MICROALGAE STRAIN HAVING EFFECT OF PROMOTING PLANT GROWTH AND USE THEREOF

Abstract

The present application relates to a novel microalgae strain with the efficacy of promoting plant growth and a use thereof. When cultured in the presence of fermentation exhaust gas, a novel Chlorella vulgaris CD02-3002 strain according to an aspect grows fast with a high efficiency of photosynthesis and thus can effectively reduce the exhaust gas generated by microbial fermentation. Having the effect of promoting plant growth when applied to plants, a culture of the strain or a supernatant of the culture can be used as a fertilizer for plants and thus can be advantageously applied as a novel carbon reduction technique.

Claims

1. (canceled)

2. A composition for, comprising one or more selected from the group consisting of Chlorella vulgaris strain of, deposited with Accession number KCTC14659BP; culture or culture supernatant of the strain; concentrate of the culture or culture supernatant; a dried matter of the culture, culture supernatant or concentrate; and lysate of the dried matter.

3. A fertilizer for plants comprising the composition of claim 2.

4. A method of culturing a Chlorella vulgaris strain, comprising culturing Chlorella vulgaris strain, deposited with Accession number KCTC14659BP in the presence of fermentation exhaust gas.

5. The method according to claim 4, wherein the fermentation exhaust gas comprises carbon dioxide of 0.5 to 20% (v/v).

6. The method according to claim 4, wherein the fermentation exhaust gas is generated by microbial fermentation.

7. The method according to claim 4, wherein the culturing is performed at 20 to 40 C.

8. The method according to claim 4, wherein the culturing is performed for 30 days or less.

9. A method of promoting plant growth, comprising contacting the composition of claim 2 to a plant.

10. The method according to claim 9, wherein the contacting is performed by a method of treating the composition for promoting plant growth to soil, a plant or a seed of a plant.

11. The method according to claim 9, further comprising preparing the composition.

12. The composition according to claim 2, wherein said one or more comprises the Chlorella vulgaris.

13. The composition according to claim 2, wherein said one or more comprises the culture or the culture supernatant of the strain.

14. The composition according to claim 2, wherein said one or more comprises the dried matter of the culture, culture supernatant or concentrate.

15. The composition according to claim 2, further comprising a preservative, stabilizer, wetting agent or emulsifier, cryoprotectant, or excipient.

16. The composition according to claim 2, wherein the composition has an effect of promoting plant growth.

17. The method according to claim 9, wherein said one or more comprises the Chlorella vulgaris.

18. The method according to claim 9, wherein said one or more comprises the culture or the culture supernatant of the strain.

19. The method according to claim 9, wherein said one or more comprises the dried matter of the culture, culture supernatant or concentrate.

20. The method according to claim 9, wherein the composition has an effect of promoting plant growth.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0051] FIG. 1 is a graph of the result of measuring the dry cell weight (DCW) after culturing each of 4 kinds of Chlorella vulgaris strains.

[0052] FIG. 2 is a graph of the result of measuring the aerial part (top part) weight of Arabidopsis thaliana, after treating the diluted solution of the culture supernatant of each of 4 kinds of DW, BG-11 liquid medium, Acadian 29 or Chlorella vulgaris, respectively.

MODE FOR INVENTION

[0053] Hereinafter, the present invention will be described in more detail by examples. However, these examples are intended to illustratively describe one or more specific example, and the scope of the present invention is not limited by these examples.

Example 1. Isolation of Novel Wild-Type Green Algae

[0054] Samples were collected from a total of 5 river regions in Suwon, Gyeonggi-do, Korea, and microalgae belonging to green algae were isolated using a direct planting method.

[0055] Specifically, after collecting the samples, microalgae were isolated therefrom within 23 days, and the samples showing green color and comprising spherical morphology were smeared on BG-11 solid medium (1.5 g/L NaNO.sub.3, 40 mg/L K.sub.2HPO.sub.4, 75 mg/L MgSO.sub.4.Math.7H.sub.2O, 36 mg/L CaCl.sub.2) 2H.sub.2O, 6 mg/L citric acid H.sub.2O, 6 mg/L ferric ammonium citrate, 1 mg/L Na.sub.2EDTA 2H.sub.2O, 20 mg/L Na.sub.2CO.sub.3, 2.86 mg/L H.sub.3BO.sub.3, 1.81 mg/L MnCl.sub.2.Math.4H.sub.2O, 0.22 mg/L ZnSO.sub.4.Math.7H.sub.2O, 0.39 mg/L Na.sub.2MoO.sub.4.Math.2H.sub.2O, 0.079 mg/L CuSO.sub.4.Math.5H.sub.2O, 0.049 mg/L Co(NO.sub.3).sub.2.Math.6H.sub.2O, 15 g/L agar) for microbial isolation. The obtained colonies were purely isolated through subculturing in the BG-11 solid medium inserted by adjusting the concentration of an antibiotic cocktail mix solution (0500 mg/L Streptomycin sulfate, 0500 mg/L Ampicillin, 0500 mg/L Kanamycin sulfate).

