METHODS AND COMPOSITIONS FOR THE PRODUCTION OF GUIDE RNA
20170022499 ยท 2017-01-26
Assignee
Inventors
- Timothy Kuan-Ta Lu (Cambridge, MA)
- Lior Nissim (Cambridge, MA, US)
- Samuel David Perli (Cambridge, MA, US)
Cpc classification
C12N2310/20
CHEMISTRY; METALLURGY
C12N9/22
CHEMISTRY; METALLURGY
C12N2310/51
CHEMISTRY; METALLURGY
C12N15/113
CHEMISTRY; METALLURGY
C12N15/63
CHEMISTRY; METALLURGY
C12N2830/42
CHEMISTRY; METALLURGY
C12N15/111
CHEMISTRY; METALLURGY
International classification
C12N15/113
CHEMISTRY; METALLURGY
C12N9/22
CHEMISTRY; METALLURGY
Abstract
Various aspects and embodiments of the present disclosure relate to methods and compositions that combine multiple mammalian RNA regulatory strategies, including RNA triple helix structures, introns, microRNAs, and ribozymes with Cas-based CRISPR transcription factors and ribonuclease-based RNA processing in human cells. The methods and compositions of the present disclosure, in some embodiments, enable multiplexed production of proteins and multiple guide RNAs from a single compact RNA-polymerase-II-expressed transcript for efficient modulation of synthetic constructs and endogenous human promoters.
Claims
1. An engineered construct comprising a promoter operably linked to a nucleic acid that comprises: (a) a nucleotide sequence encoding at least one guide RNA (gRNA); and (b) one or more nucleotide sequences selected from (i) a nucleotide sequence encoding a protein of interest and (ii) a nucleotide sequence encoding an RNA interference molecule.
2. The engineered construct of claim 1, wherein the promoter is a RNA-polymerase-II-dependent (RNA pol II) promoter.
3. The engineered construct of claim 1 or 2, wherein the at least one gRNA is flanked by nucleotide sequences encoding ribonuclease recognition sites.
4. The engineered construct of claim 3, wherein the ribonuclease recognition sites are Csy4 ribonuclease recognition sites.
5. The engineered construct of claim 1 or 2, wherein the at least one gRNA is flanked by nucleotide sequences encoding ribozymes.
6. The engineered construct of claim 5, wherein the ribozymes are selected from a hammerhead ribozyme and a Hepatitis delta virus ribozyme.
7. The engineered construct of any one of claims 1-6, wherein the nucleotide sequence of (a) is flanked by cognate intronic splice sites.
8. An engineered construct comprising a promoter operably linked to a nucleic acid that comprises a first nucleotide sequence encoding at least one guide RNA (gRNA) flanked by ribonuclease recognition sites.
9. The engineered construct of claim 8, wherein the first nucleotide sequence is flanked by cognate intronic splice sites.
10. The engineered construct of claim 8 or 9, wherein the nucleic acid further comprises a second nucleotide sequence encoding a protein of interest, wherein the first nucleotide sequence is within the second nucleotide sequence.
11. The engineered construct of any one of claims 8-10, wherein the nucleic acid further comprise a second nucleotide sequence encoding a protein of interest, wherein the second nucleotide sequence is upstream of the first nucleotide sequence.
12. The engineered construct of any one of claims 8-11, wherein the engineered construct further comprises a nucleotide sequence encoding at least one microRNA.
13. The engineered construct of claim 12, wherein the at least one microRNA is encoded within the protein of interest.
14. The engineered construct of any one of claims 10-13, wherein the nucleic acid further comprises a third nucleotide sequence encoding a triple helix structure, wherein the third nucleotide sequence is between the second nucleotide sequence and the first nucleotide sequence.
15. The engineered construct of any one of claims 8-14, wherein the promoter is a RNA-polymerase-II-dependent (RNA pol II) promoter.
16. The engineered construct of claim 15, wherein the RNA pol II promoter is a human cytomegalovirus promoter, a human ubiquitin promoter, a human histone H2A1 promoter, or a human inflammatory chemokine CXCL1 promoter.
17. The engineered construct of any one of claims 8-16, wherein the first nucleotide sequence encodes at least two gRNAs, each gRNA flanked by ribonuclease recognition sites.
18. The engineered construct of claim 17, wherein the first nucleotide sequence encodes at least three gRNAs, each gRNA flanked by ribonuclease recognition sites.
19. The engineered construct of claim 18, wherein the first nucleotide sequence encodes at least four gRNAs, each gRNA flanked by ribonuclease recognition sites.
20. The engineered construct of claim 19, wherein the first nucleotide sequence encodes at least five gRNAs, each gRNA flanked by ribonuclease recognition sites.
21. The engineered construct of any one of claims 8-20, wherein the first nucleotide sequence encodes at least two gRNAs flanked by ribonuclease recognition sites, and wherein the gRNAs are different from each other.
22. The engineered construct of any one of claims 8-21, wherein the ribonuclease recognition sites are Csy4 ribonuclease recognition sites.
23. The engineered construct of claim 22, wherein each of the Csy4 ribonuclease recognition sites has a length of 28 nucleotides.
24. The engineered construct of claim 22 or 23, wherein the Csy4 ribonuclease recognition sites are from Pseudomonas aeruginosa.
25. The engineered construct of any one of claims 14-24, wherein the triple helix structure is encoded by a nucleotide sequence from the 3 end of the MALAT1 locus or the 3 end of the MEN locus.
26. An engineered construct comprising a promoter operably linked to a nucleic acid that comprises: a first nucleotide sequence encoding a protein of interest; and a second nucleotide sequence encoding at least one guide RNA (gRNA) flanked by ribonuclease recognition sites, wherein the second nucleotide sequence is flanked by nucleotide sequences encoding cognate intronic splice sites and is within the first nucleotide sequence.
27. The engineered construct of claim 26, wherein the engineered construct further comprises a nucleotide sequence encoding at least one microRNA.
28. The engineered construct of claim 27, wherein the at least one microRNA is encoded within the protein of interest.
29. The engineered construct of any one of claims 26-28, wherein the nucleic acid further comprises: a third nucleotide sequence encoding a triple helix structure; and a fourth nucleotide sequence encoding at least one gRNA flanked by ribonuclease recognition sites, wherein the third nucleotide sequence is downstream of the first nucleotide sequence and is upstream of the fourth nucleotide sequence.
30. The engineered construct of any one of claims 26-29, wherein the promoter is a RNA-polymerase-II-dependent (RNA pol II) promoter.
31. The engineered construct of claim 30, wherein the RNA pol II promoter is a human cytomegalovirus promoter, a human ubiquitin promoter, a human histone H2A1 promoter, or a human inflammatory chemokine CXCL1 promoter.
32. The engineered construct of any one of claims 26-31, wherein the second nucleotide sequence encodes at least two gRNAs, each gRNA flanked by ribonuclease recognition sites.
33. The engineered construct of claim 32, wherein the second nucleotide sequence encodes at least three gRNAs, each gRNA flanked by ribonuclease recognition sites.
34. The engineered construct of claim 33, wherein the second nucleotide sequence encodes at least four gRNAs, each gRNA flanked by ribonuclease recognition sites.
35. The engineered construct of claim 34, wherein the second nucleotide sequence encodes at least five gRNAs, each gRNA flanked by ribonuclease recognition sites.
36. The engineered construct of any one of claims 26-35, wherein the second nucleotide sequence encodes at least two gRNAs flanked by ribonuclease recognition sites, and wherein the gRNAs are different from each other.
37. The engineered construct of any one of claims 26-36, wherein the ribonuclease recognition sites are Csy4 ribonuclease recognition sites.
38. The engineered construct of claim 37, wherein each of the Csy4 ribonuclease recognition sites has a length of 28 nucleotides.
39. The engineered construct of claim 37 or 38, wherein the Csy4 ribonuclease recognition sites are from Pseudomonas aeruginosa.
40. The engineered construct of any one of claims 26-39, wherein the cognate intronic splice sites are from a consensus intron.
41. The engineered construct of any one of claims 26-39, wherein the cognate intronic splice sites are from a HSV1 latency-associated intron.
42. The engineered nucleic acid of any one of claims 26-39, wherein the cognate intronic splice sites are from a sno-IncRNA2 intron.
43. The engineered nucleic acid of any one of claims 29-42, wherein the triple helix structure is encoded by a nucleotide sequence from the 3 end of the MALAT1 locus or the 3 end of the MEN locus.
44. The engineered construct of any one of claims 29-43, wherein the fourth nucleotide sequence encodes at least two gRNAs, each gRNA flanked by ribonuclease recognition sites.
45. The engineered construct of claim 44, wherein the fourth nucleotide sequence encodes at least three gRNAs, each gRNA flanked by ribonuclease recognition sites.
46. The engineered construct of claim 45, wherein the fourth nucleotide sequence encodes at least four gRNAs, each gRNA flanked by ribonuclease recognition sites.
47. The engineered construct of claim 46, wherein the fourth nucleotide sequence encodes at least five gRNAs, each gRNA flanked by ribonuclease recognition sites.
48. The engineered construct of any one of claims 29-47, wherein the fourth nucleotide sequence encodes at least two gRNAs flanked by ribonuclease recognition sites, and wherein the gRNAs are different from each other.
49. An engineered construct comprising a promoter operably linked to a nucleic acid that comprises a first nucleotide sequence encoding at least one guide RNA (gRNA) flanked by ribozymes.
50. The engineered construct of claim 49, wherein the nucleic acid further comprise a second nucleotide sequence encoding a protein of interest, wherein the second nucleotide sequence is upstream of the first nucleotide sequence.
51. The engineered construct of claim 49 or 50, wherein the engineered construct further comprises a nucleotide sequence encoding at least one microRNA.
52. The engineered construct of claim 51, wherein the at least one microRNA is encoded within the protein of interest.
53. The engineered construct of any one of claims 50-52, wherein the nucleic acid further comprises a third nucleotide sequence encoding a triple helix structure, wherein the third nucleotide sequence is between the second nucleotide sequence and the first nucleotide sequence.
54. The engineered construct of any one of claims 49-53, wherein the promoter is a RNA-polymerase-II-dependent (RNA pol II) promoter.
55. The engineered construct of claim 54, wherein the RNA pol II promoter is a human cytomegalovirus promoter, a human ubiquitin promoter, a human histone H2A1 promoter, or a human inflammatory chemokine CXCL1 promoter.
56. The engineered construct of any one of claims 49-55, wherein the first nucleotide sequence encodes at least two gRNAs, each gRNA flanked by ribozymes.
57. The engineered construct of claim 56, wherein the first nucleotide sequence encodes at least three gRNAs, each gRNA flanked by ribozymes.
58. The engineered construct of claim 57, wherein the first nucleotide sequence encodes at least four gRNAs, each gRNA flanked by ribozymes.
59. The engineered construct of claim 58, wherein the first nucleotide sequence encodes at least five gRNAs, each gRNA flanked by ribozymes.
60. The engineered construct of any one of claims 49-59, wherein the first nucleotide sequence encodes at least two gRNAs flanked by ribozymes, and wherein the gRNAs are different from each other.
61. The engineered construct of any one of claims 49-60, wherein the ribozymes are cis-acting ribozymes.
62. The engineered construct of claim 61, wherein at least one of the cis-acting ribozymes is a hammerhead ribozyme.
63. The engineered construct of claim 62, wherein the hammerhead ribozyme is at the 5 end of the at least one gRNA.
64. The engineered construct of claim 61, wherein at least one of the cis-acting ribozymes is a Hepatitis delta virus ribozyme.
65. The engineered construct of claim 64, wherein the Hepatitis delta virus ribozyme is at the 3 end of the at least one gRNA.
66. The engineered construct of any one of claims 53-65, wherein the triple helix structure is encoded by a nucleotide sequence from the 3 end of the MALAT1 locus or the 3 end of the MEN locus.
67. An engineered construct comprising a promoter operably linked to a nucleic acid that comprises: a first nucleotide sequence encoding at least one RNA interference molecule within a protein of interest; a second nucleotide sequence encoding at least one guide RNA flanked by ribonuclease recognition sites; and a third nucleotide sequence encoding a triple helix structure, wherein the third nucleotide sequence is between the first and second nucleotide sequences.
68. An engineered construct comprising a promoter operably linked to a nucleic acid that comprises: a first nucleotide sequence encoding at least one RNA interference molecule within a protein of interest; a second nucleotide sequence encoding at least one guide RNA flanked by ribozymes; and a third nucleotide sequence encoding a triple helix structure, wherein the third nucleotide sequence is between the first and second nucleotide sequences.
69. The engineered construct of claim 67 or 68, wherein the at least one RNA interference molecule is selected from a microRNA (miRNA) and a small-interfering RNA (siRNA).
70. The engineered construct of claim 69, wherein the at least one RNA interference molecule comprises at least one miRNA.
71. A vector comprising the engineered construct of any one of claims 1-70.
72. A cell comprising the engineered construct of any one of claims 1-70 or the vector of claim 71.
73. A cell comprising at least two of the engineered constructs of any one of claims 1-70 or at least two of the vectors of claim 71.
74. The cell of claim 72 or 73, wherein the cell is modified to stably express a ribonuclease.
75. The cell of claim 74, wherein the ribonuclease is a Csy4 ribonuclease.
76. The cell of any one of claims 72-75, wherein the cell is modified to stably express a Cas protein.
77. The cell of claim 76, wherein the Cas protein is a Cas nuclease.
78. The cell of claim 76, wherein the Cas nuclease is a Cas9 nuclease.
79. The cell of claim 76, wherein the Cas protein is a transcriptionally active Cas protein.
80. The cell of claim 79, wherein the transcriptionally active Cas protein is a transcriptionally active Cas9 protein.
81. The cell of any one of claims 72-80, wherein the cell further comprises an engineered nucleic acid comprising a promoter operably linked to a nucleotide sequence encoding a ribonuclease.
82. The cell of claim 81, wherein the ribonuclease is a Csy4 ribonuclease.
83. The cell of any one of claims 72-82, wherein the cell further comprises an engineered nucleic acid comprising a promoter operably linked to a nucleotide sequence encoding a Cas protein.
84. The cell of claim 83, wherein the Cas protein is a Cas nuclease.
85. The cell of claim 84, wherein the Cas nuclease is a Cas9 nuclease.
86. The cell of claim 83, wherein the Cas protein is a transcriptionally active Cas protein.
87. The cell of claim 86, wherein the transcriptionally active Cas protein is a transcriptionally active Cas9 protein.
88. The cell of any one of claims 72-87, wherein the cell further comprises at least one additional engineered nucleic acid comprising a promoter operably linked to a nucleotide sequence encoding a protein of interest.
89. The cell of claim 88, wherein the protein of interest of the at least one additional engineered nucleic acid is different from any other protein of interest of the cell.
90. The cell of any one of claims 72-89, wherein the cell is a bacterial cell.
91. The cell of any one of claims 72-89, wherein the cell is a human cell.
92. A method comprising culturing the cell of any one of claims 72-91.
93. The method of claim 92 comprising culturing the cell under conditions that permit nucleic acid expression.
94. A method of producing, modifying or rewiring a cellular genetic circuit comprising: expressing in a cell a first engineered construct selected from the engineered construct of any one of claims 1-70; and expressing in the cell a second engineered construct selected from the engineered construct of any one of claims 1-70, wherein at least one gRNA of the first engineered construct is complementary to and binds to a region of the promoter of the second engineered construct or to a region of an endogenous promoter.
95. The method of claim 94 further comprising expressing a third engineered construct selected from the engineered construct of any one of claims 1-70, wherein at least one gRNA of the second engineered construct is complementary to and binds to a region of the promoter of the third engineered construct or to a region of an endogenous promoter.
96. The method of claim 95 further comprising expressing at least one additional engineered nucleic acid selected from the engineered nucleic acid of any one of claims 1-70, wherein at least one gRNA of the at least one additional engineered nucleic acid is complementary to and binds to a region of the promoter of any one of the engineered nucleic acids of the cell or to a region of at least one endogenous promoter.
97. The method of any one of claims 94-96, wherein the cell is modified to stably express a Cas protein.
98. The method of claim 97, wherein the Cas protein is a Cas nuclease.
99. The method of claim 98, wherein the Cas nuclease is a Cas9 nuclease.
100. The method of claim 97, wherein the Cas protein is a transcriptionally active Cas protein.
101. The method of claim 100, wherein the transcriptionally active Cas protein is a transcriptionally active Cas9 protein.
102. The method of any one of claims 94-101, wherein the cell further comprises an engineered nucleic acid comprising a promoter operably linked to a nucleotide sequence encoding a ribonuclease.
103. The method of claim 102, wherein the ribonuclease is a Csy4 ribonuclease.
104. The method of any one of claims 94-103, wherein the cell further comprises an engineered nucleic acid comprising a promoter operably linked to a nucleotide sequence encoding a Cas protein.
105. The method of claim 104, wherein the Cas protein is a Cas nuclease.
106. The method of claim 105, wherein the Cas nuclease is a Cas9 nuclease.
107. The method of claim 104, wherein the Cas protein is a transcriptionally active Cas protein.
108. The method of claim 107, wherein the transcriptionally active Cas protein is a transcriptionally active Cas9 protein.
109. The method of any one of claims 94-108 further comprising culturing the cell.
110. A method of multiplexed cellular expression of guide ribonucleic acids (gRNAs) comprising expressing in a cell an engineered construct comprising a promoter operably linked to a nucleic acid that comprises a first nucleotide sequence encoding at least two gRNAs, each gRNA flanked by ribonuclease recognition sites.
111. The method of claim 110, wherein the nucleic acid further comprises a second nucleotide sequence encoding a protein of interest, wherein the second nucleotide sequence is upstream of the first nucleotide sequence.
112. The method of claim 111, wherein the engineered construct further comprises a nucleotide sequence encoding at least one microRNA.
113. The engineered construct of claim 112, wherein the at least one microRNA is encoded within the protein of interest.
114. The method of any one of claims 111-113, wherein the nucleic acid further comprises a third nucleotide sequence encoding a triple helix structure, wherein the third nucleotide sequence is between the second nucleotide sequence and the first nucleotide sequence.
115. The method of any one of claims 110-114, wherein the cell is modified to stably express a Cas protein.
116. The method of claim 115, wherein the Cas protein is a Cas nuclease.
117. The method of claim 116, wherein the Cas nuclease is a Cas9 nuclease.
118. The method of claim 115, wherein the Cas protein is a transcriptionally active Cas protein.
119. The method of claim 118, wherein the transcriptionally active Cas protein is a transcriptionally active Cas9 protein.
120. The method of any one of claims 110-119, wherein the cell further comprises an engineered nucleic acid comprising a promoter operably linked to a nucleotide sequence encoding a ribonuclease.
121. The method of claim 120, wherein the ribonuclease is a Csy4 ribonuclease.
122. The method of any one of claims 110-121, wherein the cell further comprises an engineered nucleic acid comprising a promoter operably linked to a nucleotide sequence encoding a Cas protein.
123. The method of claim 122, wherein the Cas protein is a Cas nuclease.
124. The method of claim 123, wherein the Cas nuclease is a Cas9 nuclease.
125. The method of claim 122, wherein the Cas protein is a transcriptionally active Cas protein.
126. The method of claim 125, wherein the transcriptionally active Cas protein is a transcriptionally active Cas9 protein.
127. The method of any one of claims 110-126 further comprising culturing the cell.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0067]
[0068]
[0069]
[0070]
[0071]
[0072]
[0073]
[0074]
[0075]
[0076]
[0077]
[0078]
[0079]
[0080]
[0081]
[0082]
[0083]
[0084]
[0085]
[0086]
[0087]
[0088]
[0089]
[0090]
[0091]
[0092]
[0093]
[0094]
[0095]
[0096]
[0097]
[0098]
[0099]
[0100]
[0101]
[0102]
[0103]
[0104]
[0105]
DETAILED DESCRIPTION OF INVENTION
[0106] The ability to build complex, robust and scalable synthetic gene networks that operate with defined interconnections between artificial parts and native cellular processes is central to engineering biological systems. This capability can enable new strategies, for example, for rewiring, perturbing and probing natural biological networks. A large set of tunable, orthogonal, compact and multiplexable gene regulatory mechanisms is of fundamental importance to implement these applications. Despite much progress in the fields of transcriptional regulation and synthetic biology, the tools that were available prior to the present disclosure fail to meet one or more of the criteria described above. Transcriptional regulation utilizes transcription factors that bind predetermined DNA sequences of interest. Type II CRISPR/Cas systems (e.g., with DNA-targeting Cas proteins) have been adapted to achieve programmable DNA binding without requiring complex protein engineering (Sander and Joung, 2014). In these systems, the sequence specificity of the Cas9 DNA-binding protein is determined by guide RNAs (gRNAs), which have base-pairing complementarity to target DNA sites. This enables simple and highly flexible programming of Cas9 binding.
