Vaccination of animals to elicit a protective immune response against tick infestations and tick-borne pathogen transmission
09556244 ยท 2017-01-31
Assignee
Inventors
Cpc classification
A61P31/00
HUMAN NECESSITIES
International classification
Abstract
Two antigenic and immunogenic proteins of the cattle tick, Rhipicephalus microplus, and the genes encoding these proteins, are effective for eliciting a protective immune response that controls and prevents infestations of bovines and other livestock by the tick. The proteins isolated from the cattle tick include an aquaporin protein and a TC5777 gut membrane protein. Each of the proteins elicit an immunoprotective response in livestock to the cattle tick, and can be formulated and administered as vaccines. Alternatively, the isolated DNA sequences which encode these proteins can be incorporated into nucleic acid constructs which could be utilized as DNA vaccines. The nucleic acid constructs can also be used for the transformation of cells and the production of recombinant proteins. Induction of the protective immune response controls and prevents infestations of the treated animals with the tick, thereby protecting them against tick-borne pathogen transmission.
Claims
1. A composition comprising TC5777 gut membrane protein of the cattle tick, Rhipicephalus microplus, and a pharmaceutically acceptable carrier, wherein said pharmaceutically acceptable carrier is selected from the group consisting of physiological saline, phosphate buffered saline, mineral oil, vegetable oil, aqueous carboxymethyl cellulose, and polyvinylpyrrolidone; wherein said TC5777 is in an amount effective to stimulate a protective immune response in bovine to said cattle tick, and wherein said TC5777 comprises SEQ ID NO: 9.
2. A method for reducing the incidence of infestation of bovine with the cattle tick, Rhipicephalus microplus, comprising administering the composition of claim 1 to said bovine.
3. The method of claim 2 wherein said composition further comprises aquaporin protein, and said aquaporin protein comprises amino acids 3-198 of SEQ ID NO: 1.
4. The method of claim 2 wherein said amount of said TC5777 is greater than 10 g per dose.
5. The method of claim 2 wherein said composition further comprises an adjuvant.
6. The composition of claim 1 wherein said amount of said TC5777 is greater than 10 g per dose.
7. The composition of claim 6, wherein said amount of said TC5777 is between about 50 g to about 150 per g per dose.
8. The composition of claim 1 further comprising an adjuvant.
9. The composition of claim 8, wherein said adjuvant is selected from the group consisting of mineral oil, vegetable oil, alum, Freund's incomplete adjuvant, and microparticles, nanoparticles or beads of a biocompatible matrix material.
10. The composition of claim 9, wherein said biocompatible matrix material comprises agar or polyacrylate.
11. The composition of claim 1, wherein said carrier is phosphate buffered saline.
12. A composition comprising TC5777 gut membrane protein of the cattle tick, Rhipicephalus microplus, a pharmaceutically acceptable carrier, and an adjuvant; wherein said TC5777 is in an amount effective to stimulate a protective immune response in bovine to said cattle tick; wherein said TC5777 comprises SEQ ID NO: 9; and wherein said adjuvant is selected from the group consisting of mineral oil, vegetable oil, alum, Freund's incomplete adjuvant, and microparticles, nanoparticles or beads of a biocompatible matrix material.
13. The composition of claim 12, wherein said biocompatible matrix material comprises agar or polyacrylate.
14. The composition of claim 12 wherein said amount of said TC5777 is greater than 10 g per dose.
15. The composition of claim 12, wherein said amount of said TC5777 is between about 50 g to about 150 per g per dose.
16. The composition of claim 12, wherein said pharmaceutically acceptable carrier is selected from the group consisting of physiological saline, phosphate buffered saline, aqueous carboxymethyl cellulose, and polyvinylpyrrolidone.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
DEFINITIONS
(7) The following terms are employed herein:
(8) Cloning. The selection and propagation of (a) genetic material from a single individual, (b) a vector containing one gene or gene fragment, or (c) a single organism containing one such gene or gene fragment.
(9) Cloning Vector. A plasmid, virus, retrovirus, bacteriophage or nucleic acid sequence which is able to replicate in a host cell, characterized by one or a small number of restriction endonuclease recognition sites at which the sequence may be cut in a predetermined fashion, and which contains a marker suitable for use in the identification of transformed cells, e.g., uracil utilization, tetracycline resistance, ampicillin resistance. A cloning vector may or may not possess the features necessary for it to operate as an expression vector.
(10) Codon. A DNA sequence of three nucleotides (a triplet) which codes (through mRNA) for an amino acid, a translational start signal, or a translational termination signal. For example, the nucleotide triplets TTA, TTG, CTT, CTC, CTA, and CTG encode for the amino acid leucine, while TAG, TAA, and TGA are translational stop signals, and ATG is a translational start signal.
(11) Complement or Complementary Sequence. The product of complementary base pairing in which purines bond with pyrimidines, as it occurs in the two polynucleotide chains of DNA (adenine with thymine, guanine with cytosine) and between DNA and messenger RNA nucleotides during transcription.
(12) DNA Coding Sequence. A DNA sequence which is transcribed and translated into a polypeptide in viva when placed under the control of appropriate regulatory sequences. The boundaries of the coding sequence are determined by a start codon at the 5 (amino) terminus and a translation stop codon at the 3 (carboxy) terminus. A coding sequence can include, but is not limited to, prokaryotic sequences and cDNA from eukaryotic mRNA. A polyadenylation signal and transcription termination sequence will usually be located 3 to the coding sequence.
(13) DNA Sequence. A linear series of nucleotides connected one to the other by phosphodiester bonds between the 3 and 5 carbons of adjacent pentoses.
(14) Expression. The process undergone by a structural gene to produce a polypeptide. Expression requires both transcription of DNA and translation of RNA.
(15) Expression Vector. A replicon such as a plasmid, virus, retrovirus, bacteriophage, or nucleic acid sequence which is able to replicate in a host cell, characterized by a restriction endonuclease recognition site at which the sequence may be cut in a predetermined fashion for the insertion of a heterologous DNA sequence. An expression vector has a promoter positioned upstream of the site at which the sequence is cut for the insertion of the heterologous DNA sequence, the recognition site being selected so that the promoter will be operatively associated with the heterologous DNA sequence. A heterologous DNA sequence is operatively associated with the promoter in a cell when RNA polymerase, which binds the promoter sequence transcribes the coding sequence into mRNA which is then in turn translated into the protein encoded by the coding sequence.
