<i>Heterorhabditis bacteriophora </i>with enhanced shelf-life

Abstract

Entomopathogenic nematode Heterorhabditis bacteriophora having an enhanced longevity, comprising a first locus comprising a single nucleotide polymorphism at position 75 of the nucleotide sequence SC00004647 as depicted in SEQ ID NO: 5, in which C is substituted by T; and/or a second locus comprising a single nucleotide polymorphism at position 54 of the nucleotide sequence SC00006203 as depicted in SEQ ID NO: 7, in which C is substituted by T.

Claims

1. Entomopathogenic nematode Heterorhabditis bacteriophora, comprising: at least one locus, conferring enhanced longevity, from the group consisting of: a first locus comprising a single nucleotide polymorphism at position 75 of the nucleotide sequence SC00004647 as depicted in SEQ ID NO: 5, in which C is substituted by T; and a second locus comprising a single nucleotide polymorphism at position 54 of the nucleotide sequence SC00006203 as depicted in SEQ ID NO: 7, in which C is substituted by T; and at least one locus, conferring an enhanced virulence, from the group consisting of: a single nucleotide polymorphism at position 73 of the nucleotide sequence SC00004554 as depicted in SEQ ID NO:3, in which G is substituted by A; and a single nucleotide polymorphism at position 111 of the nucleotide sequence SC0010093 as depicted in SEQ ID NO:8, in which G is substituted by A, wherein the nematode is not exclusively obtained by an essentially biological process.

2. Entomopathogenic nematode according to claim 1, having a third locus comprising a single nucleotide polymorphism at position 66 of the nucleotide sequence SC00003427 as depicted in SEQ ID NO: 1, in which T is substituted by G; and/or a fourth locus comprising a single nucleotide polymorphism at position 76 of the nucleotide sequence SC00004141 as depicted in SEQ ID NO: 2, in which A is substituted by T; and/or a fifth locus comprising a single nucleotide polymorphism at position 86 of the nucleotide sequence SC00004634 as depicted in SEQ ID NO: 4, in which C is substituted by T; and/or a sixth locus comprising a single nucleotide polymorphism at position 98 of the nucleotide sequence SC00005330 as depicted in SEQ ID NO: 6, in which G is substituted by A; and/or a seventh locus comprising a single nucleotide polymorphism at position 77 of the nucleotide sequence SC00012917 as depicted in SEQ ID NO:9, in which C is substituted by G; and/or an eighth locus comprising a single nucleotide polymorphism at position 200 of the nucleotide sequence EN-Hb_oxid-11688 as depicted in SEQ ID NO: 10, in which C is substituted by G; and/or a ninth locus comprising a single nucleotide polymorphism at position 176 of the nucleotide sequence EN-Hb_oxid-26008 as depicted in SEQ ID NO: 11, in which A is substituted by G.

3. Entomopathogenic nematode according to claim 1, further comprising a thirteenth locus conferring an enhanced virulence, comprising a single nucleotide polymorphism at position 111 of the nucleotide sequence SC00010093 as depicted in SEQ ID NO: 8, in which G is substituted by A.

4. Biological control agent comprising the entomopathogenic nematode according to claim 1.

5. Biological control agent according to claim 4 comprising at least one agriculturally acceptable carrier.

6. A method of controlling insects comprising employing the entomopathogenic nematode according to claim 1 against true weevils (Curculionidae), scarabs (Scarabaeidae) or leaf beetles (Chrsysomelidae).

7. The method according to claim 6 employing the entomopathogenic nematode against the western corn rootworm (Diabrotica virgifera virgifera).

Description

BRIEF DESCRIPTION OF THE FIGURES

(1) Main experimental steps and milestones for the generation and evaluation of natural strains and hybrids are depicted in the accompanying drawings, wherein:

(2) FIG. 1 shows the main experimental steps carried out towards the selection and testing of Heteorhabditis bacteriophora materials with improved performance. Processes depicted in dotted lines denote support information derived from stress-characterization and molecular analyses.

(3) FIG. 2A shows the mean time survived by 50% (MTS.sub.50) and best 10% (MTS.sub.10) of DJ populations from Heterorhabditis bacteriophora strains and lines stored at 25 C. under oxidative stress (70 mM H.sub.2O.sub.2). The MTS for each line was calculated by fitting a cumulative distribution curve. Error bars: standard deviation (SD) from three independent biological replicates (each with three replicates). Different letters denote significant differences (Tukey's HSD test at P0.05). Further information is available under Sumaya et al. (2017).

(4) FIG. 2B shows the Mean LD.sub.50 per Tenebrio molitor larvae from DJs along a set of Heterorhabditis bacteriophora WT strains and inbred lines. Host mortality was assessed after 7 days of exposure to DJs at 25 C. Error bars: SD of four replicates. Different letters on the error bars indicate significant differences (Conover-Iman test with Bonferroni correction at P<0.0001)

(5) FIG. 3 shows the mean time survived by 50% (MTS.sub.50) of DJ-populations from the contrasting lines DE6-IL4 (high survival) and DE2-IL1 (low survival). Both inbred lines were derived after 8 self-fecundation cycles. Error bars: SD from three independent trials. Different letters denote significant differences (Tukey's HSD test at P0.05).

(6) FIG. 4 shows the mean Time Survived by 50% (MTS.sub.50) of DJ populations from D2D6-RILs and parental lines under oxidative stress assays. Two assays were conducted along 30 days. DJs of each line were treated with 70 mM H.sub.2O.sub.2 at 25 C. in three randomized replicates and counted for live and dead nematodes over time. The gray bars represent the two contrasting parents, DE6-IL4 and DE2-IL1. Error bars: SD. Letters at the right indicate significant differences among lines (Tukey's HSD test at P0.05).

(7) FIG. 5 shows linkage groups obtained from polymorphic SNPs analyzed in 28 RILs from the D2D6 RILs along their parental lines. Five major linkage groups were determined comprising 550 cM. Seven QTL were identified using data from one desiccation and two oxidative stress trials independently (colour bars). Six of the seven QTL were found mainly in three linkage groups regions (red dashed lines). GBS clusters selected for design of PCR markers are denoted with a star.

(8) FIG. 6 depicts the main LD.sub.50 of the Heterorhabditis bacteriophora commercial strain EN01 along promissory materials characterized within BIOCOMES WP2 (HU2, HUPT, sel-HUPT and HU2-IL1). Host larvae: Tenebrio molitor (dark bars) and Diabrotica virgifera virgifera L3 larvae (white bars). LD.sub.50 was assessed after seven days of exposure at 25 C. Error bars: SEM of ten replicates for (T. molitor) and four replicates (D. v. virgifera). Different letters (uppercase for T. molitor, lowercase for D. v. virgifera) indicate significant differences (Tukey's HSD test at P0.05).

(9) FIG. 7 shows the mean LD.sub.50 against D. v. virgifera of the Heterorhabditis bacteriophora commercial strain EN01 along materials characterized within BIOCOMES WP2 (HU2, HUPT, sel-HUPT and HU2-IL1. Persistence was assessed after six weeks of incubation at 17 C. in sand bio-assays and seven days of incubation at 25 C. LD.sub.50 was corrected (black bars) according to DJs survival after mechanic extraction. Error bars: SEM of two replicates. No significant differences were determined between strains (Tukey's HSD test at P0.05).

(10) FIG. 8 shows the infected hosts (%) after 21 days of DJ application calculated for the Heterorhabditis bacteriophora commercial strain EN01 and two strains characterized along BIOCOMES WP2 (HU2 and sel-HUPT). Doses of 1109 (reduced dose) and 2109 DJs ha-1 (commercial dose) were evaluated against Diabrotica v. virgifera (A) and Tenebrio molitor (B). Stars above the bars indicate significant differences between doses, for each strain and host. Letters above the bars indicate differences between strains for each dosage (Tukey's HSD test at P0.05).

(11) FIG. 9 shows the infected Tenebrio molitor larvae percentage over time in a semi-field experiment. DJs of the Heterorhabditis bacteriophora commercial strain (EN01) and strains and inbred lines characterized along BIOCOMES WP2 (HU2, HUPT, sel-HUPT and HU2-IL1) were applied. Two application doses were tested: 1109 DJs ha-1 (A) and the commercial dose of 2109 DJs ha-1 (B). Baiting was done using the Falcon tube method with ten insects per tube. Error bars: SD of five replicates. Different letters on the error bars indicate significant differences between groups (P0.05). No significant differences between dosages of the same strain were determined.

(12) FIG. 10 shows the insect mortality after baiting experiments in field trials in 2017. Field trials in Styria (Austria) were carried out in Unterschwarza (A) and Lichendorf (B). For Austrian sites, baiting was done two 60 days post-DJs-application using the Falcon tube method containing 10 Tenebrio molitor larvae per tube and 5 replicates per treatment. Field trials in Hungary were carried out in two fields of the Kondoros site: Field-S and Field-T (C and D, respectively). For Hungarian sites, baiting was done two 80 days post-DJs-application using the Falcon tube method containing 10 T. molitor larvae per tube and 5 replicates per treatment. Different letters on the error bars represent significant differences within fields. Two application DJ doses were evaluated: commercial DJ dose (2109 DJs ha-1, white bars), and a reduced dose (1109 DJs ha-1, black bars).

(13) FIG. 11 shows the number of emerging D. v. virgifera in Austrian field sites Unterschwarza (A) and Lichendorf (B) in field trials in 2016. Control untreated maize parcels were compared against chemically treated-(Belem) and DJ-treated parcels. Two Heterorhabditis bacteriophora strains were evaluated (EN01 and HU2), at 2109 DJs ha-1. Additionally, the combination of commercial DJs and Rhizovital was assessed. Emerging beetles were registered by photoeclectors.

(14) FIG. 12 shows the plant damage levels (%) per plant treatment in the Austrian field sites Unterschwarza (A) and Lichendorf (B) in field trials in 2016. Control untreated maize parcels were compared against chemically treated-(Belem) and DJ-treated parcels. Two Heterorhabditis bacteriophora strains were evaluated (EN01 and HU2), at 2109 DJs ha-1. Additionally, the combination of commercial DJs and Rhizovital was assessed. Plants were evaluated according to the strength of their stem in the categories depicted above.