[0107] Prior to the present disclosure, gRNAs for gene regulation in human cells were expressed only from RNA polymerase III (RNAP III) promoters. This is a limitation in terms of integrating CRISPR/Cas regulation with endogenous gene networks because RNAP III promoters comprise only a small portion of cellular promoters and are mostly constitutively active, thus preventing the linkage of most cellular promoters and signals into CRISPR-TF-based networks. Further, multiple gRNAs are typically needed to efficiently activate endogenous promoters, but strategies for multiplexed gRNA production from single transcripts for transcriptional regulation were not available prior to the present disclosure. As a result, multiple gRNA expression constructs were needed to perturb natural transcriptional networks, thus limiting scalability.
[0108] In addition to transcriptional regulation, natural circuits leverage RNA-based translational and post-translational regulation to achieve complex behavior. Synthetic gene regulatory strategies that combine RNA and transcriptional engineering, as provided herein, are useful in modeling natural systems or implementing artificial behaviors. Thus provided herein, in various aspects, are methods and compositions that integrate mammalian and bacterial RNA-based regulatory mechanisms to, for example, create complex synthetic circuit topologies and to regulate endogenous promoters. Multiple mammalian RNA processing strategies can be used, including 3 RNA triple helixes (referred to as triplexes), introns and ribozymes, together with mammalian miRNA regulation, bacteria-derived CRISPR-TFs and the Csy4 RNA-modifying protein from P. aeruginosa. These constructs can be used, for example, to generate functional gRNAs from RNAP-II-regulated mRNAs in human cells while rendering the concomitant translation of the mRNAs tunable.
[0109] As shown herein, functional gRNAs were used to target both synthetic and endogenous promoters for activation via CRISPR-TFs. Additionally, strategies for multiplexed gRNA production were developed, thus enabling compact encoding of proteins and multiple gRNAs in single transcripts. To demonstrate the utility of these regulatory parts, multi-stage transcriptional cascades that can be used for the construction of complex synthetic gene circuits were implemented. Also combined herein are mammalian miRNA-based regulation with CRISPR-TFs to create multicomponent genetic circuits with feedback loops, interconnections, and behaviors that can be rewired, in some embodiments, by Csy4-based RNA processing. Thus, the platform of the present disclosure can be used, for example, to construct, synchronize and switch complex regulatory networks, both artificial and endogenous, using synthetic transcriptional and RNA-dependent mechanisms. The integration of CRISPR-TF-based gene regulation systems with mammalian RNA regulatory configurations, in some embodiments, enables scalable gene regulatory systems for synthetic biology as well as basic biology applications.
[0110] Aspects of the present disclosure relate to engineered constructs and engineered nucleic acids. Engineered construct is a term used to describe an engineered nucleic acid having multiple genetic elements, including, for example, a promoter and various nucleotide sequences (e.g., nucleotide sequences encoding a protein and/or an RNA interference molecule, as provided herein). A nucleic acid is at least two nucleotides covalently linked together, and in some instances, may contain phosphodiester bonds (e.g., a phosphodiester backbone). An engineered nucleic acid is a nucleic acid that does not occur in nature. It should be understood, however, that while an engineered nucleic acid as a whole is not naturally-occurring, it may include nucleotide sequences that occur in nature. In some embodiments, an engineered nucleic acid comprises nucleotide sequences from different organisms (e.g., from different species). For example, in some embodiments, an engineered nucleic acid includes a murine nucleotide sequence, a bacterial nucleotide sequence, a human nucleotide sequence, and/or a viral nucleotide sequence. Engineered nucleic acids include recombinant nucleic acids and synthetic nucleic acids. A recombinant nucleic acid is a molecule that is constructed by joining nucleic acids (e.g., isolated nucleic acids, synthetic nucleic acids or a combination thereof) and, in some embodiments, can replicate in a living cell. A synthetic nucleic acid is a molecule that is amplified or chemically, or by other means, synthesized. A synthetic nucleic acid includes those that are chemically modified, or otherwise modified, but can base pair with naturally-occurring nucleic acid molecules. Recombinant and synthetic nucleic acids also include those molecules that result from the replication of either of the foregoing.
[0111] In some embodiments, a nucleic acid of the present disclosure is considered to be a nucleic acid analog, which may contain, at least in part, other backbones comprising, for example, phosphoramide, phosphorothioate, phosphorodithioate, O-methylphophoroamidite linkages and/or peptide nucleic acids. A nucleic acid may be single-stranded (ss) or double-stranded (ds), as specified, or may contain portions of both single-stranded and double-stranded sequence. In some embodiments, a nucleic acid may contain portions of triple-stranded sequence. A nucleic acid may be DNA, both genomic and/or cDNA, RNA or a hybrid, where the nucleic acid contains any combination of deoxyribonucleotides and ribonucleotides (e.g., artificial or natural), and any combination of bases, including uracil, adenine, thymine, cytosine, guanine, inosine, xanthine, hypoxanthine, isocytosine and isoguanine.
[0112] Engineered constructs (including engineered nucleic acids) of the present disclosure include one or more genetic elements. A genetic element refers to a particular nucleotide sequence that has a role in nucleic acid expression (e.g., promoter, enhancer, terminator) or encodes a discrete product of an engineered nucleic acid (e.g., a nucleotide sequence encoding a guide RNA, a protein and/or an RNA interference molecule). Examples of genetic elements of the present disclosure include, without limitation, promoters and nucleotide sequences that encode proteins, guide RNAs, Csy4 binding sites, triple helix structures, introns and intronic sequences (e.g., donor site, acceptor site and/or branch site), exons and ribozymes.
[0113] The position of a genetic element of an engineered nucleic acid of the present disclosure may be defined relative to other genetic elements along a 5 to 3 oriented coding (sense) strand. For example,
[0114] Some aspects of the present disclosure relate to engineered nucleic acids that include a (e.g., one or more, at least one) nucleotide sequence encoding a (e.g., at least one, including at least 2, at least 3, at least 4, at least 5, at least 6, or more) guide RNA (gRNA). A gRNA is a component of the CRISPR/Cas system. CRISPR/Cas systems are used by various bacteria and archaea to mediate defense against viruses and other foreign nucleic acid. Components of the CRISPR/Cas system coordinate to selectively cleave nucleic acid. Type II CRISPR/Cas systems include Cas proteins that are targeted to DNA, while type III CRISPR/Cas systems include Cas proteins that are targeted to RNA. The sequence specificity of a Cas DNA-binding protein is determined by gRNAs, which have base-pairing complementarity to target DNA sites. Thus, Cas proteins are guided by gRNAs to target DNA sites. The base-pairing complementarity of gRNAs enables, in some embodiments, simple and flexible programming of Cas binding. Base-pair complementarity refers to distinct interactions between adenine and thymine (DNA) or uracil (RNA), and between guanine and cytosine.
[0115] Guide RNAs of the present disclosure, in some embodiments, have a length of 10 to 500 nucleotides. In some embodiments, a gRNA has a length of 10 to 20 nucleotides, 10 to 30 nucleotides, 10 to 40 nucleotides, 10 to 50 nucleotides, 10 to 60 nucleotides, 10 to 70 nucleotides, 10 to 80 nucleotides, 10 to 90 nucleotides, 10 to 100 nucleotides, 20 to 30 nucleotides, 20 to 40 nucleotides, 20 to 50 nucleotides, 20 to 60 nucleotides, 20 to 70 nucleotides, 20 to 80 nucleotides, 20 to 90 nucleotides, 20 to 100 nucleotides, 30 to 40 nucleotides, 30 to 50 nucleotides, 30 to 60 nucleotides, 30 to 70 nucleotides, 30 to 80 nucleotides, 30 to 90 nucleotides, 30 to 100 nucleotides, 40 to 50 nucleotides, 40 to 60 nucleotides, 40 to 70 nucleotides, 40 to 80 nucleotides, 40 to 90 nucleotides, 40 to 100 nucleotides, 50 to 60 nucleotides, 50 to 70 nucleotides, 50 to 80 nucleotides, 50 to 90 nucleotides or 50 to 100 nucleotides. In some embodiments, a gRNA has a length of 10 to 200 nucleotides, 10 to 250 nucleotides, 10 to 300 nucleotides, 10 to 350 nucleotides, 10 to 400 nucleotides or 10 to 450 nucleotides. In some embodiments, a gRNA has a length of more than 500 nucleotides. In some embodiments, a gRNA has a length of 10, 15, 20, 15, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 500 or more nucleotides.
[0116] The methods and compositions of the present disclosure, surprisingly, permit production of multiple guide RNAs (gRNAs), in some embodiments, from a single transcript. It should be understood, however, that multiple gRNAs may produced from multiple transcripts in a single cell. gRNAs produced as provided herein may have the same nucleotide sequence or may have different nucleotide sequences. Thus, gRNAs may target and bind to the same target site or different target site (e.g., a region within a particular promoter). For example, some engineered nucleic acids comprise a nucleotide sequence encoding a first gRNA and a nucleotide sequence encoding a second gRNA (or a nucleotide sequence encoding at least two gRNAs). The first gRNA may have the same RNA sequence as the second gRNA, and, thus the two gRNAs may target the same site. Alternatively, the first gRNA may have a RNA sequence that is different from the second gRNA, and, thus, the two gRNAs may target the different sites (e.g., within the same promoter of within different promoters). As exemplified in
[0117] A first nucleotide sequence is considered to be within a second nucleotide sequence if the first nucleotide sequence is inserted between two nucleotides of the second nucleotide sequence, or if the nucleotide sequence replaces a stretch of contiguous nucleotides of the second nucleotide sequence. In some embodiments, a nucleotide sequence encodes a gRNA or an RNA interference molecule within a protein of interest. In this configuration, a nucleotide sequence encoding a gRNA, for example, is positioned between two adjacent exons of the protein of interest such that when the encoded gRNA is removed (e.g., by RNA splicing if the gRNA is flanked by cognate intronic splice sites) the protein is translated. Guide RNAs, as discussed above, guide Cas proteins to a nucleic acid, in some embodiments.
[0118] Cas proteins are nucleases that cleave nucleic acid. The nuclease activity of Cas proteins (e.g., Cas9 proteins), in some embodiments, can be utilized for precise and efficient genome editing in prokaryotic and eukaryotic cells. Mutant Cas proteins are also contemplated herein. In some embodiments, a mutant Cas protein lacks nuclease activity (e.g., dCas9). In some embodiments, a mutant Cas protein lacking nuclease activity is modified to enable programmable transcriptional regulation of both ectopic and native promoters to create CRISPR-based transcription factors (CRISPR-TFs) in mammalian cells (Cheng et al., 2013; Farzadfard et al., 2013; Gilbert et al., 2013; Maeder et al., 2013a; Mali et al., 2013a; Perez-Pinera et al., 2013a). For example, fusing an activation domain (e.g., VP16, VP64 or p65) to a Cas protein renders the Cas transcriptionally active (also referred to as a taCas protein). Transcriptional activator proteins recruit the RNA polymerase II machinery and chromatin-modifying activities to promoters. Thus, in some embodiments, transcriptionally active Cas (taCas) proteins, which lack nuclease activity, are used in accordance with the present disclosure. In some embodiments, a transcriptionally active Cas protein is a transcriptionally active Cas9 (taCas9) protein. Other transcriptionally active Cas proteins are contemplated herein.
[0119] In some embodiments, a guide RNA of the present disclosure is flanked by ribonuclease recognition sites. A ribonuclease (abbreviated as RNase) is a nuclease that catalyzes the hydrolysis of RNA. A ribonuclease may be an endoribonuclease or an exoribonuclease. An endoribonuclease cleaves either single-stranded or double-stranded RNA. An exoribonuclease degrades RNA by removing terminal nucleotides from either the 5 end or the 3 end of the RNA. In some embodiments, a guide RNA of the present disclosure is flanked by Csy ribonuclease recognition sites (e.g., Csy4 ribonuclease recognition sites). Csy4 is an endoribonuclease that recognizes a particular RNA sequence, cleaves the RNA, and remains bound to the upstream fragment. In some embodiments, a Csy ribonuclease (e.g., Csy4 ribonuclease) is used to release a guide RNA from an engineered nucleic acid transcript. Thus, in some embodiments, cells are co-transfected with an engineered construct that comprises a nucleotide sequence encoding a guide RNA flanked by Csy4 or other Cas6 ribonuclease recognition sites and an engineered nucleic acid encoding a Csy4 or other Cas6 ribonuclease. Alternatively, or in addition, the cell may stably express, or be modified to stably express, a Csy4 or other Cas6 ribonuclease. In some embodiments, a Csy ribonuclease (e.g., Csy4 ribonuclease) is from Pseudomonas aeruginosa, Staphylococcus epidermidis, Pyrococcus furiosus or Sulfolobus solfataricus. Other ribonucleases and ribonuclease recognitions sites are contemplated herein (see, e.g., Mojica, F. J. M. et al., CRISPR-Cas Systems, RNA-mediated Adaptive Immunity in Bacteria and Archaea, Barrangou, Rodolphe, van der Oost, John (Eds.), 2013, ISBN 978-3-642-34657-6, of which the subject matter relating to ribonucleases/recognition sites is incorporated by reference herein).
[0120] In some embodiments, a ribonuclease recognition site (e.g., Csy4 ribonuclease recognition site) is 10 to 50 nucleotides in length. For example, a Csy ribonuclease recognition site may be 10 to 40, 10 to 30, 10 to 20, 20 to 50, 20 to 40 or 20 to 30 nucleotides in length. In some embodiments, a Csy ribonuclease recognition site is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides in length. In some embodiments, a Csy ribonuclease recognition site (e.g., Csy4 ribonuclease recognition site) is 28 nucleotides in length. In some embodiments, the nucleotide sequence encoding a ribonuclease recognition site comprises SEQ ID NO: 26. Csy homologs are also contemplated herein (see, e.g., Mojica, F. J. M. et al., CRISPR-Cas Systems, RNA-mediated Adaptive Immunity in Bacteria and Archaea, Barrangou, Rodolphe, van der Oost, John (Eds.), 2013, ISBN 978-3-642-34657-6, of which the subject matter relating to ribonucleases/recognition sites is incorporated by reference herein).
[0121] A first genetic element is said to be flanked by other genetic elements when the first genetic element is located between and immediately adjacent to the other genetic elements.
[0122] Some aspects of the present disclosure relate to engineered constructs that include a 3 RNA stabilizing sequence such as, for example, an RNA sequence that forms a triple helix structure (or triplex). A 3 RNA stabilizing sequence is a nucleotide sequence added to the 3 end of a nucleotide sequence encoding a product to complement for the lack of a poly-(A) tail. Thus, 3 RNA stabilizing sequences, such as those that form triple helix structures, in some embodiments, enable efficient translation of mRNA lacking a poly-(A) tail. A triple helical structure is a secondary or tertiary RNA structure formed, for example, by adenine- and uridine-rich motifs. In some embodiments, a 3 RNA stabilizing sequence is from a 3 untranslated region (UTR) of a nucleic acid.
[0123] A triple helix structure, in some embodiments, promotes RNA stability and/or translation. In some embodiments, a triple helix structure of the present disclosure is encoded by a nucleotide fragment from the 3 end of the MALAT1 (metastasis-associated lung adenocarcinoma transcript 1) locus or the MEN (multiple endocrine neoplasia-) locus. In some embodiments, a triple helix structure is encoded by a nucleotide fragment from the 3 end of the MALAT1 locus or the 3 end of the MEN locus (see, e.g., Wilusz et al., 2012, incorporated by reference herein; see also, Brown J A et al. Proc Natl Acad Sci USA. 2012 Nov. 20; 109(47), incorporated by reference herein). In some embodiments, a triple helix structure is encoded by a 110 nucleotide sequence (e.g., 110 contiguous nucleotide sequences) from the 3 end of the MALAT1 locus. In some embodiments, a triple helix structure is encoded by a nucleic acid comprising or consisting of SEQ ID NO: 1. Other 3 RNA stabilizing sequences, included those that encode triple helix structures, are contemplated herein (see, e.g., Wilusz J. E. et al. RNA 2010. 16: 259-266, incorporated by reference herein).
[0124] Some aspects of the present disclosure relate to engineered constructs that include a nucleotide sequence encoding a gRNA flanked by ribonuclease (e.g., Csy4) recognition sites, wherein the nucleotide sequence is flanked by nucleotide sequences encoding cognate intronic splice sites. In the art, the term intron often refers to both the DNA sequence within a gene and the corresponding sequence in an RNA transcript. For clarity and consistency herein, it should be understood that in the context of an engineered construct, a nucleotide sequence encoding an intron refers to a DNA sequence, while the term intron refers to an RNA sequence. An intron is a non-coding RNA sequence that is removed by RNA splicing. RNA splicing is the process by which pre-messenger RNA is modified to remove introns and bring together exons (e.g., protein-coding region of a nucleic acid) to form a mature messenger RNA (mRNA) molecule. Cognate intronic splice sites include a donor site (e.g., at the 5 end of an intron), a branch site (e.g., near the 3 end of the intron) and an acceptor site (e.g., at the 3 end of the intron) such that during RNA splicing any intervening sequence (e.g., sequence between the 5 splice site and the 3 splice site) is removed. For example, the engineered construct depicted in
[0125] In some embodiments, a 5 splice donor site includes an almost invariant sequence GU within a larger, less highly conserved region. In some embodiments, a 3 splice acceptor site includes an almost invariant AG sequence. In some embodiments, upstream of the AG there is a region high in pyrimidines (e.g., C and U), referred to as a polypyrimidine tract. Upstream of the polypyrimidine tract, in some embodiments, is a branchpoint, which may include, for example, an adenine nucleotide. In some embodiments, the consensus sequence for an intron (in IUPAC nucleic acid notation) is: M-A-G-[cut]-G-U-R-A-G-U (donor site) . . . intron sequence . . . C-U-R-[A]Y (branch sequence, e.g., 20-50 nucleotides upstream of acceptor site) . . . Y-rich-N-C-A-G-[cut]-G (acceptor site).
[0126] Contemplated herein, in some embodiments, are intronic sequences that produce relatively stable (e.g., long-lived) introns. Examples of such sequences include, without limitation, the HSV-1 latency associated intron, which forms a stable circular intron (Block and Hill, 1997), and the sno-IncRNA2 intron (Yin et al., 2012). The sno-IncRNA2 intron (or sno-RNA2 intron) is processed on both ends by the snoRNA machinery, which protects it from degradation and leads to the accumulation of IncRNAs flanked by snoRNA sequences, which lack 5 caps and 3 poly-(A) tails. Other sequences that confer structural stability to an intronic sequence are also contemplated herein.
[0127] Some aspects of the present disclosure relate to engineered constructs that include a nucleotide sequence encoding a gRNA flanked by ribozymes. Ribozymes are RNA molecules that are capable of catalyzing specific biochemical reactions, similar to the action of protein enzymes. Cis-acting ribozymes are typically self-forming and capable of self-cleaving. Cis-acting ribozymes can mediate functional gRNA expression from RNA pol II promoters. Trans-acting ribozymes, by comparison, do not perform self-cleavage. Self-cleavage refers to the process of intramolecular catalysis in which the RNA molecule containing the ribozyme is itself cleaved. Examples of cis-acting ribozymes for use in accordance with the present disclosure include, without limitation, hammerhead (HH) ribozyme (see, e.g., Pley et al., 1994, incorporated by reference herein) and Hepatitis delta virus (HDV) ribozyme (see, e.g., Ferre-D'Amare et al., 1998, incorporated by reference herein). Examples of trans-acting ribozymes for use in accordance with the present disclosure include, without limitation, natural and artificial versions of the hairpin ribozymes found in the satellite RNA of tobacco ringspot virus (sTRSV), chicory yellow mottle virus (sCYMV) and arabis mosaic virus (sARMV).
