VECTOR SYSTEM FOR TRANSFORMATION OF CHLORELLA VULGARIS, AND TRANSFORMATION METHOD FOR CHLORELLA VULGARIS
20250122511 ยท 2025-04-17
Inventors
Cpc classification
C12N15/79
CHEMISTRY; METALLURGY
International classification
C12N15/74
CHEMISTRY; METALLURGY
Abstract
The present invention relates to a vector system for transformation of Chlorella vulgaris, a Chlorella vulgaris transformation method using same, and a Chlorella vulgaris transformant.
Claims
1.-27. (canceled)
28. A promoter for Coccomyxa C-169 ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) small subunit 2 (rbcS2) gene.
29. The promoter according to claim 28, wherein the promoter comprises the nucleotide sequence of SEQ ID NO: 2.
30. A recombinant vector comprising the promoter of claim 28.
31. The recombinant vector according to claim 30, wherein the vector comprises a target protein-encoding nucleotide sequence.
32. The recombinant vector according to claim 30, wherein the vector comprises a terminator sequence of Coccomyxa C-169 rbcS2 gene.
33. The recombinant vector according to claim 31, wherein target protein-encoding nucleotide sequence is operatively linked to the promoter.
34. The recombinant vector according to claim 32, wherein the terminator sequence comprises the nucleotide sequence of SEQ ID NO: 3.
35. The recombinant vector according to claim 30, wherein the vector further comprises a gene resistant to an antibiotic as a selectable marker.
36. The recombinant vector according to claim 30, wherein the vector further comprises a gene coding for a reporter molecule.
37. The recombinant vector according to claim 35, wherein the reporter molecule is at least one selected from the group consisting of a growth-promoting protein, a fluorescent protein, and a hydrolase.
38. A method for producing a Chlorella transformant comprising: a transformation step of introducing the vector of claim 30 into Chlorella.
39. The method according to claim 38, wherein the transformation step is performed using gold particles bombardment.
40. The method for producing a Chlorella transformant according to claim 38, wherein the cell stage in the transformation step is a log phase.
41. The method for producing a Chlorella transformant according to claim 40, wherein the log phase is when the OD686 value is 0.4 to 0.6.
42. The method for producing a Chlorella transformant according to claim 38, wherein the cell density in the transformation step is 5.0*10.sup.6 to 8.0*10.sup.7 per 60 mm Diameter.
43. The method for producing a Chlorella transformant according to claim 38, wherein the vacuum in the transformation step is 27.0 to 29.0 inches Hg.
44. The method for producing a Chlorella transformant according to claim 38, wherein the target distance in the transformation step is 3 to 9.
45. The method for producing a Chlorella transformant according to claim 38, wherein the pressure in the transformation step is 1200 to 1300 psi.
46. A Chlorella transformed with the vector of claim 30.
47. The Chlorella according to claim 46, wherein the Chlorella is Chlorella vulgaris.
Description
BRIEF DESCRIPTION OF DRAWINGS
[0076]
[0077]
[0078]
[0079]
[0080]
[0081]
[0082]
[0083]
[0084]
[0085]
[0086]
[0087]
BEST MODE FOR CARRYING OUT THE INVENTION
[0088] A vector system for transformation of Chlorella vulgaris, comprising: [0089] a promoter for Coccomyxa C-169 ribulose-1,5-bisphosphate carboxylase/oxygenase (RuBisCo) small subunit 2 (rbcS2) gene; [0090] a target protein-encoding nucleotide sequence; and [0091] a terminator sequence of Coccomyxa C-169 rbcS2 gene.
MODE FOR CARRYING OUT THE INVENTION
[0092] A better understanding of the present disclosure may be obtained through the following examples that are set forth to illustrate, but are not to be construed to limit the present disclosure.