(16) Fusion Protein. A protein produced when two heterologous genes or fragments thereof coding for two different proteins not found fused together in nature are fused together in an expression vector. For the fusion protein to correspond to the separate proteins, the separate DNA sequences must be fused together in correct translational reading frame.
(17) Gene. A segment of DNA which encodes a specific protein or polypeptide, or RNA.
(18) Genome. The entire DNA of an organism. It includes, among other things, the structural genes encoding for the polypeptides of the substance, as well as operator, promoter and ribosome binding and interaction sequences.
(19) Heterologous DNA. A DNA sequence inserted within or connected to another DNA sequence which codes for polypeptides not coded for in nature by the DNA sequence to which it is joined. Allelic variations or naturally occurring mutational events do not give rise to a heterologous DNA sequence as defined herein.
(20) Hybridization. The pairing together or annealing of single stranded regions of nucleic acids to form double-stranded molecules.
(21) Nucleotide. A monomeric unit of DNA or RNA consisting of a sugar moiety (pentose), a phosphate, and a nitrogenous heterocyclic base. The base is linked to the sugar moiety via the glycosidic carbon (1 carbon of the pentose) and that combination of base and sugar is a nucleoside. The base characterizes the nucleotide. The four DNA bases are adenine (A), guanine (G), cytosine (C), and thymine (T). The four RNA bases are A, G, C, and uracil (U).
(22) Phage or Bacteriophage. Bacterial virus many of which include DNA sequences encapsidated in a protein envelope or coat (capsid). In a unicellular organism, a phage may be introduced by a process called transfection.
(23) Plasmid. A non-chromosomal double-stranded DNA sequence comprising an intact replicon such that the plasmid is replicated in a host cell. When the plasmid is placed within a unicellular organism, the characteristics of that organism may be changed or transformed as a result of the DNA of the plasmid. A cell transformed by a plasmid is called a transformant.
(24) Polypeptide. A linear series of amino acids connected one to the other by peptide bonds between the alpha-amino and carboxy groups of adjacent amino acids.
(25) Promoter. A DNA sequence within a larger DNA sequence defining a site to which RNA polymerase may bind and initiate transcription.
(26) Reading Frame. The grouping of codons during translation of mRNA into amino acid sequences. During translation the proper reading frame must be maintained. For example, the DNA sequence may be translated via mRNA into three reading frames, each of which affords a different amino acid sequence.
(27) Recombinant DNA Molecule. A hybrid DNA sequence comprising at least two DNA sequences, the first sequence not normally being found together in nature with the second.
(28) Ribosomal Binding Site. A nucleotide sequence of mRNA, coded for by a DNA sequence, to which ribosomes bind so that translation may be initiated. A ribosomal binding site is required for efficient translation to occur. The DNA sequence coding for a ribosomal binding site is positioned on a larger DNA sequence downstream of a promoter and upstream from a translational start sequence.
(29) Start Codon. Also called the initiation codon, is the first mRNA triplet to be translated during protein or peptide synthesis and immediately precedes the structural gene being translated. The start codon is usually AUG, but may sometimes also be GUG.
(30) Stringent Hybridization Conditions. The term stringent conditions or stringent hybridization conditions includes reference to conditions under which a probe will hybridize to its target sequence, to a detectably greater degree than to other sequences (e.g., at least 2-fold over background). Stringent conditions are sequence-dependent and will differ in different circumstances. By controlling the stringency of the hybridization and/or washing conditions, target sequences can be identified which are 100% complementary to the probe (homologous probing). Alternatively, stringency conditions can be adjusted to allow some mismatching in sequences so that lower degrees of similarity are detected (heterologous probing). Generally, a probe is less than about 1000 nucleotides in length, optionally less than 500 nucleotides in length. Typically, stringent hybridization conditions comprise hybridization in 50% formamide, 1 M NaCl, 1% SDS at 42 C., and a wash in 0.1SSC at 60 to 65 C. It is also understood that due to the advances in DNA PCR and sequencing approaches that issues of gene identity and homology may be determined by sequence based rather than hybridization approaches.
(31) Structural Gene. A DNA sequence which encodes through its template or messenger RNA (mRNA) a sequence of amino acids characteristic of a specific polypeptide.
(32) Substantially Pure. The condition of a compound, such as a protein or a nucleotide, being cell free or being separated from other components that would interfere with or have a substantial qualitative effect on the activity of the compound or on a substrate on which the compound acts.
(33) Transform. To change in a heritable manner the characteristics of a host cell in response to DNA foreign to that cell. An exogenous DNA has been introduced inside the cell wall or protoplast. Exogenous DNA may or may not be integrated (covalently linked) to chromosomal DNA making up the genome of the cell. In prokaryotes and some fungi, for example, the exogenous DNA may be maintained on an episomal element such as a plasmid. With respect to most eukaryotic cells, a stably transformed cell is one in which the exogenous DNA has been integrated into a chromosome so that it is inherited by daughter cells through chromosome replication. This stability is demonstrated by the ability of the eukaryotic cell to establish cell lines or clones comprised of a population of daughter cells containing the exogenous DNA.
(34) Transcription. The process of producing mRNA from a structural gene.
(35) Translation. The process of producing a polypeptide from mRNA.
(36) Vaccine. Vaccine is defined herein in its broad sense to refer to any type of biological agent in an administrable form capable of stimulating a protective immune response in an animal inoculated with the vaccine. For purposes of this invention, the vaccine may comprise either one or more of the immunogenic (antigenic) proteins or nucleic acid constructs encoding these proteins.
DETAILED DESCRIPTION OF THE INVENTION
(37) In the following description, the nomenclature used to define the proteins and peptides is that specified by Schroder and Lubke [The Peptides, Academic Press (1965)] wherein, in accordance with conventional representation, the N-terminal appears to the left and the C-terminal to the right. Where the amino acid residue has isomeric forms, it is the L-form of the amino acid that is represented herein unless otherwise expressly indicated.