[0128] Some aspects of the present disclosure relate to nucleic acids encoding proteins of interest. A protein of interest may be any protein. Examples of proteins of interest include, without limitation, those involved in cell signaling (e.g., receptor/ligand binding) and signal transduction. A protein of interest may be, for example, a fibrous protein or a globular protein. Examples of fibrous proteins include, without limitation, cytoskeletal proteins and extracellular matrix proteins. Examples of globular proteins include, without limitation, plasma proteins (e.g., coagulation factors, acute phase proteins), hemoproteins, cell adhesion proteins, transmembrane transport proteins (e.g., ion channel proteins, synport proteins, antiport proteins), hormones and growth factors, receptors (e.g., transmembrane receptors, intracellular receptors), DNA-binding proteins (e.g., transcription factors or other proteins involved in transcriptional regulation), immune system proteins, nutrient storage/transport proteins, chaperone proteins, and enzymes. Other proteins are contemplated and may be used in accordance with the present disclosure.
[0129] Some aspects of the present disclosure contemplate integrating CRISPR-based mechanisms with mammalian RNA interference mechanisms to, for example, implement more sophisticated circuit topologies. As shown in non-limiting Example 8, micro RNA regulation was incorporated with CRISPR-TFs and Csy4 to disrupt miRNA inhibition of target RNAs by removing cognate miRNA binding sites. RNA interference generally refers to a biological process in which RNA molecules inhibit gene expression, typically by causing the destruction of specific mRNA molecules. Examples of such RNA molecules include microRNA (miRNA) and small interfering RNA (siRNA).
[0130] miRNAs are short, non-coding, single-stranded RNA molecules. miRNAs of the present disclosure may be naturally-occurring or synthetic (e.g., artificial). miRNAs usually induce gene silencing by binding to target sites found within the 3 UTR (untranslated region) of a targeted mRNA. This interaction prevents protein production by suppressing protein synthesis and/or by initiating mRNA degradation. Most target sites on the mRNA have only partial base complementarity with their corresponding microRNA, thus, individual microRNAs may target 100 different mRNAs, or more. Further, individual mRNAs may contain multiple binding sites for different miRNAs, resulting in a complex regulatory network. In some embodiments, a miRNA is 10 to 50 nucleotides in length. For example, a miRNA may be 10 to 40, 10 to 30, 10 to 20, 20 to 50, 20 to 40 or 20 to 30 nucleotides in length. In some embodiments, a miRNA is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides in length. In some embodiments, a miRNA is 22 nucleotides in length.
[0131] siRNAs are short, non-coding, single-stranded RNA molecules. siRNAs of the present disclosure may be naturally-occurring or synthetic (e.g., artificial). Binding of a siRNA to a cognate mRNA typically results in degradation of the mRNA. In some embodiments, a siRNA is 10 to 50 nucleotides in length. For example, a siRNA may be 10 to 40, 10 to 30, 10 to 20, 20 to 50, 20 to 40 or 20 to 30 nucleotides in length. In some embodiments, a siRNA is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides in length. In some embodiments, a siRNA is 21 to 25 nucleotides in length. Engineered constructs of the present disclosure comprise, in some embodiments, promoters operably linked to a nucleotide sequence (e.g., encoding a protein of interest). A promoter is a control region of a nucleic acid at which initiation and rate of transcription of the remainder of a nucleic acid are controlled. A promoter may also contain sub-regions at which regulatory proteins and molecules may bind, such as RNA polymerase and other transcription factors. Promoters may be constitutive, inducible, activatable, repressible, tissue-specific or any combination thereof.
[0132] A promoter drives expression or drives transcription of the nucleic acid sequence that it regulates. A promoter is considered to be operably linked when it is in a correct functional location and orientation in relation to the nucleotide sequence it regulates to control (drive) transcriptional initiation and/or expression of that sequence.
[0133] A promoter may be classified as strong or weak according to its affinity for RNA polymerase (and/or sigma factor); this is related to how closely the promoter sequence resembles the ideal consensus sequence for the polymerase. The strength of a promoter may depend on whether initiation of transcription occurs at that promoter with high or low frequency. Different promoters with different strengths may be used to construct nucleic acids with different levels of gene/protein expression (e.g., the level of expression initiated from a weak promoter is lower than the level of expression initiated from a strong promoter).
[0134] A promoter may be one naturally associated with a gene or sequence, as may be obtained by isolating the 5 non-coding sequences located upstream of the coding segment of a given gene or sequence. Such a promoter can be referred to as endogenous. In some embodiments, gRNAs of the present disclosure are designed to target endogenous promoters (e.g., endogenous human promoter).
[0135] In some embodiments, nucleotide sequence may be positioned under the control of a recombinant or heterologous promoter, which refers to a promoter that is not normally associated with the nucleotide sequence in its natural environment. Such promoters may include promoters of other genes; promoters isolated from any other prokaryotic cell; and synthetic promoters that are not naturally occurring such as, for example, those that contain different elements of different transcriptional regulatory regions and/or mutations that alter expression through methods of genetic engineering that are known in the art. In addition to producing nucleotide sequences of promoters synthetically, sequences may be produced using recombinant cloning and/or nucleic acid amplification technology, including polymerase chain reaction (PCR).
[0136] In some embodiments, initiation of transcription from a promoter depends on the activity of RNA polymerase (also referred to as DNA-dependent RNA polymerase). RNA polymerases are nucleotidyl transferase that polymerizes ribonucleotides at the 3 end of an RNA transcript. Eukaryotes have multiple types of nuclear RNA polymerases, each responsible for synthesis of a distinct subset of RNA. All are structurally and mechanistically related to each other and to bacterial RNA polymerase. RNA polymerase I synthesizes a pre-rRNA 45S (35S in yeast), which matures into 28S, 18S and 5.8S rRNAs, which will form the major RNA sections of the ribosome. RNA polymerase II synthesizes precursors of mRNAs and most snRNA and microRNAs. RNA polymerase III synthesizes tRNAs, rRNA 5S and other small RNAs found in the nucleus and cytosol. RNA polymerase IV synthesizes siRNA in plants. RNA polymerase V synthesizes RNAs involved in siRNA-directed heterochromatin formation in plants.
[0137] Contemplated herein, in some embodiments, are RNA pol II and RNA pol III promoters. Promoters that direct accurate initiation of transcription by an RNA polymerase II are referred to as RNA pol II promoters. Examples of RNA pol II promoters for use in accordance with the present disclosure include, without limitation, human cytomegalovirus promoters, human ubiquitin promoters, human histone H2A1 promoters and human inflammatory chemokine CXCL 1 promoters. Other RNA pol II promoters are also contemplated herein. Promoters that direct accurate initiation of transcription by an RNA polymerase III are referred to as RNA pol III promoters. Examples of RNA pol III promoters for use in accordance with the present disclosure include, without limitation, a U6 promoter, a H1 promoter and promoters of transfer RNAs, 5S ribosomal RNA (rRNA), and the signal recognition particle 7SL RNA.
[0138] In some embodiments, a promoter may be an inducible promoter. An inducible promoter is one that is characterized by initiating or enhancing transcriptional activity when in the presence of, influenced by or contacted by an inducer or inducing agent. An inducer, or inducing agent, may be endogenous or a normally exogenous condition, compound or protein that contacts an engineered nucleic acid in such a way as to be active in inducing transcriptional activity from the inducible promoter.
[0139] Engineered nucleic acids of the present disclosure may be produced using standard molecular biology methods (see, e.g., Green and Sambrook, Molecular Cloning, A Laboratory Manual, 2012, Cold Spring Harbor Press).
[0140] In some embodiments, engineered constructs and/or engineered nucleic acids are produced using GIBSON ASSEMBLY Cloning (see, e.g., Gibson, D. G. et al. Nature Methods, 343-345, 2009; and Gibson, D. G. et al. Nature Methods, 901-903, 2010, each of which is incorporated by reference herein). GIBSON ASSEMBLY typically uses three enzymatic activities in a single-tube reaction: 5 exonuclease, the 3 extension activity of a DNA polymerase and DNA ligase activity. The 5 exonuclease activity chews back the 5 end sequences and exposes the complementary sequence for annealing. The polymerase activity then fills in the gaps on the annealed regions. A DNA ligase then seals the nick and covalently links the DNA fragments together. The overlapping sequence of adjoining fragments is much longer than those used in Golden Gate Assembly, and therefore results in a higher percentage of correct assemblies.
[0141] In some embodiments, engineered constructs and/or engineered nucleic acids are included within a vector. A vector is a nucleic acid (e.g., DNA) used as a vehicle to artificially carry genetic material (e.g., an engineered nucleic acid) into another cell where, for example, it can be replicated and/or expressed. In some embodiments, a vector is an episomal vector (see, e.g., Van Craenenbroeck K. et al. Eur. J. Biochem. 267, 5665, 2000, incorporated by reference herein). A non-limiting example of a vector is a plasmid. Plasmids are double-stranded generally circular DNA sequences that are capable of automatically replicating in a host cell. Plasmid vectors typically contain an origin of replication that allows for semi-independent replication of the plasmid in the host and also the transgene insert. Plasmids may have more features, including, for example, a multiple cloning site, which includes nucleotide overhangs for insertion of a nucleic acid insert, and multiple restriction enzyme consensus sites to either side of the insert. Another non-limiting example of a vector is a viral vector.
[0142] Engineered constructs of the present disclosure may be expressed in a variety of cell types. In some embodiments, engineered constructs are expressed in mammalian cells. For example, in some embodiments, engineered constructs are expressed in human cells, primate cells (e.g., vero cells), rat cells (e.g., GH3 cells, OC23 cells) or mouse cells (e.g., MC3T3 cells). There are a variety of human cell lines, including, without limitation, HEK cells, HeLa cells, cancer cells from the National Cancer Institute's 60 cancer cell lines (NCI60), DU145 (prostate cancer) cells, Lncap (prostate cancer) cells, MCF-7 (breast cancer) cells, MDA-MB-438 (breast cancer) cells, PC3 (prostate cancer) cells, T47D (breast cancer) cells, THP-1 (acute myeloid leukemia) cells, U87 (glioblastoma) cells, SHSY5Y human neuroblastoma cells (cloned from a myeloma) and Saos-2 (bone cancer) cells. In some embodiments, engineered constructs are expressed in human embryonic kidney (HEK) cells (e.g., HEK 293 or HEK 293T cells). In some embodiments, engineered constructs are expressed in bacterial cells, yeast cells, insect cells or other types of cells. In some embodiments, engineered constructs are expressed in stem cells (e.g., human stem cells) such as, for example, pluripotent stem cells (e.g., human pluripotent stem cells including human induced pluripotent stem cells (hiPSCs)). A stem cell refers to a cell with the ability to divide for indefinite periods in culture and to give rise to specialized cells. A pluripotent stem cell refers to a type of stem cell that is capable of differentiating into all tissues of an organism, but not alone capable of sustaining full organismal development. A human induced pluripotent stem cell refers to a somatic (e.g., mature or adult) cell that has been reprogrammed to an embryonic stem cell-like state by being forced to express genes and factors important for maintaining the defining properties of embryonic stem cells (see, e.g., Takahashi and Yamanaka, Cell 126 (4): 663-76, 2006, incorporated by reference herein). Human induced pluripotent stem cell cells express stem cell markers and are capable of generating cells characteristic of all three germ layers (ectoderm, endoderm, mesoderm).
[0143] Additional non-limiting examples of cell lines that may be used in accordance with the present disclosure include 293-T, 293-T, 3T3, 4T1, 721, 9L, A-549, A172, A20, A253, A2780, A2780ADR, A2780cis, A431, ALC, B16, B35, BCP-1, BEAS-2B, bEnd.3, BHK-21, BR 293, BxPC3, C2C12, C3H-10T1/2, C6, C6/36, Cal-27, CGR8, CHO, CML T1, CMT, COR-L23, COR-L23/5010, COR-L23/CPR, COR-L23/R23, COS-7, COV-434, CT26, D17, DH82, DU145, DuCaP, E14Tg2a, EL4, EM2, EM3, EMT6/AR1, EMT6/AR10.0, FM3, H1299, H69, HB54, HB55, HCA2, Hepa1c1c7, High Five cells, HL-60, HMEC, HT-29, HUVEC, J558L cells, Jurkat, JY cells, K562 cells, KCL22, KG1, Ku812, KYO1, LNCap, Ma-Mel 1, 2, 3 . . . 48, MC-38, MCF-10A, MCF-7, MDA-MB-231, MDA-MB-435, MDA-MB-468, MDCK II, MG63, MONO-MAC 6, MOR/0.2R, MRCS, MTD-1A, MyEnd, NALM-1, NCI-H69/CPR, NCI-H69/LX10, NCI-H69/LX20, NCI-H69/LX4, NIH-3T3, NW-145, OPCN/OPCT Peer, PNT-1A/PNT 2, PTK2, Raji, RBL cells, RenCa, RIN-5F, RMA/RMAS, S2, Saos-2 cells, Sf21, Sf9, SiHa, SKBR3, SKOV-3, T-47D, T2, T84, THP1, U373, U87, U937, VCaP, WM39, WT-49, X63, YAC-1 and YAR cells.
[0144] Cells of the present disclosure, in some embodiments, are modified. A modified cell is a cell that contains an exogenous nucleic acid or a nucleic acid that does not occur in nature. In some embodiments, a modified cell contains a mutation in a genomic nucleic acid. In some embodiments, a modified cell contains an exogenous independently replicating nucleic acid (e.g., an engineered nucleic acid present on an episomal vector). In some embodiments, a modified cell is produced by introducing a foreign or exogenous nucleic acid into a cell. A nucleic acid may be introduced into a cell by conventional methods, such as, for example, electroporation (see, e.g., Heiser W. C. Transcription Factor Protocols: Methods in Molecular Biology 2000; 130: 117-134), chemical (e.g., calcium phosphate or lipid) transfection (see, e.g., Lewis W. H., et al., Somatic Cell Genet. 1980 May; 6(3): 333-47; Chen C., et al., Mol Cell Biol. 1987 August; 7(8): 2745-2752), fusion with bacterial protoplasts containing recombinant plasmids (see, e.g., Schaffner W. Proc Natl Acad Sci USA. 1980 April; 77(4): 2163-7), or microinjection of purified DNA directly into the nucleus of the cell (see, e.g., Capecchi M. R. Cell. 1980 November; 22(2 Pt 2): 479-88).
[0145] In some embodiments, a cell is modified to overexpress an endogenous protein of interest (e.g., via introducing or modifying a promoter or other regulatory element near the endogenous gene that encodes the protein of interest to increase its expression level). In some embodiments, a cell is modified by mutagenesis. In some embodiments, a cell is modified by introducing a recombinant nucleic acid into the cell in order to produce a genetic change of interest (e.g., via insertion or homologous recombination).
[0146] In some embodiments, an engineered nucleic acid may be codon-optimized, for example, for expression in human cells or other types of cells. Codon optimization is a technique to maximize the protein expression in living organism by increasing the translational efficiency of gene of interest by transforming a DNA sequence of nucleotides of one species into a DNA sequence of nucleotides of another species. Methods of codon optimization are well-known.
[0147] Engineered constructs of the present disclosure may be transiently expressed or stably expressed. Transient cell expression refers to expression by a cell of a nucleic acid that is not integrated into the nuclear genome of the cell. By comparison, stable cell expression refers to expression by a cell of a nucleic acid that remains in the nuclear genome of the cell and its daughter cells. Typically, to achieve stable cell expression, a cell is co-transfected with a marker gene and an exogenous nucleic acid (e.g., engineered nucleic acid) that is intended for stable expression in the cell. The marker gene gives the cell some selectable advantage (e.g., resistance to a toxin, antibiotic, or other factor). Few transfected cells will, by chance, have integrated the exogenous nucleic acid into their genome. If a toxin, for example, is then added to the cell culture, only those few cells with a toxin-resistant marker gene integrated into their genomes will be able to proliferate, while other cells will die. After applying this selective pressure for a period of time, only the cells with a stable transfection remain and can be cultured further. Examples of marker genes and selection agents for use in accordance with the present disclosure include, without limitation, dihydrofolate reductase with methotrexate, glutamine synthetase with methionine sulphoximine, hygromycin phosphotransferase with hygromycin, puromycin N-acetyltransferase with puromycin, and neomycin phosphotransferase with Geneticin, also known as G418. Other marker genes/selection agents are contemplated herein.
[0148] Expression of nucleic acids in transiently-transfected and/or stably-transfected cells may be constitutive or inducible. Inducible promoters for use as provided herein are described above.
[0149] Mammalian cells (e.g., human cells) modified to comprise an engineered constructs of the present disclosure may be cultured (e.g., maintained in cell culture) using conventional mammalian cell culture methods (see, e.g., Phelan M. C. Curr Protoc Cell Biol. 2007 September; Chapter 1: Unit 1.1, incorporated by reference herein). For example, cells may be grown and maintained at an appropriate temperature and gas mixture (e.g., 37 C., 5% CO.sub.2 for mammalian cells) in a cell incubator. Culture conditions may vary for each cell type. For example, cell growth media may vary in pH, glucose concentration, growth factors, and the presence of other nutrients. Growth factors used to supplement media are often derived from the serum of animal blood, such as fetal bovine serum (FBS), bovine calf serum, equine serum and/or porcine serum. In some embodiments, culture media used as provided herein may be commercially available and/or well-described (see, e.g., Birch J. R., R. G. Spier (Ed.) Encyclopedia of Cell Technology, Wiley. 411-424, 2000; Keen M. J. Cytotechnology 17: 125-132, 1995; Zang, et al. Bio/Technology. 13: 389-392, 1995). In some embodiments, chemically defined media is used.
[0150] Also contemplated herein, in various aspects, are methods and compositions for constructing genetic circuits, including transcriptional cascades, within in a cell (e.g., a mammalian cell such as a human cell). Many complex gene circuits require the ability to implement cascades, in which signals integrated at one stage are transmitted into multiple downstream stages for processing and actuation. For example, gene cascades are important for synthetic-biology applications such as multi-layer artificial gene circuits that compute in living cells (Weber and Fussenegger, 2009). Transcriptional cascades are important in natural regulatory systems, such as those that control segmentation, sexual commitment and development (Dequeant and Pourquie, 2008; Peel et al., 2005; Sinha et al., 2014).
[0151] As shown in
[0152] As shown in
[0153] The present disclosure contemplates, in some embodiments, expression of multiple engineered constructs provided herein. For example, a cell may express 2 to 500, or more, different engineered constructs. In some embodiments, a cell may express 2 to 10, 2 to 25, 2 to 50, 2 to 75, 2 to 100, 2 to 200, 2 to 300 or 2 to 400 different engineered constructs. In some embodiments, a cell may express 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 or more different engineered constructs of the present disclosure. Engineered constructs are considered to be different from each other if the configuration of their genetic elements is different, as shown in
[0154] It should be appreciated that the genetic elements provided herein, in some embodiments, are modular such that a cell may comprise multiple engineered constructs of the present disclosure, each construct comprising a different combination of elements configured in a different way, provided the elements are configured in a manner that permits transcriptional activation and subsequent nucleic acid expression. For example, an engineered construct may comprise a promoter (e.g., an RNA pol II promoter) operably linked to a nucleic acid that comprises: (a) a nucleotide sequence encoding at least one guide RNA (gRNA); and (b) one or more nucleotide sequences selected from (i) a nucleotide sequence encoding a protein of interest and (ii) a nucleotide sequence encoding an RNA interference molecule. Such engineered constructs may or may not further comprise cognate intronic splice sites flanking a gRNA or an RNA interference molecule (e.g., miRNA).
[0155] A nucleotide sequence encoding a gRNA may be flanked by ribonuclease recognition sites (e.g., Csy4 recognition sites) or a gRNA may be flanked by ribozymes. In some embodiments, an engineered construct includes a combination of nucleotide sequence encoding a gRNA flanked by ribonuclease recognition sites and a nucleotide sequence encoding a gRNA flanked by ribozymes. In some embodiments, an engineered construct includes a combination of a first nucleotide sequence encoding a gRNA flanked by ribonuclease recognition sites and a second nucleotide sequence encoding a gRNA flanked by ribozymes, wherein the first nucleotide sequence or the second nucleotide sequence is flanked by cognate intronic splice sites. In some embodiments, an engineered construct includes a combination of a first nucleotide sequence encoding a gRNA flanked by ribonuclease recognition sites and a second nucleotide sequence encoding a gRNA flanked by ribozymes, wherein the first nucleotide sequence and the second nucleotide sequence are each flanked by cognate intronic splice sites. In some embodiments, an engineered construct includes a combination of a first nucleotide sequence encoding a gRNA flanked by ribonuclease recognition sites and/or a second nucleotide sequence encoding a gRNA flanked by ribozymes, and an additional nucleotide sequence encoding a gRNA (flanked or not flanked by ribonuclease recognition sites or ribozymes) flanked by cognate intronic splice sites.