Preparation Example 1
Plasmid Construction and Cloning
[0093] The sequence of the bleomycin resistance gene (Sh ble) was obtained from the genomic DNA of Streptomyces verticillus. A promoter sequence for Coccomyxa C-169 rbcS2 gene and a terminator sequence of for Coccomyxa C-169 rbcS2 gene were joined to the 5 and 3 ends of Coccomyxa C-169 rbcS2, respectively, to synthesize the entire sequence Sh-ble (GenScript, USA). The synthesized gene was treated with restriction enzymes Swa I and Kpn I and then inserted into the pSP124S vector. The obtained plasmid was named pKA650, and the vector map thereof is represented in
[0094] As can be seen in
Preparation Example 2
Transformation of Chlorella Vulgaris
2-1 Transformation Using Glass Bead Method
[0095] A Simple and Rapid Glass Bead Transformation Method was used through glass beads. In this method, glass beads are added to cells and physical force is applied to create holes in the cell membrane through physical friction with the cell, thereby introducing a desired plasmid into the cells.
[0096] The experiment was conducted according to the conditions described in Table 1. Specifically, cells were lysed at room temperature (25 C.) by vortexing with glass beads. Then, beads and supernatant were separated by gravity, and DNA was added to the supernatant. Next, recovery was carried out by slowly rotating at 37 C. After applying onto an antibiotic-containing solid medium, transformants were confirmed. The results are shown in
TABLE-US-00001 TABLE 1 Cell Concen- Amount Date OD686 Number tration of DNA Vortexing Results 160810 0.1 1*10.sup.6 1*10.sup.8 10 ug 15 sec NO cells/ml cells/ml linearized 160811 0.3 1*10.sup.6 1*10.sup.8 10 ug 10 sec NO cells/ml cells/ml linearized 160816 0.3 1*10.sup.7 1*10.sup.9 10 ug non- 20 sec NO cells/ml cells/ml linearized
[0097] As shown in
2-2. Transformation Using Gene Gun Method
[0098] Transformation was carried out by the plant transformation technique gold particle bombardment using a gene gun. This technique, also referred to as microprojectile acceleration or biolistics, and the gene gun is officially called microparticle bombardment. In the method, transformation is performed by coating a plasmid with micro particles. The micro particles, being very heavy relative to their size, penetrate the cells effectively. By shooting the micro particles towards the cells at high speed and surrounding them with a steel net, more particles are directed towards the cells. The DNA coated with the micro particles that enter the cells are released and can integrate into the plant's genome. For use in transformation, gold particles can be used as the micro particles.
[0099] Specifically, experiments were carried out using gold particle bombardment for transformation under various conditions shown in Table 2, below. The experiments were performed in consideration of cell stages and concentrations, shooting ranges of gold particles, target distances, and experimental environments of cells, while the vacuum and helium pressure conditions were fixed.
[0100] During the condition-establishment process, the experiments were performed on dishes with diameters of 47 mm, 50 mm, and 60 mm in consideration with the gold particle range and pressure of the gene gun, and the appropriate Target Distance was established as Target Distance 3. Also, as the cell stage advances, the algal membrane thickens, making experiments difficult. Thus, experiments were conducted considering changes in OD values from the initial stage. Additionally, cell density was adjusted according to the diameter.
