MICROORGANISM WITH ENHANCED L-BRANCHED-CHAIN AMINO ACID PRODUCING ABILITY AND METHOD FOR PRODUCING L-BRANCHED-CHAIN AMINO ACID USING SAME
20230063145 · 2023-03-02
Inventors
- Byoung Hoon Yoon (Seoul, KR)
- Seon Hye Kim (Seoul, KR)
- Jin Sook CHANG (Seoul, KR)
- Ju-Yeon KIM (Seoul, KR)
- Sun Hyoung CHOI (Seoul, KR)
- Kyungrim KIM (Seoul, KR)
- Ju Eun Kim (Seoul, KR)
- Hyung Joon KIM (Seoul, KR)
Cpc classification
C12P13/06
CHEMISTRY; METALLURGY
C12P13/08
CHEMISTRY; METALLURGY
International classification
C12P13/08
CHEMISTRY; METALLURGY
C12P13/06
CHEMISTRY; METALLURGY
Abstract
Disclosed is an L-branched-chain amino acid-producing microorganism having enhanced activity of regulator of acetate metabolism A and a method for producing an L-branched-chain amino acids using the same.
Claims
1. An L-branched-chain amino acid-producing microorganism having enhanced activity of regulator of acetate metabolism A.
2. The microorganism according to claim 1, wherein the enhanced activity is obtained by: introducing a modification into a gene expression regulatory sequence of regulator of acetate metabolism A; replacing the gene expression regulatory sequence with a sequence improving expression; additionally introducing a modification to the gene to enhance the activity; or a combination thereof.
3. The microorganism according to claim 2, wherein the gene expression regulatory sequence is a promoter.
4. The microorganism according to claim 2, wherein the microorganism comprises a polynucleotide having promoter activity and including substitution of a nucleotide with a different nucleotide at one or more corresponding positions selected from positions 34, 36, 37, 41, and 43 of a nucleotide sequence as set forth in SEQ ID NO: 1.
5. The microorganism according to claim 4, wherein the polynucleotide comprises substitution with T at the 34.sup.th nucleotide; substitution with T at the 36.sup.th nucleotide; substitution with G at the 37.sup.th nucleotide; substitution with T at the 41.sup.st nucleotide; substitution with A at the 43.sup.rd nucleotide; or a combination thereof, in the nucleotide sequence as set forth in SEQ ID NO: 1.
6. The microorganism according to claim 4, wherein the polynucleotide comprises one nucleotide sequence selected from SEQ ID NOS: 3 to 5.
7. The microorganism according to claim 1, wherein the microorganism is a microorganism of the genus Corynebacterium.
8. The microorganism according to claim 7, wherein the microorganism of the genus Corynebacterium comprises Corynebacterium glutamicum.
9. A method for producing an L-branched-chain amino acid, the method comprising culturing the microorganism according to claim 1 in a culture medium.
10. The method according to claim 9, further comprising recovering or separating the L-branched-chain amino acid from the culture medium or the microorganism.
11. A polynucleotide having promoter activity and comprising substitution of a nucleotide with a different nucleotide at one or more corresponding positions selected from positions 34, 36, 37, 41, and 43 of a nucleotide sequence as set forth in SEQ ID NO: 1.
12. The polynucleotide according to claim 11, wherein the polynucleotide comprises substitution with T at the 34.sup.th nucleotide; substitution with T at the 36.sup.th nucleotide; substitution with G at the 37.sup.th nucleotide; substitution with T at the 41.sup.st nucleotide; substitution with A at the 43.sup.rd nucleotide; or a combination thereof, in the nucleotide sequence as set forth in SEQ ID NO: 1.
13. The polynucleotide according to claim 11, wherein the polynucleotide comprises one nucleotide sequence selected from SEQ ID NOS: 3 to 5.
Description
MODE FOR INVENTION
[0105] Hereinafter, the present disclosure will be described in more detail with reference to the following examples. However, the following examples are merely presented to exemplify the present disclosure, and the scope of the present disclosure is not limited thereto.
Example 1. Selection of Mutant Strains Having Enhanced Valine Producing Ability Via Artificial Mutagenesis
Example 1-1. Induction of Artificial Mutation by UV Radiation
[0106] In order to select a mutant strain having enhanced ability to produce valine that is a representative branched-chain amino acid, Corynebacterium glutamicum KCCM11201P (Korean Patent No. 10-1117022) as a valine-producing strain was smeared on an agar-containing nutrient medium and cultured at 30° C. for 36 hours. Several hundreds of colonies were obtained therefrom and exposed to UV rays at room temperature to induce random mutation on genomes of the strains.