[0156] A nucleotide sequence encoding a protein of interest, in some embodiments, may also encode a gRNA flanked by ribonuclease recognition sites, which are flanked by cognate intronic splice sites. In some embodiments, a gRNA flanked by ribonuclease recognition sites may also encode an RNA interference molecule (e.g., miRNA and/or siRNA) within the protein of interest.
[0157] Engineered constructs of the present disclosure may or may not include a nucleotide sequence encoding a triple helix structure, depending on the particular configuration and stability of the constructs.
[0158] Also contemplated herein, in various aspects, are methods and compositions for rewiring cellular regulatory circuits. CRISPR transcription factor-based regulation can be integrated with RNA interference, for example, to inactivate repressive outputs and/or to activate otherwise inactive outputs. As shown in
[0159] Thus, various aspects and embodiments of the present disclosure may be used to facilitate the construction of multi-mechanism genetic circuits that integrate RNA interference and CRISPR-based systems for tunable, multi-output gene regulation. Furthermore, ribonuclease-based RNA processing can be used to rewire multiple interconnections and feedback loops between genetic components, resulting in synchronized shifts in circuit behavior.
Examples
Example 1
Functional gRNA Generation with an RNA Triple Helix and Csy4
[0160] An important first step to enabling complex CRISPR-TF-based circuits is to generate functional gRNAs from RNAP II promoters in human cells, which permits coupling of gRNA production to specific regulatory signals. For example, the activation of gRNA-dependent circuits can be initiated in defined cell types or states, or in response to external inputs. Furthermore, the ability to simultaneously express gRNAs along with proteins from a single transcript is beneficial. This enables multiple outputs, including effector proteins and regulatory links, to be produced from a concise genetic configuration. It can also enable the integration of gRNA expression into endogenous loci. Thus, the present Example demonstrates a system in which functional gRNAs and proteins are simultaneously produced by endogenous RNAP II promoters.
[0161] The RNA-binding and RNA-endonuclease capabilities of the Csy4 protein from P. aeruginosa (Haurwitz et al., 2012; Sternberg et al., 2012) were utilized in this example. Csy4 recognizes a 28 nucleotide RNA sequence (hereafter referred to as the 28 sequence), cleaves the RNA, and remains bound to the upstream RNA fragment (Haurwitz et al., 2012). Thus, Csy4 was utilized to release gRNAs from transcripts generated by RNAP II promoters, which also encode functional protein sequences. To generate a gRNA-containing transcript, the potent CMV promoter (CMVp) was used to express the mKate2 protein. A gRNA (gRNA1), flanked by two Csy4 binding sites, was encoded downstream of the coding region of mKate2 (
[0162] To enable efficient translation of mRNA lacking a poly-(A) tail, a triple helix structure was used to functionally complement the loss of the poly-(A). A 110 bp fragment derived from the 3 end of the mouse MALAT1 locus (Wilusz et al., 2012) was cloned downstream of mKate2 and upstream of the gRNA sequence flanked by Csy4 recognition sites. The MALAT1 lncRNA is deregulated in many human cancers (Lin et al., 2006) and despite lacking a poly-(A) tail, the MALAT1 is a stable transcript (Wilusz et al., 2008; Wilusz et al., 2012) that is protected from the exosome and 3-5 exonucleases by a highly conserved 3 triple helical structure (triplex) (Wilusz et al., 2012). Thus, the final triplex/Csy4 configuration was a CMVp-driven mKate2 transcript with a 3 triplex sequence followed by a 28-gRNA-28 sequence (CMVp-mK-Tr-28-gRNA-28) (
[0163] To characterize gRNA activity, HEK-293T cells were co-transfected with the CMVp-mK-Tr-28-gRNA1-28 expression plasmid, along with a plasmid encoding a synthetic P1 promoter that is specifically activated by gRNA1 to express EYFP. The P1 promoter contains 8 binding sites for gRNA1 and is based on a minimal promoter construct (Farzadfard et al., 2013). In this experiment and those that follow (unless otherwise indicated), the cells were co-transfected with a transcriptionally active dCas9-NLS-VP64 protein (taCas9) expressed by a CMV promoter. HEK-293T cells were co-transfected with 0-400 ng of a Csy4-expressing plasmid (where Csy4 was produced by the murine PGK1 promoter) along with 1 g of the other plasmids (
[0164] Increasing Csy4 concentration levels did not result in a decrease of mKate2 levels, but instead led to an up to 5-fold increase (
[0165] Interestingly, although a 5 Csy4 recognition site alone should be sufficient to release gRNAs from the RNA transcript, this variant configuration did not generate functional gRNAs capable of activating a downstream target promoter above background levels (data not shown). Without being bound by theory, this could be the result of RNA destabilization, poly-(A)-mediated cytoplasmic transport, interference of the poly-(A) tail with taCas9 activity, or other mechanisms.
[0166] The relative effects of Csy4 and taCas9 on the expression of mKate2 were further characterized. mKate2 fluorescence was measured from the triplex/Csy4-based gRNA expression construct in the presence of Csy4 and taCas9, Csy4 alone, taCas9 alone, or neither protein (
Example 2
Modulating Endogenous Loci with CRISPR-TFs Expressed from Human Promoters
[0167] To validate the robustness of the triplex/Csy4 configuration, it was adapted to regulate the expression of a native genomic target in human cells. The endogenous IL1RN locus was targeted for gene activation via the co-expression of four distinct gRNAs, gRNA3-6 (Table 1) (Perez-Pinera et al., 2013a).
TABLE-US-00001 TABLE1 Sequencesusedinthestudy Sequence(Kozaksequenceandstart Name codonunderlined) dCas9-3xNLS- GCCACCATGGACAAGAAGTACTCCATTGGGCTCGCCATCGGCA VP64-3LTR CAAACAGCGTCGGCTGGGCCGTCATTACGGACGAGTACAAGG (Construct1) TGCCGAGCAAAAAATTCAAAGTTCTGGGCAATACCGATCGCC ACAGCATAAAGAAGAACCTCATTGGCGCCCTCCTGTTCGACTC CGGGGAGACGGCCGAAGCCACGCGGCTCAAAAGAACAGCACG GCGCAGATATACCCGCAGAAAGAATCGGATCTGCTACCTGCA GGAGATCTTTAGTAATGAGATGGCTAAGGTGGATGACTCTTTC TTCCATAGGCTGGAGGAGTCCTTTTTGGTGGAGGAGGATAAAA AGCACGAGCGCCACCCAATCTTTGGCAATATCGTGGACGAGGT GGCGTACCATGAAAAGTACCCAACCATATATCATCTGAGGAA GAAGCTTGTAGACAGTACTGATAAGGCTGACTTGCGGTTGATC TATCTCGCGCTGGCGCATATGATCAAATTTCGGGGACACTTCC TCATCGAGGGGGACCTGAACCCAGACAACAGCGATGTCGACA AACTCTTTATCCAACTGGTTCAGACTTACAATCAGCTTTTCGAA GAGAACCCGATCAACGCATCCGGAGTTGACGCCAAAGCAATC CTGAGCGCTAGGCTGTCCAAATCCCGGCGGCTCGAAAACCTCA TCGCACAGCTCCCTGGGGAGAAGAAGAACGGCCTGTTTGGTA ATCTTATCGCCCTGTCACTCGGGCTGACCCCCAACTTTAAATCT AACTTCGACCTGGCCGAAGATGCCAAGCTTCAACTGAGCAAA GACACCTACGATGATGATCTCGACAATCTGCTGGCCCAGATCG GCGACCAGTACGCAGACCTTTTTTTGGCGGCAAAGAACCTGTC AGACGCCATTCTGCTGAGTGATATTCTGCGAGTGAACACGGAG ATCACCAAAGCTCCGCTGAGCGCTAGTATGATCAAGCGCTATG ATGAGCACCACCAAGACTTGACTTTGCTGAAGGCCCTTGTCAG ACAGCAACTGCCTGAGAAGTACAAGGAAATTTTCTTCGATCAG TCTAAAAATGGCTACGCCGGATACATTGACGGCGGAGCAAGC CAGGAGGAATTTTACAAATTTATTAAGCCCATCTTGGAAAAAA TGGACGGCACCGAGGAGCTGCTGGTAAAGCTTAACAGAGAAG ATCTGTTGCGCAAACAGCGCACTTTCGACAATGGAAGCATCCC CCACCAGATTCACCTGGGCGAACTGCACGCTATCCTCAGGCGG CAAGAGGATTTCTACCCCTTTTTGAAAGATAACAGGGAAAAG ATTGAGAAAATCCTCACATTTCGGATACCCTACTATGTAGGCC CCCTCGCCCGGGGAAATTCCAGATTCGCGTGGATGACTCGCAA ATCAGAAGAGACCATCACTCCCTGGAACTTCGAGGAAGTCGT GGATAAGGGGGCCTCTGCCCAGTCCTTCATCGAAAGGATGACT AACTTTGATAAAAATCTGCCTAACGAAAAGGTGCTTCCTAAAC ACTCTCTGCTGTACGAGTACTTCACAGTTTATAACGAGCTCAC CAAGGTCAAATACGTCACAGAAGGGATGAGAAAGCCAGCATT CCTGTCTGGAGAGCAGAAGAAAGCTATCGTGGACCTCCTCTTC AAGACGAACCGGAAAGTTACCGTGAAACAGCTCAAAGAAGAC TATTTCAAAAAGATTGAATGTTTCGACTCTGTTGAAATCAGCG GAGTGGAGGATCGCTTCAACGCATCCCTGGGAACGTATCACG ATCTCCTGAAAATCATTAAAGACAAGGACTTCCTGGACAATGA GGAGAACGAGGACATTCTTGAGGACATTGTCCTCACCCTTACG TTGTTTGAAGATAGGGAGATGATTGAAGAACGCTTGAAAACTT ACGCTCATCTCTTCGACGACAAAGTCATGAAACAGCTCAAGAG GCGCCGATATACAGGATGGGGGCGGCTGTCAAGAAAACTGAT CAATGGGATCCGAGACAAGCAGAGTGGAAAGACAATCCTGGA TTTTCTTAAGTCCGATGGATTTGCCAACCGGAACTTCATGCAG TTGATCCATGATGACTCTCTCACCTTTAAGGAGGACATCCAGA AAGCACAAGTTTCTGGCCAGGGGGACAGTCTTCACGAGCACA TCGCTAATCTTGCAGGTAGCCCAGCTATCAAAAAGGGAATACT GCAGACCGTTAAGGTCGTGGATGAACTCGTCAAAGTAATGGG AAGGCATAAGCCCGAGAATATCGTTATCGAGATGGCCCGAGA GAACCAAACTACCCAGAAGGGACAGAAGAACAGTAGGGAAA GGATGAAGAGGATTGAAGAGGGTATAAAAGAACTGGGGTCCC AAATCCTTAAGGAACACCCAGTTGAAAACACCCAGCTTCAGA ATGAGAAGCTCTACCTGTACTACCTGCAGAACGGCAGGGACA TGTACGTGGATCAGGAACTGGACATCAATCGGCTCTCCGACTA CGACGTGGATGCCATCGTGCCCCAGTCTTTTCTCAAAGATGAT TCTATTGATAATAAAGTGTTGACAAGATCCGATAAAAATAGAG GGAAGAGTGATAACGTCCCCTCAGAAGAAGTTGTCAAGAAAA TGAAAAATTATTGGCGGCAGCTGCTGAACGCCAAACTGATCAC ACAACGGAAGTTCGATAATCTGACTAAGGCTGAACGAGGTGG CCTGTCTGAGTTGGATAAAGCCGGCTTCATCAAAAGGCAGCTT GTTGAGACACGCCAGATCACCAAGCACGTGGCCCAAATTCTCG ATTCACGCATGAACACCAAGTACGATGAAAATGACAAACTGA TTCGAGAGGTGAAAGTTATTACTCTGAAGTCTAAGCTGGTCTC AGATTTCAGAAAGGACTTTCAGTTTTATAAGGTGAGAGAGATC AACAATTACCACCATGCGCATGATGCCTACCTGAATGCAGTGG TAGGCACTGCACTTATCAAAAAATATCCCAAGCTTGAATCTGA ATTTGTTTACGGAGACTATAAAGTGTACGATGTTAGGAAAATG ATCGCAAAGTCTGAGCAGGAAATAGGCAAGGCCACCGCTAAG TACTTCTTTTACAGCAATATTATGAATTTTTTCAAGACCGAGAT TACACTGGCCAATGGAGAGATTCGGAAGCGACCACTTATCGA AACAAACGGAGAAACAGGAGAAATCGTGTGGGACAAGGGTA GGGATTTCGCGACAGTCCGGAAGGTCCTGTCCATGCCGCAGGT GAACATCGTTAAAAAGACCGAAGTACAGACCGGAGGCTTCTC CAAGGAAAGTATCCTCCCGAAAAGGAACAGCGACAAGCTGAT CGCACGCAAAAAAGATTGGGACCCCAAGAAATACGGCGGATT CGATTCTCCTACAGTCGCTTACAGTGTACTGGTTGTGGCCAAA GTGGAGAAAGGGAAGTCTAAAAAACTCAAAAGCGTCAAGGAA CTGCTGGGCATCACAATCATGGAGCGATCAAGCTTCGAAAAA AACCCCATCGACTTTCTCGAGGCGAAAGGATATAAAGAGGTC AAAAAAGACCTCATCATTAAGCTTCCCAAGTACTCTCTCTTTG AGCTTGAAAACGGCCGGAAACGAATGCTCGCTAGTGCGGGCG AGCTGCAGAAAGGTAACGAGCTGGCACTGCCCTCTAAATACG TTAATTTCTTGTATCTGGCCAGCCACTATGAAAAGCTCAAAGG GTCTCCCGAAGATAATGAGCAGAAGCAGCTGTTCGTGGAACA ACACAAACACTACCTTGATGAGATCATCGAGCAAATAAGCGA ATTCTCCAAAAGAGTGATCCTCGCCGACGCTAACCTCGATAAG GTGCTTTCTGCTTACAATAAGCACAGGGATAAGCCCATCAGGG AGCAGGCAGAAAACATTATCCACTTGTTTACTCTGACCAACTT GGGCGCGCCTGCAGCCTTCAAGTACTTCGACACCACCATAGAC AGAAAGCGGTACACCTCTACAAAGGAGGTCCTGGACGCCACA CTGATTCATCAGTCAATTACGGGGCTCTATGAAACAAGAATCG ACCTCTCTCAGCTCGGTGGAGACAGCAGGGCTGACGGGCCCTC ACTGGGTTCAGGGTCACCCAAGAAGAAACGCAAAGTCGAGGA TCCAAAGAAGAAAAGGAAGGTTGAAGACCCCAAGAAAAAGA GGAAGGTGGATGGGATCGGCTCAGGCAGCAACGGCGGTGGAG GTTCAGACGCTTTGGACGATTTCGATCTCGATATGCTCGGTTCT GACGCCCTGGATGATTTCGATCTGGATATGCTCGGCAGCGACG CTCTCGACGATTTCGACCTCGACATGCTCGGGTCAGATGCCTT GGATGATTTTGACCTGGATATGCTCTCATGATGA (SEQIDNO:2) PGK1p-Csy4-pA GCCACCATGAAATCTTCTCACCATCACCATCACCATGAAAACC (Construct2) TGTACTTCCAATCCAATGCAGCTAGCGACCACTATCTGGACAT CAGACTGAGGCCCGATCCTGAGTTCCCTCCCGCCCAGCTGATG AGCGTGCTGTTTGGCAAGCTGCATCAGGCTCTGGTCGCCCAAG GCGGAGACAGAATCGGCGTGTCCTTCCCCGACCTGGACGAGTC CCGGAGTCGCCTGGGCGAGCGGCTGAGAATCCACGCCAGCGC AGACGATCTGCGCGCCCTGCTGGCCCGGCCTTGGCTGGAGGGC CTGCGGGATCATCTGCAGTTTGGCGAGCCCGCCGTGGTGCCAC ACCCAACACCCTACCGCCAGGTGAGCCGCGTGCAGGCCAAGT CAAATCCCGAGAGACTGCGGCGGAGGCTGATGAGGCGACATG ATCTGAGCGAGGAGGAGGCCAGAAAGAGAATCCCCGACACAG TGGCCAGAGCCCTGGATCTGCCATTTGTGACCCTGCGGAGCCA GAGCACTGGCCAGCATTTCAGACTGTTCATCAGACACGGGCCC CTGCAGGTGACAGCCGAGGAGGGCGGATTTACATGCTATGGC CTGTCTAAAGGCGGCTTCGTGCCCTGGTTCTGA (SEQIDNO:3) mKate2-Triplex-28- GCCACCATGGTGTCTAAGGGCGAAGAGCTGATTAAGGAGAAC gRNA1-28-pA ATGCACATGAAGCTGTACATGGAGGGCACCGTGAACAACCAC (Construct3) CACTTCAAGTGCACATCCGAGGGCGAAGGCAAGCCCTACGAG GGCACCCAGACCATGAGAATCAAGGTGGTCGAGGGCGGCCCT CTCCCCTTCGCCTTCGACATCCTGGCTACCAGCTTCATGTACGG CAGCAAAACCTTCATCAACCACACCCAGGGCATCCCCGACTTC TTTAAGCAGTCCTTCCCTGAGGGCTTCACATGGGAGAGAGTCA CCACATACGAAGACGGGGGCGTGCTGACCGCTACCCAGGACA CCAGCCTCCAGGACGGCTGCCTCATCTACAACGTCAAGATCAG AGGGGTGAACTTCCCATCCAACGGCCCTGTGATGCAGAAGAA AACACTCGGCTGGGAGGCCTCCACCGAGATGCTGTACCCCGCT GACGGCGGCCTGGAAGGCAGAAGCGACATGGCCCTGAAGCTC GTGGGCGGGGGCCACCTGATCTGCAACTTGAAGACCACATAC AGATCCAAGAAACCCGCTAAGAACCTCAAGATGCCCGGCGTC TACTATGTGGACAGAAGACTGGAAAGAATCAAGGAGGCCGAC AAAGAGACCTACGTCGAGCAGCACGAGGTGGCTGTGGCCAGA TACTGCGACCTCCCTAGCAAACTGGGGCACAAACTTAATTGAT AAACCGGTGATTCGTCAGTAGGGTTGTAAAGGTTTTTCTTTTCC TGAGAAAACAACCTTTTGTTTTCTCAGGTTTTGCTTTTTGGCCT TTCCCTAGCTTTAAAAAAAAAAAAGCAAAACTCACCGAGGCA GTTCCATAGGATGGCAAGATCCTGGTATTGGTCTGCGAGTTCA CTGCCGTATAGGCAGCTAAGAAATAGTCGCGTGTAGCGAAGC AGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCC GTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTTC GTTCACTGCCGTATAGGCAGCTAAGAAACAAACAGGAATCGA ATGCAACCGGCGCAGGAACACTGCCAGCGCATCAACCCCGGG (SEQIDNO:4) mKate2_EX1-[28- GCCACCATGGTGTCTAAGGGCGAAGAGCTGATTAAGGAGAAC gRNA1-28].sub.Hsv1- ATGCACATGAAGCTGTACATGGAGGGCACCGTGAACAACCAC mKate2_EX2-pA CACTTCAAGTGCACATCCGAGGGCGAAGGCAAGCCCTACGAG (Construct4) GGCACCCAGACCATGAGAATCAAGGTGGTCGAGGGCGGCCCT CTCCCCTTCGCCTTCGACATCCTGGCTACCAGCTTCATGTACGG CAGCAAAACCTTCATCAACCACACCCAGGGCATCCCCGACTTC TTTAAGCAGTCCTTCCCTGAGGTAAGTGTTCACTGCCGTATAG GCAGCTAAGAAATAGTCGCGTGTAGCGAAGCAGTTTTAGAGC TAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTG AAAAAGTGGCACCGAGTCGGTGCTTTTTTTCGTTCACTGCCGT ATAGGCAGCTAAGAAAGAGGGAGTCGAGTCTTCTTTTTTTTTT TCACAGGGCTTCACATGGGAGAGAGTCACCACATACGAAGAC GGGGGCGTGCTGACCGCTACCCAGGACACCAGCCTCCAGGAC GGCTGCCTCATCTACAACGTCAAGATCAGAGGGGTGAACTTCC CATCCAACGGCCCTGTGATGCAGAAGAAAACACTCGGCTGGG AGGCCTCCACCGAGATGCTGTACCCCGCTGACGGCGGCCTGGA AGGCAGAAGCGACATGGCCCTGAAGCTCGTGGGCGGGGGCCA CCTGATCTGCAACTTGAAGACCACATACAGATCCAAGAAACCC GCTAAGAACCTCAAGATGCCCGGCGTCTACTATGTGGACAGA AGACTGGAAAGAATCAAGGAGGCCGACAAAGAGACCTACGTC GAGCAGCACGAGGTGGCTGTGGCCAGATACTGCGACCTCCCT AGCAAACTGGGGCACAAACTTAATTGA (SEQIDNO:5) P1-EYFP-pA GCTAGCCATGCTTCGCTACACGCGACTATTAATATTTTCAGGC (Construct5) TAGCCATGCTTCGCTACACGCGACTATTAATATTTTCAGGCTA GCCATGCTTCGCTACACGCGACTATTAATATTTTCAGGCTAGC CATGCTTCGCTACACGCGACTATTAATATTTTCAGGCTAGCCA TGCTTCGCTACACGCGACTATTAATATTTTCAGGCTAGCCATG CTTCGCTACACGCGACTATTAATATTTTCAGGCTAGCCATGCTT CGCTACACGCGACTATTAATATTTTCAGGCTAGCCATGCTTCG CTACACGCGACTATTAATATTTTCAGGCTAGCCATGCTTCGCT ACACGCGACTATTAATATTTTCAGGCTAGCGGGGGGCTATAAA AGGGGGTGGGGGCGTTCGTCCTGCTATCTAGCGTCGCGTTGAC CATGGCGCCACCATGAGCAGCGGCGCCCTGCTGTTCCACGGCA AGATCCCCTACGTGGTGGAGATGGAGGGCGATGTGGATGGCC ACACCTTCAGCATCCGCGGTAAGGGCTACGGCGATGCCAGCGT GGGCAAGGTGGATGCCCAGTTCATCTGCACCACCGGCGATGTG CCCGTGCCCTGGAGCACCCTGGTGACCACCCTGACCTACGGCG CCCAGTGCTTCGCCAAGTACGGCCCCGAGCTGAAGGATTTCTA CAAGAGCTGCATGCCCGATGGCTACGTGCAGGAGCGCACCAT CACCTTCGAGGGCGATGGCAATTTCAAGACCCGCGCCGAGGT GACCTTCGAGAATGGCAGCGTGTACAATCGCGTGAAGCTGAA TGGCCAGGGCTTCAAGAAGGATGGCCACGTGCTGGGCAAGAA TCTGGAGTTCAATTTCACCCCCCACTGCCTGTACATCTGGGGC GATCAGGCCAATCACGGCCTGAAGAGCGCCTTCAAGATCTGCC ACGAGATCGCCGGCAGCAAGGGCGATTTCATCGTGGCCGATC ACACCCAGATGAATACCCCCATCGGCGGCGGCCCCGTGCACGT GCCCGAGTACCACCACATGAGCTACCACGTGAAGCTGAGCAA GGATGTGACCGATCACCGCGATAATATGAGCCTGACGGAGAC