TABLE-US-00002 TABLE 2 Heli- Vacuum Target um (inches Dis- Pres- Re- Date OD686 Cell Density Hg) tance sure sults 160603 0.5 4.0*107 per 60 mm 29 3, 6, 9 1300 NO Diameter 160607 0.7 6.0*107 per 50 mm 29 3 1300 NO Diameter 160607 0.7 6.0*108 per 50 mm 29 6 1300 NO Diameter 160607 0.7 6.0*109 per 50 mm 29 9 1300 NO Diameter 160613 0.074 3.6*106 per 50 mm 29 3, 6, 9 1300 NO Diameter 160614 0.1 3.6*106 per 50 mm 29 3.6.9 1300 NO Diameter 160615 0.2 3.5*106 per 50 mm 29 3.6.9 1300 NO Diameter 160616 0.3 4.0*106 per 50 mm 29 3.6.9 1300 NO Diameter 160617 0.6 3.6*106 per 50 mm 29 3.6.9 1300 NO Diameter 160629 0.1 4.8*107 per 60 mm 29 3.6.9 1300 NO Diameter 160630 0.2 4.8*107 per 60 mm 29 3.6.9 1300 NO Diameter 160701 0.3 4.8*107 per 60 mm 29 3.6.9 1300 NO Diameter 160704 0.6 4.8*107 per 60 mm 29 3.6.9 1300 YES Diameter 160711 0.1 1.0*107 per 47 mm 29 3 1300 NO Membrane 160712 0.2 1.0*107 per 47 mm 29 3 1300 NO Membrane 160713 0.3 1.0*107 per 47 mm 29 3 1300 NO Membrane 160714 0.6 1.0*107 per 47 mm 29 3 1300 NO Membrane 160815 0.07 2.0*107 per 47 mm 29 3 1300 Membrane 160816 0.1 2.0*107 per 47 mm 29 3 1300 Membrane 160818 0.3 2.0*107 per 47 mm 29 3 1300 Membrane
[0101] As shown in Table 2 and
Experimental Example 1
Genetic Information Confirmation
[0102] To confirm the genetic information, genomic DNA was secured and the introduced gene was confirmed through PCR and DNA sequencing. Specifically, for use in PCR, the primer set of Table 3 was constructed. In the presence of the primer set, PCR started by pre-denaturation at 98 C. for 8 minutes and was continued with 30 cycles of 98 C. for 1 minute, 53.5 C. for 30 seconds, and 72 C. for 1 minute, followed by 72 C. for 7 minutes. The PCR product was analyzed by sequencing, and the results are summarized in Table 3.
[0103] Additionally, to confirm the entire sequence Sh-ble, obtained by joining the promoter sequence for the Coccomyxa C-169 rbcS2 gene at the 5 end and the terminator sequence of the Coccomyxa C-169 rbcS2 gene at the 3 end to the bleomycin resistance gene, PCR was performed using the M13 primer set. Starting at 98 C. for 8 minutes for pre-denaturation, PCR was carried out with 30 cycles of 98 C. for 1 minute, 54 C. for 40 seconds, 72 C. for 2 minutes 30 seconds, followed by extension at 72 C. for 7 minutes, and the target DNA band was confirmed. The results are shown in
TABLE-US-00003 TABLE3 SEQ Sequencelisting IDNO: Name (5.fwdarw.3) Note 5 Forwardprimer ATGGCCAAGTTGACCAGT 6 Reverseprimer TCAGTCCTGCTCCTCGGCCA
[0104] As can be seen in
TABLE-US-00004 TABLE4 sh-ble ----------------------------------------------- TF5ble1 CGGCAATGACTGATTACGCCAGCTTGGTACCGAGCTCGGATCCACTA GTAACGGCCGCCA sh-ble ATGGCCAAGTTGACCAGTGCCGTTCCGGTGCTCACCGCGC TF5ble1 GTGTGCTGGAATTCGCCCTTATGGCCAAGTTGACCAGTGCCGTTCCG GTGCTCACCGCGC *********************************************** sh-ble GCGACGTCGCCGGAGCGGTCGAGTTCTGGACCGACCGGCTCGGGTT TF5ble1 CTCCCGGGACTTCG GCGACGTCGCCGGAGCGGTCGAGTTCTGGACCGACCGGCTCGGGTT CTCCCGGGACTTCG ********************************************** sh-ble TGGAGGACGACTTCGCCGGTGTGGTCCGGGACGACGTGACCCTGTT TF5ble1 CATCAGCGCGGTCC TGGAGGACGACTTCGCCGGTGTGGTCCGGGACGACGTGACCCTGTT CATCAGCGCGGTCC ********************************************** sh-ble AGGACCAGGTGGTGCCGGACAACACCCTGGCCTGGGTGTGGGTGCG