ESCHERICHIA COLI-BASED RECOMBINANT STRAIN, CONSTRUCTION METHOD THEREFOR AND USE THEREOF

Abstract

An Escherichia coli-based kdtA-gene-modified recombinant strain, a construction method therefor and use thereof are provided. A mutant gene obtained by subjecting a wild-type kdtA gene (ORF sequence is shown in a sequence 73556-74833 in GenBank accession No. CP032667.1), a wild-type spoT gene (ORF sequence is shown in a sequence 3815907-3818015 in GenBank accession No. AP009048.1) and a wild-type yebN gene (ORF sequence is shown in a sequence 1907402-1907968 in GenBank accession No. AP009048.1) of an E. coli K12 strain and a derivative strain thereof (such as MG1655 and W3110) to site-directed mutagenesis, and a recombinant strain obtained therefrom can be used for the production of L-threonine. Compared with an unmutated wild-type strain, the obtained strain can produce L-threonine with a higher concentration and has good strain stability, and also has lower production cost as an L-threonine production strain.

Claims

1. A nucleotide sequence, comprising a sequence selected from the group consisting of: i. a sequence formed by a mutation occurring at the 82.sup.th base of a coding sequence of a wild-type kdtA gene shown in SEQ ID NO: 1; ii. a nucleotide sequence formed by a mutation occurring at the 520.sup.th base of a coding sequence of a spoT gene shown in SEQ ID NO: 13; and iii. a nucleotide sequence formed by a mutation occurring at the 74.sup.th base of a coding sequence of a wild-type yebN gene shown in SEQ ID NO: 23.

2. The nucleotide sequence according to claim 1, comprising a sequence selected from the group consisting of: i. a sequence having the mutation that guanine (G) mutates to adenine (A) at the 82.sup.th base in SEQ ID NO: 1; ii. a sequence having the mutation that guanine (G) mutates to thymine (T) at the 520.sup.th base in SEQ ID NO: 13; and iii. a sequence having the mutation that guanine (G) mutates to adenine (A) at the 74.sup.th base in SEQ ID NO: 23.

3. The nucleotide sequence according to claim 1, wherein the mutated nucleotide sequence is selected from the group consisting of: i. a sequence shown in SEQ ID NO: 2; ii. a sequence shown in SEQ ID NO: 14; and iii. a sequence shown in SEQ ID NO: 24.

4. A recombinant protein, encoded by the nucleotide sequence according to claim 1, wherein, preferably, an amino acid sequence of the recombinant protein is shown in SEQ ID NO: 4; or the amino acid sequence is shown in SEQ ID NO: 16; or the amino acid sequence is shown in SEQ ID NO: 26.

5. A recombinant vector, comprising the nucleotide sequence according to claim 1.

6. The recombinant vector according to claim 5, wherein the recombinant vector is constructed by introducing the nucleotide sequence into a plasmid.

7. A recombinant strain, comprising the nucleotide sequence according to claim 1.

8. The recombinant strain according to claim 7, wherein the recombinant strain is formed by introducing the recombinant vector comprising the nucleotide sequence into a host strain, wherein the host strain is selected from Escherichia coli; for example, the host strain is E. coli K12, a derivative strain thereof E. coli K12 (W3110), or an E. coli CGMCC 7.232 strain.

9. A construction method for the recombinant strain according to claim 7, comprising the following steps: (1) modifying the nucleotide sequence of the wild-type gene shown in SEQ ID NO: 1 or SEQ ID NO: 13 or SEQ ID NO: 23 to obtain a mutated nucleotide sequence shown in SEQ ID NO: 2 or SEQ ID NO: 14 or SEQ ID NO: 24; (2) ligating the mutated nucleotide sequence to a plasmid to construct a recombinant vector, preferably, the plasmid being a pKOV plasmid; and (3) introducing the recombinant vector into a host strain to obtain the recombinant strain.

10. A method of preparing L-threonine, comprising fermenting L-threonine in presence of the nucleotide sequence according to claim 1.

11. A method of preparing L-threonine, comprising fermenting L-threonine in presence of the recombinant protein according to claim 4.

12. A method of preparing L-threonine, comprising fermenting L-threonine in presence of the recombinant vector according to claim 5.

13. A method of preparing L-threonine, comprising fermenting L-threonine in presence of the recombinant strain according to claim 7.