(15) FIG. 13 shows the number of emerging D. v. virgifera in Austrian field sites Unterschwarza (A) and Lichendorf (B) in field trials in 2017. Control untreated maize parcels were compared against chemically treated-(Belem) and DJ-treated parcels. Two Heterorhabditis bacteriophora strains were evaluated (EN01 and HU2), at two doses each: 1109 DJs ha-1 (1b) and 2109 DJs ha-1 (2b). Emerging beetles were registered by photoeclectors. Significant letters denote significant differences among treatments within one field for Unterschwarza (Tukey's HSD test at P0.05) and Lichendorf (Conover-Iman test with Bonferroni correction at P0.05). Error bars: SD.

(16) FIG. 14 shows the plant damage levels (%) per plant treatment in the Austrian field sites Unterschwarza (A) and Lichendorf (B) in field trials in 2017. Control untreated maize parcels were compared against chemically treated(Belem) and DJ-treated parcels. Two Heterorhabditis bacteriophora strains were evaluated (EN01 and HU2), at two doses each: 1109 DJs ha-1 (1b) and 2109 DJs ha-1 (2b). Plants were evaluated according to the strength of their stem in the categories depicted above.

(17) FIG. 15 shows the efficacy of nematodes and chemical insecticide (Cypermethrin) treatments in reduction of Diabrotica v. virgifera in artificially-infested field trials in Hungarian sites on 2016. All treatments are compared against the untreated control parcels. Emerging adults were counted upon application of 100 eggs per plant. Nematodes from the EN01 and HU2 strains were applied at 2109 DJs ha-1. Error bars: SD from two fields.

(18) FIG. 16 shows the efficacy (%) of DJ and chemical insecticide (Cypermethrin 12 kg ha-1) treatments in reduction the plant root damage (IWOA scale) in artificially-infested field trials in Hungarian sites in 2016. All treatments are compared against the untreated control parcels. Nematodes from the EN01 and HU2 strains were applied at 2109 DJs ha-1. Error bars: SD from two fields.

(19) FIG. 17 shows the efficacy (%) of nematodes and chemical insecticide (Cypermethrin, 12 kg ha-1) treatments in reduction of Diabrotica v. virgifera in artificially-infested field trials in Hungarian sites in 2017. All treatments are compared against the untreated control parcels. Emerging adults were counted upon application of 100 eggs per plant. Nematodes from the EN01 and HU2 strains were applied at a reduced dose of 1109 DJs ha-1 (1b) and the commercial dose of 2109 DJs ha-1 (2b). Error bars: SD from two fields.

(20) FIG. 18 shows the efficacy (%) of DJ and chemical insecticide (Cypermethrin 12 kg ha-1) treatments in reduction the plant root damage (IWOA scale) in artificially-infested field trials in Hungarian sites in 2017. All treatments are compared against the untreated control parcels. Nematodes from the EN01 and HU2 strains were applied at a reduced dose of 1109 DJs ha-1 (1b) and the commercial dose of 2109 DJs ha-1 (2b). Error bars: SD from two fields.

(21) FIG. 19 depicts the percentage survival of two Heterorhabdits bacteriophora strains EN01 (blue line) and HU2 (red line) stored at 6 C. in formulation. Storage time: days after formulation. Error bars: SD of three sub-samples per strain and time point. Different letters show significant differences within the same time point (Tukey's test; P0.05).

(22) FIG. 20 shows the mean tolerated H.sub.2O.sub.2 concentration (in mM) at which 50% of the nematode population survived on day 12 (LC.sub.50 H.sub.2O.sub.2) of strains HU2 and ENO1 stored at 6 C. in powder formulation for 30 or 45 days. Error bars: Standard deviation from three replicates. Different letters on the bars denote significant differences within one time point (Tukey's Test, P0.05).

(23) FIG. 21 shows the mean lethal doses (LD.sub.50) of IJs extracted from formulation of strains HU2 and EN01 over storage period of up to 62 days at 60 C. Error bars: Standard deviation of three replicates. Different letters on bars denote significant differences within each time point (Tukey's test, P0.05).

DETAILED DESCRIPTION OF THE INVENTION

(24) Nematodes Growth in Monoxenic Cultures

(25) Starting from a collection of 40 H. bacteriophora strains that were collected in several parts of the world and that have been worked in the lab in previous research, the isolates were propagated in Nematode Gelrite Media (NGG; gelrite 3.0 gl-1, peptone 2.50 gl-1, NaCl 51 mM, CaCl.sub.2)*H.sub.2O 1 mM, MgSO.sub.4*7H.sub.2O 1 mM, KH.sub.2PO.sub.4 1 mM, cholesterol 12 M) pre-coated with pre-cultured Photorhabdus luminescens at a density of 210.sup.9 cells ml.sup.1 in a semi-solid NGG matrix (NGG, 1.5 gl.sup.1 gelrite). After DJ-recovery and completion of one life-cycle (7 days), mature hermaphrodites (Endotokia matricida stage) were washed-off from the NGG plates and re-suspended in Ringer's solution (NaCl 9 gl.sup.1, KCl 4.42 gl.sup.1, CaCl.sub.22 H.sub.2O 0.37 gl.sup.1, NaHCO.sub.3 0.2 gl.sup.1) until the majority of DJ were released. Thereafter, DJ were cleaned via cotton trap and vacuum-filtering with a 10 m sieve. Clean DJ were stored in culture flasks In Ringer's solution until used for characterization.

(26) Oxidative Stress Assays to Predict DJ-Longevity in Strains and Inbred Lines

(27) Dauer Juveniles from the H. bacteriophora natural strains were subjected to oxidative stress assays according to Sumaya et al. (2017). DJ-populations from each line (1,000 individuals) were disposed in 24-cell well plates in a final volume of 400 l of Ringer's solution in three randomized technical replicates. Thereafter, 15 l of 1.94 M H.sub.2O.sub.2 were added to each cell-well to obtain a final H.sub.2O.sub.2 concentration of 70 mM. DJ-mortality over time was assessed by periodically (every second day) surveying 20 l aliquots for dead and alive individuals in each replicate. The percentage of DJ-mortality was used to determine the MTS.sub.50 of the DJ-population for each line. The MTS.sub.50 was determined from a fitted cumulative normal distribution by using the Probit analysis of the XLSTAT (https://www.xlstat.com/de/) software. Oxidative stress assays were repeated starting from different DJ growth batches

(28) Virulence Estimation of the Natural Strains

(29) Mealworms (Tenebrio molitor) were used as hosts for the virulence characterization of H. bacteriophora WT materials. Tenebrio molitor larvae were obtained from Futterinsektenfarm Schulz (Eschach-Holzhausen, Germany). For laboratory virulence bioassays, 40 T. molitor larvae were placed into Petri dishes (150 mm) filled with 150 g of sand adjusted to 8.5% water content. Nematode suspension volumes of 1.0 ml (Ringer's solution) from each strain and line containing 80, 200, 400, 800 and 2000 DJs ml-1 were inoculated in the middle of the Petri dishes and incubated at 25 C. for 7 days. Infection by DJs was checked with the luminometer LUMAT LB 9501 (Berthold GmbH, Germany). The mean mortality by nematode infection of T. molitor was compared among all strains. Mortality data was used to calculate the lethal dose of DJs required to kill 50% of the insect larvae per assay (LD.sub.50). The LD.sub.50 was calculated by fitting the observed data to saturated curves, which were compared with the saturation curve through minimising the chi-square (chi.sup.2) fitting to the nearest value to zero. The insect mortality was calculated through the formula:
mortality=a(1ln(bx))+c Where: a=total number of insects b=slope of the fitted model x=number of DJs per insect c=control mortality

(30) The data were compared with the saturation curve through minimizing the chi-square (Chi.sup.2) fitting to a value nearest to cero (0). The values obtained were analyzed for normality with the Shapiro-Wilk test at P0.05. In case of not-normal-distribution, log transformation was used. For normal distributed data ANOVA and Tukey's test for multiple comparisons were done. For non-normal distributed data the Kruskal-Wallis test with post hoc Conover-Iman test for multiple comparisons were used. The Bonferroni test was performed for correction of significant differences. Standard deviation of LD.sub.50 was calculated according to the formula:
SD=(infected ratenon-infectedtotal insects)(total insects)
Results on Variability in DJ-Longevity and Virulence Among H. bactariophora Strains
Differences in MTS.sub.50 Among H. bacteriophora Strains

(31) The highly positive correlation between oxidative stress tolerance and DJ-longevity, as well as a comprehensive overview of this characterization has been published by Sumaya et al. (2017). We determined a high variability and significant differences (F=36.62; df=39; P0.0001) on mean time survived by 50% of DJ populations (MTS.sub.50) along the 40 tested H. bacteriophora strains. The MTS.sub.50 in DJ-populations under oxidative stress (70 mM H.sub.2O.sub.2) ranged from 3.20.65 up to 22.463.18 days. This measurement was highly correlated (R=0.87, P0.001) with survival bioassays carried out under control conditions (0.0 mM H.sub.2O.sub.2, 25 C.). Natural isolates from central Europe and Australia were found among the longest surviving materials. Among them is found the strain HU2, which also showed high virulence in parallel tests. An overview of the determined MTS.sub.50 under oxidative stress is presented in FIG. 2A.

(32) Concerning virulence, all WT strains and inbred lines were able to infect T molitor larvae, and significant differences were found among the LD.sub.50 values (K=120.55; df=42; P0.0001). The LD.sub.50 of the tested materials ranged from 1.4 to 30.5 DJs per insect. The isolate PT1, was the most virulent strain against T. molitor larvae with a LD.sub.50 of 1.40.33, followed by the isolate HU2 (LD.sub.50=1.80.23). The current commercial strain (EN01) showed a relatively high virulence level (LD.sub.50=3.60.91). An overview of the LD.sub.50 in all strains and inbred lines is depicted in FIG. 2B. Although the LD.sub.50 of the current commercial strain EN01 does not present significant differences with the most virulent isolate, this suggests that still higher virulence could be reached by breeding or selection procedures. Thus, new isolates with lower LD.sub.50 values and better performance in other important traits (stress-resistance and DJ-longevity) can be as well potential candidates for commercial production.

(33) Selection of Two Contrasting Materials for Subsequent Genetic Analysis

(34) Genetic analysis is crucial for the generation of molecular markers for marker-assisted breeding. In this framework we choose two strains with contrasting properties for subsequent genetic linkage and QTL analysis: i) DE2-IL1 (Short DJ-longevity, high virulence), and DE6-IL4 (large DJ-longevity, low virulence). Both strains originated respectively inbred lines after more than 8 self-fecundation cycles. The DJ-longevity phenotype of both inbred lines was confirmed by MTS.sub.50 estimation under oxidative stress (70 mM H.sub.2O.sub.2) as shown in FIG. 3

(35) Crossing H. bacetriophora Homozygous Lines to Make Genetic Analyses in Recombinant Inbred Lines (RILs)

(36) Methods

(37) Genetic Crossing Between Contrasting Lines

(38) Genetic crosses were carried out with inbred lines. A description of the parental inbred lines and progeny is deposited in Table 1. All crosses were done following the report of Iraki and co-authors (2000). As outcome, sets of highly homozygous recombinant inbred lines (RILs) were obtained from each cross.