Example 1-2. Fermentation Titer Evaluation and Selection of Mutation-Induced Strain
[0107] In order to select a mutant strain having enhanced L-valine producing ability compared to Corynebacterium glutamicum KCCM11201P used as a parent strain, a fermentation titer test was performed on the strains in which random mutation was induced. After subculturing each of the colonies in a nutrient medium, each of the strains was inoculated onto a 250 mL corner-baffled flask containing 25 mL of a production medium and cultured while shaking at 30° C. for 72 hours at 200 rpm. Then, concentrations of L-valine were analyzed using HPLC, and the analyzed concentrations of L-valine are shown in Table 1 below.
[0108] Nutrient Medium (pH 7.2)
[0109] 10 g of glucose, 5 g of meat gravy, 10 g of polypeptone, 2.5 g of sodium chloride, 5 g of yeast extract, 20 g of agar, 2 g of urea (based on 1 L of distilled water)
[0110] Production Medium (pH 7.0)
[0111] 100 g of glucose, 40 g of ammonium sulfate, 2.5 g of soy protein, 5 g of corn steep solids, 3 g of urea, 1 g of dibasic potassium phosphate, 0.5 g of magnesium sulfate heptahydrate, 100 μg of biotin, 1 mg of thiamine-HCl, 2 mg of calcium pantothenate, 3 mg of nicotinamide, and 30 g of calcium carbonate (based on 1 L of distilled water)
TABLE-US-00001 TABLE 1 Strain name L-Valine (g/L) Control KCCM11201P 2.8 Experimental A1 2.9 group A2 2.5 A3 3.5 A4 3.0 A5 1.5 A6 1.2 A7 4.2 A8 3.9 A9 2.8 A10 2.4 A11 3.1 A12 3.3 A13 3.8 A14 2.7 A15 2.9
[0112] In comparison with the KCCM11201P strain used as a control, A7 strain, whose production of valine was increased the most, was selected (see Table 1).
Example 2. Confirmation of Mutation By Gene Sequencing
[0113] Major genes of the A7 strain having enhanced valine producing ability were sequenced and compared with those of the KCCM11201P strain and wild-type Corynebacterium glutamicum ATCC14067 strain. As a result, it was confirmed that the A7 strain contains mutation at the promoter position of regulator of acetate metabolism A.
[0114] Specifically, it was confirmed that the A7 strain had a nucleotide sequence of SEQ ID NO: 2 including mutation at the promoter region (SEQ ID NO: 1) of the ramA gene.
[0115] In the following examples, effects of modification inserted into a specific position of the promoter region of the ramA gene and effects of enhanced expression of RamA by improvement or substitution of the promoter of the ramA gene on production of valine, isoleucine, and leucine, which are branched-chain amino acids of a microorganism of the genus Corynebacterium, were examined.
Example 3. Construction of Strain Introduced with Modification and Confirmation of Valine Producing Ability
Example 3-1. Introduction of Promoter Modification into Corynebacterium glutamicum KCCM11201P Strain and Evaluation of L-Valine Producing Ability
[0116] In order to insert a ramA gene promoter-modified polynucleotide represented by SEQ ID NO: 2 into Corynebacterium glutamicum KCCM11201P, a vector including a target modification was prepared. Specifically, genomic DNA of the A7 strain was extracted using a G-spin Total DNA Extraction Mini Kit (Intron, Cat. No 17045) in accordance with protocols of the kit, and PCR was performed using the genomic DNA as a template. The PCR was performed under the following conditions: denaturation at 94° C. for 5 minutes; 25 cycles of denaturation at 94° C. for 30 seconds, annealing at 55° C. for 30 seconds, and polymerization at 72° C. for 150 seconds; and then polymerization at 72° C. for 7 minutes, and a PCR product (hereinafter, referred to as “modification-introduced fragment 1”) of 1114 bp was obtained using SEQ ID NOS: 9 and 10.