CGTGCGCGCCGTGGATTGCCGCAAGACCTACCTGTAA (SEQIDNO:6) P2-ECFP-pA GCTAGCCCAGGACAGTACTCCGACTTACTTAATATTTTCAGGC (Construct6) TAGCCCAGGACAGTACTCCGACTTACTTAATATTTTCAGGCTA GCCCAGGACAGTACTCCGACTTACTTAATATTTTCAGGCTAGC CCAGGACAGTACTCCGACTTACTTAATATTTTCAGGCTAGCCC AGGACAGTACTCCGACTTACTTAATATTTTCAGGCTAGCCCAG GACAGTACTCCGACTTACTTAATATTTTCAGGCTAGCCCAGGA CAGTACTCCGACTTACTTAATATTTTCAGGCTAGCCCAGGACA GTACTCCGACTTACTTAATATTTTCAGGCTAGCGGGGGGCTAT AAAAGGGGGTGGGGGCGTTCGTCCTGCTATCTAGCGTCGCGTT GACCATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGT GCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAA GTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGG CAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCC GTGCCCTGGCCCACCCTCGTGACCACCCTGACCTGGGGCGTGC AGTGCTTCGCCCGCTACCCCGACCACATGAAGCAGCACGACTT CTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACC ATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAG GTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTG AAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCAC AAGCTGGAGTACAACGCCATCAGCGACAACGTCTATATCACC GCCGACAAGCAGAAGAACGGCATCAAGGCCAACTTCAAGATC CGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCAC TACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGC CCGACAACCACTACCTGAGCACCCAGTCCAAGCTGAGCAAAG ACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGT GACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAA GTAA (SEQIDNO:7) mKate2_EX1-[28- GCCACCATGGTGTCTAAGGGCGAAGAGCTGATTAAGGAGAAC gRNA1-28].sub.consensus- ATGCACATGAAGCTGTACATGGAGGGCACCGTGAACAACCAC mKate2_EX2-pA CACTTCAAGTGCACATCCGAGGGCGAAGGCAAGCCCTACGAG (Construct8) GGCACCCAGACCATGAGAATCAAGGTGGTCGAGGGCGGCCCT CTCCCCTTCGCCTTCGACATCCTGGCTACCAGCTTCATGTACGG CAGCAAAACCTTCATCAACCACACCCAGGGCATCCCCGACTTC TTTAAGCAGTCCTTCCCTGAGGTAAGTGTTCACTGCCGTATAG GCAGCTAAGAAATAGTCGCGTGTAGCGAAGCAGTTTTAGAGC TAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTG AAAAAGTGGCACCGAGTCGGTGCTTTTTTTCGTTCACTGCCGT ATAGGCAGCTAAGAAATACTAACTTCGAGTCTTCTTTTTTTTTT TCACAGGGCTTCACATGGGAGAGAGTCACCACATACGAAGAC GGGGGCGTGCTGACCGCTACCCAGGACACCAGCCTCCAGGAC GGCTGCCTCATCTACAACGTCAAGATCAGAGGGGTGAACTTCC CATCCAACGGCCCTGTGATGCAGAAGAAAACACTCGGCTGGG AGGCCTCCACCGAGATGCTGTACCCCGCTGACGGCGGCCTGGA AGGCAGAAGCGACATGGCCCTGAAGCTCGTGGGCGGGGGCCA CCTGATCTGCAACTTGAAGACCACATACAGATCCAAGAAACCC GCTAAGAACCTCAAGATGCCCGGCGTCTACTATGTGGACAGA AGACTGGAAAGAATCAAGGAGGCCGACAAAGAGACCTACGTC GAGCAGCACGAGGTGGCTGTGGCCAGATACTGCGACCTCCCT AGCAAACTGGGGCACAAACTTAATTGACCCGGG (SEQIDNO:8) mKate2_EX1-[28- GCCACCATGGTGTCTAAGGGCGAAGAGCTGATTAAGGAGAAC gRNA1-28].sub.snoRNA2- ATGCACATGAAGCTGTACATGGAGGGCACCGTGAACAACCAC mKate2_EX2-pA CACTTCAAGTGCACATCCGAGGGCGAAGGCAAGCCCTACGAG (Construct9) GGCACCCAGACCATGAGAATCAAGGTGGTCGAGGGCGGCCCT CTCCCCTTCGCCTTCGACATCCTGGCTACCAGCTTCATGTACGG CAGCAAAACCTTCATCAACCACACCCAGGGCATCCCCGACTTC TTTAAGCAGTCCTTCCCTGAGGTAAGTGTTCATTTCTCAAAAG ACCCTAATGTTCTTCCTTTACAGGAATGAATACTGTGCATGGA CCAATGATGACTTCCATACATGCATTCCTTGGAAAGCTGAACA AAATGAGTGGGAACTCTGTACTATCATCTTAGTTGAACTGAGG TCCGGATCCGTTCACTGCCGTATAGGCAGCTAAGAAATAGTCG CGTGTAGCGAAGCAGTTTTAGAGCTAGAAATAGCAAGTTAAA ATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTC GGTGCTTTTTTTCAGATCTGTTCACTGCCGTATAGGCAGCTAAG AAATCTAGATGGATCGATGATGACTTCCATATATACATTCCTT GGAAAGCTGAACAAAATGAGTGAAAACTCTATACCGTCATTCT CGTCGAACTGAGGTCCAACCGGTGCACATTACTCCAACAGGG GCTAGACAGAGAGGGCCAACATTGATTCGTTGACATGGGTGG CTGCAGTACTAACTTCGAGTCTTCTTTTTTTTTTTCACAGGGCT TCACATGGGAGAGAGTCACCACATACGAAGACGGGGGCGTGC TGACCGCTACCCAGGACACCAGCCTCCAGGACGGCTGCCTCAT CTACAACGTCAAGATCAGAGGGGTGAACTTCCCATCCAACGG CCCTGTGATGCAGAAGAAAACACTCGGCTGGGAGGCCTCCAC CGAGATGCTGTACCCCGCTGACGGCGGCCTGGAAGGCAGAAG CGACATGGCCCTGAAGCTCGTGGGCGGGGGCCACCTGATCTGC AACTTGAAGACCACATACAGATCCAAGAAACCCGCTAAGAAC CTCAAGATGCCCGGCGTCTACTATGTGGACAGAAGACTGGAA AGAATCAAGGAGGCCGACAAAGAGACCTACGTCGAGCAGCAC GAGGTGGCTGTGGCCAGATACTGCGACCTCCCTAGCAAACTGG GGCACAAACTTAATTGA(SEQIDNO:9) mKate2-Triplex- GCCACCATGGTGTCTAAGGGCGAAGAGCTGATTAAGGAGAAC HHRibo-gRNA1- ATGCACATGAAGCTGTACATGGAGGGCACCGTGAACAACCAC HDVRibo-pA CACTTCAAGTGCACATCCGAGGGCGAAGGCAAGCCCTACGAG (Construct13) GGCACCCAGACCATGAGAATCAAGGTGGTCGAGGGCGGCCCT CTCCCCTTCGCCTTCGACATCCTGGCTACCAGCTTCATGTACGG CAGCAAAACCTTCATCAACCACACCCAGGGCATCCCCGACTTC TTTAAGCAGTCCTTCCCTGAGGGCTTCACATGGGAGAGAGTCA CCACATACGAAGACGGGGGCGTGCTGACCGCTACCCAGGACA CCAGCCTCCAGGACGGCTGCCTCATCTACAACGTCAAGATCAG AGGGGTGAACTTCCCATCCAACGGCCCTGTGATGCAGAAGAA AACACTCGGCTGGGAGGCCTCCACCGAGATGCTGTACCCCGCT GACGGCGGCCTGGAAGGCAGAAGCGACATGGCCCTGAAGCTC GTGGGCGGGGGCCACCTGATCTGCAACTTGAAGACCACATAC AGATCCAAGAAACCCGCTAAGAACCTCAAGATGCCCGGCGTC TACTATGTGGACAGAAGACTGGAAAGAATCAAGGAGGCCGAC AAAGAGACCTACGTCGAGCAGCACGAGGTGGCTGTGGCCAGA TACTGCGACCTCCCTAGCAAACTGGGGCACAAACTTAATTGAT AAACCGGTGATTCGTCAGTAGGGTTGTAAAGGTTTTTCTTTTCC TGAGAAAACAACCTTTTGTTTTCTCAGGTTTTGCTTTTTGGCCT TTCCCTAGCTTTAAAAAAAAAAAAGCAAAACGACTACTGATG AGTCCGTGAGGACGAAACGAGTAAGCTCGTCTAGTCGCGTGT AGCGAAGCAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAG GCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC TTTTGGCCGGCATGGTCCCAGCCTCCTCGCTGGCGCCGGCTGG GCAACATGCTTCGGCATGGCGAATGGGACCCCGGG (SEQIDNO:10) mKate2-HHRibo- GCCACCATGGTGTCTAAGGGCGAAGAGCTGATTAAGGAGAAC gRNA1-HDVRibo- ATGCACATGAAGCTGTACATGGAGGGCACCGTGAACAACCAC pA CACTTCAAGTGCACATCCGAGGGCGAAGGCAAGCCCTACGAG (Construct14) GGCACCCAGACCATGAGAATCAAGGTGGTCGAGGGCGGCCCT CTCCCCTTCGCCTTCGACATCCTGGCTACCAGCTTCATGTACGG CAGCAAAACCTTCATCAACCACACCCAGGGCATCCCCGACTTC TTTAAGCAGTCCTTCCCTGAGGGCTTCACATGGGAGAGAGTCA CCACATACGAAGACGGGGGCGTGCTGACCGCTACCCAGGACA CCAGCCTCCAGGACGGCTGCCTCATCTACAACGTCAAGATCAG AGGGGTGAACTTCCCATCCAACGGCCCTGTGATGCAGAAGAA AACACTCGGCTGGGAGGCCTCCACCGAGATGCTGTACCCCGCT GACGGCGGCCTGGAAGGCAGAAGCGACATGGCCCTGAAGCTC GTGGGCGGGGGCCACCTGATCTGCAACTTGAAGACCACATAC AGATCCAAGAAACCCGCTAAGAACCTCAAGATGCCCGGCGTC TACTATGTGGACAGAAGACTGGAAAGAATCAAGGAGGCCGAC AAAGAGACCTACGTCGAGCAGCACGAGGTGGCTGTGGCCAGA TACTGCGACCTCCCTAGCAAACTGGGGCACAAACTTAATTGAT AAACCGGTCGACTACTGATGAGTCCGTGAGGACGAAACGAGT AAGCTCGTCTAGTCGCGTGTAGCGAAGCAGTTTTAGAGCTAGA AATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAA AGTGGCACCGAGTCGGTGCTTTTGGCCGGCATGGTCCCAGCCT CCTCGCTGGCGCCGGCTGGGCAACATGCTTCGGCATGGCGAAT GGGACCCCGGG (SEQIDNO:11) HHRibo-gRNA1- CGACTACTGATGAGTCCGTGAGGACGAAACGAGTAAGCTCGT HDVRibo-pA CTAGTCGCGTGTAGCGAAGCAGTTTTAGAGCTAGAAATAGCA (Construct15) AGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCA CCGAGTCGGTGCTTTTGGCCGGCATGGTCCCAGCCTCCTCGCT GGCGCCGGCTGGGCAACATGCTTCGGCATGGCGAATGGGACC CCGGG(SEQIDNO:12) mKate2-Triplex-28- GCCACCATGGTGTCTAAGGGCGAAGAGCTGATTAAGGAGAAC gRNA3-28-gRNA4- ATGCACATGAAGCTGTACATGGAGGGCACCGTGAACAACCAC 28-gRNA5-28- CACTTCAAGTGCACATCCGAGGGCGAAGGCAAGCCCTACGAG gRNA6-28-pA GGCACCCAGACCATGAGAATCAAGGTGGTCGAGGGCGGCCCT (Construct19) CTCCCCTTCGCCTTCGACATCCTGGCTACCAGCTTCATGTACGG CAGCAAAACCTTCATCAACCACACCCAGGGCATCCCCGACTTC TTTAAGCAGTCCTTCCCTGAGGGCTTCACATGGGAGAGAGTCA CCACATACGAAGACGGGGGCGTGCTGACCGCTACCCAGGACA CCAGCCTCCAGGACGGCTGCCTCATCTACAACGTCAAGATCAG AGGGGTGAACTTCCCATCCAACGGCCCTGTGATGCAGAAGAA AACACTCGGCTGGGAGGCCTCCACCGAGATGCTGTACCCCGCT GACGGCGGCCTGGAAGGCAGAAGCGACATGGCCCTGAAGCTC GTGGGCGGGGGCCACCTGATCTGCAACTTGAAGACCACATAC AGATCCAAGAAACCCGCTAAGAACCTCAAGATGCCCGGCGTC TACTATGTGGACAGAAGACTGGAAAGAATCAAGGAGGCCGAC AAAGAGACCTACGTCGAGCAGCACGAGGTGGCTGTGGCCAGA TACTGCGACCTCCCTAGCAAACTGGGGCACAAACTTAATTGAT AAACCGGTGATTCGTCAGTAGGGTTGTAAAGGTTTTTCTTTTCC TGAGAAAACAACCTTTTGTTTTCTCAGGTTTTGCTTTTTGGCCT TTCCCTAGCTTTAAAAAAAAAAAAGCAAAACTCACCGAGGCA GTTCCATAGGATGGCAAGATCCTGGTATCGGTCTGCGAGTTCA CTGCCGTATAGGCAGCTAAGAAAGCTAGCGTGTACTCTCTGAG GTGCTCGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTA GTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTT TTTCGTTCACTGCCGTATAGGCAGCTAAGAAAAGGTGACGCAG ATAAGAACCAGTTGTTTTAGAGCTAGAAATAGCAAGTTAAAAT AAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCG GTGCTTTTTTTCGTTCACTGCCGTATAGGCAGCTAAGAAACAG GGCATCAAGTCAGCCATCAGCGTTTTAGAGCTAGAAATAGCA AGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCA CCGAGTCGGTGCTTTTTTTCGTTCACTGCCGTATAGGCAGCTAA GAAAAGTCGGGAGTCACCCTCCTGGAAACGTTTTAGAGCTAG AAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAA AAGTGGCACCGAGTCGGTGCTTTTTTTCGTTCACTGCCGTATA GGCAGCTAAGAAACCCGGG(SEQIDNO:13) CMVp-mK.sub.Ex1- GCCACCATGGTGTCTAAGGGCGAAGAGCTGATTAAGGAGAAC [miR]-mK.sub.Ex2-Tr-28- ATGCACATGAAGCTGTACATGGAGGGCACCGTGAACAACCAC g1-28 CACTTCAAGTGCACATCCGAGGGCGAAGGCAAGCCCTACGAG (Construct20) GGCACCCAGACCATGAGAATCAAGGTGGTCGAGGGCGGCCCT CTCCCCTTCGCCTTCGACATCCTGGCTACCAGCTTCATGTACGG CAGCAAAACCTTCATCAACCACACCCAGGGCATCCCCGACTTC TTTAAGCAGTCCTTCCCTGAGGTAAGTGTGCTCGCTTCGGCAG CACATATACTATGTTGAATGAGGCTTCAGTACTTTACAGAATC GTTGCCTGCACATCTTGGAAACACTTGCTGGGATTACTTCTTCA GGTTAACCCAACAGAAGGCTCGAGTGCTGTTGACAGTGAGCG CCGCTTGAAGTCTTTAATTAAATAGTGAAGCCACAGATGTATT TAATTAAAGACTTCAAGCGGTGCCTACTGCCTCGGAGAATTCA AGGGGCTACTTTAGGAGCAATTATCTTGTTTACTAAAACTGAA TACCTTGCTATCTCTTTGATACATTTTTACAAAGCTGAATTAAA ATGGTATAAATTAAATCACTTTTTTCAATTGTACTAACTTCGAG TCTTCTTTTTTTTTTTCACAGGGCTTCACATGGGAGAGAGTCAC CACATACGAAGACGGGGGCGTGCTGACCGCTACCCAGGACAC CAGCCTCCAGGACGGCTGCCTCATCTACAACGTCAAGATCAGA GGGGTGAACTTCCCATCCAACGGCCCTGTGATGCAGAAGAAA ACACTCGGCTGGGAGGCCTCCACCGAGATGCTGTACCCCGCTG ACGGCGGCCTGGAAGGCAGAAGCGACATGGCCCTGAAGCTCG TGGGCGGGGGCCACCTGATCTGCAACTTGAAGACCACATACA GATCCAAGAAACCCGCTAAGAACCTCAAGATGCCCGGCGTCT ACTATGTGGACAGAAGACTGGAAAGAATCAAGGAGGCCGACA AAGAGACCTACGTCGAGCAGCACGAGGTGGCTGTGGCCAGAT ACTGCGACCTCCCTAGCAAACTGGGGCACAAACTTAATTGATA AACCGGTGATTCGTCAGTAGGGTTGTAAAGGTTTTTCTTTTCCT GAGAAAACAACCTTTTGTTTTCTCAGGTTTTGCTTTTTGGCCTT TCCCTAGCTTTAAAAAAAAAAAAGCAAAACTCACCGAGGCAG TTCCATAGGATGGCAAGATCCTGGTATCGGTCTGCGAGTTCAC TGCCGTATAGGCAGCTAAGAAATAGTCGCGTGTAGCGAAGCA GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGT TATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTTCCC GCTTGAAGTCTTTAATTAAACCGCTTGAAGTCTTTAATTAAAC CGCTTGAAGTCTTTAATTAAACCGCTTGAAGTCTTTAATTAAA GTTCACTGCCGTATAGGCAGCTAAGAAACCCGGG (SEQIDNO:14) ECFP-Triplex-28- GCCACCATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTG 8xmiRNA-BS-28- GTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCAC pA AAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTAC (Construct22) GGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGC CCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTGGGGCGT GCAGTGCTTCGCCCGCTACCCCGACCACATGAAGCAGCACGAC TTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCA CCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGA GGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCT GAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCA CAAGCTGGAGTACAACGCCATCAGCGACAACGTCTATATCACC GCCGACAAGCAGAAGAACGGCATCAAGGCCAACTTCAAGATC CGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCAC TACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGC CCGACAACCACTACCTGAGCACCCAGTCCAAGCTGAGCAAAG ACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGT GACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAA GTAAACCGGTGATTCGTCAGTAGGGTTGTAAAGGTTTTTCTTTT CCTGAGAAAACAACCTTTTGTTTTCTCAGGTTTTGCTTTTTGGC CTTTCCCTAGCTTTAAAAAAAAAAAAGCAAAACTCACCGAGG CAGTTCCATAGGATGGCAAGATCCTGGTATCGGTCTGCGAGTT CACTGCCGTATAGGCAGCTAAGAAACCGCTTGAAGTCTTTAAT TAAACCGCTTGAAGTCTTTAATTAAACCGCTTGAAGTCTTTAA TTAAACCGCTTGAAGTCTTTAATTAAACCTCTGGCCACATCGG TTCCTGCTCCGCTTGAAGTCTTTAATTAAACCGCTTGAAGTCTT TAATTAAACCGCTTGAAGTCTTTAATTAAACCGCTTGAAGTCT TTAATTAAAGTTCACTGCCGTATAGGCAGCTAAGAAACCCGGG (SEQIDNO:15) Malat1triplehelix GATTCGTCAGTAGGGTTGTAAAGGTTTTTCTTTTCCTGAGAAA structure ACAACCTTTTGTTTTCTCAGGTTTTGCTTTTTGGCCTTTCCCTAG CTTTAAAAAAAAAAAAGCAAAA(SEQIDNO:1) Cys428nt GTTCACTGCCGTATAGGCAGCTAAGAAA recognitionsite (SEQIDNO:26) gRNAs whereNNNNNNNNNNNNNNNNNNNN isoneofthefollowing: gRNA1 GAGTCGCGTGTAGCGAAGCA(SEQIDNO:16) gRNA2 GTAAGTCGGAGTACTGTCCT(SEQIDNO:17) gRNA3 GTGTACTCTCTGAGGTGCTC(SEQIDNO:18) gRNA4 GACGCAGATAAGAACCAGTT(SEQIDNO:19) gRNA5 GCATCAAGTCAGCCATCAGC(SEQIDNO:20) gRNA6 GGAGTCACCCTCCTGGAAAC(SEQIDNO:21)
[0168] Each of the four gRNAs were designed to be expressed concomitantly with mKate2, each from a separate plasmid. Each set of four gRNAs was regulated by one of the following promoters (in descending order according to their activity level in HEK-293T cells): the Cytomegalovirus Immediate Early (CMVp), human Ubiquitin C (UbCp), human Histone H2A1 (H2A1p) (Rogakou et al., 1998), and human inflammatory chemokine CXCL1 (CXCL1p) promoters (Wang et al., 2006). As a control, the RNAP III promoter U6 (U6p) was used to drive expression of the four gRNAs. For each promoter tested, four plasmids encoding the four different gRNAs were co-transfected along with plasmids expressing taCas9 and Csy4. As a negative control, the IL1RN-targeting gRNA expression plasmids were substituted with plasmids that expressed gRNA1, which was non-specific for the IL1RN promoter (
[0169] qRT-PCR was used to quantify the mRNA levels of the endogenous IL1RN gene, with the results normalized to the negative control. With the four gRNAs regulated by the U6 promoter, IL1RN activation levels were increased by 8,410-fold in the absence of Csy4 and 6,476-fold with 100 ng of the Csy4-expressing plasmid over the negative control (
[0170] To further characterize the input-output transfer function of endogenous gene regulation, mKate2 fluorescence generated by each promoter was used as a marker of input promoter activity for the various RNAP II promoters (
Example 3
Functional gRNA Generation from Introns with Csy4
[0171] As a complement to the triplex/Csy4 configuration, an alternative strategy was developed for generating functional gRNAs from RNAP II promoters by encoding a gRNA within an intron in the coding sequence of a gene. Specifically, gRNA1 was encoded as an intron within the coding sequence of mKate2 (
[0172] As an alternative strategy, intronic gRNAs were stabilized by flanking the gRNA cassette with two Csy4 recognition sites. Without being bound by theory, spliced gRNA-containing introns should be bound by Csy4, which should release functional gRNAs. In contrast to the triplex/Csy4 setting, Csy4 can also potentially bind and digest the pre-mRNA before splicing occurs. In this case, functional gRNA would be produced, but the mKate-containing pre-mRNA would be destroyed in the process (
[0173] The presence of Csy4 generated functional gRNA1, as determined by EYFP activation (
Example 4
Interactions Between Csy4 and Intronic gRNA
[0174] To determine whether both of the 5 and 3 Csy4 recognition sites are necessary for functional gRNA generation from introns, an HSV1-based intron was used within mKate2. This intron housed a gRNA1 sequence that was either preceded by a Csy4 binding site on its 5 side (28-gRNA,
[0175] In contrast, downstream EYFP activation by the gRNA1-directed CRISPR-TF was significantly lower for the single Csy4-binding-site configurations (
Example 5
Functional gRNA Generation with Cis-Acting Ribozymes