(38) We have isolated two immunogenic proteins from the cattle tick, an aguaporin protein fragment and a tick gut membrane protein, TC5777, which can be effectively used as protective vaccines against the cattle tick, Rhipicephalus microplus in livestock, including bovines. Moreover, while we have demonstrated efficacy using aquaporin protein fragments, it is recognized that larger fragments of the protein which encompass the disclosed fragments, or the entire aguaporin protein, may also be used herein. This aquaporin protein is believed to play a role in the osmoregulation system of the tick, while the TC5777 is a gut membrane protein of the tick which is up-regulated in response to infection of the tick gut by B. bovis. The proteins have been isolated, substantially free from other proteins or cell components which are normally present in the cells of the tick, such that the aquaporin or TC5777 proteins are the only significant protein or peptide in the sample and may be used effectively as a vaccine. Moreover, both of the proteins have been produced in recombinant form as described herein below. The term isolated encompasses not only proteins which have been recovered from naturally occurring cells, but also recombinant proteins and synthesized proteins. Each of the aquaporin protein fragments and TC5777 gut membrane protein, including recombinants, are immunogenic, effective for eliciting a protective immune response against the cattle tick, which response is mediated by humoral, i.e., antibodies, and/or cellular processes. The gut membrane (i.e., TC5777) protein of R. microplus has been previously described by Rachinsky et al. (2008, ibid) as being up-regulated in response to infection with the B. bovis parasite, and a partial amino acid sequence was provided. However, the function of the TC5777 gut membrane protein, its use as a vaccine and its gene, have not been described.
(39) The isolated aquaporin protein fragment and TC5777 gut membrane protein of R. microplus have been sequenced, and their amino acid sequences are shown in
(40) It is envisioned that the R. microplus aquaporin and TC5777 gut membrane proteins may be synthesized by any suitable method well known to those skilled in the art of peptide synthesis, such as exclusively solid-phase techniques, partial solid-phase techniques, fragment condensation, or classical solution addition. For example, without being limited thereto, suitable solution phase synthesis methods are described by Finn and Hoffman [In Proteins, Vol. 2, 3rd Ed., H. Neurath and R. L. Hill (eds.), Academic Press, New York, pp. 105-253 (1976)], while solid phase synthesis methods are described by Barany and Merrifield [In The Peptides, Vol. 2, E. Gross and J. Meienhofer (eds.), Academic Press, New York, pp. 3-284 (1979)], and stepwise solid phase synthesis methods are described by Merrifield [J. Am. Chem. Soc. 85: 2149-2154 (1963)], the contents of each of which are incorporated herein by reference. However, the proteins are preferably produced by recombinant DNA techniques which are particularly suitable for large-scale use. Without being limited thereto, nucleotide sequences encoding the proteins which are preferred for use in recombinant DNA techniques are described in detail below. The synthetic proteins may be obtained by transforming a microorganism using an expression vector including a promoter or operator, or both, together with one or both of the aquaporin and TC5777 gut membrane structural genes and causing such transformed microorganisms to express the proteins.
(41) The genes encoding each of the aquaporin protein fragment and TC5777 gut membrane protein of R. microplus have also been isolated and their cDNA nucleic acid sequences are shown in
(42) As noted above, the amino acid sequence of the aquaporin protein fragment may be modified to assist cloning in the selected vector, and either of the expressed proteins (aquaporin or TC5777) may further include optional, additional terminal amino acid sequences from the vector (not of tick origin). Thus, the nucleic acid sequences may be modified to reflect these changes. For example,
(43) Any one or combinations of the isolated cDNA nucleic acid sequences encoding the R. microplus aquaporin and TC5777 gut membrane proteins may be cloned into any suitable vector for subsequent use as either a DNA vaccine or for the production of recombinant R. microplus aquaporin or TC5777 gut membrane proteins. For use as a DNA vaccine, the nucleic acid constructs comprising the nucleic acid sequences encoding the R. microplus aquaporin and/or TC5777 gut membrane proteins are administered to a subject animal such that the proteins are expressed in vivo within the cells of the vaccinated animal. Similarly, where the object is the production of recombinant proteins, the nucleic acid constructs are used for the transformation of a microorganism and causing such transformed microorganism to express the proteins in vitro.
(44) A variety of vectors are suitable for use herein, and are selected to be operable as cloning vectors or expression vectors in the selected host cell, although expression vectors are preferred. Numerous vectors are known to practitioners skilled in the art, and selection of an appropriate vector and host cell is a matter of choice. The vectors may, for example, be bacteriophage, plasmids (including linearized or circular plasmids), viruses or hybrids thereof, such as those described in Sambrook et al. (ibid) or Ausubel et al. (Current Protocols in Molecular Biology, John Wiley & Sons, Inc, 1995), the contents of each of which are herein incorporated by reference. Further, the vectors may be non-fusion vectors (i.e., those producing the proteins of the invention not fused to any heterologous polypeptide), or alternatively, fusion vectors (i.e., those producing the proteins fused to a vector encoded polypeptide). The fusion proteins would of course vary with the particular vector chosen. In accordance with a preferred embodiment, and particularly for applications as DNA vaccines, the vectors are eukaryotic expression vectors, most preferably plasmids. Particularly preferred plasmids for use herein include plasmids commercially available from Invitrogen Inc., Carlsbad, Calif. for both the DNA vaccine and recombinant protein vaccine protocols. The pcDNA 4/myc 5.1 kb vectors are designed for overproduction of recombinant proteins in mammalian cells. This plasmid contains a human cytomegalovirus immediate-early (CMV) promoter for high-level expression, a c-myc epitope and 6His metal-binding peptide tag for facilitating protein purification and verification, and a Zeocin antibiotic resistance marker gene coding region for selection purposes. The preferred plasmids used to produce recombinant proteins are the pPICZ and pPICZ from Invitrogen Inc. Both plasmids contain the AOX1 gene promoter for methanol-inducible high-level expression in Pichia pastoris, a c-myc epitope and 6His metal-binding peptide tag for facilitating protein purification and verification, and a Zeocin antibiotic resistance marker gene coding region for selection purposes. The pPICZ also contains a native Saccharomyces cerevisiae -factor secretion signal.