TF5ble1 CGGCCTGGACGAGC AGGACCAGGTGGTGCCGGACAACACCCTGGCCTGGGTGTGGGTGCG CGGCCTGGACGAGC ********************************************** sh-ble TGTACGCCGAGTGGTCGGAGGTCGTGTCCACGAACTTCCGGGACGC TF5ble1 CTCCGGGCCGGCCA TGTACGCCGAGTGGTCGGAGGTCGTGTCCACGAACTTCCGGGACGC CTCCGGGCCGGCCA ********************************************** sh-ble TGACCGAGATCGGCGAGCAGCCGTGGGGGGGGGAGTTCGCCCTGC TF5ble1 GCGACCCGGCCGGCA TGACCGAGATCGGCGAGCAGCCGTGGGGGGGGGAGTTCGCCCTGC GCGACCCGGCCGGCA ********************************************* sh-ble ACTGCGTGCACTTCGTGGCCGAGGAGCAGGACTGA TF5ble1 ACTGCGTGCACTTCGTGGCCGAGGAGCAGGACTGA ***********************************
[0105] As can be seen in Table 4, a complete match was confirmed when comparing the DNA nucleotide sequence of the target gene, Sh-ble, with the acquired genetic information, as analyzed by CLUSTAL 2.1 multiple sequence alignment.
Experimental Example 2
Maintenance of Mutants
[0106] To confirm the maintenance of mutants, passages were performed, and the results are shown in
Experimental Example 3
Biomineralization
Example 1
Plasmid Construction and Cloning
[0107] pKA650 vector was constructed for expressing and cloning a gene for a target protein, with resistance to zeocin given thereto. In this regard, the bleomycin resistance gene sequence (Sh ble) was obtained from the genomic DNA of Streptomyces verticillus (Sh ble). An overall sequence was synthesized by linking the promoter and terminator sequences of the Coccomyxa C-169 rbcS2 (ribulose-1,5-bisphosphate carboxylase/oxygenase small subunit) gene to the 5 and 3 ends of Sh ble, respectively. The synthesized sequence was named pKA650. In the synthesized pKA650, the intermediate gene BleoR of the entire sequence Sh-ble was substituted for C-169 beta-type carbonic anhydrase, after which repeated promoter region was inserted with the aid of KpnI and ApaI. The cloned plasmid is depicted in
Example 2
Chlorella Vulgaris Transformation
[0108] The method of transformation using the pJG002 vector is same as that using the pKA650 vector.
[0109] Specifically, competent cells were created. In this regard, 300 ml of sterile MBM medium (KNO.sub.3 2.5 mM, MgSO.sub.47H.sub.2O 0.3 mM, K.sub.2HPO.sub.4 0.43 mM, KH.sub.2PO.sub.4 1.29 mM, NaCl 0.43 mM, CaCl.sub.2*2H.sub.2O 0.068 mM, FeSO.sub.4*7H.sub.2O 0.1 g, A5 metal mix ml/L) was prepared in a 500 mL flask and inoculated with Chlorella vulgaris, followed by incubation at 23 C. and 100 rpm. When OD.sub.686 reached 0.5-0.6, Chlorella vulgaris was collected by centrifugation and counted.
[0110] After being counted, Chlorella vulgaris was prepared at a density of 4.8*10.sup.7 cells. For gold particle bombardment, the introduced pKA650 was linearized using the restriction enzyme KpnI. A retaining cap, a brass adjustable nest, a microcarrier holder, a stopping screen, and a macrocarrier were prepared as being sterilized, and a rupture disk was washed with 70% isopropanol. While drying the rupture disk, a plasmid and gold particle mixture was prepared. For 20 bombardments, 12 mg of gold particles was put in a microfuge tube, and 1 ml of 70% ethanol was added thereto. The tube was vortexed at maximum speed for 5 minutes and briefly spun down for 5 seconds, followed by decanting the supernatant.
