptable carriers or adjuvant or vehicles or excipients, including, but not limited to, alum; CpG oligonucleotides (ODN), in particular ODN 2006, 2007, 2059, or 2135 (Pontarollo R. A. et al., Vet. Immunol. Immunopath, 2002, 84: 43-59; Wernette C. M. et al., Vet. Immunol. Immunopath, 2002, 84: 223-236; Mutwiri G. et al., Vet. Immunol. Immunopath, 2003, 91: 89-103); polyA-polyU, dimethyldioctadecylammonium bromide (DDA) (Vaccine Design The Subunit and Adjuvant Approach, edited by Michael F. Powell and Mark J. Newman, Pharmaceutical Biotechnology, 6: p. 03, p. 157); N,N-dioctadecyl-N,N-bis(2-hydroxyethyl) propanediamine (such as AVRIDINE) (Ibid, p. 148); carbomer, chitosan (see U.S. Pat. No. 5,980,912 for example).
(51) The pharmaceutical compositions and vaccines according to the invention may comprise or consist essentially of one or more adjuvants. Suitable adjuvants for use in the practice of the present invention are (1) polymers of acrylic or methacrylic acid, maleic anhydride and alkenyl derivative polymers, (2) immunostimulating sequences (ISS), such as oligodeoxyribonucleotide sequences having one or more non-methylated CpG units (Klinman et al., 1996; WO98/16247), (3) an oil in water emulsion, such as the SPT emulsion described on p 147 of Vaccine Design, The Subunit and Adjuvant Approach published by M. Powell, M. Newman, Plenum Press 1995, and the emulsion MF59 described on p 183 of the same work, (4) cation lipids containing a quaternary ammonium salt, e.g., DDA (5) cytokines, (6) aluminum hydroxide or aluminum phosphate, (7) saponin or (8) other adjuvants discussed in any document cited and incorporated by reference into the instant application, or (9) any combinations or mixtures thereof.
(52) Another aspect of the invention relates to a method for inducing an immunological response in an animal against one or more antigens or a protective response in an animal against one or more avian pathogens, which method comprises inoculating the animal at least once with the vaccine or pharmaceutical composition of the present invention. Yet another aspect of the invention relates to a method for inducing an immunological response in an animal to one or more antigens or a protective response in an animal against one or more avian pathogens in a prime-boost administration regimen, which is comprised of at least one primary administration and at least one booster administration using at least one common polypeptide, antigen, epitope or immunogen. The immunological composition or vaccine used in primary administration may be same, may be different in nature from those used as a booster.
(53) The avian pathogens may be Newcastle Disease Virus (NDV), Infectious Bursal Disease Virus (i.e., IBDV or Gumboro Disease virus), Marek's Disease Virus (MDV), Infectious Laryngotracheitis Virus (ILTV), avian encephalomyelitis virus, avian reovirus, avian paramyxovirus, avian metapneumovirus, avian influenza virus, avian adenovirus, fowl pox virus, avian coronavirus, avian rotavirus, avian parvovirus, avian astrovirus and chick anemia virus coccidiosis (Eimeria sp.), Campylobacter sp., Salmonella sp., Mycoplasma gallisepticum, Mycoplasma synoviae, Pasteurella sp., Avibacterium sp., E. coli or Clostridium sp.
(54) Usually, one administration of the vaccine is performed either at one day-of-age by the subcutaneous or intramuscular route or in ovo in 17-19 day-old embryo. A second administration can be done within the first 10 days of age. The animals are preferably at least 17 day-embryo or one day old at the time of the first administration.
(55) A variety of administration routes in day-old chicks may be used such as subcutaneously or intramuscularly, intradermally, transdermally. The in ovo vaccination can be performed in the amniotic sac and/or the embryo. Commercially available in ovo and SC administration devices can be used for vaccination.
(56) The invention will now be further described by way of the following non-limiting examples.
EXAMPLES
(57) Construction of DNA inserts, plasmids and recombinant viral vectors was carried out using the standard molecular biology techniques described by J. Sambrook et al. (Molecular Cloning: A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y., 1989).
Example 1
Construction of Recombinant vHVT114 Expressing NDV-F
Preparation of Donor Plasmid pHM103+Fopt
(58) The plasmid pHM103 (Merial Limited) containing the Intergenic I arms of HVT FC126 (see
Generation of Recombinant HVT Viral Vector
(59) An in vitro recombination (IVR) was performed by co-electroporation of secondary chicken embryo fibroblast cells (2 CEF cells) using pHM103+Fopt as the donor plasmid and viral DNA isolated from the HVT strain FC126. Co-electroporation was performed using 110.sup.7 2 CEF in 300 ul Opti-MEM and shocked at 150 volts with 950 capacitance in a 2 mm electroporation cuvette. The transfected cells were seeded into 96-well plate and incubated for 5 days. The cells grown in the 96-well plate were then duplicated into two 96-well plates. One set of 96-well plates was used for IFA using chicken polyclonal sera against NDV-F to identify positive wells containing recombinants and another set of 96-well plates was used for recovering the infected cells from the positive wells.
(60) The recombinant viral purification was performed first by 96-well plate duplication and IFA selection for the wells containing the most IFA positive plaques with the least amount of IFA negative plaques. Wells matching those criteria were then harvested and adjusted to 1 ml in DMEM+2% FBS. From the 1 ml stock, 5-20 ul were removed and mixed with 110.sup.7 CEFs in 10 ml DMEM+2% FBS and aliquoted onto a new 96-well plate to have single HVT plaques per well. The supernatant of the wells that contained single plaques were tested for the absence of parental virus by PCR. After five rounds of plaque purification, a recombinant virus designated as vHVT114 was isolated and the purity was tested by IFA and PCR to confirm NDV-F expression and the absence of parental virus.
PCR Analysis of Recombinant vHVT114
(61) DNA was extracted from vHVT114 by phenol/chloroform extraction, ethanol precipitated, and was resuspended in 20 mM HEPES. PCR primers (shown in Table 1) were designed to specifically identify the presence of the codon optimized NDV-F, the SV40 promoter, as well as, the purity of the recombinant virus from FC126 CL2 parental virus. PCR was performed using 200 ng of DNA template along with the specified primers pairs indicted in Table 1. PCR cycling conditions are as follows: 94 C. for 2 mins; 30 cycles of 94 C. for 30 secs, 55 C. for 30 secs, 68 C. for 3 mins; 68 C. for 5 mins. The expected PCR products are shown in Table 2. The PCR results are shown in
(62) TABLE-US-00001 TABLE1 SEQ primer IDNO Sequence5-3 MB080 13 CGAACAAACTTCATCGCTATGC MB081 14 TAACTCAAATGCGAAGCGTTGC optF 15 ACTGACAACACCCTACATGGC VlloptFRP 16 GCCAGCACCAGGCTCAGGG SV40promoterF 17 AGCTTGGCTGTGGAATGT
(63) TABLE-US-00002 TABLE 2 Expected size (bp) Primer pairs FC126 CL21 vHVT114 MB081 + VIIoptF.RP 2138 SV40promoterF + MB080 2368 OptFprimer + MB080 872 MB080 + MB081 323 2578
Expression Analysis of Recombinant vHVT114
(64) Immunofluorescence testing was performed using the vHVT114 which was passaged over ten times beyond an experimental pre-master seed (pre-MSV). The pre-MSV and pre-MSV+12 materials were diluted 1:100 in media. Fifty microliters of the diluted virus was added to 10 ml of DMEM+2% FBS with 110.sup.7 CEFs and then aliquoted onto a 96 well plate (100 ul/well). The plates were incubated for 3 days at 37 C.+5% CO.sub.2 until viral plaques were visible. The plates were fixed with 95% ice-cold acetone for three minutes and washed three times with PBS. Chicken anti-sera against Newcastle Disease Virus (lot #C0139, Charles Rivers Laboratory) at 1:1000 were added along with monoclonal antibody L-78 (Merial Limited) at 1:3000 and the plates were incubated at 37 C. for 1 hour. After the 1 hour incubation the plates were washed three times with PBS and FITC anti-chicken (cat #F8888, Sigma) was added along with Alexz Fluor 568 donkey anti-mouse (IgG) (cat #A 10037, Molecular Probe) at 1:500. Again the plates were incubated at 37 C. for 1 hour. After the 1 hour incubation the cells were rinsed three times with PBS. A small amount of PBS was added to prevent the monolayer from drying and causing auto fluorescence. The cells were then visualized with a fluorescent microscope using both the tetramethylrhodamine isothiocyanate (TRITC) and fluorescein isothiocyanate (FITC) filters in combination.