(45) Regardless of the specific vector utilized, various sites may be selected for insertion of the isolated nucleotide sequences. These sites are usually designated by the restriction enzyme or endonuclease that cuts them.
(46) The particular site chosen for insertion of the selected nucleotide sequences into the vector to form a recombinant vector is determined by a variety of factors. These include size and structure of the protein to be expressed, susceptibility of the desired protein to enzymatic degradation by the host cell components and contamination by its proteins, expression characteristics such as the location of start and stop codons, and other factors recognized by those skilled in the art. None of these factors alone absolutely controls the choice of insertion site for a particular polypeptide. Rather, the site chosen reflects a balance of these factors, and not all sites may be equally effective for a given protein.
(47) The nucleotide sequences comprising the R. microplus aquaporin protein fragment and/or TC5777 gut membrane protein encoding genes may be inserted into the desired vector by known techniques. If, however, the vector is to serve as an expression vector, the vector should have a promoter effective for expression in the selected host cell, and the DNA sequences should be inserted in the vector downstream of the promoter and operationally associated therewith (that is, the promoter should be recognized by the RNA polymerase of the host cell). In addition, the vector should have a region which codes for a ribosome binding site positioned between the promoter and the site at which the DNA sequence is inserted so as to be operatively associated with the DNA sequence of the invention once inserted (in correct translational reading frame therewith). The vector should be selected to provide a region which codes for a ribosomal binding site recognized by the ribosomes of the host cell into which the vector is to be inserted. The vector should contain a terminator with necessary 3 untranslated sequences for RNA termination, stability, and/or poly(A) tail addition (if eukaryotic). Alternatively, any or all of the above control sequences may be ligated to the coding sequence prior to insertion into the vector.
(48) For use in animal vaccinations, the isolated R. microplus aquaporin protein fragment and/or TC5777 gut membrane protein or the nucleic acid constructs comprising the nucleic acid sequences encoding these proteins, will typically be formulated in conjunction with a suitable pharmaceutically acceptable carrier or diluent as is known in the art, including, but not limited to, physiological saline, mineral oil, vegetable oils, aqueous carboxymethyl cellulose or polyvinylpyrrolidone. The skilled practitioner will recognize that such carriers should of course be compatible with the proteins or nucleic acid constructs. Phosphate buffered saline (PBS) is preferred. The concentration and amount of the proteins or nucleic acid constructs in the final composition may vary depending upon the desired use and type of response needed, and the host animal. In any event, the proteins or nucleic acid constructs should be provided in an amount effective to induce the preferred response as determined by routine testing. Appropriate adjuvants as known in the art may also be included in the formulation. Without being limited thereto, suitable adjuvants include but are not limited to mineral oil, vegetable oils, alum, Freund's incomplete adjuvant, and microparticles or nanoparticles or beads of biocompatible matrix materials such as (although not limited to) agar or polyacrylate. Other known immunogenic agents used in conventional vaccines for bovine may also be included in the formulation.
(49) The immunogenic R. microplus aquaporin protein fragment and/or TC5777 gut membrane protein or the nucleic acid constructs comprising the nucleic acid sequences encoding these proteins are administered in an amount effective to reduce or eliminate the incidence of infestation of treated livestock, including bovines, with the cattle tick, R. microplus. As noted hereinabove, the administration of the R. microplus aquaporin and/or TC5777 gut membrane protein, or the nucleic acid constructs comprising the nucleic acid sequences encoding these proteins (such that the nucleic acid sequences are expressed and the encoded proteins are produced in vivo in the cells of the vaccinated animal), stimulates an immune response in the animal. Thus, as used herein, an effective amount of R. microplus aquaporin and/or TC5777 gut membrane protein or the nucleic acid constructs comprising the nucleic acid sequences encoding these proteins, is preferably defined as that amount which will elicit a protective immune response against the cattle tick, which may be either or both of antibody production against the protein(s) or a cell-mediated immune response against the tick, in a treated animal in comparison to an untreated control animal. In a preferred embodiment, an immune response may be demonstrated by production of antibodies against either or both of the R. microplus aquaporin and/or TC5777 gut membrane proteins, by a significant reduction in the percentage of animals infested with the cattle tick, by a significant reduction in the average number of cattle ticks on animals, or by a significant reduction in the number of viable eggs produced by the cattle ticks present on animals, all in vaccinated animals as compared to an unvaccinated control group (measured at a confidence level of at least 80%, preferably measured at a confidence level of 95%). The actual effective amount will of course vary with the specific vaccine component (protein vaccine or DNA vaccine), the age and size of the target animal, and the route of administration, and may be readily determined empirically by the practitioner skilled in the art using an antigen dose response assay. By way of example and without being limited thereto, for vaccines administered to bovine by subcutaneous or intramuscular injection, or with a needle-less device, it is envisioned that typical doses of protein vaccine (R. microplus aquaporin and/or TC5777 gut membrane proteins), may be greater than 10 g protein/animal/dose, preferably between about 50 to 150 g protein/animal/dose, while typical doses of DNA vaccine (nucleic acid constructs) may be greater than 100 g of DNA construct/animal/dose, preferably between about 300 to 800 g DNA construct/animal/dose.
(50) The vaccines (R. microplus aquaporin and/or TC5777 gut membrane protein or the nucleic acid constructs comprising the nucleic acid sequences encoding these proteins) may be used for the treatment of livestock, including horses, sheep, and bovines such as dairy cows and preferably cattle. The vaccines may be effectively administered any time after the animal attains immunocompetence. The vaccines may be administered to the subject animal by any convenient route which enables an immune response. However, parenteral injection (e.g., subcutaneous, intravenous, or intramuscular) is preferred, with intradermal injection being particularly preferred for administration of the DNA vaccines and intramuscular injection being particularly preferred for administration of the protein vaccines. The vaccine products could also be administered using a needle-less device. The vaccine may be administered in a single dose or in a plurality of doses. Dependent upon rearing conditions, the vaccine may be administered in multiple doses, the timing of which may be readily determined by the skilled artisan.