[0111] The cycle of washing gold particles with 1 ml of distilled water, vortexing for 1 minutes, leaving the gold particles for 1 minutes, spinning down for 5 seconds, and decanting the supernatant was repeated three times. Then, the addition of 205 L of 50% glycerol was followed by vortexing for 5 minutes to suspend the pellet. Vortexing was continued at speed 2-3. One hundred L of gold particles was transferred to a new microfuge tube, and 10 L of DNA (0.5-20 g/L), 100 L of 2.5M CaCl.sub.2, and 40 L of 0.1 M spermidine were added sequentially while being mixed by pipetting. After mixing, the mixture was vortexed continued for 2 minutes, left for 1 minute, and spun down for 2 seconds. After removal of the supernatant, the pellet was added with 300 L of 70% ethanol and left for 1 minute. The supernatant was decanted after which 300 L of 100% ethanol was added and left for 1 minute. Again, the supernatant was removed, and 110 L of 100% ethanol was added and continuously vortex to suspend the pellet.
[0112] Once prepared, the Gold Particle Mix was placed in an amount of 11 L in the center of the microcarrier and dried for 5-10 minutes. Meanwhile, the prepared cells were evenly spread on the plate with a diameter of 60 mm. The stopping screen was mounted on the brass adjustable nest, followed by loading the dried microcarrier thereon. After fixation with a holder, the gene gun instrument was turned on and preheated for 5 minutes. When preheating was completed, the rupture disk was loaded into a retaining cap and inserted into the gun part by screwing. Then, the microcarrier-assembled brass adjustable nest was inserted and the plate having the cells spread thereon was mounted at target distance 3 before closing the door. Helium gas was introduced and the vacuum button was pressed. When the vacuum and the helium pressure reached 29 (inches Hg) and 1300 psi, respectively, the fire button was pressed to increase the pressure to 1100 psi at which gold particles are shot. After bombardment, the plate was incubated at 23 C. for recovery.
Example 3
Confirmation of Chlorella Vulgaris Transformant
[0113] The transformation was performed biolistically as in Example 2, and after passages, the transformants were tested for maintaining antibiotic resistance at various concentrations. The results are shown in
[0114] The genetic and protein expression of the transformants was examined. To this end, the target protein, beta-type carbonic anhydrase was detected at a band size of approximately 43 kDa as analyzed by whole protein SDS-PAGE. The results are shown in
[0115] The band for the target protein was determined by MALDI-TOF, and the results are depicted in
[0116] In the present disclosure, the transformants were found to express the target protein and maintain antibiotic resistance over passages. For the genetic aspect, the presence or absence of the target gene was determined by southern blotting, and the results are depicted in
[0117] As seen in
Example 4
Sr Biomineralization
[0118] The function of the transformant was to provide an increase in Sr biomineralization capacity. This was confirmed by visualizing crystal formation under a microscope with equal amounts. Initially, the Sr biomineralization capability of the wild-type (WT) Chlorella vulgaris was confirmed.
[0119] In brief, Chlorella vulgaris was cultured under light conditions until OD0.6. After cultivation, the microalgae were collected at 25 C. and 4000 rpm for 15 minutes in a sterile condition. They were then washed three times with 3 mM NaHCO.sub.3. Subsequently, 3 mM NaHCO.sub.3 was added with 200 ppm Sr, mixed with 1*10.sup.7 Chlorella vulgaris, and incubated at 4 C. for 4 hours or longer. The cells were then stained with 0.004% sodium rhodizonate and observed under a microscope, with the results shown in
[0120] As can be seen in
TABLE-US-00005 TABLE 5 Remain metal RSD(%): Relative ion rate (%) Standard Deviation Control (200 mM LiCl.sub.2) 100 0.56 +algae 45.27667 0.42
[0121] As seen in
INDUSTRIAL APPLICABILITY
[0122] The present disclosure relates to a vector system for the transformation of Chlorella vulgaris, a method for transforming Chlorella vulgaris using same, and a Chlorella vulgaris transformant.