(65) The vHVT114 viral plaques were visualized using both the TRITC and FITC filters for the dual staining. The FITC test showed the NDV-F expression and the TRITC test showed the HVT expression. Because of the small wells of the 96 well plates, each well was recorded with the plaques first counted with the TRITC filter and then recounted with the FITC filter. Over 500 plaques were counted for the pre-MSV and pre-MSV+12 passage. All the plaques were positive for both the FITC and TRITC on both plates. (
Southern Blot Analysis of Recombinant vHVT114
(66) Total genomic DNA was extracted from HVT FC126 and vHVT114 according to the standard genomic DNA extraction protocol. For each restriction digest, 3 g of genomic DNA (1 ng for the donor plasmid) was used with a total digestion volume of 20 l for each sample. The genomic DNA of HVT FC126 (negative control), pHM103+Fopt donor plasmid, and vHVT114 were each digested overnight at 37 C. with BamHI, PstI, SphI, and NcoI restriction endonucleases. The restriction fragments of HVT FC126 (negative control), pHM103+Fopt donor plasmid, and vHVT114 genomic DNA were separated by a 1% agarose gel and transferred to a positively charged Nylon membrane. Following the North2South Chemiluminescent Hybridization and Detection Kit (Thermo Scientific) manufacturers' instructions, the membrane was pre-hybridized for 1 hr and then hybridized with a biotinylated NDV-F probe overnight at 55 C. Following the overnight hybridization, several stringency washes were performed until the membrane was placed in blocking buffer with the addition of Streptavidin-HRP. After rinsing the membrane of any unbound Streptavidin-HRP the substrate solution of Luminal and peroxide were added. The membrane was then exposed to X-ray film and developed. Areas where the biotinylated probe bound to the DNA were chemiluminescent and were captured by the X-ray film. Table 3 shows the expected Southern blot bands using the NDV-F probe. The Southern blot results showed the digestion patterns as expected (
(67) TABLE-US-00003 TABLE 3 NDV-F Probe Restriction Donor plasmid Endonuclease pHM103 + Fopt vHVT114 FC126 CL2 BamHl 7.014 6.630 0.198 1.259 0.198 Pstl 5.481 6.359 0.947 0.947 0.784 0.784 Sphl 4.763 2.377 2.377 2.119 0.072 0.072 Ncol 4.931 3.753 2.157 2.157 0.124 0.124
Sequence Analysis of the Inserted Region in Recombinant vHVT114
(68) Analysis of vHVT114 genomic DNA region was performed by PCR amplification. Total of 10 primers were used to amplify the entire cassette, as well as, beyond the flanking BamHI-I arms used in the donor plasmid. The 4.727 kb PCR product was gel purified and the entire fragment was sequenced using the sequencing primers. The sequence result confirmed that the vHVT114 contains the correct SV40 promoter, the codon-optimized NDV-F and the SV40 polyA sequences that match exactly the sequence described for the donor plasmid pHM103+Fopt in SEQ ID NO:18.
Western Blot Analysis of Recombinant vHVT114
(69) Approximately 210.sup.6 chicken fibroblast cells were infected at 0.1 MOI with vHVT114 Pre-MSV. After two days of incubation at 37 C., infected as well as uninfected cells were harvested using a cell scraper after removing the media and rinsing with PBS. The cells were harvested with 1 ml of PBS and centrifuged. The cell pellets were lysed by following the Pierce Classic IP Kit (cat #26146, Thermo Scientific). 100 l of the anti-NDV-F monoclonal antibody 001C3 (Merial Limited) was used to form the immune complex. The antibody/lysate sample was added to Protein A/G Plus Agarose to capture the immune complex. The immune complex was washed three times to remove non-bound material and then eluted in 50 ul volume using sample buffer elution under non-reducing condition. After boiling for 5 minutes, 10 l of the samples were loaded into a 10% Acrylamide gel (Invitrogen). The PAGE gel was run in MOPS buffer (Invitrogen) at 200 volts for 1 hour. Then the gel was transferred onto a PVDF membrane.
(70) The Protein Detector Western Blot Kit TMB System (KPL, cat #54-11-50) was used for blotting the PVDF membrane by using the reagents and following manufacturer's directions. After blocking the membrane for 1 hour at room temperature, the membrane was then rinsed three times in 1 Wash Buffer, five minutes each and then soaked in blocking buffer containing 1:1000 dilution of chicken serum raised against NDV virus (Lot #C0139, Charles River Laboratories). After washing three times in a washing buffer, the membrane was incubated with a peroxidase labeled goat anti-chicken IgG (KPL, cat #14-24-06) at a dilution of 1:2000 for 1 hour at room temperature. The membrane was then rinsed three times in 1 Wash Buffer, five minutes each. 5 ml of TMB membrane peroxidase substrate was added to the membrane and gently rocked for about 1 minute. The developing reaction was stopped by placing the membrane into water.
(71) The immunoprecipitation and Western blot technique detected an approximately 55 kD protein in vHVT114 sample that corresponds to the expected size of F1 component of the NDV-F protein (
Example 2
Construction of Recombinant vHVT110, vHVT111 and vHVT116 Expressing NDV-F
(72) Generation and characterization of HVT recombinants vHVT110, vHVT111 and vHVT116 was essentially done in the same way as for vHVT114 described in example 1. Table 4 shows the features unique to each construct around the expression cassettes, including the respective sequences.
(73) TABLE-US-00004 TABLE 4 Characteristics of the expression cassettes of single HVT recombinants Parental Name virus Promoter F gene Poly-A Locus vHVT110 HVT mCMV IE Wt-VIId SV40 IG1 vHVT111 HVT SV40 Wt-VIId SV40 IG1 vHVT114 HVT SV40 Opt-VIId SV40 IG1 vHVT116 HVT SV40 Opt-Ca02 SV40 IG1
vHVT110
(74) The plasmid pCD046 (Merial proprietary material) containing the Intergenic I arms of HVT FC126, mouse CMV promoter and SV40 poly A was digested with NotI, dephosphorylated, and a 6.6 kb fragment was gel extracted. A NotI flanked 1.7 kb fragment of a chemically synthesized NDV-F gene containing wild-type F sequence (SEQ ID NO:3, coding for SEQ ID NO:4) was also NotI digested and the 1.7 kb fragment was gel extracted. The 6.6 and 1.7 kb fragments were ligated to create a donor plasmid pCD046+NDV-F wt (SEQ ID NO:21 for vHVT110) used in transfection to generate recombinant vHVT110. Sequencing of the insert region confirmed that vHVT110 contains the correct sequences of mCMV promoter, the wildtype NDV-F gene and the SV40 polyA. The sequence also exactly matches the sequence described for the donor plasmid pCD046+NDV-F wt in SEQ ID NO:21.
vHVT111
(75) The plasmid pHM103 plasmid (Merial proprietary material) containing the Intergenic I arms of HVT FC126, SV40 promoter and SV40 polyA was digested with NotI, dephosphorylated, and the 5.6 kb fragment was gel extracted. A NotI flanked 1.7 kb fragment of a chemically synthesized NDV-F gene containing wildtype F sequence (SEQ ID NO:3, coding for SEQ ID NO:4) was also NotI digested and a 1.7 kb fragment was gel extracted. The 5.6 and 1.7 kb fragments were ligated to create a donor plasmid (SEQ ID NO:22 for vHVT1110) used in transfection to generate recombinant vHVT111. Sequencing of the insert region confirmed that vHVT111 contains the correct sequences of SV40 promoter, the wildtype NDV-F gene and the SV40 polyA as shown in the sequence of the donor plasmid pHM103+NDV-F wt (SEQ ID NO:22).
vHVT116
(76) The plasmid pHM103 plasmid (Merial proprietary material) containing the Intergenic I arms of HVT FC126, SV40 promoter and SV40 polyA was digested with NotI, dephosphorylated, and the 5.6 kb fragment was gel extracted. A NotI flanked 1.7 kb fragment of a chemically synthesized, codon-optimized, CA02 genotype V NDV-F gene (SEQ ID NO:5, coding for SEQ ID NO:6) was also NotI digested and the 1.7 kb fragment was gel extracted. The 5.6 and 1.7 kb fragments were ligated to create pHM103+NDV-F CA02 (SEQ ID NO:23 for vHVT116) used in transfection to generate recombinant vHVT116. Sequencing of the insert region confirmed that vHVT116 contains the correct sequences of SV40 promoter, the codon-optimized CA02 NDV-F gene and the SV40 polyA as shown in the sequence of the donor plasmid pHM103+NDV-F wt (SEQ ID NO:23).
Discussion
(77) Various cassettes under mCMV or non-CMV promoter were inserted at different loci of HVT genome (Table 4). Despite repeated attempts, generating a construct with a combination of mCMV and codon-optimized F sequence was not successful beyond passage 2. However, when wild-type sequence was driven by mCMV a stable construct, vHVT110 could be generated. In addition, recombinant vHVT111 with wild-type F sequence under SV40 promoter was also stable for more than 10 in vitro passages. Surprisingly, a codon-optimized F sequence under SV40 promoter was similarly found to be stable for more than 10 in vitro passages (e.g. vHVT114 and vHVT116). These results indicate the delicate balance between the strength of the promoter and the nature of the gene they control (codon-optimized or not optimized) in generating a genetically stable HVT construct.
Example 3
Construction of vHVT306, a Double HVT Vector Expressing NDV-F and IBDV VP2
(78) The donor plasmid pHVT US2 SV-Fopt-synPA was constructed containing SV40 promoter, synthetic NDV F codon optimized VII gene, synthetic polyA tail flanked by the SORF3 and US2 arm sequences of HVT FC126.
Generation of Recombinant Virus
(79) A standard homologous recombination procedure was followed by co-electroporation of secondary CEF cells using donor plasmid pHVT US2 SV-Fopt-synPA and viral DNA isolated from vHVT13 (an HVT vector expressing the IBDV VP2 gene, Merial Limited). Essentially the procedure described in example 1 for vHVT114 was followed to generate, plaque purify and characterize recombinants by immunofluorescence.
(80) After two rounds of plaque purification, pure recombinant virus (vHVT306) was isolated and the purity of vHVT306 was tested and confirmed by IFA and PCR.
PCR Analysis
(81) Viral DNA was extracted from vHVT306 pre-master seed virus (pre-MSV) stock by QIA DNeasy Blood & Tissue Kit (Qiagen cat #69506). PCR primers were designed to identify the presence of the NDV F optimized, the NDV F wild type, the SV40 promoter, the mCMV promoter, the flanking arms of US2 HVT virus and SB-1 virus.