Description

DETAILED DESCRIPTION

[0111] The above-mentioned and other features and advantages of the present disclosure are explained and illustrated in more detail in the following description of examples of the present disclosure. It should be understood that the following examples are intended to illustrate the technical solutions of the present disclosure, and are not intended to limit the protection scope of the present disclosure defined in the claims and equivalents thereof in any way.

[0112] Unless otherwise indicated, the materials and reagents herein are either commercially available or can be prepared by one skilled in the art in light of the prior art.

EXAMPLE 1

[0113] (1) Construction of Plasmid pKO V-kdtA.sup.(G82A)with kdtA Gene Coding Region Having Site-Directed Mutation (G82A) (equivalent to that alanine is substituted with threonine at the 28.sup.th site (A28T) in a wild-type protein-coding amino acid sequence SEQ ID NO: 3, the substituted amino acid sequence being SEQ ID NO: 4)

[0114] The 3-deoxy-D-mannose-sulfamyltransferase was encoded by a kdtA gene, and in an E. coli K12 strain and a derivative strain thereof (such as MG1655), an ORF sequence of the wild-type kdtA gene is shown in a sequence 73556-74833 in Genbank accession No. CP032667.1. Two pairs of primers for amplifying kdtA were designed and synthesized according to the sequence, and a vector was constructed for a base G mutating to a base A at the 82.sup.th site in a kdtA gene coding region sequence of an original strain. The primers (synthesized by Shanghai Invitrogen Corporation) were designed as follows:

TABLE-US-00004 P1: (SEQ ID NO: 5) 5′ CGGGATCCACCAGTGAACCGCCAACA 3′; P2: (SEQ ID NO: 6) 5′ TGCGCGGACGTAAGACTC 3′; P3: (SEQ ID NO: 7) 5′ GAGTCTTACGTCCGCGCA 3′; and P4: (SEQ ID NO: 8) 5′ AAGGAAAAAAGCGGCCGCTTCCCGCACCTTTATTG 3′.

[0115] The construction method was as follows: using primers P1/P2 and P3/P4 for PCR amplification by taking a genome of a wild-type strain E. coli K12 as a template to obtain two DNA fragments having a length of 927 bp and 695 bp and point mutation (kdtA.sup.(G82A))-Up and kdtA.sup.(G82A))-Down fragments). The PCR amplification was performed as follows: denaturing at 94° C. for 30 s, annealing at 52° C. for 30 s, and extending at 72° C. for 30 s (for 30 cycles). The two DNA fragments were separated and purified by agarose gel electrophoresis, and then the two purified DNA fragments were taken as templates, and P1 and P4 were taken as primers to perform overlap PCR to obtain a fragment (kdtA.sup.(G82A)-Up-Down) having a length of about 1622 bp. The overlap PCR amplification was performed as follows: denaturing at 94° C. for 30 s, annealing at 52° C. for 30 s, and extending at 72° C. for 60 s (for 30 cycles). The kdtA.sup.(G82A)-Up-Down fragment was separated and purified by agarose gel electrophoresis, then the purified fragment and a pKOV plasmid (purchased from Addgene) were digested with BamH I/Not I, and the digested kdtA.sup.(G82A)-Up-Down fragment and the digested pKOV plasmid were separated and purified by agarose gel electrophoresis followed by ligation to obtain a vector pKO V-kdtA.sup.(G82A). The vector pKO V-kdtA.sup.(G82A) was sent to a sequencing company for sequencing and identification, the result is shown in SEQ ID NO: 11, and the vector pKO V-kdtA.sup.(G82A) with the correct point mutation (kdtA.sup.(G82A)) was stored for later use.