[0117] After treating the obtained modification-introduced fragment 1 with the restriction enzyme XbaI (New England Biolabs, Beverly, Mass.), the modification-introduced fragment 1 was ligated to a pDZ vector (Korean Patent No. 10-0924065 and International Patent Application Publication No. 2008-033001) treated with the same restriction enzyme using a T4 ligase (New England Biolabs, Beverly, Mass.). After transforming E. coli DH5α with the constructed gene, transformed strains were selected in an LB medium containing kanamycin and DNA was obtained therefrom using a DNA-spin plasmid DNA purification kit (iNtRON) to prepare a pDZ-Pm-ramA vector including the modification-introduced fragment 1.
TABLE-US-00002 TABLE 2 Primer Base sequence SEQ ID NO: Pm(TATAAT)-F1 gctctagaTAGGCCGGTTCGGACTCGCCCTG SEQ ID NO: 9 CC Pm(TATAAT)-R1 gctctagaaacgtgcgcgcagtcatggtgactt SEQ ID NO: 10
[0118] Corynebacterium glutamicum KCCM11201P was transformed with the pDZ-Pm-ramA vector via chromosomal homologous recombination (van der Rest et al., Appl Microbiol Biotechnol 52:541-545, 1999). Strains whose chromosome was inserted with the vector by homologous sequence recombination were selected in a culture medium containing kanamycin (25 mg/f). Then, PCR was performed on the Corynebacterium glutamicum transformants in which secondary recombination was completed using SEQ ID NOS: 9 and 10 and strains in which modification was inserted into the promoter at an upstream region of ramA (SEQ ID NO: 1) on the chromosome were confirmed. The recombinant strain was named Corynebacterium glutamicum KCCM11201P-Pm-ramA.
[0119] For comparison of valine producing ability between valine-producing Corynebacterium glutamicum KCCM11201P and KCCM11201P-Pm-ramA, flask evaluation was performed. After subculturing each of the strains in a nutrient medium, each of the strains was inoculated onto a 250 mL corner-baffled flask containing 25 mL of a production medium, and cultured while shaking at 30° C. for 72 hours at 200 rpm. Then, concentrations of L-valine were analyzed using HPLC, and the analyzed concentrations of L-valine are shown in Table 3 below.
[0120] Nutrient Medium (pH 7.2)
[0121] 10 g of glucose, 5 g of meat gravy, 10 g of polypeptone, 2.5 g of sodium chloride, 5 g of yeast extract, 20 g of agar, 2 g of urea (based on 1 L of distilled water)
[0122] Production Medium (pH 7.0)
[0123] 100 g of glucose, 40 g of ammonium sulfate, 2.5 g of soy protein, 5 g of corn steep solids, 3 g of urea, 1 g of dibasic potassium phosphate, 0.5 g of magnesium sulfate heptahydrate, 100 μg of biotin, 1 mg of thiamine-HCl, 2 mg of calcium pantothenate, 3 mg of nicotinamide, 30 g of calcium carbonate (based on 1 L of distilled water)
TABLE-US-00003 TABLE 3 L-valine producing ability of KCCM11201P and KCCM11201P-Pm-ramA L-valine (g/L) Strain Batch 1 Batch 2 Batch 3 Average KCCM11201P 2.6 2.5 2.7 2.6 KCCM11201P- 3.2 3.3 3.1 3.2 Pm-ramA
[0124] As a result, it was confirmed that the L-valine producing ability of the KCCM11201P-Pm-ramA strain was enhanced by about 23% compared to that of KCCM11201P.
Example 3-2. Construction of Mutant Strain of Corynebacterium Glutamicum KCCM11201P in which Promoter is Improved and Substituted and Evaluation of L-Valine Producing Ability of Constructed Strain
[0125] As shown in the results of Example 3-1 above, it was confirmed that the valine producing ability was enhanced by modifying the ramA gene promoter, and thus vectors for improving or substituting the ramA promoter were constructed based on the modified promoter of SEQ ID NO: 2 to further increase expression of ramA.
[0126] In order to construct vectors including modification, primer 3 (SEQ ID NO: 11) to primer 10 (SEQ ID NO: 18) of Table 4 were synthesized to have an xbaI restriction enzyme region at the 5′ terminal and the 3′ terminal.
[0127] The improved ramA promoters were named Pm1, Pm2, and Pm3-ramA, and a primer pair of SEQ ID NOS: 11 and 13; and a primer pair of SEQ ID NOS: 12 and 14 were used to construct Pm1-ramA and a primer pair of SEQ ID NOS: 11 and 15 and a primer pair of SEQ ID NOS: 12 and 14 were used to construct Pm2-ramA. Also, a primer pair of SEQ ID NOS: 11 and 17; and a primer pair of SEQ ID NOS: 12 and 18 was used to construct Pm3-ramA.