(82) PCR amplification with various primers confirmed that the vHVT306 has the expected amplification patterns and amplicons.
Expression Analysis
(83) Indirect immunofluorescent assay (IFA) was performed on the vHVT306 pre-MSV stock. The CEFs that were inoculated with vHVT306 were fixed with ice-cold 95% acetone for three minutes at room temperature and air-dried for 10 min. After three washes with PBS, two primary antibodies, chicken anti-Newcastle Disease Virus sera (Charles Rivers Laboratories cat #10100641, lot #C0117A) at 1:500 dilution and L78 monoclonal antibody against HVT (Merial Select, Gainesville, Ga.) at 1:3000 dilution were added and incubated for 45 min at 37 C. After three washes with PBS, two secondary antibodies, goat anti-chicken IgGfluorescein (KPL cat #.02-24-06, lot #110020) at 1:500 dilution and donkey anti-mouse IgG-Alexa Fluor 568 (Molecular Probe #A10037, lot #989784) at 1:300 dilution were added. The plates were incubated at 37 C. for 45 min and followed by three washes with PBS. The cells were observed to identify the IFA positive plaques with a fluorescent microscope using fluorescein isothiocyanate (FITC)- and tetramethylrhodamine isothiocyanate (TRITC)-filters of Nikon Eclipse Ti inverted microscope.
(84) Similarly the expression of IBDV VP2 protein (SEQ ID NO:8 encoded by SEQ ID NO:7) of vHVT306 were examined by IFA using chicken anti-IBDV sera (Charles River Laboratories cat #10100610 lot #G0117) (1:500 dilution) and anti-NDV F monoclonal antibody 001C3 (Asceitic fluid, Batch 10/09/044, 02/11/2010) (1:300 dilution) as primary antibodies; followed by goat anti-chicken IgG-fluorescein (KPL cat #.02-24-06, lot #110020) (1:500 dilution) and donkey anti-mouse IgG-Alexa Fluor 568 (Molecular Probe #A10037, lot #989784) (1:300 dilution) as secondary antibodies.
(85) IFA results indicate that vHVT306 expresses the NDV F genes in virus-infected CEFs.
(86) Over 400 vHVT306 plaques were counted using the FITC-filter and TRITC-filter of microscope. The overall expression of NDV F gene and IBDV VP2 match with the HVT plaques (Table 5).
(87) TABLE-US-00005 TABLE 5 Dual IFA of vHVT306 IFA #1 (total 453 plaques) IFA#2 (total 478 plaques) Anti-NDV serum Anti-HVT MAb Anti-NDV F MAb Anti-IBDV serum Virus positive plaques positive plaques positive plaques positive plaques vHVT306 pre-MSV 453 453 478 478
Southern Blot Analysis
(88) Total genomic DNA was extracted from vHVT306 pre-MSV stock infected CEFs. The Southern blot analysis was performed according to the standard protocol.
(89) A total 3 probes were used to confirm the NDV F cassette (SV40 promoter, NDV F codon optimized gene, synthetic poly A tail) between SORF3 and US2 of vHVT306 as well as retention of IBDV VP2 cassette (mCMV promoter, IBDV VP2 gene, SV40 poly A tail).
(90) The Southern blot results showed the digestion patterns as expected based on Vector NTI (Invitrogen, 1600 Faraday Ave., Carlsbad, Calif.) map analysis. The NDV F cassette (SV40 promoter, NDV F codon optimized gene, synthetic poly A tail) is located between SORF3 and US2, and IBDV VP2 cassette (mCMV promoter, IBDV VP2 gene, SV40 poly A tail) is intact like the parent virus (vHVT13).
Genomic Analysis
(91) The genomic DNA of vHVT306 pre-MSV stock was sequenced to verify the sequence of the recombination arm region as well as inserted gene cassette.
(92) Primers were designed to amplify the entire inserted gene cassette including recombination arm used in donor plasmid. Analysis of vHVT306 genomic DNA was performed by PCR amplification and followed by nucleotide sequence determination.
(93) The vHVT306 (donor plasmid pHVT US2 SV-Fopt-synPA) containing the recombinant arms, SV40 promoter and NDV F codon-optimized gene was confirmed to be correct as shown in SEQ ID NO:20.
Western Blot Analysis
(94) The CEF monolayer was infected with vHVT306 pre-MSV at MOI0.1. After a 4-day incubation, the CEFs were pelleted and washed with PBS followed by lysis with IP Lysis/Wash buffer of Pierce Classic IP Kit (Thermo Scientific cat #26146) according to the manufacturer's protocols. The lysate was pre-cleared and incubated with 100 ul of anti-NDV F monoclonal antibody 001C3 to make the immune complex. The immune complex was captured by Protein A/G Plus Agarose and after removing of the un-bounded immune complex by washing steps, the 50 ul of sample buffer was used to elute under non-reducing conditions. The uninfected CEFs were included as controls. The 20 ul of eluted samples were separated in a 10% Bis-Tris Gels by electrophoresis. After the electrophoresis, the separated proteins were transferred onto PV DF membrane. The Protein Detection TMB Western Blot Kit (KPL cat #54-11-50) was used to detect the NDV antigens on PVDF membrane with chicken anti-NDV serum (Charles River Laboratories Laboratories cat #10100641, lot #C0117A), and goat anti-chicken IgG-peroxidase conjugate (KPL cat #14-24-06) following the manufacturers' protocols.
(95) The NDV F protein expression of vHVT306 was confirmed by two-step immunodetection. First, the expressed NDV F proteins from vHVT306 infected CEF were captured by the immunoprecipitation using anti-NDV F monoclonal antibody 001C3. Subsequently Western blot analysis using anti-NDV polyclonal serum (Charles River Laboratories cat #10100641, lot #C0117A) was applied to detect the NDV F protein in the captured samples (NDV F protein-monoclonal antibody complex) (
Example 4
Construction of Double HVT Vectors vHVT301, vHVT302, vHVT303, vHVT304 and vHVT307 Expressing NDV-F and IBDV VP2
(96) Generation and characterization of double HVT recombinants vHVT301, vHVT302, vHVT303, vHVT304, and vHVT307 were essentially done in the same way as for vHVT306 described in example 3. Table 6 shows the features unique to each construct around the expression cassettes, including the respective sequences.
(97) TABLE-US-00006 TABLE 6 Characteristics of the expression cassettes of double HVT recombinants Parental Name virus Promoter F gene Poly-A Locus vHVT301 vHVT13 SV40 Wt-VIId SV40 IG2 vHVT302 vHVT13 US10 Opt-VIId US10 US10 vHVT303 vHVT13 US10 Opt-V US10 US10 vHVT304 vHVT13 SV40 Opt-VIId Synthetic IG2 vHVT306 vHVT13 SV40 Opt-VIId Synthetic SORF3-US2 vHVT307 vHVT13 SV40 Opt-V Synthetic SORF3-US2
vHVT301
(98) The plasmid pHVT IG2 SbfI (Merial proprietary material) containing the Intergenic 2 arm sequences of vHVT13. was digested with SmaI, dephosphorylated, and the 4.3 kb fragment was gel extracted. The donor plasmid pHM103+NDV-F wt containing an SV40 promoter, wildtype NDV-F genotype VIId, SV40 poly A tail was EcoRI and SalI digested, klenow treated, and the 2.3 kb fragment was gel extracted. The two fragments were ligated to create a donor plasmid pHVT IG2 SV Fwt SbfI (SEQ ID NO: 24) used in transfection to generate recombinant vHVT301.
vHVT302
(99) A synthetically synthesized plasmid, pHVT US10 cds, containing the US10 arm sequences of vHVT13 was digested with NotI, dephosphorylated, and the 4.7 kb fragment was gel extracted. A NotI flanked 1.7 kb fragment of a chemically synthesized, codon-optimized, NDV-F genotype VIId was NotI digested and gel extracted. The two fragments were ligated to create a donor plasmid pHVT US10 cds F opt used in transfection to generate recombinant vHVT302. The transcription of the inserted F gene should be driven by the native US10 promoter and be stopped by the native US10 polyA signal. No exogenous promoter or polyA is added to express this insert. Sequencing of the insert region confirmed that vHVT302 contains the correct sequence of the codon-optimized VIId NDV-F gene as shown in the sequence of the donor plasmid pHVT US10 cds F opt (SEQ ID NO: 25).
vHVT303
(100) The synthetically synthesized plasmid pHVT US10 cds containing the US10 arm sequences of vHVT13 was digested with NotI, dephosphorylated, and the 4.7 kb fragment was gel extracted. A NotI flanked 1.7 kb fragment of a chemically synthesized, codon-optimized, NDV-F genotype V was NotI digested and gel extracted. The two fragments were ligated to create a donor plasmid pHVT US10 cds F CAO2 opt used in transfection to generate recombinant vHVT303. As with vHVT302, the transcription of this inserted F gene should also be driven by the native US10 promoter and be stopped by the native US10 polyA signal. No exogenous promoter or polyA is added to express this insert. Sequencing of the insert region confirmed that vHVT303 contains the correct sequence of the codon-optimized NDV-F genotype V as shown in the sequence of the donor plasmid pHVT US10 cds F CA02 (SEQ ID NO: 26).
vHVT304
(101) The donor plasmid pHVT IG2 SbfI containing the Intergenic 2 arm sequences of vHVT13 was digested with SbfI, dephosphorylated, and the 4.3 kb fragment was gel extracted. A synthetically synthesized plasmid containing an SV40 promoter+codon optimized NDV-F genotype VIId+synthetic poly A tail flanked by SbfI was digested with SbfI and the 2.3 kb fragment was gel extracted. The two fragments were ligated to create a donor plasmid pHVT IG2 SV Fopt syn tail used in transfection to generate recombinant vHVT304. Sequencing of the insert region confirmed that vHVT304 contains the correct sequences of SV40 promoter, the codon-optimized VIId NDV-F gene, and the synthetic poly A tail as shown in the sequence of the donor plasmid pHVT IG2 SV Fopt syn tail (SEQ ID NO:27).
vHVT307
(102) The donor plasmid pHVT US2-SORF3 containing the US2 and SORF3 arm sequences of vHVT13 was digested with SbfI, dephosphorylated, and the 5.1 kb fragment was gel extracted. The plasmid SB-1 UL55 SV CaF syn tail SbfI containing an SV40 promoter+codon optimized NDV-F genotype V+synthetic poly A tail flanked by SbfI was digested with SbfI and the 2.3 kb fragment was gel extracted. The two fragments were ligated to create a donor plasmid pHVT US2 SV-FCA02 opt-synPA used in transfection to generate recombinant vHVT307. Sequencing of the insert region confirmed that vHVT307 contains the correct sequences of SV40 promoter, the codon-optimized VIId NDV-F gene, and the synthetic poly A tail as shown in the sequence of the donor plasmid pHVT US2 SV-FCA02 opt-synPA (SEQ ID NO: 28).