(39) TABLE-US-00001 TABLE 1 H. bacteriophora inbred lines used for additional genetic crosses Cross name Parent 1 Phenotype Parent 2 Phenotype Outcome D2D6 DE2-IL1 low DJ- DE6-IL4 high DJ- RILs longevty longevty High low virulence virulence
Results on Derivation of Progenies Out of Genetic Crosses

(40) After genetic crossing, single progeny individuals were self-fertilized for more than 8 generations (>F.sub.8) to produce recombinant inbred lines (hereafter, D2D6 RILs). These lines were chosen to be extensively genotyped by high throughput sequencing using the genotyping by sequencing (GBS) approach. All RILs were also characterized for DJ-longevity. Subsequently, genotype and phenotype were correlated by QTL and association analysis.

(41) Variability in Oxidative Stress Survival and Desiccation Tolerance Along D2D6 RILs

(42) Phenotypic data for QTL and association analysis was generated by calculating the MTS.sub.50 under 70 mM H.sub.2O.sub.2 of each RIL derived from the D2D6 cross. The DJs of the stress tolerant parent line (DE6-IL4) survived the longest time on the set (MTS.sub.50=7.91.3 days) whereas lower MTS.sub.50 value (5.11.1 days) was determined for DE2-IL1, however not the lowest among all lines. The RIL D2D6-42 survived the shortest time among all lines (MTS.sub.50=3.7 days). Interestingly, several lines had a shorter MTS.sub.50 compared to that of the parental DE2-IL4 population. Differences in MTS.sub.50 among lines resulted significant (F=8.55; df=51; P0.0001) considering lines with MTS.sub.50 values in both trials. An overview of the RILs survival along the parental lines is shown in FIG. 4.

(43) Evaluating the Genetic Diversity of H. bacteriophora Strains and RILs Methods

(44) Genome-Wide Genotyping by Sequencing (GBS)

(45) Parallel to the phenotypic analysis, a subset of 28 D2D6 RILs, 11 wild type H. bacteriophora strains, and 6 WT inbred ILs were analyzed by GBS as described by Elshire et al. (2011). The materials selected for the analysis were chosen according to their DJ-longevity (contrasting material Table 2). All H. bacteriophora lines and strains chosen for GBS were propagated in NGG media and harvested as described above. Clean DJs were used for DNA extraction with the peqGOLD Tissue DNA Mini Kit (PeqLab, Germany), according to the manufacturer's instructions. All sequencing steps were carried out by the company LGC Genomics GmbH (Berlin, Germany) according the GBS standard protocol.

(46) TABLE-US-00002 TABLE 2 Set of H. bacteriophora materials selected for GBS. For each material, its DJ-longevity under oxidative stress is depicted. Within each subset, contrasting materials are included. Materials with three different genetic backgrounds were analysed: WT strains, WT inbred lines, RILs, and selected cross-progenies Longevity 25 C./70 mM Type Code H.sub.2O.sub.2 WT Strains HY3 High AU1 High DE6 High HU1 High HU2 High DE2 low PT1 low PT2 low PT4 low EN01 low PT3 low WT Inbred lines AU1-IL1 high HU2-IL1 high DE6-IL4 high PT1-IL1 low IL3 low DE2-IL1 low RILs D2D6-133 high D2D6-24 high D2D6-124 high D2D6-125 high D2D6-126 high D2D6-135 high D2D6-109 high D2D6-99 high D2D6-10 high D2D6-84 high D2D6-143 high D2D6-144 high D2D6-104 high D2D6-114 high D2D6-113 low D2D6-111 low D2D6-95 low D2D6-128 low D2D6-78 low D2D6-71 low D2D6-22 low D2D6-21 low D2D6-54 low D2D6-93 low D2D6-122 low D2D6-94 low D2D6-123A low D2D6-123B low Selected HU2-IL1 PT1-IL1-Vir (very) high progenies HU2-IL1 PT1-IL1-LL + Vir (very) high HU2-IL1 PT1-IL1 high
In Silico Analysis of GBS Data and Genotype-Phenotype Correlation Analysis

(47) The finality of the GBS analysis is to find polymorphisms in large numbers among the tested materials. The targeted polymorphisms are single nucleotide substitutions in the genetic code (SNPs). After sequencing, GBS clusters harboring SNPs among the analyzed strains and lines were filtered according to the allele frequencies (reduction of minor SNP alleles) and variant call files (VCF) were generated. The obtained VCF were used to test the correlation between the lines SNP-genotype and existing longevity phenotype information using the software Tassel 5.0 (http://www.maizegenetics.net/tassel). SNPs with association to a specific longevity-related trait were filtered out after analyzing natural strains and RILs in separate runs. As a complementary approach, GBS clusters showing polymorphisms along the sequenced RILs were filtered and used for linkage analysis with the software package Joinmap 4.1 (https://www.kyazma.nl) with the Kosambi genetic mapping function with a minimum LOD score (logarithm [base 10] of odds) of 2.0. For QTL analysis, the linkage map generated by joinmap 4.1 was combined with RILs phenotypic data using the PlabQTL software (https://plant-breeding.uni-hohenheim.de/software.html). PlabQTL was run including test for additive and dominance effects (no test for residuals). GBS clusters flanking QTL were selected for further analyses.

(48) Results on Finding SNPs with Correlation with Longevity and Virulence

(49) Genotyping by Sequencing (GBS) in H. bacetriophora Strains and Lines

(50) After GBS sequencing, Illumina paired end-sequencing yielded a total of 80.000 GBS clusters (64 bp sequence stretches). After filtering out minor SNP alleles, 1.126 clusters resulted polymorphic either in natural strains or in RILs. Further on, BLAST analyses against the public repositories yielded 380 clusters with high homology to the latest version of the H. bacteriophora genome draft. Additionally, 230 clusters presented high homology to the NCBI (nr) database. For Further analyses, variant call files (VCF) were generated for two categories of sequenced individuals: i) natural strains and inbred lines, ii) RILs and parental inbred lines.

(51) Correlation Analyses Combining Phenotype and GBS Data from Strains

(52) The phenotype and genotype information from the previously analysed H. bacteriophora strains and inbred lines was combined by association analysis. SNP variant calls from wild type lines and strains were analyzed under an allele frequency threshold of 0.05 for the minor SNP allele. With this approach, a total of 1.075 SNPs were analyzed using the Tassel 5.0 software. Phenotypic data from the DJ-survival (MTS.sub.50 and MTS.sub.10) of 17 strains and inbred lines was combined with the respective SNP alleles. Phenotype information has been published by Sumaya et al. (2017). Survival time from four treatments was considered: i) 25 C.control, 25 C.oxidative stress, 7 C.control, and 7 C.oxidative stress. After data analysis, association to at least one of the traits was shown by five markers. Marker details and associations are depicted in Table 3.

(53) TABLE-US-00003 TABLE 3 GBS-clusters showing SNPs with association to DJ-longevity related traits in Heterorhabditis bacteriophora natural strains and inbred lines. For each SNP, associated traits are depicted along their P-value. Homology hits with previously sequenced RNA-seq transcripts and contigs of the H. bacteriophora current genome draft are shown. BLAST homology hits H. Trait RNA-seq bacteriophora Marker Parameter Conditions p-value transcripts genome draft SC00002607 MTS.sub.50 25 C. - 70 mM 2.78E05 EN-Hb_oxid- contig1336 H.sub.2O.sub.2 51278 MTS.sub.10 25 C. - 70 mM 7.62E04 EN-Hb_oxid- contig1336 H.sub.2O.sub.2 51278 SC00003550 MTS.sub.50 25 C. - 70 mM 6.69E06 H.sub.2O.sub.2 MTS.sub.10 25 C. - 70 mM 1.32E04 H.sub.2O.sub.2 SC00004013 MTS.sub.50 7 C. - 70 mM 4.24E04 H.sub.2O.sub.2 MTS.sub.10 7 C. - 70 mM 8.31E04 H.sub.2O.sub.2 SC00004647 MTS.sub.50 25 C. - 70 mM 2.78E05 contig1265 H.sub.2O.sub.2 MTS.sub.10 25 C. - 70 mM 7.62E04 contig1265 H.sub.2O.sub.2 SC00006203 MTS.sub.50 25 C. - 70 mM 2.78E05 contig1190 H.sub.2O.sub.2 MTS.sub.10 25 C. - 70 mM 7.62E04 contig1190 H.sub.2O.sub.2
QTL Analysis in D2D6 RILs Using GBS Alleles

(54) A QTL analysis was carried out using SNPs recorded for the 28 D2D6-RILs analyzed by GBS aside the parent lines DE2-IL1 and DE6-IL4. Genotype data was combined with RILs phenotype data described in the previous sections (DJs MTS.sub.50 under oxidative stress). Additionally, desiccation tolerance data from the same RILs was included. For linkage analysis, 321 SNPs for the parental and the RILs were chosen. After filtering for all SNP minor alleles, 63 SNPs were used for the construction of a linkage map using the Joinmap software. A low resolution linkage map with five major linkage groups was obtained including 53 SNPs. The developed genetic map covered 553 centimorgan (cM). Thereafter, phenotype and genotype were correlated by QTL analysis. The phenotypic data from three different oxidative trials and one desiccation trial (each consisting of three technical replicates) was used independently for the QTL calculation. Seven QTL with profile LOD score above 2.0 were determined in three linkage groups. A graphic display of the linkage groups and the main QTL is depicted in FIG. 5. Basic QTL parameters are deposited in Table 4. SNPs in the vicinity of the QTL were later chosen for the design of PCR-base genotyping markers.