[0128] PCR was performed using each of the primers and chromosomal DNA of wild-type Corynebacterium glutamicum as a template [Sambrook et al., Molecular Cloning, a Laboratory Manual (1989), Cold Spring Harbor Laboratories].
[0129] In this case, the PCR was performed under the following conditions: denaturation at 95° C. for 5 minutes; 30 cycles of denaturation at 94° C. for 30 seconds, annealing at 56° C. for 30 seconds, and polymerization at 72° C. for 1 minute; and then polymerization at 72° C. for 7 minutes.
[0130] Then, a PCR product obtained from the above-described process and the previously prepared pDZ-Pm-ramA vector were treated with the xbaI restriction enzyme, followed by fusion cloning. The fusion cloning was performed using an In-Fusion® HD Cloning Kit (Clontech). E. coli DH5α was transformed therewith and smeared on an LB solid medium containing kanamycin (25 mg/f). Colonies transformed with plasmids into which a target gene was inserted were selected by PCR and the plasmids was obtained by extraction and named pDZ-Pm1-ramA, pDZ-Pm2-ramA, and pDZ-Pm3-ramA, respectively.
TABLE-US-00004 TABLE 4 Primer Base sequence SEQ ID NO: Primer 3 gctcggtacccggggatcctctagataggccggttcggactcgccc SEQ ID NO: 11 tgcc Primer 4 ttacgccaagcttgcatgctctagaaacgtgcgcgcagtcatggtg SEQ ID NO: 12 actt Primer 5 CGA CAA GGG TCC ATT ATA CCA CAC CTT SEQ ID NO: 13 TGG GGG T Primer 6 acccccaaaggTgTGgtaTaAtgGacccttgtcg SEQ ID NO: 14 primer 7 TCG ACA AGG GTA CAT TAT ACT TCC CCT TT SEQ ID NO: 15 Primer 8 aaaggggaagtaTaAtgtacccttgtcga SEQ ID NO: 16 Primer 9 AAG GGT ACA GTG TAC CAC ACC TTT GGG SEQ ID NO: 17 GGT Primer 10 acccccaaaggTgTGgtacactgtaccctt SEQ ID NO: 18 Primer 11 attcgagctcggtacccggtctagatcaagaaactgcaggtgtgta SEQ ID NO: 19 ccga Primer 12 CAT CGG TAG GCT ATG CCG GCG GTA CCT SEQ ID NO: 20 TCA GAT TTC CTC CTG CTT TAC AC Primer 13 gtaccgccggcatagcctaccgatg SEQ ID NO: 21 Primer 14 AGT GTT TCC TTT CGT TGG GTA CGT A SEQ ID NO: 22 Primer 15 tacgtacccaacgaaaggaaacactgtggatacccagcggatta SEQ ID NO: 23 aagatg Primer 16 TGC ATG CCT GCA GGT CGA CTC TAG AAT SEQ ID NO: 24 CGC GGC GCA GAT CCT CAT CGG TC
[0131] Also, separately, in order to substitute the ramA promoter with Pcj7 that is a stronger promoter, primer 11 (SEQ ID NO: 19) to primer 16 (SEQ ID NO: 24) of Table 4 were synthesized to have an xbaI restriction enzyme region at the 5′ terminal and the 3′ terminal.
[0132] A pDZ-Pcj7-ramA vector was constructed in the same manner as the method of constructing vectors in Example 3-1 described above using a primer pair of SEQ ID NOS: 19 and 20; a primer pair of SEQ ID NOS: 21 and 22; and a primer pair of SEQ ID NOS: 23 and 24.
[0133] Corynebacterium glutamicum KCCM11201P was transformed with the pDZ-Pm1-ramA, pDZ-Pm2-ramA, pDZ-Pm3-ramA, and pDZ-Pcj7-ramA vectors by chromosomal homologous recombination (van der Rest et al., Appl Microbiol Biotechnol 52:541-545, 1999). Strains whose chromosome was inserted with the vector by homologous sequence recombination were selected in a culture medium containing kanamycin (25 mg/f). Then, PCR was performed using the Corynebacterium glutamicum transformants in which secondary recombination was completed using SEQ ID NOS: 9 and 10 and strains in which the ramA promoter was improved and substituted with the Pcj7 promoter were confirmed.