Discussion
(103) One of the main goals of this work was to develop a multivalent avian Herpesvirus-based vector by incorporating multiple protective genes of interest to one avian Herpesvirus backbone (e.g. HVT). A prerequisite for this approach is to define expression cassettes containing appropriate promoter-gene-plyA combinations and evaluate for their genetic stability and ability to protect against the specific disease.
(104) For the purpose of creating an efficacious MD-IBD-ND trivalent vector vaccine, either codon-optimized or non-optimized Newcastle Disease Virus (NDV)-F gene sequences were cloned into vHVT13 backbone (HVT-IBD, a licensed vaccine to simultaneously protect chickens against MD and IBD) under human CMV (mouse CMV is already used in vHVT13). All vHVT-IBD-F constructs under human CMV promoter lost F-protein expression within six passages whether or not the NDV-F sequence is codon-optimized and regardless of the insertion site. The loss of F protein expression was rapid (within two passes) when hCMV was combined with codon-optimized F protein as compared to a combination of hCMV with wild-type F-sequence (loss of F protein expression within 6 passages). Taken together, the data shows that human CMV is not an ideal promoter for the generation of stable HVT recombinants expressing NDV-F protein. Surprisingly, this example shows that SV40 promoter and HVT endogenous promoter (US10 promoter) generated stable HVT recombinants expressing NDV-F protein.
Example 5
Construction of Recombinant vSB1-009 Expressing NDV-F
(105) The aim of the study is to construct a recombinant SB-1 viral vector vSB1-009 in which an expression cassette containing SV40 promoter and Newcastle disease virus fusion protein (NDV-F) is inserted to replace UL44 coding sequence (gC) of SB-1.
(106) A donor plasmid pSB1 44 cds SV FCAopt was constructed containing UL44 flanking arms of SB1 virus, SV40 promoter and NDV F codon optimized gene sequence (SEQ ID NO:5, coding for SEQ ID NO:6).
Generation of Recombinant Virus
(107) A standard homologous recombination procedure was followed by co-electroporation of secondary CEF cells using donor plasmid pSB1 44 cds SV FCAopt and viral DNA isolated from SB-1 virus infected CEFs. Essentially the procedure described in example 1 for vHVT114 was followed to generate, plaque purify and characterize recombinants by immunofluorescence.
(108) After two rounds of plaque purification, pure recombinant virus (vSB1-009) was isolated and the purity of vSB1-009 was tested by IFA and PCR to validate the appropriate insertion as well as no remnant parental virus.
PCR Analysis
(109) Viral DNA was extracted from vSB1-009 pre-master seed virus (pre-MSV) stock by QIA DNeasy Blood & Tissue Kit (Qiagen cat #69506). PCR primers were designed to identify the presence of the NDV F optimized, the NDV F wild type, the SV40 promoter, the mCMV promoter, the UL44 flanking arms of SB-1 virus and HVT virus. PCR amplifications were performed using approximately 200 ng of DNA template along with the primer pairs.
(110) PCR amplification with various primers confirmed that the vSB1-009 has the expected amplification patterns and amplicons.
Expression Analysis
(111) Indirect immunofluorescent assay (IFA) was performed on the vSB1-009 pre-MSV stock to examine the expression of NDV F gene and SB-1 virus antigen. The CEFs that were inoculated with vSB1-009 were fixed with ice-cold 95% acetone for three minutes at room temperature and air-dried for 10 min. The plates were washed with PBS, then two primary antibodies, chicken anti-Newcastle Disease Virus sera (Charles Rivers Laboratories cat #10100641, lot #C0117A) at 1:500 dilution and Y5.9 monoclonal antibody against SB-1 virus (Merial Select, Gainesville, Ga.) at 1:3000 dilution were added and the plates were incubated for 45 min at 37 C. After three washes with PBS, two secondary antibodies, goat anti-chicken IgG-fluorescein (KPL cat #.02-24-06, lot #110020) at 1:500 dilution and donkey anti-mouse IgG-Alexa Fluor 568 (Molecular Probe #A10037, lot #989784) at 1:250 dilution were added. The plates were incubated at 37 C. for 45 min and followed by three washes with PBS. The wells were screened for IFA positive plaques with a fluorescent microscope using fluorescein isothiocyanate (FITC) and tetramethylrhodamine isothiocyanate (TRITC)-filters of Nikon Eclipse Ti inverted microscope. Similarly, reactivity of vSB1-009 with NDV F Mab was examined by Dual IFA using anti-MDV serum (Charles River Laboratories, cat #10100628, lot #D0111) (1/300 dilution) and anti-NDV F monoclonal antibody (1/300 dilution) as primary antibody. The goat anti-chicken IgG-fluorescein (KPL cat #.02-24-06, lot #110020) (1:500 dilution) and donkey anti-mouse IgG-Alexa Fluor 568 (Molecular Probe #A10037, lot #989784) (1:250 dilution) were used as secondary antibodies. The wells were observed to identify the IFA positive plaques with a fluorescent microscope using FITC- and TRITC-filters of Nikon Eclipse Ti inverted microscope.
(112) IFA results indicate that vSB1-009 expresses the NDV F protein in virus-infected CEF. Over 500 vSB1-009 plaques were counted for NDV F protein expression as well as SB-1 virus specific protein expression with dual IFA. The expression of NDV F protein completely matched with SB-1 virus antigen expression in each virus plaque (Table 7).
(113) TABLE-US-00007 TABLE 7 Dual IFA of vSB1-009 Dual IFA plate#1(total 189 plaques) Dual IFA plate#2(total 361 plaques) Anti-NDV serum Anti-SB-1 MAb Anti-NDV serum Anti-SB-1 MAb Virus positive plaques positive plaques positive plaques positive plaques vSB1-009 pre-MSV 189 189 361 361
(114) NDV F Mab reactivity was confirmed by Dual IFA. Over 200 vSB1-009 plaques were examined for NDV F Mab reactivity as well as anti-MDV serum reactivity. The reactivity with NDV F Mab completely matched with anti-MDV serum reactivity in each virus plaque (Table 8).
(115) TABLE-US-00008 TABLE 8 Reactivity of vSB1-009 with anti-NDV F Mab Dual IFA (total 254 plaques) Anti-MDV serum Anti-NDV F MAb Virus positive plaques positive plaques vSB1-009 pre-MSV 254 254
Southern Blot Analysis
(116) Total genomic DNA was extracted from vSB1-009 pre-MSV stock infected CEFs. The genomic DNA of vSB1-009, SB-1 virus (negative control), pSB1 44 cds SV FCA opt donor plasmid were digested at 37 C. with EcoRI, NcoI, and KpnI restriction endonucleases separately. The restriction fragments were separated by a 0.8% agarose gel electrophoresis and transferred onto a positively charged Nylon membrane. After transfer, the membrane was treated with 0.4M NaOH and then neutralized with 2SSC-HCl buffer. The membrane was then air dried and UV crosslinked.
(117) Following the North2South Chemiluminescent Hybridization and Detection Kit (Thermo Scientific cat #89880) manufacturers' instructions, the membrane was pre-hybridized for 1 hr and then hybridized with the probe at 55 C. for overnight. For hybridization, two probes were used; 1) the SbfI fragment of pSB1 44 cds SV FCA opt as NDV F cassette probe, 2) the SmaI-EcoRI fragment of pUC57 SB1 44 arm (GenScript) as recombination arm probe. After the overnight hybridization, several stringency washes were conducted until the membrane was placed in blocking buffer with the addition of Streptavidin-HRP. After rinsing the membrane of any unbound Streptavidin-HRP, the substrate solution of Luminal and peroxide were added. The membrane was then exposed to X-ray film and the film was developed.
(118) The Southern blot results were as expected based on Vector NTI map analysis. The NDV F cassette (SV40 promoter, NDV-F CA02 codon optimized gene) replaced the UL44 coding sequences of SB-1 virus.
Genomic Analysis
(119) The genomic DNA of vSB1-009 pre-MSV stock was conducted by nucleotide sequence determination of the region of recombination arm as well as inserted gene cassette. Primers were designed and used to amplify the entire NDV-F gene cassette including the recombination arms.
(120) The vSB1-009 sequence (donor plasmid pSB1 44 cds SV FCAopt) containing the recombinant arms, SV40 promoter and NDV F codon-optimized gene was confirmed to be correct as shown in SEQ ID NO:19.