(55) TABLE-US-00004 TABLE 4 Oxidative stress- (MTS.sub.50) and desiccation-tolerance (Survival %) QTL detected in Heterorhabditis bacteriophora linkage groups determined using polymorphic SNPs. For each QTL, the left and right markers are depicted along with the total LOD score of the QTL. Positive additive effects indicate DE6-IL4 as strong parent. Negative additive effects indicate DE6-IL4 as weak parent, for the given loci. Additive Trait-trial LG Position Left Marker Right Marker LOD effect MTS.sub.50-H.sub.2O.sub.2-2 1 187 SC00005330 SC00004141 2.51 3.75 MTS.sub.50 H.sub.2O.sub.2-2 1 213 SC00004634 En_Oxid-8385 2.04 2.01 MTS.sub.50 H.sub.2O.sub.2-2 1 314 SC01010026 SC00014329 3.19 4.47 MTS.sub.50 H.sub.2O.sub.2-1 2 6 SC01100604 SC00061659 5.36 0.70 MTS.sub.50 H.sub.2O.sub.2-1 3 59 SC00022876 SC00024776 7.52 0.69 MTS.sub.50 H.sub.2O.sub.2-Avg 2 0 SC00038306 SC00100604 1.76 0.56 Desiccation-1 1 207 SC00006203 SC00004634 5.02 8.60
Transfer of Information from Genome-Wide SNP Analysis into PCR-Based Markers

(56) The GBS analysis was done with a limited number of H. bacteriophora strains and RILs. The next step of the research was to transfer this information to design PCR-based SNP markers and to test all 40 WT strains from the nematode collection. Once all strains and RILs were genotyped, the correlation between genotype, DJ-longevity and Virulence was tested to select KASP markers with the most predictive power.

Methods

(57) KASP Assays

(58) Sequence information from GBS was analyzed to be converted into PCR-based markers for genotyping assays. A set of 30 candidate SNPs derived from the QTL and Association analyses described above was chosen for the SNP detection assays by PCR. Additionally SNPs were filtered of RNA-seq assays done in parallel (Table 5). The technique known as KASP (Kompetitive Allele Specific PCR) was chosen for this purpose. For KASP markers primers design, all pre-selected sequences were send to the commercial partner LGC genomics (UK). KASP-PCR amplifications were done starting from 2-3 l DNA (10-15 ng) of each genotyped nematode material using the markers (primers) by following the PCR-profile: 94 C.-15 min; 10 cycles of 94 C.-20 sec, 61 C.-1 min (0.6 C. drop each cycle); and 30 cycles of 94 C.-20 sec, 55 C.-1 min. Resulting signals were analysed with the StepOne software (genotyping mode) of Applied Biosystems for allele discrimination. For each genotyping round, KASP assays with no DNA were used as negative controls.

(59) Results on SNP Genotyping

(60) KASP Genotyping in RILs and WT Strains

(61) Out of a total of 30 KASP markers (Table 5), 23 markers where polymorphic in the 40 wild type strains. To validate the KASP results, the GBS genotypic data of the 28 D2D6-RILs and their parents was compared in 5 randomly selected KASP markers. A total of 140 data points were compared between GBS and KASP assays. From GBS clusters registered as homozygous, 94 out of 94 KASP readings were consistent with the expected genotype. In 11 cases where the GBS genotype for the given RILs was regarded as heterozygous, the KASP genotype was registered as homozygous for one of the parental alleles. In summary, 90% concordance was observed for all amplified SNPs. However, the proportion of heterozygous RILs is negligible when it is considered marker by marker.

(62) TABLE-US-00005 TABLE 5 Overview of designed KASP markers for the genotyping of Heterorhabditis bacteriophora strains and inbred lines. Allele variants with the specific fluorophore are provided along with sequence source of the SNP. SNP Allele Allele Marker Name source FAM HEX SC00002607 GBS G T SC00003427 G T SC00003742 G A SC00004554 G A SC00004647 C T SC00004911 T C SC00005459 C T SC00005496 A T SC00005718 A T SC00006203 C T SC00006291 T G SC00010093 A G SC00010669 C G SC00011215 T C SC00011443 C T SC00012176 G A SC00012917 G C SC00013602 G A EN-Hb_oxid-05173 RNA-seq G T EN-Hb_oxid-08385 C G EN-Hb_oxid-11688 G C EN-Hb_oxid-26008 G A EN-Hb_oxid-41943 C T EN-Hb_oxid-45902 G C EN-Hb_oxid-48911 G A EN-Hb_oxid-51540 T C EN-Hb_oxid-56842 A G EN-Hb_oxid-56985 G A EN-Hb_oxid-58060 C T EN-Hb_oxid-58700 C T
Correlation Between KASPs Genotypes with DJ-Survival and DJ-Virulence

(63) The genotypes derived from all the KASP markers were analyzed for significant phenotypic differences in survival (MTS.sub.50) along 50 D2D6-RILs and 40 WT strains and inbred lines via ANOVA. For the D2D6 RILs, the genotypic data was combined with the MTS.sub.50 of the RILs under oxidative stress from two experimental trials and desiccation the survival. For wild type strains and inbred lines, the genotypic data was combined with the MTS.sub.50 under two temperatures (25 C. and 7 C.), and two conditions (0.0 and 70 mM H.sub.2O.sub.2) published by Sumaya et al (2017). Concerning virulence, the LD.sub.50 (number of DJs to needed to kill 50% of a host population) of the WT-strains against mealworm (Tenebrio molitor) was used. Among the 40 wild type strains and inbred lines, twelve markers showed correlation between the genotype and at least one the MTS.sub.50 parameters measured. Two of this markers (SC00004554 and SC00010093) showed also high correlation with the LD.sub.50 against T. molitor. A detailed overview of the significant markers for the 40 wild type strains and inbred lines is given in Table 6.

(64) TABLE-US-00006 TABLE 6 Differences in the DJ-longevity and virulence between homozygous genotypes of the reference and alternative SNPs of 12 KASP markers along 40 Heterorhabditis bacteriophora wild type strains and inbred lines. The differences between mean MTS.sub.50 of the homozygous genotypes (days) are depicted as absolute values. Differences in virulence (LD.sub.50) are depicted as number of DJs. For DJ-longevity, phenotypic data from two treatments (0 and 70 mM H.sub.2O.sub.2) under two temperatures (25 C. and 7 C.) were analyzed. For virulence LD.sub.50 against Tenebrio molitor as used as phenotypic trait. Significance of the differences between genotypes was assessed via ANOVA and Tukey's HSD test (P 0.05) and is indicated with stars. LD.sub.50 MTS.sub.50 25 C. MTS.sub.50 7 C. T. molitor MTS.sub.50 25 C. 70 mM H.sub.2O.sub.2 MTS.sub.50 7 C. 70 mM H.sub.2O.sub.2 LD.sub.50 Difference Difference Difference Difference Marker name difference P < 0.05 (days) P < 0.05 (days) P < 0.05 (days) P < 0.05 (days) P < 0.05 EN-Hb_oxid-05173 0.8 3.7 * 5.1 1.6 EN-Hb_oxid-56985 0.3 5.2 * 8.7 2.2 SC00003427 9.2 * 3.4 6.2 2.1 SC00004554 1.26 * 6.6 * 2.4 1.3 1.6 SC00004647 7.8 * 7.3 * 10.7 * 4.5 * SC00004911 2.6 4.4 * 13.6 3.7 SC00005330 5.2 8.2 * 6.2 2.6 SC00006203 7.3 * 5.9 * 13.2 * 4.6 * SC00010093 1.31 * 6.0 * 0.7 3.3 0.3 SC00011215 11.0 * 10.2 * 8.9 5.2 * SC00012917 7.5 * 0.3 1.0 0.6 SC00013602 0.7 4.5 * 9.7 * 3.1 *
Use of the SNP-Marker Data and Phenotypic Characterization for Selection of a Prominent H. bacteriophora Strain with Better DJ-Longevity and Virulence.

(65) The initial phenotypic information (MTS.sub.50-70 mM H.sub.2O.sub.2, and LD.sub.50 for T. molitor) was cross checked strain by strain using the genotype information with the objective to choose a WT-natural strain having the following parameters: i) high MTS.sub.50 value, ii) low LD.sub.50 value, iii) Strong alleles for the most significant SNPs tested by KASP assays, and iv) high polymorphic level in the tested KASP markers compared to the actual commercial line EN01. Based on this parameters, the WT strain HU2 was chosen for further tests, including performance in the field against the western corn rootworm, persistence, and formulation longevity. Concerning significant KASP markers 8 out of 12 markers (66%) resulted distinctive between HU2 and the commercial EN01 strain and its daughter line IL3. The polymorphic markers SC00006203, SC00005330, SC00004141 and SC00004634 were found in the vicinity of longevity-related QTL as described above (Table 4). Moreover, markers that combined correlation with virulence and DJ-longevity (SC00004554 and SC00010093) were as well polymorphic between HU2 and EN01. Considering the overall SNP genotype of 28 KASP markers analyzed, HU2 haplotype was only shared with it sister isolate HU1, which is also possess large DJ-longevity. The KASP genotypes of the subset of markers showing highest association with DJ-longevity and virulence including their genotype, along with four additional polymorphic markers extracted from relevant transcripts and QTL vicinity, is shown in Table 7. Flanking sequences of SNPs for KASP probes design is deposited in Table 8.

(66) TABLE-US-00007 TABLE 7 Genotypes of KASP markers associated to DJ-longevity along the shorter-living commercial H. bacteriophora strain and inbred line (EN01 and IL3, respectively) and the longer living WT strain HU2. For simplicity, the genotypes for the reference and alternative SNPs have been coded with the AB system for each marker individually. Longevity Virulence Marker Name Sign. Sign. IL3 EN01 HU2 SC00003427 * T/T T/T G/G SC00004141 A/A A/A T/T SC00004554 * * G/G G/G A/A SC00004634 C/C C/C T/T SC00004647 * C/C C/C T/T SC00004911 * C/C C/C C/T SC00005330 * G/G G/G A/A SC00006203 * C/C C/C T/T SC00010093 * * G/G G/G A/A SC00011215 * T/C T/C T/C SC00012917 * C/C C/C G/G SC00013602 * A/A A/A A/A EN-Hb_oxid-05173 * G/G G/G G/G EN-Hb_oxid-11688 G/G G/G C/C EN-Hb_oxid-26008 A/A A/A G/G EN-Hb_oxid-56985 * G/G G/G G/G