[0134] Among the recombinant strains, Corynebacterium glutamicum KCCM11201P-Pm1-ramA, KCCM11201P-Pm2-ramA, and KCCM11201P-Pm3-ramA were named CA08-1518, CA08-1519, and CA08-1520, respectively, and deposited with the Korean Culture Center of Microorganisms (KCCM), recognized as an international depositary authority under the Budapest Treaty, on Apr. 27, 2020, under the Accession Numbers of KCCM12704P, KCCM12705P, and KCCM12706P, respectively.
[0135] Also, the strain substituted with the Pcj7 promoter was named KCCM11201P-Pcj7-ramA. Subsequently, valine producing ability was evaluated in the same manner as in Example 3-1 above and the results are shown in Table 5 below.
TABLE-US-00005 TABLE 5 L-valine (g/L) Strain Batch 1 Batch 2 Batch 3 Average KCCM11201P 2.6 2.5 2.7 2.6 KCCM11201P-Pm1- 3.2 3.4 3.3 3.3 ramA(CA08-1518) KCCM11201P-Pm2- 3.1 3.2 3.3 3.2 ramA(CA08-1519) KCCM11201P-Pm3- 3.2 3.0 3.1 3.1 ramA(CA08-1520) KCCM11201P-Pcj7-ramA 2.9 3.1 3.0 3.0
[0136] Based on the results of Table 5, it was confirmed that the KCCM11201P-Pm1-ramA (CA08-1518), KCCM11201P-Pm2-ramA (CA08-1519) and KCCM11201P-Pm3-ramA (CA08-1520) strains including the improved promoter compared to the KCCM11201P strain had L-valine production increased by about 27%, 23%, and 19%, respectively, which are similar to or higher than L-valine producing ability of the KCCM11201P-Pcj7-ramA strain substituted with the stronger promoter.
Example 3-3: Construction of Mutant Strain of Corynebacterium glutamicum CJ7V Strain in which ramA Gene Promoter Is Improved and Substituted and Evaluation of L-Valine Producing Ability of Constructed Strain
[0137] In order to identify whether the effect on enhancing the L-valine producing ability is obtained in other L-valine-producing strains belonging to the Corynebacterium glutamicum, the wild-type Corynebacterium glutamicum ATCC14067 was introduced with one type of modification [ilvN(A42V); Biotechnology and Bioprocess Engineering, June 2014, Volume 19, Issue 3, pp 456-467] to prepare a strain having enhanced L-valine producing ability.
[0138] Specifically, genomic DNA of the wild-type Corynebacterium glutamicum ATCC14067 strain was extracted using a G-spin Total DNA Extraction Mini Kit (Intron, Cat. No 17045) in accordance with protocols of the kit. PCR was performed using the genomic DNA as a template. In order to construct a vector introducing A42V modification into ilvN gene, gene fragments A and B were obtained using a primer pair of SEQ ID NOS: 25 and 26; and a primer pair of SEQ ID NOS: 27 and 28, respectively. The PCR was performed under the following conditions: denaturation at 94° C. for 5 minutes; 25 cycles of denaturation at 94° C. for 30 seconds, annealing at 55° C. for 30 seconds, and polymerization at 72° C. for 60 seconds, and then polymerization at 72° C. for 7 minutes.
[0139] As a result, polynucleotide fragments A and B both including 537 bp were obtained. A PCR product of 1044 bp (hereinafter, referred to as “modification-introduced fragment 2”) was obtained by performing overlapping PCR using the two fragments as templates with SEQ ID NOS: 25 and 26.
[0140] After treating the obtained modification-introduced fragment 2 with the restriction enzyme XbaI (New England Biolabs, Beverly, Mass.), the modification-introduced fragment 2 was ligated to a pDZ vector treated with the same restriction enzyme using a T4 ligase (New England Biolabs, Beverly, Mass.). After transforming E. coli DH5α with the constructed gene, transformed strains were selected in an LB medium containing kanamycin and DNA was obtained therefrom using a DNA-spin plasmid DNA purification kit (iNtRON). The vector to be used to introduce A42V modification of the ilvN gene was named pDZ-ilvN(A42V).