(51) Where the nucleic acid constructs are to be employed for the production of recombinant R. microplus aquaporin or TC5777 gut membrane proteins, a variety of vector-host cell expression systems may be employed. Strains of yeast, particularly Pichia pastoris, are preferred. However, the novel invention described here can be applied with numerous host cells that would desirable. Host strains may be of bacterial, fungal, insect cell line, plant, or yeast origin. Ascertaining the most appropriate host-vector system is within the skill of the person in the art.
(52) DNA constructs may be introduced into the appropriate host cell by numerous methods described in the technical and scientific literature. Transformation of bacteria or yeast may be performed using standard techniques described in Sambrook et al., (ibid). Techniques for transforming filamentous fungi may include those described by Goosen et al. [Handbook for Applied Mycology, Arora, Elander & Mukerji, eds. (1992) pp. 151-195] and May et al. [Applied Molecular Genetics of Filamentous Fungi, Kinghorn and Turner, eds. (1992) pp. 1-27]. In general, linear or circular DNA constructs may be introduced into the host cell by techniques utilizing protoplast fusion, polyethylene glycol, liposomes, lithium acetate, electroporation, physical damage, biolistic bombardment, or Agrobacterium mediated transformation.
(53) Successful transformants may be isolated by using markers, contained on the expression vectors, which confer a selectable trait to the transformed host cell. These may include nutritional selection related to substrate utilization (such as, growth on acetamide containing medium) or prototrophy of a required growth product (such as, arginine, leucine, or uracil). Dominant selectable markers (such as, resistance to ampicillin, G418, hygromycin, and phleomycin) are also useful in selecting transformants that have taken up the introduced DNA construct.
(54) The DNA construct may be replicated autonomously or integrated into the genome of the host cell. Integration typically occurs by homologous recombination (for example, arginine selectable marker integrating in the chromosomal arginine gene) or at a chromosomal site unrelated to any genes on the DNA construct. Integration may occur by either a single or double cross-over event. It is also possible to have any number of these integration and replication types occurring in the same transformant.
(55) The following example is intended only to further illustrate the invention and is not intended to limit the scope of the invention which is defined by the claims.
EXAMPLE 1
Material and Methods
(56) Ticks
(57) Tick larvae used in this study to infest cattle for the cattle vaccine trials were obtained from a laboratory colony maintained at EMBRAPA Beef Cattle. The colony was established with R. microplus ticks collected from infested cattle in Campo Grande, MS, Brazil (Casquero-Cunha et al. In press). Fully engorged adult female ticks were collected upon host detachment and brought to the laboratory to allow oviposition. Egg masses were incubated in humidity chambers at 28 C. and 95% relative humidity to facilitate hatching. Larvae were used for infestation at 18 days after hatching. Nucleic acids were obtained from engorged adult female Rhipicephalus (Boophilus) microplus of the f20 La Minita strain maintained at The University of Idaho Holm Research Center (Moscow, Id.). The La Minita strain was originally collected in 1996 during an outbreak in Starr County, Texas and propagated at the USDA-ARS Cattle Fever Tick Research Laboratory in Edinberg, Tex. (Guerrero et al. 2001. J. Med. Entomol. 38:44-50).
(58) RNA Purification
(59) Total RNA was isolated using the FastPrep-24 Tissue and Cell Homogenizer and Lysing Matrix D (Qbiogene, Irvine, Calif., USA) as described in Saldivar of al. [2008. Microanalysis of acaricide-induced gene expression in the southern cattle tick, Rhipicephalus (Boophilus) microplus. Insect Mol Biol. 17:597-606] from gut tissue dissected from engorged adult female Rhipicephalus (Boophilus) microplus. The total RNA was DNAse treated following manufacturer's protocol using Turbo DNA-free kit (Ambion, Austin, Tex., USA).
(60) cDNA Synthesis & RACE
(61) One microgram DNase-free total RNA was used to make 5 and 3 cDNA using the SMART RACE cDNA Amplification Kit (Clontech Laboratories Inc., Mountain View, Calif., USA) and Superscript III Reverse Transcriptase (Life Technologies, Grand Island, N.Y., USA). Primers (Sigma-Aldrich, The Woodlands, Tex., USA) were designed from the target antigen sequences, synthesized, and used to obtain complete open reading frame sequences of each target antigen.
(62) The Aquaporin target 5 end was obtained using 20 L PCR reactions using 5 SMART RACE cDNA, ADVANTAGE 2 PCR Enzyme System (Clontech Laboratories Inc., Mountain View, Calif., USA), Universal Primer A and gene specific primer KB-126 according to manufacturer's protocol using the touchdown cycling profile suggested in the SMART RACE protocol booklet. This amplification product was used for a nested PCR using Nested Universal Primer A and gene specific primer KB-126 following manufacturer's protocol using a cycling profile of thirty cycles including a denaturing step of 94 C. for 30 sec, annealing step of 72 C. for 30 sec and extension step of 72 C. for 3 min.
(63) The TC5777 gut membrane protein target 5 end was obtained similarly except gene specific primer KB-130 was used. The 3 end was obtained using the same conditions as the 5 RACE experiment with the exception of using 3 SMART RACE cDNA and gene specific primer KB-127 for primary PCR and primer KB-128 for the nested PCR.