Western Blot Analysis
(121) The CEF monolayer was infected with vSB1-009 pre-MSV at MOI0.1. After a 5-day incubation, the CEFs were pelleted and washed with PBS followed by lysis with IP Lysis/Wash buffer of Pierce Classic IP Kit (Thermo Scientific cat #26146) according to the manufacturers' protocols. The lysate was pre-cleared and incubated with 100 ul of anti-NDV F monoclonal antibody to make the immune complex. The immune complex was captured by Protein A/G Plus Agarose and after removing of the un-bounded immune complex by washing steps, the 50 ul of sample buffer was used to elute under non-reducing conditions. The uninfected CEFs were included as a control. The 20 ul of eluted samples were separated in 10% Bis-Tris gels by electrophoresis. After the electrophoresis, the separated proteins in a gel were transferred onto PVDF membrane. The Protein Detection TMB Western Blot Kit (KPL cat #54-11-50) was used to detect the NDV antigens onto PVDF membrane with chicken anti-NDV serum (Charles River Laboratories Laboratories cat #10100641, lot #C0117A), and goat anti-chicken IgG-peroxidase conjugate (KPL cat #14-24-06) following the manufacturers' protocols.
(122) The NDV F protein expression of vSB1-009 was confirmed by two-step immunodetection. First, the expressed NDV F proteins from vSB1-009 infected CEF lysate were captured by the immunoprecipitation using anti-NDV F monoclonal antibody 001C3. Subsequently Western blot analysis using anti-NDV polyclonal serum (Charles River Laboratories cat #10100641, lot #C0117A) was applied to detect the NDV F protein in the captured samples (NDV F protein-monoclonal antibody complex) (
(123) Generation and characterization of HVT recombinants vSB1-004, vSB1-006, vSB1-007 and vSB1-008 were essentially done in the same way as for vSB1-009 described in this example. Table 9 shows the features unique to each construct around the expression cassettes, including the respective sequences. The generation and characterization of recombinant SB1 viral vectors were also described in U.S. patent application Ser. No. 13/689,572 filed on Nov. 29, 2012 (Merial, Inc.), which is incorporated herein by reference in its entirety.
(124) TABLE-US-00009 TABLE 9 Characteristics of the expression cassettes of SB1 recombinants Parental Name virus Promoter F gene Locus vSB1-009 SB1 SV40 Opt-CA02 UL44 (gC) vSB1-004 SB1 mCMV IE Wt-VIId US10 vSB1-006 SB1 SV40 Opt-VIId UL55/LORF5 vSB1-007 SB1 SV40 Opt-VIId UL44 (gC) vSB1-008 SB1 SV40 Opt-CA02 UL55/LORF5
Example 6
Efficacy of vHVT110, vHVT111, vHVT114 and vSB1-004 Expressing the NDV F Gene Against Challenges with NDV Chimalhuacan and Malaysian (MAL04-01) Strains at 14 Days of Age in SPF Chickens
(125) The aim of the study was to assess the efficacy of 3 HVT recombinant constructs (vHVT110, vHVT111 and vHVT114) and 1 SB1 recombinant construct (vSB1-004) expressing the NDV F gene against Newcastle disease challenges (Chimalhuacan and Malaysian virus strains) performed at 14 days of age in SPF chickens.
(126) The characteristics of these 5 vaccine candidates are described in Table 10 below.
(127) TABLE-US-00010 TABLE 10 Characteristics of the vectors used in the challenge study Parental Name virus Promoter F gene Poly-A Locus vHVT110 HVT mCMV IE Wt-VIId SV40 IG1 vHVT111 HVT SV40 Wt-VIId SV40 IG1 vHVT114 HVT SV40 Opt-VIId SV40 IG1 vSB1-004 SB-1 mCMV IE Wt-VIId SV40 US10
(128) On D0, 100 one-day-old SPF chickens were randomly allocated into 10 groups of 10 birds. The birds were injected by subcutaneous injection in the neck at D0 with 0.2 mL of recombinant vaccines containing a target dose of 2000 pfu as described in Table 11 below. It should be mentioned that the titer of vSB1-004 (31600 pfu) administered to birds of groups 6 was well above the target. The birds were challenged by the intramuscular route on D14 with velogenic ND Malaysia (genotype VIId) strain (sub-groups a) or with virulent ND Chimalhuacan (genotype V) strain (sub-groups b).
(129) TABLE-US-00011 TABLE 11 Challenge study with vHVT110, vHVT111, vHVT114 and vSB1-004 % protection against Vaccine at NDV mortality/morbidity after Newcastle day-old serology challenge at 14 days of age (D14) Group (D0) at D14* Malaysian strain Chimalhuacan strain G1a 0/10 0%/0% G1b 0%/0% G2a vHVT110 7/10 100%/89% G2b vVHT110 100%/70% G3a vHVT111 2/10 30%/20% G3b vHVT111 67%/11% G4a vHVT114 9/10 100%/100% G4b vHVT114 89%/89% G5a vSB1-004 3/10 70%/50% G5b vSB1-004 40%/30% *Number of birds positive by NDV HI test/total tested
(130) Each group was monitored before and after challenge. Clinical signs after challenge were scored daily as follows: healthy/with specific symptoms (ruffled feathers, prostration, torticollis, tremor)/dead. On D14, serum samples were taken in each group for serology (Newcastle Disease virus haemagglutination inhibition (HI) test).
(131) As expected, the unvaccinated animals (G1a and G1b) displayed no NDV antibodies on D14. A low titer seroconversion (mean HI titer<0.6 log 10) was obtained in each vaccinated group (sub-groups a and b of G2 to G5) confirming the vaccine takes. The number of positive birds/total tested was group-dependent and was the highest (90%) in vHVT114 vaccinated birds (see Table above).
(132) Percentages of protection against mortality and morbidity are reported in the table above. Full susceptibility was observed in the control groups G1a and G1b thus validating the high severity of both challenges. Lowest protection levels were observed in the groups vaccinated with vHVT111 or vSB1-004. Highest protection rates against morbidity and mortality were obtained in the groups vaccinated with vHVT110 or vHVT114 whatever the challenge strain used (homologous strain i.e. Malaysian genotype VIId or heterologous strain i.e. Chimalhuacan genotype V). There was a correlation between the % of birds positive by HI test before challenge and the % protection.
(133) The difference of protection obtained between vHVT110 and vHVT111 clearly illustrates the importance of the promoter, the mCMV IE promoter being more potent than the SV40 promoter for the transcription of the wild type (wt) genotype VIId F gene. The difference of protection obtained between vHVT111 and vHVT114 illustrates the importance of the nucleotide sequence of the F gene, the optimized sequence being more potent than the wild type (or native) sequence.
(134) In conclusion, the results of this study showed the importance of the promoter and the nucleotide sequence of the F gene in the ND protection induced by Marek's disease vector vaccines. An optimal combination of these factors need to be found to reach the best efficacy performances as for vHVT114.
Example 7
Efficacy of vHVT114, vHVT116, vHVT301, vHVT302 and vHVT303 Expressing the NDV F Gene Against Challenges with NDV Texas GB Strain at 14 Days of Age in SPF Chickens
(135) The aim of the study was to assess the efficacy of 2 single HVT recombinant constructs (vHVT114 and vHVT116) expressing the NDV F gene and 3 double HVT recombinant constructs (vHVT-301, vHVT302 and vHVT303) expressing both NDV F and IBDV VP2 genes against Newcastle disease challenge (Texas GB strain, genotype II) performed at 14 days of age in SPF chickens.
(136) The characteristics of these 4 vaccine candidates are described in Table 12 below.
(137) TABLE-US-00012 TABLE 12 Characteristics of the vectors used in the challenge study Parental Name virus Promoter F gene Poly-A Locus vHVT114 HVT SV40 Opt-VIId SV40 IG1 vHVT116 HVT SV40 Opt-V SV40 IG1 vHVT301 vHVT13* SV40 Wt-VIId SV40 IG2 vHVT302 vHVT13 US10 Opt-VIId US10 US10 vHVT303 vHVT13 US10 Opt-V US10 US10 *vHVT13 is the active ingredient of the licensed Vaxxitek HVT-IBD vaccine based on an HVT vector expressing the IBDV VP2 gene (see U.S. Pat. No. 5,980,906 and EP 0 719 864).
(138) On D0, 120 one-day-old SPF chickens were randomly allocated into 6 groups of 20 birds. The birds were injected by subcutaneous injection in the neck at D0 with 0.2 mL of recombinant vaccines containing a target dose of 1000 pfu as described in Table 13 below. The birds were challenged by the intramuscular route on D14 with 4.5 log 10 EID50 velogenic ND Texas GB (genotype II) strain.
(139) TABLE-US-00013 TABLE 13 Results of efficacy Vaccine at % clinical protection (number infected/total) day-old after Newcastle challenge at 14 days of age Group (D0) (D14) G1 0% (20/20) G2 vHVT114 80% (4/20) G3 vHVT116 70% (6/20) G4 vHVT301 15% (17/20) G5 vHVT302 52.6% (9/19)* G6 vHVT303 15% (17/20) *1 bird died before challenge
(140) Each group was monitored before and after challenge. NDV clinical signs and mortality were recorded after challenge.