TABLE-US-00006 TABLE 6 Primer Base sequence SEQ ID NO: Primer 17 aatttctagaggcagaccctattctatgaagg SEQ ID NO: 25 Primer 18 agtgtttcggtctttacagacacgagggac SEQ ID NO: 26 Primer 19 gtccctcgtgtctgtaaagaccgaaacact SEQ ID NO: 27 Primer 20 aatttctagacgtgggagtgtcactcgcttgg SEQ ID NO: 28
[0141] Subsequently, the wild-type Corynebacterium glutamicum ATCC14067 was transformed with the pDZ-ilvN(A42V) vector via chromosomal homologous recombination (van der Rest et al., Appl Microbiol Biotechnol 52:541-545, 1999). Strains whose chromosome was inserted with the vector by homologous sequence recombination were selected in a culture medium containing kanamycin (25 mg/f). Then, the gene fragments were amplified by PCR performed on Corynebacterium glutamicum transformants in which secondary recombination was completed using SEQ ID NOS: 25 and 26 and strains into which modification was inserted were confirmed by gene sequencing. The recombinant strain was named Corynebacterium glutamicum CJ7V.
[0142] Finally, the Corynebacterium glutamicum CJ7V was transformed with the vectors in the same manner as in Examples 3-1 and 3-2, and the strains were named Corynebacterium glutamicum CJ7V-Pm1-ramA, CJ7V-Pm2-ramA, CJ7V-Pm3-ramA and CJ7V-Pcj7-ramA, respectively. For comparison of L-valine producing ability between the constructed strains, the strains were cultured in the same manner as in Example 3-1 above, concentrations of L-valine were analyzed, and the analyzed concentrations of L-valine are shown in Table 7 below.
TABLE-US-00007 TABLE 7 Comparison of L-valine producing ability L-valine (g/L) Strain Batch 1 Batch 2 Batch 3 Average CJ7V 2.2 2.2 2.3 2.2 CJ7V-Pm1-ramA 2.8 2.7 2.7 2.7 CJ7V-Pm2-ramA 2.6 2.6 2.7 2.6 CJ7V-Pm3-ramA 2.6 2.4 2.5 2.5 CJ7V-Pcj7-ramA 2.4 2.5 2.6 2.5
[0143] As shown in Table 7, it was confirmed that the CJ7V-Pm1-ramA, CJ7V-Pm2-ramA and CJ7V-Pm3-ramA strains including the improved promoter had L-valine production increased by about 23%, 18%, and 14%, respectively, which are similar to or higher than L-valine producing ability of the CJ7V-Pcj7-ramA strain substituted with the stronger promoter.
Example 3-4: Construction of Mutant Strain of Corynebacterium Glutamicum CJ8V in which ramA Gene Promoter is Improved and Substituted and Evaluation of L-Valine Producing Ability of Constructed Strain
[0144] In order to identify whether the effect on enhancing the L-valine producing ability is obtained in other L-valine-producing strains belonging to the Corynebacterium glutamicum, the wild-type Corynebacterium glutamicum ATCC13869 was introduced with one type of modification [ilvN(A42V)] in the same manner as the method of Example 3-3 to prepare a strain having L-valine producing ability and the recombinant strain was named Corynebacterium glutamicum CJ8V.
[0145] Finally, the Corynebacterium glutamicum CJ8V was transformed with the vectors in the same manner as the method of Examples 3-1 and 3-2, and the strains were named Corynebacterium glutamicum CJ8V-Pm1-ramA, CJ8V-Pm2-ramA, CJ8V-Pm3-ramA and CJ8V-Pcj7-ramA, respectively. For comparison of L-valine producing ability between the constructed strains, the strains were cultured in the same manner as in Example 3-1 above, concentrations of L-valine were analyzed, and the analyzed concentrations of L-valine are shown in Table 8 below.
TABLE-US-00008 TABLE 8 L-Valine producing ability L-valine (g/L) Strain Batch 1 Batch 2 Batch 3 Average CJ8V 1.9 2.0 1.9 1.9 CJ8V-Pm1-ramA 2.3 2.3 2.3 2.3 CJ8V-Pm2-ramA 2.3 2.1 2.2 2.2 CJ8V-Pm3-ramA 2.0 2.1 2.2 2.1 CJ8V-Pcj7-ramA 2.1 2.0 1.9 2.0
[0146] As shown in Table 8, it was confirmed that the CJ8V-Pm1-ramA, CJ8V-Pm2-ramA and CJ8V-Pm3-ramA strains including the improved promoter compared to the CJ8V strain had L-valine production increased by about 21%, 16%, and 10%, respectively, which are similar to or higher than L-valine producing ability of the CJ8V-Pcj7-ramA strain substituted with the stronger promoter.