(64) The nested PCR products were analyzed using electrophoresis on 2% SeaKem Gold agarose gels in 1TBE running buffer (Lonza Group Ltd, Switzerland) and post-stained using GELSTAR Nucleic Acid Gel Stain (Lonza Group Ltd). This resulted in a 965 bp Aquaporin 5 RACE product, 410 bp and 480 bp TC5777 gut membrane protein 5 RACE products, and a 642 bp TC5777 gut membrane protein 3 RACE product. The resulting amplicon was excised from the agarose gel and DNA extracted and purified using QIAquick Gel Extraction Kit (Qiagen, Valencia, Calif., USA) according to manufacturer's protocol. The extracted gel product was then concentrated according to manufacturer's protocol using Pellet Paint Co-Precipitant (Novagen/EMD Chemicals Inc, Gibbstown, N.J., USA), polished, ligated and transformed with XL10 Gold Kan Ultracompetent Escherichia coli cells using the PCR Script Amp Cloning Kit (Stratagene/Agilent Technologies Inc, Santa Clara, Calif., USA). Individual clones were screened via. PCR using internal vector primers M13-20 and M13 Reverse with those producing a correct sized product grown in overnight cultures to make 80 C. glycerol stocks and plasmid DNA using the QIAprep Spin Miniprep Kit (Qiagen) with a QIAvac24 (Qiagen) according to manufacturer's instructions. Clones producing the correct sized restriction enzyme product were then sequenced on a 3130xl Genetic Analyzer (Applied Biosystems) using internal vector primers in both directions, specifically the standard M13-20, M13 Reverse, T3 and T7 primers. Sequences were assembled and analysis done using MacVector with Assembler version 10.0.2. Resulting consensus sequences were subjected to blastn and blastx searches.
(65) Cloning into Pichia pastoris
(66) The Aquaporin DNA insert was amplified with the ADVANTAGE 2 PCR Enzyme System (Clontech Laboratories Inc.) using 10 g template DNA, primers KB-156 and KB-157, and a cycling profile including an initial denaturation step of 95 C. for 3 min, thirty cycles of 92 C. for 1 min, 60 C. for 30 sec, 68 C. for 1 min and a final extension at 68 C. for 7 min. These conditions produced a 597 bp product. The TC5777 gut membrane protein DNA insert was amplified in a similar fashion using primers KB-152 and KB-153. This protocol yielded a 657 bp product. Both products were purified with agarose gel electrophoresis and gel extracted as described above. DNA was prepared for ligations by restriction enzyme digestion reactions with EcoRI (Life Technologies) and NotI (Life Technologies) per manufacturer's protocol.
(67) The EasySelect Pichia Expression Vectors (Life Technologies), pPICZ A and pPIC Z C, were used with Aquaporin and TC5777 gut membrane protein, respectively. Vector DNA was restriction enzyme digested with EcoRI (Life Technologies) and NotI (Life Technologies) and purified by agarose gel electrophoresis followed by gel extraction as described above. Aquaporin EcoRI/NotI digested insert DNA was ligated into the pPICZ A EcoRI/NotI-digested vector using the TA Cloning Kit (Life Technologies) with T4 DNA ligase [1 unit/L] (Life Technologies) using a modified version of the TA Cloning Kit protocol. A 10 L ligation reaction was set up consisting of 1 T4 DNA ligase reaction buffer, 137 ng Aquaporin insert, 50 ng pPICZ A EcoRI/NotI digested vector, and 1 L T4 DNA ligase incubated for 17 hrs at 4 C. TC5777 gut membrane protein-encoding EcoRI/NotI digested DNA was ligated into the pPICZ C EcoRI/NotI digested vector in a similar fashion using 160 ng insert DNA.
(68) OneShot TOP10 Electrocomp cells (Life Technologies) were transformed with ligation reaction and plated on low salt LB agar (1% tryptone, 0.5% yeast extract, 0.5% sodium chloride, 1.5% agar) with 25 g/mL ZEOCIN (Life Technologies). Resulting colonies were screened via PCR using vector primers 5AOX1 and 3 AOX1 and DNA isolated from positive colonies using the QIAprep Spin Miniprep Kit (Qiagen) according to manufacturer's instructions. The sequence of both strands of putative positive clones was verified by DNA sequencing. Sequence analysis utilized MacVector with Assembler version 10.0.02.
(69) Ten micrograms of each expression vector-antigen DNA combination was restriction enzyme digested with SstI (Life Technologies) to linearize the expression vector according to the EasySelect Pichia Expression Kit protocol (Life Technologies). A freshly prepared 80 L aliquot of electrocompetent P. pastoris KM71H strain and 5 g linearized expression vector DNA was used for transformations according to the manufacturer's instructions using the Bio-Rad Gene Pulser and Pulse Controller with pulse settings of 1.5 kV, 200 and 25 FD. Transformation mixtures were plated on YPDS (1% yeast extract, 2% peptone, 2% dextrose, 1M sorbitol, 2% agar) plates containing 100 g/mL ZEOCIN and incubated at 30 C. for four days to allow colonies to develop.
(70) Analysis of Pichia pastoris Transformants
(71) Direct screening of individual Pichia KM71H colonies using PCR was done by modifying the direct screening protocol from Linder et al. (1996. Direct PCR screening of Pichia pastoris clones. BioTechniques. 20:980-982) and the EasySelect Pichia Expression Kit manual. Single colonies were prepared as described in the direct screening protocol and 2.5 L used in a 25 L PCR including 10 mM Tris(hydroxymethyl)aminomethane hydrochloride, pH=8.3, 50 mM KCl, 2.5 mM MgCl.sub.2, 0.05 mM each dNTP, 2 M 5 AOX1 vector primer, 2 M 3 AOX1 vector primer, 0.16 L of a 1 vol:1 vol mix of AmpliTaq DNA polymerase (5 U/L stock; Applied Biosystems) and TagStart antibody (1.1 g/L stock; Clontech). The cycling profile included a 95 C. for 5 min initial denaturation step, thirty cycles of 95 C. for 1 min, 54 C. for 1 min, 72 C. for 1 min and a final extension at 72 C. for 7 min. Aquaporin-positive colonies produced a 1192 bp band and TC5777 gut membrane protein-positive colonies produced a 990 bp band. The Pichia KM71H colonies were also screened using gene specific primers for each of the antigens.
(72) Small-scale expression experiments were used to determine the optimal method and conditions for the expression of the recombinant proteins. These used similar protocols as described in the EasySelect Pichia Expression Kit manual using 3 mL cultures grown in BMGY (1% yeast extract, 2% peptone, 100 mM potassium phosphate pH 6.0, 1.34% Yeast nitrogen base with ammonium sulfate without amino acids, 410.sup.5% biotin, 1% glycerol) and BMMY media (1% yeast extract, 2% peptone, 100 mM potassium phosphate pH 6.0, 1.34% Yeast nitrogen base with ammonium sulfate without amino acids, 410.sup.5% biotin, 0.5% methanol). Cultures were replenished to 0.5% final methanol concentration every 24 hours.