(141) Percentages of clinical protection are reported in the table above. Full susceptibility was observed in the non-vaccinated challenged control group G1 thus validating the high severity of both challenges. Partial protection was observed for the 5 vaccine candidates, the best performances being obtained with vHVT114 and vHVT116. Among the double HVT recombinants, the vHVT302 was the most protective. It performed better than vHVT303 suggesting that the optimized genotype VIId NDV F gene may be better cross-protective against genotype II challenge than the optimized genotype V NDV F gene. A similar tendency was observed with single HVT, the vHVT114 (VIId gene) performing slightly better than vHVT116 (V gene) but the difference was less pronounced. These results indicated that both genotypes VIId and V NDV F genes inserted in the HVT vector provide cross-protection against an heterologous genotype II NDV challenge; the VIId gene may potentially be more cross-protective. The vHVT302 induced a better ND protection than vHVT301 confirming the importance of the promoter, poly-A and locus of insertion. In conclusion, the results of this study showed the very good early ND protection induced by tested Marek's disease vector vaccines, especially for the tested single HVT-ND.
Example 8
Efficacy of vHVT114, vHVT116, vSB1-007, vSB1-008 (Alone or with vHVT13) and vHVT 304 Against Challenges with NDV ZJ1 (Genotype VIId) and California/02 (Genotype V) at 21 Days of age in SPF Chickens
(142) The aim of the study was to assess the efficacy of 2 single HVT recombinant constructs (vHVT114 and vHVT116), 2 SB1 recombinant constructs (vSB1-007 & vSB1-008) expressing the NDV F gene and a double HVT recombinant (vHVT304) against Newcastle disease challenge with NDV ZJ1 (genotype VIId) and California/02 (genotype V) performed at 21 days of age in SPF chickens.
(143) The characteristics of these 5 vaccine candidates are described in Table 14 below.
(144) TABLE-US-00014 TABLE 14 Characteristics of the vectors used in the challenge study Name Parental virus Promoter F gene Poly-A Locus vHVT114 HVT SV40 Opt-VIId SV40 IG1 vHVT116 HVT SV40 Opt-V SV40 IG1 vSB1-007 SB-1 SV40 Opt-VIId gC UL44 (gC) vSB1-008 SB-1 SV40 Opt-V SV40 IG1 vHVT304 vHVT13* SV40 Opt-VIId Synth IG2 *vHVT13 is the active ingredient of the licensed Vaxxitek HVT-IBD vaccine based on an HVT vector expressing the IBDV VP2 gene (see U.S. Pat. No. 5,980,906 and EP 0 719 864).
(145) On D0, 158 one-day-old SPF chickens were randomly allocated into 6 groups of 24 birds (vaccinated) and 1 group of 12 birds (non-vaccinated controls). The birds were injected by subcutaneous injection in the neck at D0 with 0.2 mL of recombinant vaccines containing a target dose of 1000 pfu as described in Table 15 below. The birds were then separated into two sub-groups, each sub-group being challenged by the intramuscular route on D21 with 5 log 10 EID50 of either NDV ZJ1 (genotype VIId) or California/02 (genotype V) velogenic strain.
(146) TABLE-US-00015 TABLE 15 Results of efficacy Vaccine at % clinical protection Group day-old (D0) CA/02 (genotype V) ZJ1 (genotype VIId) G1 0% 0% G2 vHVT114 100% 100% G3 vHVT116 100% 90% G4 vSB1-007 92% 100% G5 vSB1-008 100% 100% G6 vSB1-008 + vHVT13 100% 83% G7 vHVT304 92% 75%
(147) Each group was monitored before and after challenge. Technical problems observed with isolators reduced the number of birds in group 2 (vHVT114: from 24 to 14) and in group 3 (vHVT116: from 24 to 20). NDV clinical signs were recorded after challenge. Serum was collected from blood samples taken from birds of groups 2 and 7 before challenge (D21) for NDV serology by HI test using each challenge strains as antigen.
(148) Mean serologic HI titers in G2 and G7 before challenge are shown in
(149) Percentages of protection against mortality and morbidity are reported in the table above. Full susceptibility was observed in the non-vaccinated challenged control group G1 thus validating the high severity of both challenges. All vaccines induced high levels (75%) of protection against both challenges. Full clinical protection against both challenges was induced by vHVT114 and vSB1-008. Following a similar tendency as the HI titers, the ND protection induced by vHVT304 was slightly lower than that induced by vHVT114.
(150) The shedding was evaluated after challenge by real time RT-PCR in oral and cloacal swabs taken 2 and 4 days post-challenge. Percentage of positive (Ct<40) birds are shown for both challenges in
(151) In conclusion, the results of this study showed the very good ND protection at 3 weeks of age induced by tested Marek's disease vector vaccines.
Example 9
Efficacy of vHVT114, vSB1-007, vSB1-009, vHVT306 and vHVT307 Vaccines Against Challenges with NDV Texas GB Strain at 28 Days of Age in SPF Chickens
(152) The aim of the study was to assess the efficacy of combinations of different Marek's disease vector vaccines expressing the NDV F and/or the IBDV VP2 gene against Newcastle disease challenge (Texas GB strain, genotype II) performed at 28 days of age in SPF chickens.
(153) The characteristics of the 5 recombinant vaccine candidates tested in this study are described in Table 16 below.
(154) TABLE-US-00016 TABLE 16 Characteristics of the vectors used in the challenge study Name Parental virus Promoter F gene Poly-A Locus vHVT114 HVT SV40 Opt-VIId SV40 IG1 vSB1-007 SB-1 SV40 Opt-VIId gC UL44 (gC) vSB1-009 SB-1 SV40 Opt-V gC UL44 (gC) vHVT306 vHVT13 SV40 Opt-VIId Synth SORF3-US2 vHVT307 vHVT13 SV40 Opt-V Synth SORF3-US2
(155) The Marek's disease virus serotype 1 (CVI988 (or Rispens) strain; Gallid herpesvirus 2) and serotype 2 (SB-1 strain; gallid herpesvirus 3) vaccines were used also in combination with recombinant viruses in some of the groups.
(156) On D0, 135 one-day-old SPF chickens were randomly allocated into 9 groups of 15 birds. The birds were injected by subcutaneous injection in the neck at D0 with 0.2 mL containing a target dose of 2000 pfu for recombinant vaccines (vSB1-007, vSB1-009, vHVT13, vHVT306, vHVT307, vHVT114), and 1000 pfu for parental Marek's disease vaccine strains (SB-1 and CVI988). The design of the 9 groups is shown in Table 17 below. The birds were challenged by the intramuscular route on D28 with 4.0 log 10 EID50 velogenic ND Texas GB (genotype II) strain.
(157) TABLE-US-00017 TABLE 17 Results of efficacy Vaccine at % ND protection after Newcastle Group day-old (D0) disease challenge at 28 days of age G1 0% G2 vSB1-007 + vHVT13 80% G3 vSB1-009 100% G4 vSB1-009 + vHVT13 86% G5 vSB1-009 + vHVT13 + CV1988 93% G6 vHVT306 + SB-1 100% G7 vHVT307 100% G8 vHVT307 + SB-1 93% G9 vHVT114 + vHVT13 + SB-1 100%
(158) Each group was monitored before and after challenge. NDV clinical signs after challenge were recorded.
(159) Percentages of protection against mortality and morbidity are reported in the table above. Full susceptibility was observed in the non-vaccinated challenged control group G1 thus validating the high severity of challenge. Excellent levels of protection were observed in all vaccinated groups. Birds from G3, G6, G7 and G9 were fully protected. This study shows that the vSB1-ND candidates can be co-administered with vHVT13 and CVI988 and still provide a very good ND protection. Similarly, double HVT-IBD+ND are compatible with SB-1 and vHVT-ND (vHVT114) is compatible with vHVT13 and SB-1.
(160) In conclusion, the results of this study showed the lack of interference on ND protection induced by the tested Marek's disease parental and vector vaccines.
Example 10
Efficacy of vHVT114, vHVT307, vSB1-007 and vSB1-009 in Combination with vHVT13 Against Challenges with NDV Chimalhuacan Strain (Genotype V) at D28 in SPF Chickens
(161) The aim of the study was to assess the efficacy of 1 HVT recombinant construct (vHVT114) and 2 SB1 recombinant constructs (vSB1-007 and vSB1-009) expressing the NDV F gene in combination with vHVT-IBD (vHVT13), as well as a double HVT vHVT307 expressing both NDV F and IBDV VP2 against Newcastle disease challenge (Chimalhuacan, genotype V) performed at 28 days of age in SPF chickens.
(162) The characteristics of these 4 vaccine candidates are described in Table 18 below.
(163) TABLE-US-00018 TABLE 18 Characteristics of the vectors used in the challenge study Name Parental virus Promoter F gene Poly-A Locus vHVT114 HVT SV40 Opt-VIId SV40 IG1 vSB1-007 SB-1 SV40 Opt-VIId gC UL44 (gC) vSB1-009 SB-1 SV40 Opt-V gC UL44 (gC) vHVT307 vHVT13 SV40 Opt-V Synth SORF3-US2
(164) On D0, 45 one-day-old SPF chickens were randomly allocated into 4 groups of 10 birds and 1 group of 5 birds (unvaccinated control group). The birds were injected by subcutaneous injection in the neck at D0 with 0.2 mL or recombinant vaccines containing a target dose of 2000 pfu as described in Table 19 below. The birds were challenged by the intramuscular route on D28 with 5.0 log 10 EID50 velogenic Chimalhuacan (genotype V) strain.
(165) TABLE-US-00019 TABLE 19 Results of efficacy Vaccine at % protection % protection Group day-old (D0) against mortality against morbidity G1 0% 0% G2 vHVT114 + vHVT13 100% 100% G3 vHVT307 80% 80% G4 vSB1-007 + vHVT13 90% 90% G5 vSB1-009 + vHVT13 90% 90%
(166) Each group was monitored before and after challenge. NDV clinical signs were recorded after challenge. Oropharyngeal swabs were taken in the vaccinated groups at 5 and 7 days post-challenge to evaluate the viral load by real time RT-PCR.