Example 2. Identification of DNA Sequence of Isolated Microalgae

[0056] For molecular biological identification of the microalgae isolated in Example 1 above, the 18s rRNA sequence was analyzed.

[0057] Specifically, after extracting DNA from the purely isolated colonies, using primers for amplifying a gene of the 18s rRNA region (Table 1), PCR was carried out.

TABLE-US-00001 TABLE1 SEQIDNO: Primer Sequence(5>3) 2 18s-F CGACTTCTGGAAGGGACGTA 3 18s-R CTAGGTGGGAGGGTTTAATG

[0058] PCR reaction was performed by denaturation at 95 C. for 5 minutes, and then repeating denaturation at 95 C. for 30 seconds, annealing at 55 C. for 30 seconds and polymerization at 72 C. for 2 minutes 35 times, and then polymerization at 72 C. for 5 minutes. As the result of analyzing the nucleotide sequence utilizing the amplified reaction solution, a nucleotide sequence in an about 1,565 bp size was secured (SEQ ID NO: 1). As the result of BLAST search of this on NCBI (https://www.ncbi.nlm.nih.gov/), it was confirmed that it had homology of 99.68% to the Chlorella vulgaris KMMCC FC-42 strain, and the isolated strain was named Chlorella vulgaris CD02-3002, and was deposited to Korea Research Institute of Bioscience and Biotechnology, Korean Collection for Type Cultures (KCTC), an international depository under the Budapest Treaty, on Aug. 23, 2021, and was given Accession number KCTC14659BP.

Example 3. Confirmation of Growth Ability of Chlorella vulgaris CD02-3002 Strain Under Light Cultivation Condition Based on Fermentation Exhaust Gas

[0059] In order to confirm whether the isolated novel strain Chlorella vulgaris CD02-3002 is a strain capable of growing under a condition of light cultivation based on fermentation exhaust gas, the growth ability was compared and evaluated to various kinds of Chlorella vulgaris strains.

[0060] As a control strain, Chlorella vulgaris UTEX265 strain received from UTEX Culture Collection of Algae at UT-Austin institution was used, and as a comparative group, the Chlorella vulgaris CD 11-2001 and CD11-2003 strains isolated by the same method as described in Example 1 were used. Each strain was inoculated in a sterilized BG-11 liquid medium (1.5 g/L NaNO.sub.3, 40 mg/L K.sub.2HPO.sub.4, 75 mg/L MgSO.sub.4.Math.7H.sub.2O, 36 mg/L CaCl.sub.2.Math.2H.sub.2O, 6 mg/L citric acid H.sub.2O, 6 mg/L ferric ammonium citrate, 1 mg/L Na.sub.2EDTA.Math.2H.sub.2O, 20 mg/L Na.sub.2CO.sub.3, 2.86 mg/L H.sub.3BO.sub.3, 1.81 mg/L MnCl.sub.2.Math.4H.sub.2O, 0.22 mg/L ZnSO.sub.4.Math.7H.sub.2O, 0.39 mg/L Na.sub.2MoO.sub.4.Math.2H.sub.2O, 0.079 mg/L CuSO.sub.4.Math.5H.sub.2O, 0.049 mg/L Co(NO.sub.3).sub.2.Math.6H.sub.2O) 100 mL, and then was cultured for 4-7 days while light was continuously irradiated with an LED light source, and CO.sub.2 at a concentration of 110% (v/v) was supplied by 0.010.1 vvm. After that, the culturing solution was inoculated to a new sterilized BG-11 liquid medium 900 mL, and was cultured for 35 days while light was continuously irradiated with an LED light source, and during the culturing period, fermentation exhaust gas was directly supplied to the culturing solution by 0.010.5 vvm after passing through an air filter. As the fermentation exhaust gas, gas generated during fed-batch culturing Escherichia coli CJ181 (KFCC 10902) strain (U.S. Patent Publication US 2008/0299644 A1) in a fermenter while maintaining the culturing temperature of 30 C., culturing pH 6.97.1 (adjusting pH with ammonia water), aeration amount 0.5-1.0 vvm and stirring rate of 500700 rpm was used.