[0176] In addition to the triplex/Csy4 and intron/Csy4-based mechanisms described above, self-cleaving ribozymes were also employed to enable gene regulation in human cells via gRNAs generated from RNAP II promoters. Specifically, the gRNAs were engineered to contain a hammerhead (HH) ribozyme (Pley et al., 1994) on their 5 end and a HDV ribozyme (Ferre-D'Amare et al., 1998) on their 3 end, as shown in
[0177] All the constructs that contained mKate2 exhibited detectable mKate2 fluorescence levels (
[0178] Cis-acting ribozymes are useful and can mediate functional gRNA expression from RNAP II promoters. Ribozymes with activities that can be regulated with external ligands, such as theophylline, could also be used to trigger gRNA release exogenously. However, such strategies cannot link intracellular ribozyme activity to endogenous signals generated within single cells. In contrast, as shown below, the expression of genetically encoded Csy4 can be used to rewire RNA-directed genetic circuits and change their behavior (
Example 6
Multiplexed gRNA Expression from Single RNA Transcripts
[0179] To demonstrate the expression of two independent gRNAs from a single RNA transcript to activate two independent downstream promoters, two configurations were used. In the first configuration (intron-triplex), gRNA1 was encoded within an HSV1 intron flanked by two Csy4 binding sites within the coding sequence of mKate2. Further, gRNA2 enclosed by two Csy4 binding sites was encoded downstream of the mKate2-triplex sequence (
[0180] As shown in
[0181] To further explore the scalability of the multiplexing constructs and to demonstrate its utility in targeting endogenous loci, four different gRNAs species were generated from a single transcript. The four gRNAs required for IL1RN activation were cloned in tandem, separated by Csy4 binding sites, downstream of an mKate2-triplex sequence on a single transcript (
Example 7
Synthetic Transcriptional Cascades with RNA-Guided Regulation
[0182] To demonstrate the utility of the RNA-dependent regulatory constructs, it was used herein to create the first CRISPR-TF-based transcriptional cascades. The triplex/Csy4 and intron/Csy4 strategies were integrated to build two different three-stage CRISPR-TF-mediated transcriptional cascades (
[0183] In the first cascade design, a 76-fold increase in EYFP and a 13-fold increase in ECFP were observed compared to a control in which the second stage of the cascade (P1-EYFP-Tr-28-g2-28) was replaced by an empty plasmid (
Example 8
Rewiring RNA-Dependent Synthetic Regulatory Circuits
[0184] The following experiments sought to demonstrate how CRISPR-TF regulation can be integrated with mammalian RNA interference to implement more sophisticated circuit topologies. Furthermore, the following experiments showed how network motifs could be rewired based on Csy4-based RNA processing. Specifically, miRNA regulation was incorporated with CRISPR-TFs and used Csy4 to disrupt miRNA inhibition of target RNAs by removing cognate miRNA binding sites. A single RNA transcript was built, which was capable of expressing both a functional miRNA (Greber et al., 2008; Xie et al., 2011) and a functional gRNA. This was achieved by encoding a mammalian miRNA inside the consensus intron within the mKate2 gene, followed by a triplex sequence and a gRNA1 sequence flanked by Csy4 recognition sites (
[0185] In the absence of Csy4, ECFP and EYFP levels were low because the miRNA suppressed ECFP expression and no functional gRNA1 was generated (
[0186] To demonstrate the facile nature by which additional circuit topologies can be programmed using RNA-dependent mechanisms, the design in
[0187] Synthetic biology provides tools for studying natural regulatory networks by disrupting, rewiring, and mimicking natural network motifs. In addition, synthetic circuits can used to link exogenous signals to endogenous gene regulation to address biomedical applications and to perform cellular computation. Although many synthetic gene circuits are based on transcriptional regulation, RNA-based regulation can be used to construct a variety of synthetic gene circuits. Despite many advances, previous efforts have not yet integrated RNA-based regulation with CRISPR-TFs, which are both promising strategies for implementing scalable genetic circuits given their programmability and potential for multiplexing. Provided herein are constructs for engineering artificial gene circuits and endogenous gene regulation in human cells. This framework integrates mammalian RNA regulatory mechanisms with the RNA-dependent protein, dCas9, and the RNA-processing protein, Csy4, from bacteria. Moreover, it enables convenient programming of regulatory links based on base-pairing complementary between nucleic acids.
[0188] Provided herein, in some embodiments, are multiple complementary approaches to generate functional gRNAs from the coding sequence of proteins regulated by RNAP II promoters, which also permit concomitant expression of the protein of interest. The genes used were fluorescent genes because they are convenient reporters of promoter activity. However, these genes can be readily exchanged with any other protein-coding sequence, thus enabling multiplexed expression of gRNAs along with arbitrary protein outputs from a single construct. The ability of these strategies was validated, based on RNA triplexes with Csy4, RNA introns with Csy4, and cis-acting ribozymes, to generate functional gRNAs by targeting synthetic promoters. Furthermore, when gRNAs were flanked by Csy4 recognition sites and located downstream of a gene followed by an RNA triplex, the levels of the gene increased with the levels of Csy4. The opposite effect was found when gRNAs were flanked by Csy4 recognition sites within introns, with the magnitude of the effect varying depending on the specific intronic sequence used. Thus, these complementary configurations enable tunable RNA and protein levels to be achieved within synthetic gene circuits.
[0189] As a complement to synthetic circuits, engineered constructs of the present disclosure can be used, in some embodiments, to activate endogenous promoters from multiple different human RNAP II promoters, as well as the CMV promoter. Provided herein, in some embodiments, are novel strategies for multiplexed gRNA expression from compact single transcripts to modulate both synthetic and native promoters. This feature is useful because, for example, it can be used to regulate multiple nodes from a single one. The ability to concisely encode multiple gRNAs within a single transcript enables sophisticated circuits with a large number of parallel fan-outs (e.g., outgoing interconnections from a given node) and networks with dense interconnections. Moreover, the ability to synergistically modulate endogenous loci with several gRNAs in a condensed fashion is advantageous, for example, because multiple gRNAs are often needed to enact substantial modulation of native promoters. Thus, the engineered constructs described herein can be used, in some instances, to build efficient artificial gene networks and to perturb native regulatory networks.
[0190] In addition to transcriptional regulation, a nuclease-proficient Cas9 may be used instead of taCas9, in some embodiments, to conditionally link multiplexed genome-editing activity to cellular signals via regulation of gRNA expression. This enables conditional, multiplexed knockouts within in vivo settingsfor example, with cell-specific, temporal, or spatial control. In addition to genetic studies, this capability can be used, in some embodiments, to create in vivo DNA-based ticker tapes that link cellular events to mutations.
[0191] These configurations lay down a foundation, in some embodiments, for the construction of sophisticated and compact synthetic gene circuits in human cells. Without being bound by theory, because the specificity of regulatory interconnections with the engineered constructs is determined only by RNA sequences, scalable circuits with almost any network topology can be constructed. For example, multi-layer network topologies are important for achieving sophisticated behaviors, both in artificial and natural genetic contexts. Thus, to demonstrate the utility of the present constructs for implementing more complex synthetic circuits, they was used to create the first CRISPR-TF-based transcriptional cascades which were highly specific and effective. Demonstrated by the examples provided herein are reliable three-step transcriptional cascades with two different configurations that incorporated RNA triplexes, introns, Csy4 and CRISPR-TFs. The absence of undesired crosstalk between different stages of the cascade underscores the orthogonality and scalability of RNA-dependent regulatory schemes for synthetic gene circuit design. Combining multiplexed gRNA expression with transcriptional cascades can be used, in some instances to create multi-stage, multi-input/multi-output gene networks capable of logic, computing, and interfacing with endogenous systems. In addition, useful topologies, such as multi-stage feedforward and feedback loops, can be readily programmed, in some embodiments.
[0192] Furthermore, RNA regulatory parts, such as CRISPR-TFs and RNA interference, were integrated together to create various circuit topologies that can be rewired via conditional RNA processing. Because both positive and negative regulation is possible with the same taCas9 protein and miRNAs enact tunable negative regulation, many important multi-component network topologies can be implemented using this set of regulatory parts. In addition, Csy4 can be used, for example, to catalyze changes in gene expression by modifying RNA transcripts. For example, functional gRNAs were liberated for transcriptional modulation and miRNA binding sites were removed from RNA transcripts to eliminate miRNA-based links. In addition, the absence or presence of Csy4 was used to switch a miRNA-based autoregulatory negative feedback loop on and off, respectively (
[0193] In summary, the present disclosure provides a diverse set of constructs for building scalable regulatory gene circuits, tuning them, modifying connections between circuit components, and synchronizing the expression of multiple genes in a network. Furthermore, these regulatory parts can be used, in some embodiments, to interface synthetic gene circuits with endogenous systems as well as to rewire endogenous networks. Integrating RNA-dependent regulatory mechanisms with RNA processing will enable sophisticated transcriptional and post-transcriptional regulation, accelerate synthetic biology, and facilitate the study of basic biology in human cells.
Plasmid Construction
[0194] The CMVp-dCas9-3NLS-VP64 (taCas9, Construct 1, Table 2) plasmid was built as described previously (Farzadfard et al., 2013). The csy4 gene from Pseudomonas aeruginosa strain UCBPP-PA14 (Qi et al., 2012), was codon optimized for expression in human cells, PCR amplified to contain an N-terminal 6x-His tag and a TEV recognition sequence, and cloned downstream of the PGK1 promoter between HindIII/SacI sites in the PGK1-EBFP2 plasmid (Farzadfard et al., 2013) to create PGK1p-Csy4-pA (Construct 2, Table 2).
TABLE-US-00002 TABLE 2 Construct names, designs, and abbreviations Construct 1 CMVp-dCas9-3xNLS-VP64-3LTR Abbreviation taCas9 Construct 2 PGK1p-Csy4-pA Abbreviation Csy4 Construct 3 CMVp-mKate2-Triplex-28-gRNA1-28-pA Abbreviation CMVp-mK-Tr-28-g1-28 Construct 4 CMVp-mKate2_EX1-[28-gRNA1-28].sub.HSV1-mKate2_EX2-pA Abbreviation CMVp-mK.sub.EX1-[28-g1-28].sub.HSV1-mK.sub.EX2 Construct 5 P1-EYFP-pA Abbreviation P1-EYFP Construct 6 P2-ECFP-pA Abbreviation P2-ECFP Construct 7 U6p-gRNA1-TTTTT Abbreviation U6p-g1 Construct 8 CMVp-mKate2_EX1-[28-gRNA1-28].sub.consensus-mKate2_EX2-pA Abbreviation CMVp-mK.sub.EX1-[28-g1-28].sub.cons-mK.sub.EX2 Construct 9 CMVp-mKate2_EX1-[28-gRNA1-28].sub.snoRNA2-mKate2_EX2-pA Abbreviation CMVp-mK.sub.Ex1-[28-g1-28].sub.sno-mK.sub.Ex2 Construct 10 CMVp-mKate2_EX1-[28-gRNA1].sub.HSV1-mKate2_EX2-pA Abbreviation CMVp-mK.sub.EX1-[28-g1].sub.HSV1-mK.sub.EX2 Construct 11 CMVp-mKate2_EX1-[gRNA1-28].sub.HSV1-mKate2_EX2-pA Abbreviation CMVp-mK.sub.EX1-[g1-28].sub.HSV1-mK.sub.EX2 Construct 12 CMVp-mKate2_exon1-[gRNA1].sub.consensus-mKate2_EX2-pA Abbreviation CMVp-mK.sub.EX1-[g1].sub.cons-mK.sub.EX2 Construct 13 CMVp-mKate2-Triplex-HHRibo-gRNA1-HDVRibo-pA Abbreviation CMVp-mK-Tr-HH-g1-HDV Construct 14 CMVp-mKate2-HHRibo-gRNA1-HDVRibo-pA Abbreviation CMVp-mK-HH-g1-HDV Construct 15 CMVp-HHRibo-gRNA1-HDVRibo-pA Abbreviation CMVp-HH-g1-HDV Construct 16 CMVp-mKate2_EX1-[28-gRNA1-28].sub.HSV1-mKate2_EX2-Triplex-28- gRNA2-28-pA Abbreviation CMVp-mK.sub.EX1-[28-g1-28].sub.HSV1-mK.sub.EX2-Tr-28-g2-28 Construct 17 CMVp-mKate2-Triplex-28-gRNA1-28-gRNA2-28-pA Abbreviation CMVp-mK-Tr-28-g1-28-g2-28 Construct 18 P1-EYFP-Triplex-28-gRNA2-28-pA Abbreviation P1-EYFP-Tr-28-g2-28 Construct 19 CMVp-mKate2-Triplex-28-gRNA3-28-gRNA4-28-gRNA5-28-gRNA6- 28-pA Abbreviation CMVp-mK-Tr-(28-g-28).sub.3-6 Construct 20 CMVp-mKate2_EX1-[miRNA]-mKate2_EX2-Triplex-28-gRNA1-28-pA Abbreviation CMVp-mK.sub.EX1-[miR]-mK.sub.EX2-Tr-28-g1-28 Construct 21 CMVp-mKate2_EX1-[miRNA]-mKate2_EX2-Triplex-28-gRNA1-28- 4xFF4BS-pA Abbreviation CMVp-mK.sub.EX1-[miR]-mK.sub.EX2-Tr-28-g1-28-miR.sub.4xBS Construct 22 CMVp-ECFP-Triplex-28-8xmiRNA-BS-28-pA Abbreviation CMVp-ECFP-Tr-28-miR.sub.8xBS-28 Construct 23 CMVp-mKate2_Triplex-28-gRNA3-28 Abbreviation CMVp-mK-28-Tr-28-g3-28 Construct 24 CMVp-mKate2_Triplex-28-gRNA4-28 Abbreviation CMVp-mK-28-Tr-28-g4-28 Construct 25 CMVp-mKate2_Triplex-28-gRNA5-28 Abbreviation CMVp-mK-28-Tr-28-g5-28 Construct 26 CMVp-mKate2_Triplex-28-gRNA6-28 Abbreviation CMVp-mK-28-Tr-28-g6-28
[0195] The plasmid CMVp-mKate2-Triplex-28-gRNA1-28-pA (Construct 3, Table 2) was built using GIBSON ASSEMBLY from three parts amplified with appropriate homology overhangs: 1) the full length coding sequence of mKate2; 2) the first 110 base pair (bp) of the mouse MALAT1 3 triple helix (Wilusz et al., 2012); and 3) gRNA1 containing a 20 bp Specificity Determining Sequence (SDS) and a S. pyogenes gRNA scaffold along with 28 nucleotide (nt) Csy4 recognition sites.
[0196] The reporter plasmids P1-EFYP-pA (Construct 5, Table 2) and P2-ECFP-pA (Construct 6, Table 2) were built by cloning in eight repeats of gRNA1 binding sites and eight repeats of gRNA2 binding sites into the NheI site of pG5-Luc (Promega) via annealing complementary oligonucleotides. Then, EYFP and ECFP were cloned into the NcoI/FseI sites, respectively.