(73) Both the intracellular cell pellets and the secreted supernatant samples were analyzed by denaturing gel electrophoresis under reducing conditions using the NUPAGE Electrophoresis System (Life Technologies) and NUPAGE 4-12% Bis-Tris gels (Life Technologies) in the XCell SURELOCK Mini-Cell (Life Technologies) with 1 NUPAGE MOPS SDS Running Buffer (Life Technologies) according to manufacturer's instructions. Proteins were visualized by staining with Coomassie Brilliant Blue R-250 using a modified Fairbank's method (Wong et al., 2000. Heating greatly speeds Coomassie Blue staining and destaining. Biotechniques. 28:426-432). Recombinant Aquaporin was localized in the cell pellet sample with maximal expression seen after 4 days of induction growth in BMMY while the recombinant TC5777 gut membrane protein was secreted into the growth media with maximal expression seen after 16 hr of induction in BMMY.
(74) After the optimized expression time points were determined in the small-scale expression experiments, large scale cultures were grown to produce more protein. For Aquaporin, cells were grown in 25 mL BMGY media in 500 ml baffled flasks in a shaking incubator (275 rpm) at 29 C. to an OD.sub.600=2-6. Cells were harvested by centrifugation and resuspended in BMMH to an OD.sub.600=1 and returned to the incubator at 29 C. with shaking to induce expression. Every 24 hrs, methanol was added to a final concentration of 0.5% to maintain induction and cells were harvested four days post-induction. The resulting supernatant was decanted and cell pellets frozen at 70 C. until protein extraction.
(75) Total yeast intracellular protein was extracted similarly as described above for the small-scale expression cell pellets with the exception of using 50 mL Breaking Buffer and 10 cycles of 30 sec vortexing followed by 30 sec on ice. The cell pellet lysates were then frozen at 70 C. overnight and thawed followed by 10 cycles of 30 sec vortexing and 30 sec on ice. The protein solution was clarified by centrifugation and the resulting solution concentrated using Centricon Plus-70 Centrifugal Filter Devices (Millipore; 10,000 MWCO) and freezing. TC5777 gut membrane protein was grown in similar fashion, harvesting the media supernatant fraction 16 hr after induction initiation in BMMY, and concentrating in Centricon Plus-70 units.
(76) DNA Vaccine Reagents
(77) The Aquaporin and TC5777 gut membrane protein coding regions were prepared using PCR with the ADVANTAGE 2 PCR Enzyme System (Clontech Laboratories Inc.) manufacturer protocol and primers KB-144 and KB-145 for Aquaporin and primers KB-146 and KB-147 for TC5777 gut membrane protein. The cycling profile including an initial denaturation step of 95 C. for 3 mins, thirty cycles of 92 C. for 1 min, 64 C. for 30 sec, 68 C. for 1 min and a final extension at 68 C. for 7 min. This protocol produced a 597 bp product for Aquaporin and 657 bp product for TC5777 gut membrane protein. Amplification products were gel purified using the QIAquick Gel Extraction kit (Qiagen), concentrated using Pellet Paint Co-Precipitant (Novagen), and ligated onto the pcDNA 4/myc-His Vectors (Life Technologies). The forward and reverse primers used in the PCR include an internal PstI and XhoI site, respectively, for in-frame insertion into the pcDNA 4/myc-His vectors. Aquaporin and the TC5777 gut membrane protein coding regions were ligated into PstI/XhoI double digested pcDNA 4/myc-His vectors A and C, respectively, vector using the TA Cloning Kit (Life Technologies) with T4 DNA ligase [1 unit/L] (Life Technologies) using a modified version of the TA Cloning Kit protocol as described above. Sequence verifications were performed as described above. The Qiagen Plasmid Giga Kit (Qiagen) was used to produce milligram quantities of plasmid DNA for the vaccine study.
(78) Native Affinity Purification of Expressed Recombinant Protein
(79) Recombinant protein for both antigens was purified making use of the 6-Histidine tag and the ProBond Purification System (Life Technologies) using PROBOND nickel-chelating resin under native conditions according to manufacturer's instructions. Eluted protein was concentrated using Amicon Ultra-15 (10,000 MWCO) centrifugation units, protein quantified by the BioRad Protein Assay Kit I with bovine plasma gamma globulin protein standards, and purity verified by gel electrophoresis as described above. Protein identity was verified by mass spectrometry analysis and Western blotting, taking advantage of the c-myc and 6His tag epitopes on the recombinant protein that are provided by the expression vector sequence. The WesternBreeze Chromogenic Kit and Anti-myc-HRP and Anti-His(C-term)-HRP antibodies (Invitrogen) were utilized with standard protocols provided by the supplier. The supplier-provided alkaline phosphatase-conjugated secondary antibody was utilized to enhance sensitivity.
(80) Pen Trial
(81) Controlled pen trials were conducted to evaluate the immunogenic and protective capacity of each antigen. Recombinant protein antigen was adjuvated with Montanide ISA 61 VG (Seppic, Paris) into doses of 2 ml containing 100 g of the recombinant protein. DNA vaccine was prepared by solubilizing expression plasmid DNA in phosphate-buffered saline at 1 mg/ml and 1 ml was mixed with an equal volume of adjuvant to produce the 2 ml dose of vaccine for each injection. One-year-old Holstein calves were randomly distributed into groups of six animals each. Negative controls were injected with adjuvant/saline alone. Following a method similar to Andreotti (2006. Performance of two Bm86 antigen vaccin formulation against tick using crossbreed bovines in stall test. Rev Bras Parasitol Vet. 15:97-100), all the animals were injected intramuscularly at 0, 2 and 4 weeks. Serum samples were taken from each animal before immunization and weekly thereafter. Twenty-one days after the last injection the animals were challenged with 15,000 larvae of the Campo Grande tick strain. These larvae were delivered in three applications of 5,000 larvae each during one week, placed in separate vials onto the back of the animals. As engorged female ticks detached, they were collected once a day, weighed, and incubated at 29 C. and 85% humidity until egg laying was complete. Eggs were weighed and incubated at 29 C. and 85% humidity to allow hatching so as to determine the eclosion percentage.