(167) Percentages of protection against mortality and morbidity are reported in the table above. Full susceptibility was observed in the non-vaccinated challenged control group G1 thus validating the high severity of challenge. Very good protection was observed in all 4 vaccinated groups, a full clinical protection being induced by vHVT114+vHVT13. The percentage of positive birds and the mean shedding titer (expressed as log 10 EID50 equivalent per mL) are shown in
(168) In conclusion, this example further illustrates the excellent ND protection induced by double HVT-IBD+ND recombinant or a combination of SB1-ND or HVT-ND and HVT-IBD (vHVT13) recombinant viruses. Contrary to the general belief in the field that a second HVT vaccine (regular HVT vaccines or recombinant HVT vaccines) interferes with the immunity to the foreign genes inserted into the first recombinant HVT vaccine, the present invention showed surprising result that vHVT114 in combination with vHVT13 offered excellent protection against NDV and no interference effect was observed.
Example 11
Efficacy of vHVT306, vSB1-008 in Combination with vHVT13 Administered by SC or in ovo Route Against Challenge with NDV Chimalhuacan Strain (Genotype V) at D28 in SPF Chickens
(169) The aim of the study was to assess the efficacy of the vHVT306 double HVT expressing both NDV F and IBDV VP2 genes, and the vSB1-008 SB1 recombinant expressing the NDV F gene in combination with vHVT-IBD (vHVT13), administered by the in ovo or by the subcutaneous route against Newcastle disease challenge (Chimalhuacan, genotype V) performed at 28 days of age in SPF chickens.
(170) The characteristics of these 2 ND vaccine candidates are reported in the table 14 (vSB1-008) and in table 16 (vHVT306).
(171) The design of the groups is shown on Table 20. Sixty SPF embryonated eggs (after approximately 18 days and 18 hours of incubation; D-3) were used for the in ovo administration (20 per group for G1, G2 and G3). Fifty microliters of vaccine containing 2000 PFU were administered by the in ovo route using the IntelliLab System device from AviTech LLC (Salisbury, Md., USA). Hatchability and survival were recorded after in ovo administration. On D0, 20 one-day-old SPF chickens were randomly allocated into 2 groups of 10 birds (G4 and G5). The birds were injected by subcutaneous (SC) injection in the neck at D0 with 0.2 mL or recombinant vaccines containing a target dose of 2000 pfu as described in Table 20 below. Ten birds per group were challenged by the intramuscular route on D28 with 5.0 log 10 EID50 velogenic Chimalhuacan (genotype V) strain.
(172) TABLE-US-00020 TABLE 20 Study design and results of ND efficacy % protection % protection Vaccine at Admin. against against Group day-old (D0) route mortality morbidity G1 vHVT13 In ovo 0% 0% G2 vHVT306 In ovo 100% 100% G3 vSB1-008 + vHVT13 In ovo 78% 68% G4 vHVT306 SC 100% 100% G5 vSB1-008 + vHVT13 SC 100% 70%
(173) Each group was monitored before and after challenge. NDV clinical signs were recorded after challenge. Oropharyngeal swabs were taken in the vaccinated groups at 5 and 7 days post-challenge to evaluate the viral load by real time RT-PCR.
(174) Full hatchability and viability were recorded up to D28 (challenge day) for birds of groups G1 and G2. Hatchability in G3 was 85% and one additional bird died after hatching in this group. The lower hatchability of that group may be due to egg incubator problems. Body weights of males and females in G1, G2 and G3 were similar at D1 and at D28.
(175) Percentages of protection against mortality and morbidity are reported in the table 20. Full susceptibility was observed in the non-vaccinated challenged control group G1 thus validating the high severity of challenge. Very good protection was observed in all 4 vaccinated groups, a full clinical protection being induced by vHVT306 administered by both routes.
(176) The percentage of positive birds and the mean shedding titer (expressed as log 10 EID50 equivalent per mL) are shown in Table 21. Absence of detectable or very low shedding was observed in G2 and G4 vaccinated with vHVT306. The shedding levels detected in the groups vaccinated with vSB1-008+vHVT13 were higher especially at 5 days post-infection (pi).
(177) TABLE-US-00021 TABLE 21 Results of protection against shedding (percentage of birds with detectable shedding and mean viral load in log10) evaluated at D5 and D7 after NDV challenge Percent of positive Mean Vaccine at Admin. birds viral load* Group day-old (D0) Route (D5/D7 pi) (D5/D7 pi) G2 vHVT306 In ovo 0/0% 2.7/2.7 G3 vSB1-008 + vHVT13 In ovo 100/38% 5.2/3.2 G4 vHVT306 SC 20/10% 3.2/2.9 G5 vSB1-008 + vHVT13 SC 80/50% 4.6/3.4 *Mean quantitative real time PCR value expressed in equivalent log10 EID50; the threshold is set at 2.7 log10.
(178) In conclusion, this example shows excellent ND protection induced by vHVT306 double HVT recombinant administered either by in ovo or by SC routes. The performance of vSB1-008+vHVT13 was slightly lower especially after in ovo administration, but it may be at least partially due to egg incubator problems. Indeed, the in ovo safety testing of another SB1-ND recombinant (vSB1-009) at 1000 or 4000 PFU associated with 6000 PFU of vHVT13 did not show any difference in hatchability and early survival with a group receiving 6000 PFU of vHVT13 only.
Example 12
Efficacy of vHVT304, vHVT306, vSB1-007 and vSB1-008 in Combination with vHVT13 Against Challenge with NDV Chimalhuacan Strain (Genotype V) at D42 in Commercial Broiler Chickens
(179) The aim of the study was to assess the efficacy of two double HVT (vHVT304 and vHVT306) expressing both NDV F and IBDV VP2 genes, and two SB1 recombinants (vSB1-007 and vSB1-008) expressing the NDV F gene in combination with vHVT-IBD (vHVT13) against Newcastle disease challenge (Chimalhuacan, genotype V) performed at 42 days of age in commercial broiler chickens.
(180) The characteristics of these 4 ND vaccine candidates are reported in tables 14 and 16. The design of the groups is shown on Table 22. On D0, 55 one-day-old commercial broiler chickens were randomly allocated into 5 groups of 11 birds. The birds were injected by subcutaneous (SC) injection in the neck at D0 with 0.2 mL or recombinant vaccines containing a target dose of 2000 pfu as described in Table 22 below. Ten birds per group were challenged by the intramuscular route on D42 with 5.0 log 10 EID50 velogenic Chimalhuacan (genotype V) strain.
(181) TABLE-US-00022 TABLE 22 Study design and results of ND efficacy % protection % protection Vaccine at against against Group day-old (D0) mortality morbidity G1 vHVT13 0% 0% G2 vHVT304 82% 82% G3 vHVT306 100% 100% G4 vSB1-007 + vHVT13 100% 100% G5 vSB1-008 + vHVT13 91% 91%
(182) Each group was monitored before and after challenge. NDV clinical signs were recorded during 14 days after challenge. Oropharyngeal swabs were taken in the vaccinated groups at 5 and 7 days post-challenge to evaluate the viral load by real time RT-PCR.
(183) Percentages of protection against mortality and morbidity are reported in the table 22. Full susceptibility was observed in the non-vaccinated challenged control group G1 thus validating the high severity of challenge. Very good protection was observed in all 4 vaccinated groups, a full clinical protection being induced by vHVT306 and by vSB1-007+vHVT13.
(184) The percentage of positive birds and the mean shedding titer (expressed as log 10 EID50 equivalent per mL) are shown in Table 23. The best reduction of shedding was induced by vHVT306 and vSB1-007+vHVT13, which were also the best candidates for clinical protection.
(185) TABLE-US-00023 TABLE 23 Results of protection against shedding (percentage of birds with detectable shedding and mean viral load in log10) evaluated at D5 and D7 after NDV challenge (pi) Vaccine at Percent of positive Mean viral load* Group day-old (D0) birds (D5/D7 pi) (D5/D7 pi) G2 vHVT304 100/100% 5.4/4.6 G3 vHVT306 40/50% 3.5/3.7 G4 vSB1-007 + vHVT13 80/70% 3.8/4.8 G5 vSB1-008 + vHVT13 100/100% 4.8/4.3 *Mean quantitative real time PCR value expressed in equivalent log10 EID50; the threshold is set at 2.7 log10.
(186) The vHVT306 ND protection was found to be better than that of vHVT304. These two double HVT contain the same NDV F expression cassette but inserted in two different loci, the IBDV VP2 one being inserted at the same position. This example therefore illustrates the importance of the locus of insertion in the design of HVT recombinants. The vSB1-007+vHVT13 was better than vSB1-008+vHVT13. The vSB1-007 genomic structure differs from that of vSB1-008 in different aspects: locus of insertion, promoter, poly-adenylation signal and F gene origin. The combination of these foreign sequences and locus of insertion in vSB1-007 were likely responsible for its better ND protection performances.
(187) In summary, this example illustrates the importance of the locus of insertion and other regulatory sequences of the NDV expression cassette in the ND protection induced by HVT and MDV serotype 2 vectors.
Example 13
Efficacy of Double HVT-ND+IBD (vHVT304 and vHVT306) or SB1-ND (vSB1-008) in Combination with vHVT13 Recombinant Vaccines, Against Challenge with a Classical IBDV Isolate on D14 in SPF Chickens
(188) The aim of the study was to assess the early IBD efficacy of double HVT recombinants vHVT304 and vHVT306 as well as that of vHVT13 co-administered with a SB1-ND (vSB1-008) recombinant constructs against a virulent infectious bursal disease virus (vIBDV) challenge (Faragher 52/70 strain) performed at 14 days of age in SPF chickens.