[0197] The plasmid CMVp-mKate2_EX1-[28-gRNA1-28].sub.HSV1-mKate2_EX2-pA (Construct 4, Table 2) was built by GIBSON ASSEMBLY of the following parts with appropriate homology overhangs: 1) the mKate2_EX1 (a.a. 1-90) of mKate2; 2) mKate_EX2 (a.a. 91-239) of mKate2; and 3) gRNA1 containing a 20 bp SDS followed by the S. pyogenes gRNA scaffold flanked by Csy4 recognition sites and the HSV1 acceptor, donor and branching sequences. Variations of the CMVp-mKate2_EX1-[28-gRNA1-28].sub.HSV1-mKate2_EX2-pA plasmid containing consensus and SnoRNA2 acceptor, donor, and branching sequences and with and without the Csy4 recognition sequences (Constructs 8-12, Table 2) were built in a similar fashion.
[0198] The ribozyme-expressing plasmids CMVp-mKate2-Triplex-HHRibo-gRNA1-HDVRibo-pA and CMVp-mKate2-HHRibo-gRNA1-HDVRibo-pA plasmids (Constructs 13 and 14, respectively, Table 2) were built by GIBSON ASSEMBLY of XmaI-digested CMVp-mKate2, and PCR-extended amplicons of gRNA1 (with and without the triplex and containing HHRibo (Gao and Zhao, 2014) on the 5 end and HDVRibo (Gao and Zhao, 2014) on the 3 end). The plasmid CMVp-HHRibo-gRNA1-HDVRibo-pA (Construct 15, Table 2) was built similarly by GIBSON ASSEMBLY of SacI-digested CMVp-mKate2 and a PCR-extended amplicon of gRNA1 containing HHRibo on the 5 end and HDVRibo on the 3 end. The plasmid CMVp-mKate2_EX1-[28-gRNA1-28].sub.HSV1-mKate2_EX2-Triplex-28-gRNA2-28-pA (Construct 16, Table 2) was built by GIBSON ASSEMBLY of the following parts using appropriate homologies: 1) XmaI-digested CMVp-mKate2_EX1-[28-gRNA1-28].sub.HSV1-mKate2_EX2-pA (Construct 4, Table 2) and 2) PCR amplified Triplex-28-gRNA2-28 from CMVp-mKate2-Triplex-28-gRNA1-28-pA (Construct 3, Table 2).
[0199] The plasmid CMVp-mKate2-Triplex-28-gRNA1-28-gRNA2-28-pA (Construct 17, Table 2) was built by GIBSON ASSEMBLY with the following parts using appropriate homologies: 1) XmaI-digested CMVp-mKate2-Triplex-28-gRNA1-28-pA (Construct 3, Table 2) and 2) PCR amplified 28-gRNA2-28.
[0200] The plasmid CMVp-mKate2-Triplex-28-gRNA3-28-gRNA4-28-gRNA5-28-gRNA6-28-pA (Construct 19, Table 2) was constructed using a Golden Gate approach using the Type IIs restriction enzyme, BsaI. Specifically, the IL1RN targeting gRNA3, gRNA4, gRNA5, gRNA6 sequences containing the 20 bp SDSs along with the S. pyogenes gRNA scaffold were PCR amplified to contain a BsaI restriction site on their 5 ends and Csy4 28 and BsaI restriction sites on their 3 ends. The PCR amplified products were subjected to 30 alternating cycles of digestion followed by ligation at 37 C. and 20 C., respectively. A 540 bp PCR product containing the gRNA3-28-gRNA4-28-gRNA5-28-gRNA6-28 array was amplified and digested with NheI/XmaI and cloned into the CMVp-mKate2-Triplex-28-gRNA1-28-pA plasmid (Construct 3, Table 2).
[0201] The CMVp-mKate2_EX1-[miRNA]-mKate2_EX2-pA plasmid containing an intronic FF4 (a synthetic miRNA) was received as a gift from Lila Wroblewska. The synthetic FF4 miRNA was cloned into an intron with consensus acceptor, donor and branching sequences between a.a. 90 and 91 of mKate2 to create CMVp-mKate2_EX1-[miRNA]-mKate2_EX2-Triplex-28-gRNA1-28-pA (Construct 20, Table 2) and CMVp-mKate2_EX1-[miRNA]-mKate2_EX2-Triplex-28-gRNA1-28-4FF4BS-pA (Construct 21, Table 2).
[0202] The plasmid CMVp-ECFP-Triplex-28-8miRNA-BS-28-pA (Construct 22, Table 2) was cloned via GIBSON ASSEMBLY with the following parts: 1) full length coding sequence of ECFP and 2) 110 nt of the MALAT1 3 triple helix sequence amplified via PCR extension with oligonucleotides containing eight FF4 miRNA binding sites and Csy4 recognition sequences on both ends.
Cell Culture and Transfections
[0203] HEK293T cells were obtained from the American Tissue Collection Center (ATCC) and were maintained in Dulbecco's Modified Eagle Medium (DMEM) supplemented with 10% fetal bovine serum (FBS), 1% penicillin-streptomycin, 1% GlutaMAX, non-essential amino acids at 37 C. with 5% CO.sub.2. HEK293T cells were transfected with FuGENEHD Transfection Reagent (Promega) according to the manufacturer's instructions. Each transfection was made using 200,000 cells/well in a 6-well plate. As a control, with 2 g of a single plasmid in which a CMV promoter regulated mKate2, transfection efficiencies were routinely higher than 90% (determined by flow cytometry performed with the same settings as the experiments). Unless otherwise indicated, each plasmid was transfected at 1 g/sample. All samples were transfected with taCas9, unless specifically indicated. Cells were processed for flow cytometry or qRT-PCR analysis 72 hours after transfection.
Quantitative Reverse TranscriptionPCR (RT-PCR)
[0204] The experimental procedure followed was as described in (Perez-Pinera et al., 2013a). Cells were harvested 72 hour post-transfection. Total RNA was isolated using the RNeasy Plus RNA isolation kit (Qiagen). cDNA synthesis was performed using the qScript cDNA SuperMix (Quanta Biosciences). Real-time PCR using PerfeCTa SYBR Green FastMix (Quanta Biosciences) was performed with the Mastercycler ep realplex real-time PCR system (Eppendorf) with following oligonucleotide primers: IL1RNforward GGAATCCATGGAGGGAAGAT (SEQ ID NO: 22), reverse TGTTCTCGCTCAGGTCAGTG (SEQ ID NO: 23); GAPDHforward CAATGACCCCTTCATTGACC (SEQ ID NO: 24), reverse TTGATTTTGGAGGGATCTCG (SEQ ID NO: 25). The primers were designed using Primer3Plus software and purchased from IDT. Primer specificity was confirmed by melting curve analysis. Reaction efficiencies over the appropriate dynamic range were calculated to ensure linearity of the standard curve. Fold-increases in the mRNA expression of the gene of interest normalized to GAPDH expression were calculated by the ddCt method. We then normalized the mRNA levels to the non-specific gRNA1 control condition. Reported values are the means of three independent biological replicates with technical duplicates that were averaged for each experiment. Error bars represent standard error of the mean (s.e.m).
Flow Cytometry
[0205] Cells were harvested with trypsin 72 hours post-transfection, washed with DMEM media and 1PBS, re-suspended with 1PBS into flow cytometry tubes and immediately assayed with a Becton Dickinson LSRII Fortessa flow cytometer. At least 50,000 cells were recorded per sample in each data set. The results of each experiment represent data from at least three biological replicates. Error bars are s.e.m. on the weighted median fluorescence values (see Extended Experimental Procedures for detailed information about data analysis).
Compensation Controls
[0206] Compensation controls were strict and designed to remove false-positive cells even at the cost of removing true-positive cells. Compensation was done with BD FACSDiva (version no. 6.1.3; BD Biosciences) as detailed below:
TABLE-US-00003 TABLE 3 Compensation setup for flow cytometry Fluorochrome -% Fluorochrome Spectral Overlap PE-Tx-Red-YG FITC 0% Pacific Blue FITC 0.2% FITC PE-Tx-Red-YG 21.1% Pacific Blue PE-Tx-Red-YG 1% FITC Pacific Blue 7.5%
Flow Cytometry Analysis
[0207] Compensated flow cytometry results were analyzed using FlowJo software (vX.0.7r2). Calculations were performed as described below:
[0208] All samples were gated to exclude cell clumps and debris (population P1) Histograms of P1 cells were analyzed according to the following gates, which were determined according to the auto-fluorescence of non-transfected cells in the same acquisition conditions such that the proportion of false-positive cells would be lower than 0.1%:
[0209] mKate2: mKate2 positive cells were defined as cells above a fluorescence threshold of 100 a.u.
[0210] EYFP: EYFP positive cells were defined as cells above a fluorescence threshold of 300 a.u.
[0211] ECFP: ECFP positive cells were defined as cells above a fluorescence threshold of 400 a.u.
[0212] The percent of positive cells (% positive) and the median fluorescence for each positive cell population were calculated. The % positive cells was multiplied by the median fluorescence, resulting in a weighted median fluorescence expression level that correlated fluorescence intensity with cell numbers. This measurement strategy is consistent with several previous studies (Auslander et al., 2012; Xie et al., 2011).
[0213] The weighted median fluorescence was determined for each sample. The mean of the weighted median fluorescence of biological triplicates was calculated. These are the data presented in the paper. The standard error of the mean (s.e.m.) was also computed and presented as error bars.
[0214] To facilitate comparisons between various constructs and to account for variations in the brightness of different fluorescent proteins, the weighted median fluorescence for each experimental condition was divided by the maximum weighted median fluorescence for the same fluorophore among all conditions tested in the same set of experiments.
[0215] Flow cytometry data plots shown in the Supplemental information are representative compensated data from a single experiment. As noted above, cells were gated to exclude cell clumps and debris (population P1), and the entire gated population of viable cells are presented in each figure. The threshold for each sub-population Q1-Q4 was set according to the thresholds described above. The percentage of cells in each sub-population is indicated in the plots. Black crosses in the plots indicate the median fluorescence for a specific sub-population.
[0216] While several inventive embodiments have been described and illustrated herein, those of ordinary skill in the art will readily envision a variety of other means and/or structures for performing the function and/or obtaining the results and/or one or more of the advantages described herein, and each of such variations and/or modifications is deemed to be within the scope of the inventive embodiments described herein. More generally, those skilled in the art will readily appreciate that all parameters, dimensions, materials, and configurations described herein are meant to be exemplary and that the actual parameters, dimensions, materials, and/or configurations will depend upon the specific application or applications for which the inventive teachings is/are used. Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific inventive embodiments described herein. It is, therefore, to be understood that the foregoing embodiments are presented by way of example only and that, within the scope of the appended claims and equivalents thereto, inventive embodiments may be practiced otherwise than as specifically described and claimed. Inventive embodiments of the present disclosure are directed to each individual feature, system, article, material, kit, and/or method described herein. In addition, any combination of two or more such features, systems, articles, materials, kits, and/or methods, if such features, systems, articles, materials, kits, and/or methods are not mutually inconsistent, is included within the inventive scope of the present disclosure.
[0217] All definitions, as defined and used herein, should be understood to control over dictionary definitions, definitions in documents incorporated by reference, and/or ordinary meanings of the defined terms.
[0218] The indefinite articles a and an, as used herein in the specification and in the claims, unless clearly indicated to the contrary, should be understood to mean at least one.
[0219] The phrase and/or, as used herein in the specification and in the claims, should be understood to mean either or both of the elements so conjoined, i.e., elements that are conjunctively present in some cases and disjunctively present in other cases. Multiple elements listed with and/or should be construed in the same fashion, i.e., one or more of the elements so conjoined. Other elements may optionally be present other than the elements specifically identified by the and/or clause, whether related or unrelated to those elements specifically identified. Thus, as a non-limiting example, a reference to A and/or B, when used in conjunction with open-ended language such as comprising can refer, in one embodiment, to A only (optionally including elements other than B); in another embodiment, to B only (optionally including elements other than A); in yet another embodiment, to both A and B (optionally including other elements); etc.
[0220] As used herein in the specification and in the claims, or should be understood to have the same meaning as and/or as defined above. For example, when separating items in a list, or or and/or shall be interpreted as being inclusive, i.e., the inclusion of at least one, but also including more than one, of a number or list of elements, and, optionally, additional unlisted items. Only terms clearly indicated to the contrary, such as only one of or exactly one of, or, when used in the claims, consisting of, will refer to the inclusion of exactly one element of a number or list of elements. In general, the term or as used herein shall only be interpreted as indicating exclusive alternatives (i.e. one or the other but not both) when preceded by terms of exclusivity, such as either, one of, only one of, or exactly one of. Consisting essentially of, when used in the claims, shall have its ordinary meaning as used in the field of patent law.
[0221] As used herein in the specification and in the claims, the phrase at least one, in reference to a list of one or more elements, should be understood to mean at least one element selected from any one or more of the elements in the list of elements, but not necessarily including at least one of each and every element specifically listed within the list of elements and not excluding any combinations of elements in the list of elements. This definition also allows that elements may optionally be present other than the elements specifically identified within the list of elements to which the phrase at least one refers, whether related or unrelated to those elements specifically identified. Thus, as a non-limiting example, at least one of A and B (or, equivalently, at least one of A or B, or, equivalently at least one of A and/or B) can refer, in one embodiment, to at least one, optionally including more than one, A, with no B present (and optionally including elements other than B); in another embodiment, to at least one, optionally including more than one, B, with no A present (and optionally including elements other than A); in yet another embodiment, to at least one, optionally including more than one, A, and at least one, optionally including more than one, B (and optionally including other elements); etc.
[0222] It should also be understood that, unless clearly indicated to the contrary, in any methods claimed herein that include more than one step or act, the order of the steps or acts of the method is not necessarily limited to the order in which the steps or acts of the method are recited.
[0223] All references, patents and patent applications disclosed herein are incorporated by reference with respect to the subject matter for which each is cited, which in some cases may encompass the entirety of the document.
[0224] In the claims, as well as in the specification above, all transitional phrases such as comprising, including, carrying, having, containing, involving, holding, composed of, and the like are to be understood to be open-ended, i.e., to mean including but not limited to. Only the transitional phrases consisting of and consisting essentially of shall be closed or semi-closed transitional phrases, respectively, as set forth in the United States Patent Office Manual of Patent Examining Procedures, Section 2111.03.