(67) TABLE-US-00008 TABLE8 SequencesusedforKASPassaysdesignfortheidentification ofH.bacteriophoraSNPsbyPCR. SEQID Marker Sequenceforprobe NO: SC00003427 TTATCAAGTAAATAAAGTTCGTCTATTTTTATTAAGATTTTCTCACTAAAGTGATAAGTATG 1 TTG[G/T]AGTTCTTGATTAGTATTAATTAACAGCGATTAAATGCCAGAGAGGCAATAAACG CTGTGTAAACCCACATTAATTTAGCTTTTTCTATTCACAGATTC SC00004141 TACATACTTGCATTAAATGGAACAAAGTGCTCATCAATGTGCATTTAGTATTTACATCTATG 2 TGTATGAAATGTG[T/A]CATCTGTATATTGTGCGAACTTAACAAAGAAAGACTTATTGAGG TCATTTTTATATACATGGTGTCCACGATAAAAGGACCTATTTGACAAGTTTTATAACT SC00004554 AATTAAACCGCAGATGACCGAGCCAGGGGTGAGTTTTTCGGTGCACTTCGATGTGAGTTTGA 3 AGACTGCGAG[G/A]GATGTAAGTTTACTGGTGAGTTTTCCTTTATATTTTTTTTCAGTACT CTCCTGAGCCGAGGCGTTTGCCTCAGTGCTCTTTTCCCACCTCC SC00004634 ATCTTTTAGGAAGTACAAAAGATGTATAATTTATTTACTAGTAATAATTCGCCACGTTCTTC 4 TACTATCCATGTTGATGTTGTCA[T/C]TATGTTTAAGCACTTGATAGGTATATGGATACAC ATCTGAGATTTCGTGTCATTTACTTTACCCCGGTTACTTTTCGGGCTATTTTATACCCTT SC00004647 AACTTAGTAATAAAATTCGTAAAAATTATTTTATGCTTACATTCACTCCTATGGACTTCTAC 5 ATAGAAGGCTTC[C/T]GATGAGCGGGGAATAAGCCCTCGCTGTCCAGTGGCAATATTCATC GCATCCAGTGAACAATCCCTTTAATATGTGAAACTTAAAGTTGG SC00004911 GGATCGAGTAAAGTATTAATGACTTCCATGTCGTGGCATTGACCACTTGGATGTGACAAGAA 12 CCTCAGTGGGAGTCTTTTCTATTCAGCAATAGACTGAAAATAATAATAAA[T/C]AAGAAAT AAACACGTGATATGTGAGAAATAAAGAAACTTATTCAGACAGAT SC00005330 CTATTACTACTACTATTACTATTATCAAGTTGAGTTAAATTAATAAAGGTGAAAATATTGTG 6 GCATTATTTTTGACATGCCTGTGGTTTGAATCACT[G/A]CTTTTTTTTATCATGATTTTTA TTCTAGAATGGTACCAAATTGTATAGTAAAGGCGAAGAACGAAAGGAAGCGAGTATACGTCG GTGAAGAATTATGTGAATGTGCTGATCGAAGCAGCCTATTCTTCGTATTA SC00006203 TCACCGAAATATTGTGGTAGAAGTTAGCGTGAGAAGTTGGACTCATATTAGTG[C/T]TATT 7 CATCGAATGGACATGGGAAAACAGTTACTCAGATAACTGTTCCTTTGCCCTGTGAATAAGGG CAGATTTAATCTTACGGTTACTGGTCTTCATGGCTGAACAACTT SC00010093 GTGGCGAGAAGAAAGAATAAGTATTATTTGAAAGATCAATATCCATTAATATGAGTGAACAA 8 TTGAATAGGACAATAGTTAAATGATAGAAGGTTTAACTCAATGGTTAA[A/G]TTTAAAAAG ATAAGGGAACTACTTCAGACAGGTCTTCGGCGCACGGAATCGGC SC00011215 CTTTGCTTATGATACAACTATTAACACTCAGTCTCTTGAAATACATGTGCATGTACAGATG 13 [T/C]TATAAAGACGTATAATACACAATAAATAAAAAATAGAGTAAACATTAGAACAATTTT ATAGATTAGAAAACTATTTACTGAAAAATTTACTGGTATTGATTA SC00012917 TTGTTCCATTGTTCAAAAACATTGTAATACTGTCAACTATTGCTTGGAACATGTTCTAGAAT 9 AATGGTTCATTGGC[G/C]ATTTGCCGTCATTAGTAATGTTAAAATAGTTTTAATCTGTAGT GGATTTGTGGCGGACGCAGTGGTTGATGCATCAGAATTGTTCCA SC00013602 GTGTGGTCGTCATTCGATTTGGACACGATTGGGACCCTACATGCATGCGAATGGATGAGGTT 14 AGGTTGTTCTCTAACATTTTGGCAAATTTTTTC[G/A]GGACAAACTACATATGCAAATCTT TTATAGACACTGTTCAAAATCGCTCCCAAAATCAAAAATTTCTC EN-Hb_oxid- TGGAGTTACCTGCCGCCATTTCATATATTGTCGTTTTAGATGCTTACTTGTCGCGGACTAAG 15 05173 GGAGAACCTCTTGGAAGACAAGCTCCGGCCCCTGGAAGACTTCCAACTACACCAGGCAGGAC TGGCAACCCTTCTATGAAGTTCACTGCAGGAAGCGGCTCACGAAGCCGAAAATAGCAATCTT TAATGTTTTACCC[G/T]CAATATTGATTAGTATTTTGCTTATGGCCCAATTTCTGAAATGC ATTTTACTATTGTATCATGCAATACAATAATCTTTAATATCGATTTTCATCATCAGAGAATG AAATTATTGCAACGAA EN-Hb_oxid- GCTTCATGGTTTTAGCCATACAATCGATGATGCCATTATAGGCATTCATGGTTTGTAGTCTA 10 11688 GCCTTGACTGTGTCCAGCGGATGTCCAACGAGAAGGCCTGCTCCTCCTAACATATTAAAGGT CATAGCCGATCTCGCCCGCCCCATTTTCTCAGCGTAAATAATCAATCGAACTACGAGAGGTC AACCAAACGGCTG[G/C]ACTGCTTATTGACAGTTTTGCTGTTAGCGTTCTCGTATTTTATA TTTGCACCTCATTATATTTTAGTTTGTCTAATTAAATATATGAACTAATTGATAAATAAATA GGTTCTTACTTC EN-Hb_oxid- CAAAAATTCCGATCAACATACTTTATACATTTTATCGTTATGAAGTCATTTATTCATTGACT 11 26008 GAGAAAAATATAAGTGAAGAGCCACTAATTAATCGATATATAAGTAGCTACAAGATTGATTT TTAATACTATTGTAAATAATAATTAGTTAAATGCATTGTAGCAAATTAAAA[G/A]CTAATG ATCTAAGAAAATCCCGGAAGAAAAGGATACGAAACGGTCATCTAACAACGCTATAATAATTA TGCAGTTTTAATTTTCTTGCTATTAAAAAATCGTAACAATAACATTGATACATATATATCGA TTAATTAGTGGCTCTTCACTTATATTTTTCTCAGTCAATGAATAAATGACTTCATAACGATA AAATGT EN-Hb_oxid- GTGTGGTAGTTTTATGTCACGAGCTGGAAGTAGACAGTCTTTCACAAGTTGATCCTTAACAA 16 56985 GTGTTTCATTGAAATGCCATAAACCTATAAAAAGACTTATGAATTTTTTCTGCTAACTAGGT CTCCGGTTTCGAATCCAATGAGAACGCGATAATAGGCTCTAATGGAAACCCAAAGATCTTTC ACTTGATCAGCCAC[G/A]GCATCAACTAAGGCTTCTTCGAAAGGCGTCTTTCCAGCAAAAC CAAACTTTCTGGCTAAATATCTTGCACCTGCATAGGATTGACCAATCTGTTTCCCATCAACC TCAAGGATAGGGACCTGTCCAAATGGCATTGTTGCTTTATACTTTGGCCACATGTCAATTGG TATGCGGTAATCTTCATACTCCTGGCCTGCTAG
Testing the Performance of HU2 and HU2-IL1 and the HUPT Cross Progeny

(68) After having chosen the HU2 strain as a candidate strain for nematodes breeding, an inbred lined derived from this strain (HU2-IL1) was additionally crossed with the highly virulent but low-surviving inbred line (PT1-IL), derived from the PT1 strain. The pooled progeny of this cross (hereafter HUPT) was also subsequently tested for its performance on the lab and on the field, together with the HU2 strain and the actual commercial line EN01.

Methods

(69) Virulence Screening in H. bacteriophora WT Strains and Inbred Lines Against Mealworm

(70) Mealworms (Tenebrio molitor) were used as hosts for the virulence characterization of H. bacteriophora WT materials. Nematode suspension volumes of 1.0 ml (Ringer's solution) from each strain and line containing 80, 200, 400, 800 and 2000 DJs ml-1 were inoculated in the middle of the Petri dishes and incubated at 25 C. for 7 days. Four replicates were done for each nematode quantity and strain. Infection by DJs was checked with the luminometer LUMAT LB 9501 (Berthold GmbH, Germany). The mean mortality by nematode infection of T. molitor was compared among 42 strains (40 strains+1 mutant strain+1 strain pool). Mortality data was used to calculate the lethal dose of DJs required to kill 50% of the insect larvae per assay (LD.sub.50).

(71) Virulence Screening in H. bacteriophora WT Strains and Inbred Lines Against the Western Corn Rootworm (Diabrotica virgifera)

(72) Parallel to T. molitor assays, sand biotests containing 20 D. virgifera virgifera larvae were set as described above calibrating the sand moisture to 10%. Larvae of Diabrotica virgifera virgifera were provided by BTL Bio-Test Labor GmbH Sagerheide (Gro Lsewitz, Germany). As a food source for WCR each Petri dish was supplied with a one-week old maize seedling (cultivar Ronaldinio). Nematode suspension volumes of 1.0 ml (Ringer's solution) from each tested strain and line containing 100, 200, 400, 800, 1600, and 3200 DJs ml-1 were inoculated. After seven days, the mortality of the larvae was confirmed as described above. Mortality data was used to calculate the lethal dose of DJs required to kill 50% of the insect larvae per assay (LD.sub.50).

(73) DJ-Persistence Characterization in Cross-Progenies and Selected Materials

(74) To evaluate the performance of materials selected along WP2. Persistence assays were carried out as described above. Each Petri dish was supplied with a one-week old maize seedling. Persistence was assessed using the following H. bacteriophora strains: PT1-IL1, HU2-IL1, HUPT and sel-HUPT. Nematode concentrations of 400, 800, 1,600, 3,200 and 6,400 DJs in 1 ml of Ringer's solution were inoculated in the middle of the plate and incubated at 25 C. inside a humidity box (with water at the base preventing the plates to dry out). After 3, 4 and 5 weeks of storage, twenty larvae (third instar) of D. virgifera virgifera were supplied along with a new maize seedling and stored at 25 C. After seven days, the mortality of insect larvae was observed and nematode infectivity was confirmed by checking luminescence using Luminometer. The LD.sub.50 for each replicate was calculated.