[0061] After completion of the culturing, each strain culturing solution 10 mL was filtered with a 0.45 m filter, and then dried in a 60 C. oven for 24 hours, and then, by calculating a difference of the weight of the filter before filtration, and the weight of the filter comprising dried cells after drying, a dry cell weight (DCW) value was calculated.

[0062] As a result, as shown in FIG. 1, it was confirmed that the Chlorella vulgaris CD02-3002 strain had a significantly high dry cell weight compared to the received Chlorella vulgaris strain (UTEX265) or novel isolated other Chlorella vulgaris strains (CD11-2001 and CD 11-2003). Through this, it could be found that the Chlorella vulgaris CD02-3002 strain was a strain with the most excellent growing rate under the condition of light cultivation based on fermentation exhaust gas compared to other Chlorella vulgaris strains.

Example 4. Confirmation of Effect of Promoting Plant Growth of Culture Supernatant of Chlorella vulgaris CD02-3002 Strain

[0063] In order to confirm the effect of promoting plant growth of the culture supernatant of the Chlorella vulgaris CD02-3002 strain, promoting growth was evaluated for Arabidopsis thaliana.

[0064] Specifically, wild-type Arabidopsis thaliana seeds were prepared by surface sterilizing in 70% ethanol for 1 minutes and 1% NaOCl solution for 3 minutes, and then washing with sterilized distilled water. The Arabidopsis thaliana was refrigerated (4 C.) for 2 days and then was planted in the top soil (Dongbu Farm Hannong Co., Ltd.) and then was cultivated in a 21 C. thermostat for about 1 week in a dark state in which light is irradiated for 12 hours and light is not irradiated for 12 hours.

[0065] A total 4 kinds of Chlorella vulgaris UTEX265, CD11-2001, CD02-3002, and CD11-2003 were inoculated into sterilized BG-11 liquid medium 200 mL, and then were cultured at 25 C. for 57 days while an LED light source was irradiated and 110% (v/v) CO.sub.2 was continuously supplied by 0.1 vvm. The cultured seed culture was inoculated into sterilized BG-11 liquid medium 1.8 L and was cultured under the same condition for 10 days at maximum. After completion of the culturing, the culture was centrifuged to obtain the culture supernatant of each strain.

[0066] In order to evaluate the effect of promoting plant growth, the cultivated Arabidopsis thaliana was treated with a 10-1000-fold dilution of the culture supernatant of each strain at a level of 1 mL/plant, and foliar fertilization was applied three times at an interval of 4 days. As a control group, a group in which distilled water (DW) was equally treated was set, and as a comparative group, a group in which a medium used for microalgae light cultivation (BG-11 liquid medium) or commercialized seaweed extract liquid fertilizer (Acadian 29) were equally treated was added. The aerial part live weight (aerial part weight) was measured as a growth measurement index of Arabidopsis thaliana. The mean value and standard deviation of the top part live weight were calculated and shown by performing repeated experiments with Arabidopsis thaliana 8 subjects for each test group.

[0067] As a result, as shown in FIG. 2, it was shown that other Chlorella vulgaris strains had little or no effect of promoting growth compared to the control group, while the Chlorella vulgaris CD02-3002 strain showed a significantly excellent effect of promoting growth, and it could be confirmed that this was a significantly excellent effect than a commercialized fertilizer, Acadian 29.

[0068] From the above description, those skilled in the art to which the present application pertains will be able to understand that the present application may be embodied in other specific forms without changing the technical spirit or essential characteristics. In this regard, it should be understood that the examples described above are illustrative and not restrictive in all respects. The scope of the present application should be construed as including all changes or modifications derived from the meaning and scope of the claims to be described below and equivalent concepts rather than the detailed description above, in the scope of the present application.

ACCESSION NUMBER

[0069] Depository authority name: Korea Research Institute of Bioscience and Biotechnology, Korean Collection for Type Cultures (KCTC)

[0070] Accession number: KCTC14659BP

[0071] Accession date: 20210823