REFERENCES
[0225] (Each reference below is incorporated by reference herein.) [0226] Alon, U. (2007). Network motifs: theory and experimental approaches. Nat Rev Genet 8, 450-461. [0227] Audibert, A., Weil, D., and Dautry, F. (2002). In vivo kinetics of mRNA splicing and transport in mammalian cells. Mol Cell Biol 22, 6706-6718. [0228] Auslander, S., Auslander, D., Muller, M., Wieland, M., and Fussenegger, M. (2012). Programmable single-cell mammalian biocomputers. Nature 487, 123-127. [0229] Babiskin, A. H., and Smolke, C. D. (2011). A synthetic library of RNA control modules for predictable tuning of gene expression in yeast. Molecular systems biology 7, 471. [0230] Barrangou, R., and van der Oost, J. (2013). RNA-mediated Adaptive Immunity in Bacteria and Archaea (Springer). [0231] Bashor, C. J., Helman, N. C., Yan, S., and Lim, W. A. (2008). Using engineered scaffold interactions to reshape MAP kinase pathway signaling dynamics. Science 319, 1539-1543. [0232] Beck, J., and Nassal, M. (1995). Efficient hammerhead ribozyme-mediated cleavage of the structured hepatitis B virus encapsidation signal in vitro and in cell extracts, but not in intact cells. Nucleic Acids Research 23, 4954-4962. [0233] Beerli, R. R., and Barbas, C. F., 3rd (2002). Engineering polydactyl zinc-finger transcriptionfactors. Nat Biotechnol 20, 135-141. Benenson, Y. (2012). Biomolecular computing systems: principles, progress and potential. NatRev Genet 13, 455-468. [0234] Block, T M., and Hill, J. M. (1997). The latency associated transcripts (LAT) of herpes simplexvirus: still no end in sight. J Neurovirol 3, 313-321. [0235] Blount, B. A., Weenink, T., Vasylechko, S., and Ellis, T. (2012). Rational diversification of a promoter providing fine-tuned expression and orthogonal regulation for synthetic biology. PLoSOne 7, e33279. [0236] Chen, M., and Manley, J. L. (2009). Mechanisms of alternative splicing regulation: insights from molecular and genomics approaches. Nature reviews Molecular cell biology 10, 741-754. [0237] Chen, Y. Y., Jensen, M. C., and Smolke, C. D. (2010). Genetic control of mammalian T-cell proliferation with synthetic RNA regulatory systems. Proceedings of the National Academy of Sciences of the United States of America 107, 8531-8536. [0238] Cheng, A. W., Wang, H., Yang, H., Shi, L., Katz, Y., Theunissen, T. W., Rangarajan, S., Shivalila, C. S., Dadon, D. B., and Jaenisch, R. (2013). Multiplexed activation of endogenous genes by CRISPR-on, an RNA-guided transcriptional activator system. Cell Res 23, 1163-1171. [0239] Chowrira, B. M., Pavco, P. A., and McSwiggen, I A. (1994). In vitro and in vivo comparison of hammerhead, hairpin, and hepatitis delta virus self-processing ribozyme cassettes. Journal of Biological Chemistry 269, 25856-25864. [0240] Clement, J. Q., Qian, L., Kaplinsky, N., and Wilkinson, M. F. (1999). The stability and fate of a spliced intron from vertebrate cells. Rna 5, 206-220. [0241] Cong, L., Ran, F. A., Cox, D., Lin, S., Barretto, R., Habib, N., Hsu, P. D., Wu, X., Jiang, W., Marraffini, L. A., et al. (2013). Multiplex Genome Engineering Using CRISPR/Cas Systems. Science 339, 819-823. [0242] Cronin, C. A., Gluba, W., and Scrable, H. (2001). The lac operator-repressor system is functional in the mouse. Genes & development 15, 1506-1517. [0243] Culler, S. J., Hoff, K. G., and Smolke, C. D. (2010). Reprogramming cellular behavior with RNA controllers responsive to endogenous proteins. Science 330, 1251-1255. [0244] Deans, T. L., Cantor, C. R., and Collins, J. J. (2007). A tunable genetic switch based on RNAi and repressor proteins for regulating gene expression in mammalian cells. Cell 130, 363-372. [0245] Delebecque, C. J., Lindner, A. B., Silver, P. A., and Aldaye, F. A. (2011). Organization of intracellular reactions with rationally designed RNA assemblies. Science 333, 470-474. [0246] Dequeant, M. L., and Pourquie, O. (2008). Segmental patterning of the vertebrate embryonic axis. Nat Rev Genet 9, 370-382. [0247] Ellefson, J. W., Meyer, A. J., Hughes, R. A., Cannon, J. R., Brodbelt, J. S., and Ellington, A. D. (2014). Directed evolution of genetic parts and circuits by compartmentalized partnered replication. Nat Biotech 32, 97-101. [0248] Ellis, T., Wang, X., and Collins, J. J. (2009). Diversity-based, model-guided construction of synthetic gene networks with predicted functions. Nat Biotechnol 27, 465-471. [0249] Elowitz, M., and Lim, W. A. (2010). Build life to understand it. Nature 468, 889-890. [0250] Esvelt, K. M., Carlson, J. C., and Liu, D. R. (2011). A system for the continuous directed evolution of biomolecules. Nature 472, 499-503. [0251] Esvelt, K. M., Mali, P., Braff, J. L., Moosburner, M., Yaung, S. J., and Church, G. M. (2013). Orthogonal Cas9 proteins for RNA-guided gene regulation and editing. Nature Methods 10, 1116-1121. [0252] Farzadfard, F., Perli, S. D., and Lu, T. K. (2013). Tunable and Multifunctional Eukaryotic Transcription Factors Based on CRISPR/Cas. ACS Synthetic Biology 2, 604-613. [0253] Feng, J., Bi, C., Clark, B. S., Mady, R., Shah, P., and Kohtz, J. D. (2006). The Evf-2 noncoding RNA is transcribed from the Dlx-5/6 ultraconserved region and functions as a Dlx-2 transcriptional coactivator. Genes & development 20, 1470-1484. [0254] Ferre-D'Amare, A. R., Zhou, K., and Doudna, J. A. (1998). Crystal structure of a hepatitis deltavirus ribozyme. Nature 395, 567-574. [0255] Fussenegger, M., Morris, R. P., Fux, C., Rimann, M., von Stockar, B., Thompson, C. J., and Bailey, J. E. (2000). Streptogramin-based gene regulation systems for mammalian cells. Naturebiotechnology 18, 1203-1208. [0256] Gao, Y., and Zhao, Y. (2014). Self-processing of ribozyme-flanked RNAs into guide RNAs in vitro and in vivo for CRISPR-mediated genome editing. Journal of Integrative Plant Biology, n/an/a. [0257] Gilbert, Luke A., Larson, Matthew H., Morsut, L., Liu, Z., Brar, Gloria A., Tones, Sandra E., Stern-Ginossar, N., Brandman, O., Whitehead, Evan H., Doudna, Jennifer A., et al. (2013). CRISPR-Mediated Modular RNA-Guided Regulation of Transcription in Eukaryotes. Cell 154, 442-451. [0258] Gossen, M., and Bujard, H. (1992). Tight control of gene expression in mammalian cells by tetracycline-responsive promoters. Proceedings of the National Academy of Sciences 89, 5547-5551. [0259] Greber, D., El-Baba, M. D., and Fussenegger, M. (2008). Intronically encoded siRNAs improve dynamic range of mammalian gene regulation systems and toggle switch. Nucleic Acids Res 36, e101. [0260] Guido, N. J., Wang, X., Adalsteinsson, D., McMillen, D., Hasty, J., Cantor, C. R., Elston, T. C., and Collins, J. J. (2006). A bottom-up approach to gene regulation. Nature 439, 856-860. [0261] Haurwitz, R. E., Sternberg, S. H., and Doudna, J. A. (2012). Csy4 relies on an unusual catalytic dyad to position and cleave CRISPR RNA. Embo j 31, 2824-2832. [0262] Hooshangi, S., Thiberge, S., and Weiss, R. (2005). Ultrasensitivity and noise propagation in a synthetic transcriptional cascade. Proc Natl Acad Sci USA 102, 3581-3586. [0263] Houseley, J., and Tollervey, D. (2009). The Many Pathways of RNA Degradation. Cell 136, 763-776. Jackson, R. J. (1993). Cytoplasmic regulation of mRNA function: The importance of the 3 untranslated region. Cell 74, 9-14. [0264] Jiang, W., Bikard, D., Cox, D., Zhang, F., and Marraffini, L. A. (2013). RNA-guided editing of bacterial genomes using CRISPR-Cas systems. Nat Biotech 31, 233-239. [0265] Jinek, M., Chylinski, K., Fonfara, I., Hauer, M., Doudna, J. A., and Charpentier, E. (2012). A Programmable Dual-RNA-Guided DNA Endonuclease in Adaptive Bacterial Immunity. Science 337, 816-821. [0266] Jinek, M., East, A., Cheng, A., Lin, S., Ma, E., and Doudna, J. (2013). RNA-programmed genome editing in human cells. eLife 2, e00471. [0267] Kampf, M. M., Engesser, R., Busacker, M., Homer, M., Karlsson, M., Zurbriggen, M. D., Fussenegger, M., Timmer, J., and Weber, W. (2012). Rewiring and dosing of systems modules as a design approach for synthetic mammalian signaling networks. Molecular bioSystems 8, 1824-1832. [0268] Kemmer, C., Fluri, D. A., Witschi, U., Passeraub, A., Gutzwiller, A., and Fussenegger, M. (2011). A designer network coordinating bovine artificial insemination by ovulation-triggered release of implanted sperms. Journal of controlled release: official journal of the Controlled Release Society 150, 23-29. [0269] Kemmer, C., Gitzinger, M., Daoud-El Baba, M., Djonov, V., Stelling, J., and Fussenegger, M. (2010). Self-sufficient control of urate homeostasis in mice by a synthetic circuit. Naturebiotechnology 28, 355-360. [0270] Kennedy, A. B., Liang, J. C., and Smolke, C. D. (2013). A versatile cis-blocking and transactivation strategy for ribozyme characterization. Nucleic acids research 41, e41. [0271] Khalil, A., Lu, T. K., Bashor, C., Ramirez, C., Pyenson, N., Joung, J. K., and Collins, J. J. (2012). A Synthetic Biology Framework for Programming Eukaryotic Transcription Functions. Cell 150, 647-658. [0272] Kim, Y.-K., and Kim, V. N. (2007). Processing of intronic microRNAs. The EMBO Journal 26, 775-783. [0273] Koizumi, M., Soukup, G. A., Kerr, J. N., and Breaker, R. R. (1999). Allosteric selection of ribozymes that respond to the second messengers cGMP and cAMP. Nature structural biology 6, 1062-1071. [0274] Kuwabara, T., Warashina, M., Tanabe, T., Tani, K., Asano, S., and Taira, K. (1998). A novel allosterically trans-activated ribozyme, the maxizyme, with exceptional specificity in vitro and invivo. Mol Cell 2, 617-627. [0275] Lee, J. T. (2012). Epigenetic Regulation by Long Noncoding RNAs. Science 14, 1435-1439. Levine, J. H., Fontes, M. E., Dworkin, J., and Elowitz, M. B. (2012). Pulsed feedback defers cellular differentiation. PLoS biology 10, e1001252. [0276] Lin, R., Maeda, S., Liu, C., Karin, M., and Edgington, T. S. (2006). A large noncoding RNA is a marker for murine hepatocellular carcinomas and a spectrum of human carcinomas. Oncogene 26, 851-858. [0277] Lohmueller, J. J., Armel, T. Z., and Silver, P. A. (2012). A tunable zinc finger-based framework for Boolean logic computation in mammalian cells. Nucleic Acids Research. [0278] Maeder, M. L., Linder, S. J., Cascio, V. M., Fu, Y., Ho, Q. H., and Joung, J. K. (2013a). CRISPRRNA-guided activation of endogenous human genes. Nat Methods 10, 977-979. [0279] Maeder, M. L., Linder, S. J., Reyon, D., Angstman, J. F., Fu, Y., Sander, J. D., and Joung, J. K. (2013b). Robust, synergistic regulation of human gene expression using TALE activators. NatMeth 10, 243-245. [0280] Maeder, M. L., Thibodeau-Beganny, S., Sander, J. D., Voytas, D. F., and Joung, J. K. (2009). Oligomerized pool engineering (OPEN): an open-source protocol for making customized zincfinger arrays. Nat Protocols 4, 1471-1501. [0281] Mali, P., Aach, J., Stranges, P. B., Esvelt, K. M., Moosburner, M., Kosuri, S., Yang, L., and Church, G. M. (2013a). CAS9 transcriptional activators for target specificity screening and paired nickases for cooperative genome engineering. Nat Biotechnol 31, 833-838. [0282] Mali, P., Yang, L., Esvelt, K. M., Aach, J., Guell, M., DiCarlo, J. E., Norville, J. E., and Church, G. M. (2013b). RNA-Guided Human Genome Engineering via Cas9. Science 339, 823-826. [0283] McMillen, D., Kopell, N., Hasty, J., and Collins, J. J. (2002). Synchronizing genetic relaxation oscillators by intercell signaling. Proceedings of the National Academy of Sciences 99, 679-684. [0284] Mercer, T. R., Dinger, M E., and Mattick, J. S. (2009). Long non-coding RNAs: insights into functions. Nat Rev Genet 10, 155-159. [0285] Muller, K., Engesser, R., Metzger, S., Schulz, S., Kampf, M. M., Busacker, M., Steinberg, T., Tomakidi, P., Ehrbar, M., Nagy, F., et al. (2013a). A red/far-red light-responsive bi-stable toggle switch to control gene expression in mammalian cells. Nucleic acids research 41, e77. [0286] Muller, K., Engesser, R., Schulz, S., Steinberg, T., Tomakidi, P., Weber, C. C., Ulm, R., Timmer, J., Zurbriggen, M. D., and Weber, W. (2013b). Multi-chromatic control of mammalian gene expression and signaling. Nucleic Acids Res 41, e124. [0287] Nagano, T., Mitchell, J. A., Sanz, L. A., Pauler, F. M., Ferguson-Smith, A. C., Feil, R., and Fraser, P. (2008). The Air Noncoding RNA Epigenetically Silences Transcription by Targeting G9a to Chromatin. Science 322, 1717-1720. [0288] Nagarajan, V. K., Jones, C. I., Newbury, S. F., and Green, P. J. (2013). XRN 5->3 exoribonucleases: Structure, mechanisms and functions. Biochimica et Biophysica Acta (BBA)-Gene Regulatory Mechanisms 1829, 590-603. [0289] Nissim, L., and Bar-Ziv, R. H. (2010). A tunable dual-promoter integrator for targeting of cancer cells. Mol Syst Biol 6, 444. [0290] Nissim, L., Beatus, T., and Bar-Ziv, R. (2007). An autonomous system for identifying and governing a cell's state in yeast. Physical biology 4, 154-163. [0291] Orioli, A., Pascali, C., Pagano, A., Teichmann, M., and Dieci, G. (2012). RNA polymerase III transcription control elements: Themes and variations. Gene 493, 185-194. [0292] Pandey, R. R., Mondal, T., Mohammad, F., Enroth, S., Redrup, L., Komorowski, J., Nagano, T., Mancini-DiNardo, D., and Kanduri, C. (2008). Kcnqlotl Antisense Noncoding RNA MediatesLineage-Specific Transcriptional Silencing through Chromatin-Level Regulation. Molecular Ce1132, 232-246. [0293] Park, S. H., Zarrinpar, A., and Lim, W. A. (2003). Rewiring MAP kinase pathways using alternative scaffold assembly mechanisms. Science 299, 1061-1064. [0294] Peel, A. D., Chipman, A. D., and Akam, M. (2005). Arthropod segmentation: beyond the Drosophila paradigm. Nat Rev Genet 6, 905-916. [0295] Perez-Pinera, P., Kocak, D. D., Vockley, C. M., Adler, A. F., Kabadi, A. M., Polstein, L. R., Thakore, P. I., Glass, K. A., Ousterout, D. G., Leong, K. W., et al. (2013a). RNA-guided gene activation byCRISPR-Cas9-based transcription factors. Nat Meth 10, 973-976. [0296] Perez-Pinera, P., Ousterout, D. G., Brunger, J. M., Farin, A. M., Glass, K. A., Guilak, F, Crawford, G. E., Hartemink, A. J., and Gersbach, C. A. (2013b). Synergistic and tunable human geneactivation by combinations of synthetic transcription factors. Nat Meth 10, 239-242. [0297] Pley, H. W., Flaherty, K. M., and McKay, D. B. (1994). Three-dimensional structure of a hammerhead ribozyme. Nature 372, 68-74. Proudfoot, N. J. (2011). Ending the message: poly(A) signals then and now. Genes and Development 25, 1770-1782. [0298] Qi, L., Haurwitz, R. E., Shao, W., Doudna, J. A., and Arkin, A. P. (2012). RNA processing enables predictable programming of gene expression. Nat Biotech 30, 1002-1006. [0299] R Hormes, M. H., I Oelze, P Marschall, M Tabler, F Eckstein, and G Sczakiel (1997). The subcellular localization and length of hammerhead ribozymes determine efficacy in human cells. Nucleic Acids Research 25, 769-775. [0300] Reyon, D., Tsai, S. Q., Khayter, C., Foden, J. A., Sander, J. D., and Joking, J. K. (2012). FLASH assembly of TALENs for high-throughput genome editing. Nat Biotech 30, 460-465. [0301] Rinaudo, K., Bleris, L., Maddamsetti, R., Subramanian, S., Weiss, R., and Benenson, Y. (2007). A universal RNAi-based logic evaluator that operates in mammalian cells. Nat Biotechnol 25, 795-801. [0302] Rinn, J. L., Kertesz, M., Wang, J. K., Squazzo, S. L., Xu, X., Brugmann, S. A., Goodnough, L. H., Helms, J. A., Farnham, P. J., Segal, E., et al. (2007). Functional Demarcation of Active and Silent Chromatin Domains in Human HOX Loci by Noncoding RNAs. Cell 129, 1311-1323. [0303] Rogakou, E. P., Pilch, D. R., On, A. H., Ivanova, V. S., and Bonner, W. M. (1998). DNA doublestranded breaks induce histone H2AX phosphorylation on serine 139. J Biol Chem 273, 5858-5868. [0304] Saito, H., Fujita, Y., Kashida, S., Hayashi, K., and Inoue, T. (2011). Synthetic human cell fate regulation by protein-driven RNA switches. Nature communications 2, 160. [0305] Saito, H., Kobayashi, T., Hara, T., Fujita, Y., Hayashi, K., Furushima, R., and Inoue, T. (2010). Synthetic translational regulation by an L7Ae-kink-turn RNP switch. Nature chemical biology 6, 71-78. [0306] Sander, J. D., and Joung, J. K. (2014). CRISPR-Cas systems for editing, regulating and targeting genomes. Nat Biotechnol. Sanjana, N. E., Cong, L., Zhou, Y., Cunniff, M. M., Feng, G., and Zhang, F. (2012). A transcription activator-like effector toolbox for genome engineering. Nat Protocols 7, 171-192. [0307] Shoval, O., and Alon, U. (2010). SnapShot: Network Motifs. Cell 143, 326-326.e321. Sinha, A., Hughes, K. R., Modrzynska, K. K., Otto, T. D., Pfander, C., Dickens, N. J., Religa, A. A., Bushell, E., Graham, A. L., Cameron, R., et al. (2014). A cascade of DNA-binding proteins for sexual commitment and development in Plasmodium. Nature 507, 253-257. [0308] Smith, C. W. J., Porro, E. B., Patton, J. G., and Nadal-Ginard, B. (1989). Scanning from an independently specified branch point defines the 3[prime] splice site of mammalian introns. Nature 342, 243-247. [0309] Soukup, G. A., and Breaker, R. R. (1999). Design of allosteric hammerhead ribozymes activated by ligand-induced structure stabilization. Structure 7, 783-791. [0310] Sprinzak, D, Lakhanpal, A., LeBon, L., Garcia-Ojalvo, J., and Elowitz, M. B. (2011). Mutual inactivation of Notch receptors and ligands facilitates developmental patterning. PLoS computational biology 7, e1002069. [0311] Sternberg, S. H., Haurwitz, R. E., and Doudna, J. A. (2012). Mechanism of substrate selection by a highly specific CRISPR endoribonuclease. Rna 18, 661-672. [0312] Tabor, J. J., Salis, H. M., Simpson, Z. B., Chevalier, A. A., Levskaya, A., Marcotte, E. M., Voigt, C. A., and Ellington, A. D. (2009). A synthetic genetic edge detection program. Cell 137, 1272-1281. [0313] Taggart, A. J., DeSimone, A. M., Shih, J. S., Filloux, M. E., and Fairbrother, W. G. (2012). Largescale mapping of branchpoints in human pre-mRNA transcripts in vivo. Nature structural & molecular biology 19, 719-721. [0314] Teichmann, M., Dieci, G., Pascali, C., and Boldina, G. (2010). General transcription factors and subunits of RNA polymerase III: Paralogs for promoter- and cell type-specific transcription in multicellular eukaryotes. Transcription 1, 130-135. [0315] Upadhyay, S. K., Kumar, J., Alok, A., and Tuli, R. (2013). RNA-Guided Genome Editing for Target Gene Mutations in Wheat. G3: Genes|Genomes|Genetics 3, 2233-2238. [0316] Urlinger, S., Baron, U., Thellmann, M., Hasan, M. T., Bujard, H., and Hillen, W. (2000). Exploring the sequence space for tetracycline-dependent transcriptional activators: Novel mutations yield expanded range and sensitivity. Proceedings of the National Academy of Sciences 97, 7963-7968. [0317] Wang, D., Wang, H., Brown, J., Daikoku, T., Ning, W., Shi, Q., Richmond, A., Stricter, R., Dey, S. K., and DuBois, R. N. (2006). CXCL1 induced by prostaglandin E2 promotes angiogenesis in colorectal cancer. J Exp Med 203, 941-951. [0318] Wang, H., Yang, H., Shivalila, C. S., Dawlaty, M. M., Cheng, A. W., Zhang, F., and Jaenisch, R. (2013). One-step generation of mice carrying mutations in multiple genes by CRISPR/Cas mediated genome engineering. Cell 153, 910-918. [0319] Wang, X., Arai, S., Song, X., Reichart, D., Du, K., Pascual, G., Tempst, P., Rosenfeld, M. G., Glass, C. K., and Kurokawa, R. (2008). Induced ncRNAs allosterically modify RNA-binding proteins in cis to inhibit transcription. Nature 454, 126-130. [0320] Weber, W., Bacchus, W., Gruber, F., Hamberger, M., and Fussenegger, M. (2007). A novel vector platform for vitamin H-inducible transgene expression in mammalian cells. Journal of biotechnology 131, 150-158. [0321] Weber, W., and Fussenegger, M. (2009). Engineering of Synthetic Mammalian Gene Networks. Chemistry & Biology 16, 287-297. [0322] Weber, W., and Fussenegger, M. (2012). Emerging biomedical applications of synthetic biology. Nature reviews Genetics 13, 21-35. [0323] Weber, W., Fux, C., Daoud-el Baba, M., Keller, B., Weber, C. C., Kramer, B. P., Heinzen, C., Aubel, D., Bailey, J. E., and Fussenegger, M. (2002). Macrolide-based transgene control in mammalian cells and mice. Nature biotechnology 20, 901-907. [0324] Weber, W., Schoenmakers, R., Keller, B., Gitzinger, M., Grau, T., Daoud-El Baba, M., Sander, P., and Fussenegger, M. (2008). A synthetic mammalian gene circuit reveals antituberculosis compounds. Proceedings of the National Academy of Sciences of the United States of America 105, 9994-9998. [0325] White, R. J. (1998). RNA Polymerase III Transcription (Springer-Verlag). Willis, I. M. (1993). RNA polymerase III. European Journal of Biochemistry 212, 1-11. [0326] Wilson, R. C., and Doudna, J. A. (2013). Molecular Mechanisms of RNA Interference. AnnualReview of Biophysics 42, 217-239. [0327] Wilusz, J. E., Freier, S. M., and Spector, D. L. (2008). 3 End Processing of a Long Nuclear-Retained Noncoding RNA Yields a tRNA-like Cytoplasmic RNA. Cell 135, 919-932. [0328] Wilusz, J. E., JnBaptiste, C. K., Lu, L. Y., Kuhn, C. D., Joshua-Tor, L., and Sharp, P. A. (2012). A triple helix stabilizes the 3 ends of long noncoding RNAs that lack poly(A) tails. Genes &development 26, 2392-2407. [0329] Win, M. N., Liang, J. C., and Smolke, C. D. (2009). Frameworks for programming biological function through RNA parts and devices. Chem Biol 16, 298-310. [0330] Xie, Z., Wroblewska, L., Prochazka, L., Weiss, R., and Benenson, Y. (2011). Multi-input RNAi based logic circuit for identification of specific cancer cells. Science 333, 1307-1311. [0331] Yang, H., Wang, H., Shivalila, C. S., Cheng, A. W., Shi, L., and Jaenisch, R. (2013). One-step generation of mice carrying reporter and conditional alleles by CRISPR/Cas-mediated genome engineering. Cell 154, 1370-1379. [0332] Ye, H., Daoud-El Baba, M., Peng, R. W., and Fussenegger, M. (2011). A synthetic optogenetic transcription device enhances blood-glucose homeostasis in mice. Science 332, 1565-1568. [0333] Yin, Q.-F., Yang, L., Zhang, Y., Xiang, J.-F., Wu, Y.-W., Carmichael, G. G., and Chen, L.-L. (2012). Long Noncoding RNAs with snoRNA Ends. Molecular cell 48, 219-230. [0334] Ying, S.-Y., and Lin, S.-L. (2005). Intronic microRNAs. Biochemical and Biophysical Research Communications 326, 515-520. [0335] Zhao, J., Sun, B. K., Erwin, J. A., Song, J.-J., and Lee, J. T. (2008). Polycomb Proteins Targetedby a Short Repeat RNA to the Mouse X Chromosome. Science 322, 750-756. [0336] Auslander, S., Auslander, D., Muller, M., Wieland, M., and Fussenegger, M. (2012). Programmable single-cell mammalian biocomputers. Nature 487, 123-127. [0337] Xie, Z., Wroblewska, L., Prochazka, L., Weiss, R., and Benenson, Y. (2011). Multi-Input RNAi-Based Logic Circuit for Identification of Specific Cancer Cells. Science 333, 1307-1311.