(75) Nematode Survival Estimation in Cross-Progenies and Selected Materials

(76) The persistence of H. bacteriophora DJs is influenced by the virulence and the survival over time from the tested strain. We determined the DJ-survival on the bioassays over time in our promissory materials. For this, petri dishes (150 mm) were filled with sand (150 g with 10% moisture) and provided with a one week old maize seedling per plate. Nematodes at amounts of 400 and 6400 DJs per petri dish were inoculated in several petri dishes per tested material. Petri dishes were stored at 15 C. and 25 C. The DJs were extracted from the entire 150 g sand out of each bioassay Petri dish using a stirring and decantation process (Cobb 1918). Subsequently DJs in aliquots of the decanted solutions were counted. This procedure was repeated over extended storage times. Dauer juveniles extracted on day 1 were taken as the starting population. The percentage of DJs that survived after 1, 2, 3 and 5 weeks of incubation was calculated. To check whether the reduction of infection rate after nematode incubation is due to DJs mortality and/or declined virulence, LD.sub.50 was recalculated based on the survival data over time.

(77) Assessment of Persistence of H. bacteriophora Strains Under Semi-Field Conditions

(78) In order to assess the persistence of the studied strains under intermediary conditions between lab and field, trials with maize plants were carried out in wood containers under uncontrolled environmental conditions in the outdoor area of the applicant. Two independent trials were launched. Within each trial, wood containers had space for four pots of 292925 cm. Each pot received a tiny layer of stones and was fully filled with soil. The initial soil moisture was adjusted to 45% water content. Soil moisture and temperature were monitored by a mini-logger (PlantCare Ltd., Russikon, Switzerland). Three nematode materials were selected for the first semi-field trials: the commercial strain EN01, the high-longevity and virulent strain HU2, and the selected cross progeny sel-HUPT. The strains were tested at two application dosages (1109 and 2109 DJs ha-1). The first trial started in April 2017 whereas the second trial was started by the end of May 2017. In the second trial, the non-selected cross progeny HUPT, and the parental inbred line with high virulence and longevity HU2-IL1 were also included. Five replicates were done per strain in each trial. Pots were randomly distributed over nine and fourteen containers in the first and second experiment, respectively. Nematode persistence was assessed up to 71 days after inoculation of nematodes by non-destructive baiting as previously described. Seven days after each baiting event, tubes were removed from the soil and the insect mortality was recorded. Dead insects were individually checked for luminescence of the symbiotic bacteria under a luminometer.

(79) Field Trials for the Control of the Western Corn Rootworm

(80) For field trials, the high-virulent and high-longevity H. bacteriophora HU2 strain was chosen, along with the commercial strain EN01. Dauer juveniles of both strains were produced in large volume fermenters (500 and 3.000 litres) and were harvested and formulated according to the ENE SOP.

(81) Nematode Efficacy in Naturally Infested Field Plots (Styria, Austria) in 2016 and 2017

(82) Field trials were carried out to evaluate the efficacy of the HU2 and EN01 strain in Austrian locations (Styria) along the maize growing seasons of 2016 and 2017. Nematodes were applied in two with western corn rootworm naturally infested maize field at the sites Unterschwarza and Lichendorf. In 2016, nematode treatments consisted on DJ applications of strains HU2 and EN01 at the commercial dose (2109 DJs ha-1). Additionally, a combination of EN01 with Rhizovital was evaluated aside untreated controls and parcels treated with the chemical insecticide Belem. In the field trials of 2017 treatments consisted of the two above mentioned H. bacteriophora strains at two application dosages (1109 and 2109 DJs ha-1) aside untreated controls and parcels treated with the chemical insecticide Belem. For both seasons, study parcels consisted of 30 rows of 30 m length for nematode treatments and 12 rows for untreated control. The number of emerged beetles in all parcels was determined by the use of photoeclectors. The plants damage level registered at plant maturity. Plants were rated according to the degree of stem inclination into: upright plants, plants with inclined stems, and plants with gooseneck stem. Soil baiting from the different parcels was done using the Falcon tube method described above. Baiting was done 9 weeks after nematode application. Each Falcon tube received 18 g of soil, ten T. molitor larvae, and one maize seedling. Tubes were buried at 10 cm deep in the soil and left in soil contact for 10 days. Baiting was done at five replicates per treatment. At the end of the baiting period, tubes were recollected and shipped to ENE, where the infection of T. molitor larvae with EPNs was recorded.

(83) Nematode Efficacy in Artificially Infested Field Plots (CABI, Hungary) in 2016 and 2017

(84) Field trials were conducted as well in Hungary in 2016 and 2017. The trials were carried out in each maize growing season in two conventionally managed maize fields, referred to as field Q and R for 2016, and referred to as S and T for 2017 trials. The field site is located southeast of Kondoros village in the Bekes County in Southern Hungary. Both fields had no natural population of western corn rootworm due to crop rotation, i.e. Triticale, had been planted the previous season, thus interrupting the pest life cycle. All fields had been ploughed in autumn of the previous cropping season and they were tilled and harrowed on April of both trial years. Sowing was carried out on the 18th and 25th of April 2016 and 2017, respectively. In 2016, treatments consisted of DJs of strains HU2 and EN01 at the commercial dose (2109 DJs ha-1), aside parcels treated with the insecticide Cypermethrin and untreated controls. In 2017 Treatments consisted on the two H. bacteriophora strains mentioned above at the doses of 1109 and 2109 DJs ha-1. In each field, 4 parcels of 6 rows (4.520 m each) were used per treatment and 5 parcels for the controls. Following, D. v. virgifera eggs were infested in treated and untreated plots (control). Among the 4 middle rows, 26 successive maize plants (1.2 meters) were randomly chosen of each of the 6-row wide plots and were infested with 500 ready-to-hatch D. virgifera eggs per plant. Eggs were applied into two 100 to 140 mm-deep holes at a distance of 110 to 190 mm from both sides of the plant, deep into the soil towards the maize roots. Assessment of nematode persistence was done using the Falcon tube baiting method, ten replicates per treatment and control. All together 10 tubes5 treatments2 fields=100 tubes were put into the field. Assessment of treatment efficacy in reducing D. v. virgifera was done by cutting 6 consecutive plants for all treatments and covering them with gauze cages (Toepfer et al. 2008) at the predicted beetle emergence time. Adult emergence within the cages was recorded weekly following the procedures outlined in the EPPO standards for this pest. Root damage was assessed in dog-out plants using the EPPO scale (Anonymous, 1999) and the traditional Iowa scale (Hills and Peters, 1971). Field trials in Hungary were performed by CABI (Stefan Toepfer).

(85) Results on Nematode Performance

(86) Virulence Comparison Between the H. bacteriophora Commercial Line and the Lines Derived in the Course of BIOCOMES WP2.

(87) The virulence of the materials developed along the BIOCOMES WP2 was tested in comparison to the current commercial line. For this characterization, DJs from the EN01, HU2, HU2-IL1, HUPT and sel-HUPT were grown in parallel under sterile liquid culture conditions. After standard sand bioassays all the tested H. bacteriophora materials were able to infect T. molitor and D. v. virgifera. On T. molitor, significant differences were observed among the LD.sub.50 (F=5.09; df=4, 44; P0.002). Against this host, LD.sub.50 values ranged from 1.7 to 36.5 DJs per mealworm larva (FIG. 7). The virulence of sel-HUPT (LD.sub.50=6.51.1) and HU2-IL1 (LD.sub.50=5.10.37) was significantly lower than the commercial strain EN01. An intermediate virulence was recorded for HU2 (LD.sub.50=10.541.17) and the HUPT pool (LD.sub.50=8.130.78). No significant difference between strain infectivity was observed against D. v. virgifera (F=2.295; df=4, 17; P0.101). However, the lowest LD.sub.50 was observed for HU2-IL1 (8.251.71 DJs per insect) and HUPT (10.80.86 DJs per insect).

(88) Persistence Evaluation in Sand Bioassays

(89) The LD.sub.50 of our selected H. bacteriophora strains was assessed after six weeks of DJs inoculation in sand plates at 17 C., followed by one week of incubation at 25 C. in presence of twenty Diabrotica virgifera larvae. Subsequent to the assay, the number of living DJs on the plates was determined, and was used as correction factor for the LD.sub.50 (corrected-LD.sub.50). An overview of the non-corrected LD.sub.50 (based on inoculated DJs) and the corrected LD.sub.50 against western corn rootworm larvae is depicted in FIG. 8. After six weeks, all the tested H. bacteriophora strains presented corrected-LD.sub.50 values lower than 10 DJs per insect. Uncorrected-LD.sub.50 ranged between 63.716.2 and 22.94 DJs per insect. The higher number of living DJs extracted from the soil was found for HU2-IL1 whereas the lowest was found for sel-HUPT (data not-shown). The highest virulence after the incubation time was determined for the HU2 and sel-HUPT materials, with LD.sub.50 values of 10.2 and 3.351.8 DJs per insect, respectively. Both corrected and uncorrected data followed similar pattern for LD.sub.50, wherein the strains EN01 and sel-HUPT presented the highest LD.sub.50 (lowest virulence) and lowest LD.sub.50 (highest virulence), respectively. Due to experimental variability, the difference between strains was statistically not significant (F=1.122; df=4; P0.222 and F=2.076; df=4; P0.440 for uncorrected and corrected data, respectively).

(90) Persistence Evaluation in Soil Pot Bioassays

(91) Parallel to sand bioassays, evaluation of the persistence in soil pots of two strains characterized along BIOCOMES WP2 (HU2, sel-HUPT) was compared with the current commercial strain EN01 (FIG. 9). The experiment was conducted in the ENE laboratory at room temperature conditions (252 C.). Nematodes were applied at doses representing the commercial application (2109 DJs ha-1) and half of the required DJs (1109 DJs ha-1). Nematode persistence was assessed according to the number of infected bait insects (T. molitor or D. v. virgifera) over 63 days after nematodes application. After 21 days of DJ application, to most drastic differences between strains and doses were observed. For D. v. virgifera, the highest infection percentage was observed for sel-HUPT (47.87.1) with half of the commercial dose, whereas the lowest infection percentage was observed for the commercial strain EN01 with the commercial dose (no infection registered). For T. molitor, the highest infection percentage was determined for sel-HUPT with the commercial dose (37.07.1), whereas the lowest infection percentage was determined for the commercial strain with half of the commercial dose (4.43.0). Forty-two days after DJs application, only few insects were found infected. No significant differences were determined when comparing both doses against the same host, with exception of sel-HUPT against T. molitor (F=7.9; df=1; P0.022). A positive correlation between T. molitor and D. v. virgifera larval mortality due to overtime nematode infection was observed (R2=0.8435; P0.0001).