Example 4. Construction of Mutant Strain of L-Leucine-Producing Corynebacterium glutamicum KCCM11661P and KCCM11662P into which Promoter Modification is Introduced and Evaluation of L-Leucine Producing Ability
[0147] Corynebacterium glutamicum KCCM11661P and KCCM11662P were transformed with the pDZ-Pm1-ramA, pDZ-Pm2-ramA, pDZ-Pm3-ramA, and pDZ-Pcj7-ramA vectors via chromosomal homologous recombination (van der Rest et al., Appl Microbiol Biotechnol 52:541-545, 1999). Strains whose chromosome was inserted with the vector by homologous sequence recombination were selected in a culture medium containing kanamycin (25 mg/L). Then, PCR was performed on the Corynebacterium glutamicum transformants in which secondary recombination was completed using SEQ ID NOS: 9 and 10 and strains in which the ramA promoter was improved and substituted with Pcj7 were confirmed. The recombinant strains were named Corynebacterium glutamicum KCCM11661P-Pm1-ramA, KCCM11661P Pm2-ramA, K KCCM11661P-Pm3-ramA, KCCM11661P-Pcj7-ramA and KCCM11662P-Pm1-ramA, KCCM11662P Pm2-ramA, K KCCM11662P-Pm3-ramA, and KCCM11662P-Pcj7-ramA, respectively.
[0148] The constructed strains were cultured according to the following method and leucine producing ability was compared.
[0149] After subculturing each of the strains in a nutrient medium, each of the strains was inoculated onto a 250 mL corner-baffled flask containing 25 mL of a production medium, and cultured while shaking at 30° C. for 72 hours at 200 rpm. Then, concentrations of L-leucine were analyzed using HPLC, and the analyzed concentrations of L-leucine are shown in Table 9 below.
[0150] <Nutrient Medium (pH 7.2)>
[0151] 10 g of glucose, 5 g of meat gravy, 10 g of polypeptone, 2.5 g of sodium chloride, 5 g of yeast extract, 20 g of agar, 2 g of urea (based on 1 L of distilled water)
[0152] <Production Medium (pH 7.0)>
[0153] 50 g of glucose, 20 g of ammonium sulfate, 20 g of corn steep solid, 1 g of dibasic potassium phosphate, 0.5 g of magnesium sulfate heptahydrate, 100 μg of biotin, 1 mg of thiamine-HCl, and 15 g of calcium carbonate (based on 1 L of distilled water)
TABLE-US-00009 TABLE 9 L-Leucine producing ability L-Leucine (g/L) Strain Batch 1 Batch 2 Batch 3 Average KCCM11661P 2.8 2.6 2.7 2.7 KCCM11661P-Pm1-ramA 3.2 2.9 2.8 3.0 KCCM11661P Pm2-ramA 3.0 2.8 2.9 2.9 KCCM11661P-Pm3-ramA 3.1 3.1 3.0 3.0 KCCM11661P-Pcj7-ramA 3.2 3.1 3.1 3.1 KCCM11662P 3.0 3.1 2.9 3.0 KCCM11662P-Pm1-ramA 3.3 3.3 3.5 3.3 KCCM11662P Pm2-ramA 3.3 3.2 3.2 3.2 KCCM11662P-Pm3-ramA 3.2 3.5 3.3 3.3 KCCM11662P-Pcj7-ramA 3.4 3.4 3.3 3.3
[0154] As a result, it was confirmed that the KCCM11661P-Pm1-ramA, KCCM11661P Pm2-ramA, and KCCM11661P-Pm3-ramA strains including the improved promoter had L-leucine production increased by 11%, 7%, and 11%, respectively, compared to the KCCM11661P strain which are similar to or higher than L-leucine producing ability of the KCCM11661P-Pcj7-ramA strain substituted with the stronger promoter.
[0155] Also, it was confirmed that the KCCM11662P-Pm1-ramA, KCCM11662P Pm2-ramA, and KCCM11662P-Pm3-ramA strains including the improved strain had L-leucine production increased by 10%, 6%, and 10%, respectively, compared to the KCCM11662P strain which are similar to or higher than L-leucine producing ability of the KCCM11662P-Pcj7-ramA strain substituted with the stronger promoter.