(82) Bovine Serum Collection and Analysis
(83) Bovine blood was sampled weekly and separated serum frozen until analyzed by ELISA. For the ELISA, sera from each group were pooled according to day of collection. Microtiter plates were coated with antigen (50 L per well of a 1 g antigen/ml solution in 20 mM sodium carbonate buffer, pH 9.6) and incubated overnight at 4 C. Blocking with 2% bovine serum albumin in PBS-T was followed by washing five times with PBS pH 7.4. The plates were incubated for 45 min at 37 C. with 100 L per well of immunized bovine serum diluted to 1:100 in PBS. After washing, 50 l of rabbit anti-bovine IgG peroxidase conjugate (Sigma, St. Louis, Mo.) diluted to 1:20,000 was added and the plate incubated for 30 min at room temperature. After incubation and washing 50 l of chromogenic substrate o-phenylenediamine (1.0 mM) was added and the reaction was stopped after 15 min by adding 50 l of NaOH (0.2 M). A microplate reader was used to assess the results with absorbance set at 490 nm.
(84) Statistics and Efficacy Assessment
(85) Vaccination effects on tick biology, and efficacy were determined as described by Garcia-Garcia et al. (1999. Sequence variations in the Boophilus microplus Bm86 locus and implications for immunoprotection in cattle vaccinated with this antigen. Exp Applied Acarol. 23:883-895) and Andreotti (2006. ibid). Briefly, reduction rates associated with immunization relative to the unvaccinated group were determined for adult female ticks (% DT), egg-laying capacity (% DO), and fertility (% DF). Vaccine efficacy was calculated as 100[1(CRTCROCRF)], where CRT, CRO, and CRT represent the reduction in the number of adult female ticks, egg-laying capacity, and fertility, respectively. The Mann-Whitney nonparametric test was used to compare biological data and to assess vaccine efficacy. Mean antibody levels were determined for each group and compared using ANOVA as described previously (Andreotti, 2006. ibid).
(86) Results
(87) The results of the vaccination trials with both the recombinant protein antigen vaccines and DNA vaccines are shown in TABLE 2.
(88) It is understood that the foregoing detailed description is given merely by way of illustration and that modifications and variations may be made therein without departing from the spirit and scope of the invention.
(89) TABLE-US-00001 TABLE1 PrimersUsedforAquaporinandTC5777GutMembraneProteinProcedures DESCRIPTION SEQIDNO: Aquaporin KB-1265 GAGCGGGCACAT Reverseusedfor5 RACE 17 GCAGTTGTAGGC3 KB-1445 ACTCAGCTGCAG Forwardusedforinsertioninto 18 AAGATGGAGATCGAGAACCT3 pcDNA4/myc-HisvectorsAwithPstIsite KB-1455 TCACTGCTCGAG Reverseusedforinsertioninto 19 GCACATGCAGTTGTAGGC3 pcDNA4/myc-HisvectorsAwithXhoIsite KB-1565 ACTCAGGAATTC ForwardusedforDNAinsertioninto 20 ATGAAGATCGAGAACCT3 pPICZAwithEcoRIsite KB-1575 TCACTGGCGGCCGC ReverseusedforDNAinsertioninto 21 CGGGCACATGCAGTTGTAGGC3 pPICZAwithNotIsite TC-5777GutMembraneProtein KB-1275 CTTCGGGCATGC Forwardusedfor3 RACE 22 TGTACGGCCTG3 KB-1285 CTGCTACGTGTC Forwardusedfor3 RACE 23 CCTCGACTCGCTG3 KB-1305 CGACTGCCTGAC Reverseusedfor5 RACE 24 GGCCTTGAGGAAC3 KB-1465 ACTCAGCTGCAG Forwardusedforinsertioninto 25 AAAATGGCCATCACTTCTGTAA3 pcDNA4/myc-HisvectorsCwithPstIsite KB-1475 TCACTGCTCGAGG Reverseusedforinsertioninto 26 ACTGGGCAGTOGCAC3' pcDNA4/myc-HisvectorsCwithXhoIsite KB-1525 ACTCAGGAATTC ForwardusedforDNAinsertioninto 27 AAAATGGCCATCACTTCTGTAA3 pPICZCwithEcoRIsite KB-1535 TCACTGGCGGCCG ReverseusedforDNAinsertioninto 28 CGGACTGGGCAGTGGCAC3 pPICZCwithNotIsite
(90) TABLE-US-00002 TABLE 2 Data from Cattle Stall Trials Evaluating Aquaporin and TC5777 gut membrane protein for efficacy as vaccine antigens in cattle. Antigen Tested NET.sup.a EW.sup.b EF.sup.c EC.sup.d Eff.sup.e DNA Vaccine Trial 1 Aquaporin.sup.f + TC5777.sup.f 0.4568 1.0502 1.0518 0.9201 54% Recombinant Protein Trial 1 Aquaporin.sup.g 0.2511 0.9416 0.9556 1.0762 76% Recombinant Protein Trial 2 Aquaporin.sup.g 0.3668 0.9105 0.9961 0.8211 73% TC5777.sup.g 0.4313 0.9342 1.0341 0.8797 63% Aquaporin.sup.h + TC5777.sup.h 0.4167 0.8902 1.0067 0.7887 71% .sup.aNET = Reduction in tick numbers = Total number of ticks from the immunized group/Total number of ticks from the control group .sup.bEW = Reduction in eggs per female = (Total weight of eggs from the immunized group/Total number of ticks from immunized group)/(Total weight of eggs from the control group/Total number of ticks from control group) .sup.cEF = Reduction in eggs per weight of females = (Total weight of eggs from the immunized group/Total weight of ticks from immunized group)/(Total weight of eggs from the control group/Total weight of ticks from control group) .sup.dEC = Reduction in hatchability = % hatch from immunized group/% hatch from control group .sup.eEff = % Overall efficacy compared to controls = 100 [1 (NET EW EF EC)] .sup.f500 micrograms of expression plasmid DNA per dose .sup.g100 micrograms of recombinant protein per dose .sup.h50 micrograms of recombinant protein per dose