(92) Persistence Evaluation in Semi-Field Conditions

(93) Semi-field experiments were carried out at ENE under free environment conditions for the persistence evaluation. Two experiments were carried out in April and May respectively. The experiment started in April was exposed to unfavourable cold temperatures after sowing, not representing the real application scenario whereas the May trial went under favourable conditions (hereafter analysed in detail). For the current experiments, the baiting method based on falcon tubes was used as described under materials and methods. For this experiments, only T. molitor larvae were used for baiting. Along the May trial, bait mortality declined along time (cf. FIG. 10). Twenty-one days after DJs application in the semi-field pots, the insect mortality dropped abruptly down to an overall infectivity lower than 10%. At this time a significant difference in bait mortality for the strain HU2-IL1 was determined in relation to the commercial strain EN01 (P0.036) and HU2 (P0.047). In general, mortality due to nematode infection ranged from 286.4 to 346.7 percent of infected insects. Further on, 42 days after DJs application, insect mortality was only determined by baiting pots inoculated with HU2-IL1 applied at 2109 DJs ha-1 (FIG. 10). At the last baiting time (71 days after DJs application), only positive baiting was detected in pots inoculated with sel-HUPT and HU2-IL1 DJs. Pots infected with half of the commercial dose of sel-HUPT DJs presented one sample containing infected insects (22% of insect mortality), whereas no infectivity was recorded with the commercial dose. In pots inoculated with HU2-IL1 DJs, insect mortality due to nematode infection ranged from 16.65.3 to 23.36 percent; here most of the samples (60-80%) presented at least one infected insect (Table 3).

(94) Persistence Evaluation from Baiting in Field-Trials in 2017

(95) In the final stage of BIOCOMES WP2, evaluation of promissory materials in field trials was carried out. For this purpose, the strain HU2 was chosen in first instance. The overall performance of this strain was higher than the current commercial strain EN01. In 2016 and 2017 both strains were produced in parallel in large fermenters and were applied in Austrian and Hungarian sites. Concerning 2017, the strains were applied in maize field trials in Austria (field sites Unterschwarza and Lichendorf) and in Hungary (field sites Kondoros S and Kondoros T). In 2017 both strains were applied at the commercial dose (2109 DJs ha-1) and the reduced dose (1109 DJs ha-1). Concerning the Austrian sites in Styria, on the Unterschwarza fields, no significant differences were observed on application dosage (K=3.652; df=3; P0.302). In general, insect mortality due to nematode infection in the field was higher for the strain HU2, ranging from 646.9 and 647 percent, whereas for the commercial strain EN01 insect mortality ranged from 287.1 to 336.7 percent (FIG. 11). In this site, control parcels (no DJ application) yielded not infected hosts. In the Lichendorf site, the current commercial strain yielded higher infection rates after baiting. Insect mortality by nematode infection ranged between 406.9 to 706.5 percent (EN01) and 63.3 to 286.3 percent (HU2). Differences between strains were significant (F=7.969; df=11.449; P0.012). Concerning the application dose, no significant differences were determined (EN01: F=2.161; df=1, 8; P0.180; HU2: F=2.839; df=1, 8; P0.130).

(96) In Hungary in 2017, two fields were analysed in the Kondoros site (field T and Field S). In the Kondoros field S, significant differences in insect mortality were found between parcels where DJs were applied in comparison to control parcels (K=14.82; df=3; P0.002). In this site, the HU2 strain presented higher infection rate after baiting (31.784.65 to 31.785.2 percent of infected insects) compared to EN01 (82.78 to 173.79 percent of infected insects), as shown in FIG. 11. This infection rate was significant from DJs of the strain HU2. Considering the application dose, significant differences were only observed for strain EN01 (K=5.78; df=1; P0.016). Considering the applied dose, a higher number of infected tubes were observed for the highest application dosage in the field Kondoros S, whereas no differences were determined for Kondoros field T. Despite the high variability associated to field trials, the HU2 strain showed in general (3 out of 4 fields) a better performance that EN01 using the commercial dose (2109 DJs ha-1), whereas in 2 out 4 fields the performance was better than EN01 using half of the commercially applied DJs (FIG. 11)

(97) Trials in Fields Naturally Infested with WCR (Styria, Austria, 2016 and 2017)

(98) Main Results from Field Trials on 2016

(99) Field trials were carried out in two field sites in Austria: Unterschwarza and Lichenhof. For both strains, the commercial dose was used (2109 DJs ha-1). Parcels treated with the chemical insecticide Belem, and untreated controls were evaluated. Additionally, a mixed treatment (EN01 DJs+Rhizovital) was evaluated. Concerning the registered number of emerging D. v. virgifera beetles, parcels treated with DJs of the HU2 strain showed less number of beetles in both evaluated field sites compared to the chemical control. Concerning the commercial line performance, the results show a same level with Belem. As may be expected, untreated controls showed the highest number of registered emerging D. v. virgifera beetles (FIG. 12). Concerning the aspect of the plants on the treated parcels, no major differences on the treatments were observed on the Unterschwarza field site, whereas in the Lichendorf field site, the proportion of upright plants was higher in the parcel treated with HU2 DJs (96.3%). In this field the lowest proportion of healthy plants was shown in the parcel treated with Belem (76.1%) followed by the control parcel (81.7%) as shown in FIG. 13. In general the performance of the DJ treatment was equal or better than the chemical control. The lower number of emerged beetles in contrast to EN01 and the higher proportion of upright plants determined for parcels treated with HU2 strain indicate a general better performance of this material.

(100) Main Results from Field Trials on 2017

(101) The field trials in the Austrian locations in 2017 were evaluated for pest parameters as well as plant appearance. Concerning pest parameters, the number of emerging beetles was surveyed in the Unterschwarza and Lichendorf sites. In Unterschwarza, no significant differences were observed in the number of emerged D. v. virgifera beetles, neither for the treatment, nor for the strain or the DJ dose (FIG. 14). However, parcels treated with HU2 DJs either at 1109 DJs ha-1 or 1109 DJs ha-1 showed the lowest numbers of emerging beetles (FIG. 14). In the Lichendorf site, results showed an improved performance on HU2 compared to the other DJ treatments, to the chemically treated parcels, and the non-treated parcels (FIG. 14). Regarding appearance of the plants, parcels with DJ treatment showed either comparable results or better performance than parcels treated with chemical insecticide Belem. In both sites, Unterschwarza and Lichendorf, HU2-treated field showed plants with the least damage (FIG. 15). In parcels were HU2 DJs were applied, at least 70% of the evaluated maize plants where in upright position, whereas the percentage of healthy plants was lower in untreated fields. Interestingly, in both field sites both of the HU2 doses were better than the chemical treatment (cf. FIG. 15).

(102) Trials in Fields Artificially Infested with Diabrotica virgifera virgifera (Hungary, 2016 and 2017)

(103) Main Results from Field Trials on 2016

(104) Results from field trials in the Hungarian sites in 2017 revealed that both nematode strains largely and comparably reduced D. v. virgifera populations after survey of adults emerged per 100 applied D. v. virgifera eggs per plant. The efficacy of EN01 ranged from 74 to 84% (Mean 79.1%), whereas HU2 showed an efficacy of 60 to 97% (Mean 78.7%). Interestingly, in the parcels controlled with the chemical insecticide Cypermethrin the efficacy of the treatment against D. v. virgifera was only of 35.4% (FIG. 16). Concerning the plants degree of damage, for parcels where nematodes were applied only 7 to 16% prevention in root damage was achieved according to the Iowa Scale (FIG. 17). Also in this case, the level of prevention determined in parcels treated with Cypermethrin was even lower.

(105) Main Results from Field Trials on 2017

(106) Similarly to the field trials in 2017 carried out in the Austrian locations, field trials in Hungary in this year were carried with the nematode strains EN01 and HU2 at the commercial dose (2109 DJs ha-1) an the reduced dose (1109 DJs ha-1). Concerning adult emergence after artificial egg infestation, both nematode strains reduced D. v. virgifera populations at both application dosses (EN01=28 to 57%, HU2=49 to 66% efficacy) compared to the untreated parcel. However, discrepancies were observed among fields (FIG. 18). No measurable results were observed for EN01 at 2109 DJs ha-1 in one parcel of field S, whereas the same phenomenon was observed for HU2 at 1109 DJs ha-1 in one parcel of field T. Thus no major conclusions could be withdrawn by comparing both strains at both DJ-doses. As observed in the previous year, the insecticide Cypermethrin showed only 422% control efficacy against D. v. virgifera. Overall, only the only parcels with HU2 applied at 2109 DJs ha-1 showed significant reduction of plant damage (27%). However, this reduction was higher than the level achieved by Cypermethrin (12% damage prevention), as shown in FIG. 19. Despite the variability on the observed results, general better performance of the HU2 strain compared to the chemical insecticide and to the current commercial strain can be suggested. This result is supported by the data from parallel field trials carried out in the Austrian sites shown in the previous sections.

(107) Evaluating the Storage Potential of New Strains Against the Commercial EN01 Strain

(108) Apart from field trials, the storage potential after powder formulation was evaluated in HU2 and related strains in comparison to the commercial strain. For this, both strains were industrially produced in 500 and 3000 L fermenters. Normally, DJs are stored only for very short time in powder before they are delivered. With this row of experiments, the possibility of prolonged storage was assessed.

Methods

(109) Powder Formulation of DJs

(110) For DJs grown in liquid cultures or fermenters, washed DJs from HU2 and EN01 were formulated at 1106 DJ g-1. The formulated nematodes were packed in 5 g zip locked plastic bags. Pinholes were made for each bag to provide aeration inside the bags. HU2 and EN01 were packed in 25 g samples in plastic bags.

(111) Survival of Formulated DJs

(112) To determine the percentage survival along time of DJs produced in bioreactors, formulated nematodes were re-suspended periodically after the formulation date by dissolving the complete sample from one bag in 1 L tap water per gram of formulated powder. Thereafter, 20 l aliquots from the dissolved DJs were counted under the microscope using a counting chamber. Measurements were done for each sample in triplicate. Total active and not-active nematodes were registered for each aliquot. The percentage of survival was calculated using the formula: the total living IJs g-1*100 divide by number of nematodes at the start of the experiment.