Example 5. Construction of Mutant Strain of L-Isoleucine-Producing Corynebacterium glutamicum KCCM11248P in which ramA Gene Promoter is Improved and Substituted and Evaluation of L-Isoleucine Producing Ability
[0156] In order to identify whether the effect on enhancing L-isoleucine producing ability is obtained in other L-isoleucine-producing strains belonging to the Corynebacterium glutamicum, L-isoleucine-producing Corynebacterium glutamicum KCCM11248P strain was transformed with the vectors in the same manner as in Examples 3-1 and 3-2 above and the transformed strains were named Corynebacterium glutamicum KCCM11248P-Pm-ramA, KCCM11248P-Pm1-ramA, KCCM11248P-Pm2-ramA, KCCM11248P-Pm3-ramA, and KCCM11248P-Pcj7-ramA, respectively. The KCCM11248P-Pm-ramA, KCCM11248P-Pm1-ramA, KCCM11248P-Pm2-ramA, KCCM11248P-Pm3-ramA, and KCCM11248P-Pcj7-ramA strains were cultured according to the following method and isoleucine producing ability was evaluated.
[0157] Each of the strains was inoculated onto a 250 mL corner-baffle flask containing 25 mL of a seed medium and cultured while shaking at 30° C. for 20 hours at 200 rpm. Then, 1 mL of the seed medium was inoculated onto a 250 mL corner-baffle flask containing 24 mL of a production medium and cultured while shaking at 30° C. for 48 hours at 200 rpm. Compositions of the seed medium and the production medium are as follows.
[0158] <Seed Medium (pH 7.0)>
[0159] 20 g of glucose, 10 g of peptone, 5 g of yeast extract, 1.5 g of urea, 4 g of KH.sub.2PO.sub.4, 8 g of K.sub.2HPO.sub.4, 0.5 g of MgSO.sub.4.7H.sub.2O, 100 μg of biotin, 1000 μg of thiamine HCl, 2000 μg of calcium pantothenate, and 2000 μg of nicotinamide (based on 1 L of distilled water)
[0160] <Production Medium (pH 7.0)>
[0161] 50 g of glucose, 12.5 g of (NH.sub.4).sub.2SO.sub.4, 2.5 g of soy protein, 5 g of corn steep solids, 3 g of urea, 1 g of KH.sub.2PO.sub.4, 0.5 g of MgSO.sub.4.7H.sub.2O, 100 μg of biotin, 1000 μg of thiamine HCl, 2000 μg of calcium pantothenate, 3000 μg of nicotinamide, 30 g of CaCO.sub.3 (based on 1 L of distilled water)
[0162] After completion of the culture, concentrations of L-isoleucine were measured by HPLC, the measured concentrations of L-isoleucine are shown in Table 10 below.
TABLE-US-00010 TABLE 10 L-Isoleucine (g/L) Strain Batch 1 Batch 2 Batch 3 Average KCCM11248P 1.6 1.3 1.4 1.43 KCCM11248P-Pm1-ramA 2.0 1.8 2.2 2.00 KCCM11248P-Pm2-ramA 1.8 2.0 1.9 1.90 KCCM11248P-Pm3-ramA 1.7 1.8 1.6 1.70 KCCM11248P-Pcj7-ramA 1.8 1.8 1.7 1.76
[0163] As a result, it was confirmed that the KCCM11248P-Pm1-ramA, KCCM11248P-Pm2-ramA, and KCCM11248P-Pm3-ramA strains including the improved promoter had L-isoleucine production increased by 39%, 32%, and 18%, respectively, compared to the KCCM11248P strain which are similar to or higher than L-isoleucine producing ability of the KCCM11248P-Pcj7-ramA strain substituted with the stronger promoter.
[0164] The above description of the present disclosure is provided for the purpose of illustration, and it would be understood by those skilled in the art that various changes and modifications may be made without changing technical conception and essential features of the present disclosure. Thus, it is clear that the above-described embodiments are illustrative in all aspects and do not limit the present disclosure. Therefore, the scope of the disclosure is defined not by the detailed description, but by the claims and their equivalents, and all variations within the scope of the claims and their equivalents are to be construed as being included in the disclosure.