(189) The characteristics of the double HVT and SB1 recombinants used in this study are shown in Tables 14 and 16.
(190) On D0, 95 one-day-old SPF chickens were randomly allocated into 9 groups of 10 birds and 1 group of 5 birds (unvaccinated unchallenged control group). The birds were injected by subcutaneous injection in the neck at D0 with 0.2 mL or recombinant vaccines containing a target dose of 300 or 1000 pfu as described in the Table 24 below. On D14, blood sample was collected from 5 birds per group for serological testing with the Kit ProFLOK plus IBD (Synbiotics Corp). The birds (10 birds per group except for group 7 in which 1 bird died before challenge) were challenged by the eye drop (0.05 mL per bird) on D14 with 2.5 log 10 EID50.
(191) TABLE-US-00024 TABLE 24 Study design and results of IBD efficacy Mean IBD + bursal/ ELISA Number % body Vaccine at titer at Dead/ protect- weight Group day-old (dose in PFU) D14.sup.1 Sick.sup.2 tion.sup.3 ratio.sup.4 G1 vSBl-008 (1000) 0.2 7/10 0% 0.0013 G2 vHVT13 (300) 2.7 0/0 100% 0.0051 G3 vHVT13 (1000) 2.7 0/0 90% 0.0049 G4 vHVT13 + vSB1-008 (300) 1.9 1/1 60% 0.0041 G5 vHVT13 + vSB1-008 (1000) 2.4 0/0 70% 0.0041 G6 vHVT304 (300) 2.9 0/0 60% 0.0037 G7 vHVT304 (1000) 2.2 0/0 67% 0.0047 G8 vHVT306 (300) 2.4 0/0 80% 0.0033 G9 vHVT306 (1000) 2.7 0/0 40% 0.0026 .sup.1Mean IBD + ELISA titers expressed in log10 in the serum of 5 birds per group sampled at D14 before challenge; .sup.2Birds sick for more than 2 days or still sick on D25 were considered as sick. .sup.3Protection against clinical signs and severe bursal lesion (bursal score <3) 4The bursal/body weight ratio of the unvaccinated/unchallenged group was 0.0047.
(192) Each group was monitored before and after challenge. IBDV clinical signs were recorded for 11 days after challenge (from D15 to D25). At the end of the post-challenge observation period (D33), all the surviving birds were euthanized and necropsied. Body and bursal weights were recorded. Each bursa of Fabricius (BF) was weighted then stored in individual recipients containing 4% formaldehyde for histology. Histological lesions of the bursa were scored according to the scale presented in Table 25.
(193) TABLE-US-00025 TABLE 25 Scoring scale of histological lesions of the bursa of Fabricius* Score Histology observation/lesions 0 No lesion, normal bursa 1 1% to 25% of the follicles show lymphoid depletion (i.e. less than 50% of depletion in 1 affected follicle), influx of heterophils in lesions 2 26% to 50% of the follicles show nearly complete lymphoid depletion (i.e. more than 75% of depletion in 1 affected follicle), affected follicles show necrosis and severe influx of heterophils may be detected 3 51% to 75% of the follicles show lymphoid depletion; affected follicles show necrosis lesions and a severe influx of heterophils is detected 4 76% to 100% of the follicles show nearly complete lymphoid depletion; hyperplasia and cyst structures are detected; affected follicles show necrosis and severe influx of heterophils is detected 5 100% of the follicles show nearly complete lymphoid depletion; complete loss of follicular structure, thickened and folded epithelium, fibrosis of bursal tissue *sourced from Monograph No. 01/2008:0587 of EU Pharmacopoeia Avian Infectious Bursal Disease vaccine (live)
(194) A bird was considered as affected if it died and/or showed notable sign of disease and/or severe lesions of the bursa of Fabricius (i.e., histology score 3).
(195) The mean ELISA IBD+antibody titer expressed in log 10 before challenge is shown in Table 24. Significant titers were detected in all vaccinated groups that were significantly higher than that of the control group G1. The serology titer was not dose-dependent.
(196) Severe clinical signs were observed after challenge in all birds of the control group G1. Seven out of 10 birds of that group died within the 11 days observation period indicating the high severity of challenge. None of the vaccinated birds showed severe clinical signs after challenge except 1 bird of G4 that died. Percentages of protection against severe bursal lesions are shown in the table above. Significant IBD protection was observed in all groups, the best protection being observed in G2 and G3 (vHVT13 alone). The co-administration of vSB1-008+vHVT13 and the double vHVT304 and vHVT306 constructs induced similar levels of IBD protection. The protection was not dose-dependent. The mean bursal/body weight ratios are also shown in Table 24. Ratios in all vaccinated groups were higher than those of the challenged control group.
(197) In conclusion, these data indicate that both the combination of a SB1-ND vector with a single HVT-IBD or double HVT expressing both NDV-F and IBDV-VP2 induce IBD antibodies and early IBD protection in a severe IBDV challenge model.
Example 14
Efficacy of Single HVT-ND (vHVT114) or SB1-ND (vSB1-007 and vSB1-009) in Combination with vHVT13 Recombinant Vaccines, Against Challenge with a Very Virulent IBDV Isolate on D23 in Commercial Broiler Chickens
(198) The aim of the study was to assess the IBD efficacy of vHVT13 co-administered with an HVT-ND (vHVT114) or SB1-ND (vSB1-007 and vSB1-009) recombinant constructs against a very virulent infectious bursal disease virus (vvIBDV) challenge (91-168/980702) performed at 23 days of age in commercial broiler chickens.
(199) The characteristics of these 4 vaccine candidates are described in Tables 14 and 16. On D0, 90 one-day-old broiler chickens were randomly allocated into 7 groups of 12 birds and 1 group of 6 birds (unvaccinated unchallenged control group). The birds were injected by subcutaneous injection in the neck at D0 with 0.2 mL or recombinant vaccines containing a target dose of 3000 pfu as described in the Table 26. On D14, blood sample was collected from 5 birds per group for serological testing with the Kit ProFLOK plus IBD (Synbiotics Corp). The serum of 10 extra one-day-old broiler chickens was tested at D0 with the same kit to evaluate the level of IBDV maternal antibody. The birds (10 birds per group) were challenged by the eye drop (0.05 mL per bird) on D23 with 4.3 log 10 EID50.
(200) Each group was monitored before and after challenge. IBDV clinical signs were recorded for 11 days after challenge (from D23 to D33). At the end of the post-challenge observation period (D33), all the surviving birds were euthanized and necropsied. Body and bursal weights were recorded. Each bursa of Fabricius (BF) was weighted then stored in individual recipients containing 4% formaldehyde for histology. Histological lesions of the bursa were scored according to the scale presented in Table 25.
(201) A bird was considered as affected if it died and/or showed notable sign of disease and/or severe lesions of the bursa of Fabricius (i.e., histology score 3).
(202) TABLE-US-00026 TABLE 26 Study design and serology results Mean bursal/body Vaccine at IBD + ELISA weight Group day-old (D0) titer at D23.sup.1 ratio.sup.2 G1 3.9 0.0007 G2 vHVT13 4.0 0.0015 G3 vHVT114 + vHVT13 4.1 0.0015 G4 vSB1-007 + vHVT13 3.8 0.0018 G5 vSB1-009 + vHVT13 4.0 0.0019 .sup.1Mean IBD + ELISA titers expressed in log10 in the serum of 5 birds per group sampled at D23 before challenge; .sup.2The bursal/body weight ratio of the unvaccinated/unchallenged group was 0.0047
(203) The mean ELISA IBD+serological titer at D0 was 4.360.01 log 10 indicating a very high level of IBD maternal antibody. At D23, the mean ELISA titer was still high (3.9) in the control G1. ELISA mean titers in the vaccinated groups were not different from the control group.
(204) Neither morbidity nor mortality was observed in any of the groups after challenge. Percentages of protection against severe bursal lesions are shown in the table 24 above. The result showed that co-administration of vHVT114, vSB1-007 or vSB1-009 did not interfere with vHVT13-induced IBD protection indicating a lack of interference. Similarly, the mean bursal/body weight ratios of the vaccinated groups were similar and clearly higher than that of the control group, indicating IBD protection and no difference between the vaccination regimens.
(205) In conclusion, the data indicate the compatibility between vHVT114, vSB1-007 or vSB1-009 and vHVT13 for IBD protection.
Example 15
Efficacy of Recombinant HVT and SB1 Vectors Against Marek's Disease
(206) Efficacy is demonstrated for the HVT vectored recombinants and the SB-1 vectored recombinants either alone or in combination. The challenge strains include a virulent Marek's disease (vMD) challenge such as GA22, a very virulent Marek's disease (vvMD) challenge such as RB1B and/or a very virulent plus Marek's disease (vv+MD) challenge such as the T. King virus. One-day-old chickens are inoculated subcutaneously or 18-19-day-old embryonated eggs are inoculated with a 0.2 ml dose or 0.05 ml dose, respectively, of the test viruses. At five days of age the vaccinated chickens and nave controls are challenged with the relevant Marek's challenge virus (v, vv, or vv+MDV). The challenged birds are observed until seven weeks of age. All birds are terminated and necropsied to observe for grossly visible lesions associated with Marek's disease.
(207) Having thus described in detail preferred embodiments of the present invention, it is to be understood that the invention defined by the above examples is not to be limited to particular details set forth in the above description as many apparent variations thereof are possible without departing from the spirit or scope of the present invention.