(113) DJ-Longevity on Formulated DJs

(114) Oxidative stress assays were performed with nematodes (HU2 and EN01) extracted from the formulation Infective juveniles were transferred to 24-cell wells in 400 l final volume containing 3,000 IJs per cell well and kept at 25 C. For each tested strain, four H.sub.2O.sub.2 dosages were applied in three technical replicates (0, 40, 80, and 100 mM H.sub.2O.sub.2 final concentration). Dosages and strains were arranged in a randomized manner. Infective juvenile survival was recorded for a period of 12 days after stress induction by counting living and dead individuals in a counting chamber (20 l aliquots from each assay). The IJs mortality was used to determine the mean tolerated H.sub.2O.sub.2 dose (LC50H.sub.2O.sub.2) for each line.

(115) Virulence in Post-Formulated DJs

(116) DJs suspensions were cleaned from the formulation powder by cotton trapping. Thereafter, the IJs density was counted as described above. Bioassays were carried out in 15 cm diameter Petri dishes filled with sand as previously described for LD.sub.50 calculation. Control plates received 1 ml Ringer's solution.

(117) Results on Performance of Long-Term Formulated DJs

(118) Post-Formulation Survival in the HU2 and EN01 Strain

(119) The post-formulation survival of HU2 and EN01 after cold storage (6 C.) was monitored for a period of two months (60 days). The percentage of surviving nematodes over storage time is documented in (FIG. 20). For both strains the mayor decrease in the percentage survival was observed one week after formulation. For the HU2 strain a decrease in survival was observed from 96% down to 62% in these first 7 days. For EN01, the survival decreased from 85% down to 66% in the same time period. Between the 2nd and the 8th weeks, the survival for both strains decreased at lower rate. At the day 62, the HU2 and EN01 strains presented survival percentages of 51 and 57, respectively. No significant differences in the survival were determined between the strains after test at the latest time point.

(120) Post-Formulation Oxidative Stress Tolerance Strains HU2 and EN01

(121) As a second parameter to estimate the performance of the HU2 strain in comparison to EN01, the oxidative stress bioassay was carried out along the cold-storage time of 30 and 45 days with IJs extracted from the formulation. The mean H.sub.2O.sub.2 concentrations (LC50) lethal for 50% of the population after 12 days treatment was assessed (FIG. 21). After 30 days of cold storage in formulation, LC.sub.50 values of 794 mM and 433 mM H.sub.2O.sub.2 were determined for HU2 and EN01, respectively. This large difference in LC50 values between both strains was conserved also after 45 days of storage. At this time point, the LC50 values of 783 and 473 were determined for HU2 and EN01, respectively. The differences in H.sub.2O.sub.2-tolerance between both strains were significant (F=217.7, df=1, P<0.05). These results suggest that DJs from the HU2 strain conserve a better longevity potential than EN01 after cold storage.

(122) Virulence of Post-Formulated DJs of HU2 and EN01

(123) The mean lethal dose per insect for IJs of both strains was determined after 30, 45, and 62 days of storage (FIG. 21). After 30 days of storage, a LD.sub.50 of 14 and 8 DJs per insect were determined for EN01 and HU2, respectively. After 45 days, the LD.sub.50 increased for both strains (the virulence decreased) but not in the same dimension. At this time point, the EN01 LD.sub.50 increased to 32 IJs per insect, whereas the LD.sub.50 for HU2 slightly increased to 11 IJs per insect. The tendency concerning the large LD.sub.50 differences between lines relative to each other was conserved after 62 days of storage. However, both LD.sub.50 values decreased in relation to the previous measurement. At this observation time point, LD.sub.50 values of 5 and 19 IJs per insect were determined for HU2 and EN01, respectively. After statistical analysis, significant differences in virulence between HU2 and EN01 strains were confirmed for storage after 30 days (DF=1, P0.05, HSD=3.927), after 45 days (ANOVA, DF=1, F=19,612, P<0.011, HSD=3.927) and after 62 days (ANOVA, DF=1, F=100.3, 0.008, HSD=3.927).

LITERATURE

(124) Bai X., Adams B J, Ciche T A, Clifton S, Gaugler R, Hogenhout S A, Spieth J, Sternberg P W, Wilson R K, Grewal P S (2009) Transcriptomic analysis of the entomopathogenic nematode Heterorhabditis bacteriophora TTO1. BMC genomics 10:205. Cobb N A (1918) Estimating the population of the soil, with special reference to the sugar-beet and root-gall nemas, Heterodera schachtii Schmidt and Heterodera radicicola (Greef) Muller, and with a description of Tylencholaimus aequalis n. sp. USDA, Agricultural Technical Circle 1:1-47. Ehlers R-U (2001) Mass production of entomopathogenic nematodes for plant protection. Applied Microbiology and Biotechnology 56:623-633. Ehlers R.-U, Oestergaard J, Hollmer S, Wingen M, Strauch O. (2005). Genetic selection for heat tolerance and low temperature activity of the entomopathogenic nematodebacterium-complex Heterorhabditis bacteriophora-Photorhabdus luminescens. Biocontrol 50, 699-716. Elshire R J, Glaubitz J C, Sun Q, Poland J A, Kawamoto K, Buckler E S, Mitchell S E (2011) A robust, simple genotyping-by-sequencing (GBS) approach for high diversity species. PloS one 6: e19379. Grewal P S, Wang X, Taylor R A J (2002). Dauer juvenile longevity and stress tolerance in natural populations of entomopathogenic nematodes: is there a relationship? International Journal for Parasitology 32, 717-725. Grewal P S, Ehlers R-U, Shapiro-Ilan D I (Eds) (2005a). Nematodes as biocontrol agents. Wallingford, UK, CAB International. Grewal P S, Peters A (2005). Formulation and quality control of entomopathogenic nematodes. In: Grewal, P. S., Ehlers, R.-U. & Shapiro-Ilan, D. (Eds). Nematodes as biocontrol agents. Wallingford, UK, CAB International, pp. 79-90. Hills T M, Peters D C (1971) A method of evaluating post planting insecticide treatments for control of western corn rootworm larvae. Journal of Economic Entomology 64:764-765. Iraki N, Salah N, Sansour M A, Segal D, Glazer I, Johnigk S A, Hussein M A, Ehlers R-U (2000) Isolation and characterization of two entomopathogenic nematode strains, Heterorhabditis indica (Nematoda, Rhabditida), from the West Bank, Palestinian Territories. Journal of Applied Entomology 124:375-380. Kiss J, Komaromi J, Bayar K, Edwards C R, Hatala-Hsellr I (2005) Western Corn Rootworm (Diabrotica virgifera virgifera LeConte) and the crop rotation system in Europe. In: Vidal S, Kuhlmann U, Edwards C R (Eds) Western Corn Rootworm: Ecology and Management. Wellingford, UK. CAB International pp. 189-220. Krysan J L, Smith R F (1987) Systematics of the virgifera species group of Diabrotica (Coleoptera: Chrysomelidae: Galerucinae). Entomography 5:375-484. Long S J, Richardson P N, Fenlon J S (2000) Influence of temperature on the infectivity of entomopathogenic nematodes (Steinernema and Heterorhabditis spp.) to larvae and pupae of the vine weevil Otiorhynchus sulcatus (Coleoptera: Curculionidae). Nematology 2:309-17. Mukuka J, Strauch O, Ehlers R-U (2010) Variability in desiccation tolerance among different strains of the entomopathogenic nematode Heterorhabditis bacteriophora. Communications in Agricultural and Applied Biological Sciences 73:669-72. Mukuka J, Strauch O, Nellas Sumaya N H, Ehlers R-U (2010b) Improvement of heat and desiccation tolerance in Heterorhabditis bacteriophora through cross-breeding of tolerant strains and successive genetic selection. BioControl 55:511-521. Poinar G O (1975) Description and Biology of a new Insect parasitic Rhabditoid, Heterorhabditis bacteriophora N. Gen., N. Sp. (Rhabditida; Heterorhabditidae N. Fam.). Nematologica 21:463-470. Regeai S, Dolan K, Fitzpatrick D A, Browne J, Jones J, Burnell A (2009) Novel primers for the amplification of nuclear DNA introns in the entomopathogenic nematode Heterorhabditis bacteriophora and their cross-amplification in seven other Heterorhabditis species. Molecular ecology resources 9:421-424. Shapiro-Ilan D I, Hazir S, Lete L (2015) Viability and virulence of entomopathogenic nematodes exposed to ultraviolet radiation. Journal of Nematology 47:184-189. Strauch O, Oestergaard J, Hollmer S, Ehlers R-U (2004) Genetic improvement of the desiccation tolerance of the entomopathogenic nematode Heterorhabditis bacteriophora through selective breeding. Biological Control 31:218-226. Sumaya N H, Aryal S, Vandenbossche B, Barg M, Doerfler V, Strauch O, Molina C, Ehlers R-U (2017) Phenotyping dauer juvenile oxidative stress tolerance, longevity and persistence within wild type and inbred lines of the entomopathogenic nematode Heterorhabditis bacteriophora. Nematology. Sumaya N H, Gohil R, Okolo C, Addis T, Doerfler A, Molina C, Ehlers R-U (2017b) Applying inbreeding, hybridization and mutagenesis to improve oxidative stress tolerance and longevity of the entomopathogenic nematode Heterorhabditis bacteriophora. Journal of Invertebrate Pathology (in revision). Toepfer S, Gueldenzoph C, Ehlers R U, Kuhlmann U (2005) Screening of entomopathogenic nematodes for virulence against the invasive western corn rootworm, Diabrotica virgifera virgifera (Coleoptera: Chrysomelidae) in Europe. Bulletin of entomological research 95:473-82. Toepfer S, Peters A, Ehlers R-U, Kuhlmann U (2008) Comparative assessment of the efficacy of entomopathogenic nematode species at reducing Western Corn Rootworm larvae and root damage in maize. Journal of Applied Entomology 132:337-348. Toepfer S, Burger R, Ehlers R-U, Peters A, Kuhlmann U (2010) Controlling western corn rootworm larvae with entomopathogenic nematodes: Effect of application techniques on plant-scale efficacy. Journal of Applied Entomology 134:467-480. Vadnal J, Ratnappan R, Keaney M, Kenney E, Eleftherianos I, O'Halloran D, Hawdon J M (2017) Identification of candidate infection genes from the model entomopathogenic nematode Heterorhabditis bacteriophora. BMC Genomics, 18:8.