(2) Construction of Engineered Strain with kdtA.sup.(G82A) having Point Mutation

[0116] A wild-type kdtA gene was reserved on chromosomes of a wild-type Escherichia coli strain E. coli K12 (W3110) and a high-yield L-threonine production strain E. coli CGMCC 7.232 (preserved in China General Microbiological Culture Collection Center). The constructed plasmid pKOV-kdtA.sup.(G82A) was transferred into E. coli K12 (W3110) and E. coli CGMCC 7.232, respectively, and through allele replacement, the base G mutated to the base A at the 82.sup.th site of the kdtA gene sequences in the chromosomes of the two strains. The specific process was as follows: transforming the plasmid pKO V-kdtA(G82A) into host bacterium competent cells through an electrotransformation process, and adding the cells into 0.5 mL of a SOC liquid culture medium; resuscitating the mixture in a shaker at 30° C. and 100 rpm for 2 h; coating an LB solid culture medium having a chloramphenicol content of 34 mg/mL with 100 μL of the culture solution, and culturing at 30° C. for 18 h; selecting grown monoclonal colonies, inoculating the colonies in 10 mL of an LB liquid culture medium, and culturing at 37° C. and at 200 rpm for 8 h; coating an LB solid culture medium having a chloramphenicol content of 34 mg/mL with 100 μL of the culture solution, and culturing at 42° C. for 12 h; selecting 1-5 single colonies, inoculating the colonies in 1 mL of an LB liquid medium, and culturing at 37° C. and 200 rpm for 4 h; coating an LB solid culture medium containing 10% of sucrose with 100 uL of the culture solution, and culturing at 30° C. for 24 h; selecting monoclonal colonies, and streaking the colonies on an LB solid culture medium having a chloramphenicol content of 34 mg/mL and an LB solid culture medium in a one-to-one correspondence manner; and selecting strains which grew on the LB solid culture medium and could not grow on the LB solid culture medium having the chloramphenicol content of 34 mg/mL for PCR amplification identification. The primers (synthesized by Shanghai Invitrogen Corporation) for use in PCR amplification were as follows:

TABLE-US-00005 P5: (SEQ ID NO: 9) 5′ CTTCCCGAAAGCCGATTG 3′; and P6: (SEQ ID NO: 10) 5′ ACAAAATATACTTTAATC 3′.

[0117] SSCP (Single-Strand Conformation Polymorphism) electrophoresis was performed on the PCR-amplified product; the amplified fragment of the plasmid pKOV-kdtA.sup.(G82A) was taken as a positive control, the amplified fragment of the wild-type Escherichia coli was taken as a negative control, and water was taken as a blank control. In SSCP electrophoresis, single-stranded oligonucleotide chains having the same length but different sequence arrangements formed different spatial structures in an ice bath and also had different mobilities during electrophoresis. Therefore, the fragment electrophoresis position was not consistent with that of negative control, and a strain having a fragment electrophoresis position consistent with that of positive control is the successfully allele-replaced strain. PCR amplification was performed on the target fragment by taking the successfully allele-replaced strain as a template and using primers P5 and P6, and then the target fragment was ligated to a pMD19-T vector for sequencing. Through sequence comparison of a sequencing result, a recon formed by the base G mutating to the base A at the 82.sup.th site in the kdtA gene coding region sequence is the successfully modified strain, and the sequencing result is shown in SEQ ID NO: 12. The recon derived from E. coli K12 (W3110) was named as YPThr07, and the recon derived from E. coli CGMCC 7.232 was named as YPThr 08.

(3) Threonine Fermentation Experiment

[0118] The E. coli K12 (W3110) strain, the E. coli CGMCC 7.232 strain, and the mutant strains YPThr07 and YPThr08 were inoculated in 25 mL of a liquid culture medium described in Table 1, respectively, and cultured at 37° C. and 200 rpm for 12 h. Then, 1 mL of the resulting culture of each strain was inoculated in 25 mL of a liquid culture medium described in Table 1, and subjected to fermentation culture at 37° C. and 200 rpm for 36 h. The content of L-threonine was determined by HPLC, three replicates of each strain were taken, the average was calculated, and the results are shown in Table 2.

TABLE-US-00006 TABLE 1 Culture medium formula Component Formula g/L Glucose 40 Ammonium sulfate 12 Potassium dihydrogen phosphate 0.8 Magnesium sulfate heptahydrate 0.8 Ferrous sulfate heptahydrate 0.01 Manganese sulfate monohydrate 0.01 Yeast extract 1.5 Calcium carbonate 0.5 L-methionine 0.5 pH value adjusted with potassium pH 7.0 hydroxide

TABLE-US-00007 TABLE 2 Threonine fermentation results Fermentation Mean value Multiple of Strains volume (g/L) (g/L) improvement E. coli K12 (W3110) 0.03 0.03 — 0.03 0.02 YPThr07 2.3 2.4 83.3 2.5 2.5 E. coli CGMCC 7.232 15.8 16.1 — 16.2 16.2 YPThr08 18.1 18.1 12.4% 17.9 18.4

[0119] As can be seen from the results of Table 2, the substitution of alanine at the 28.sup.th site of the amino acid sequence of the kdtA gene with threonine contributes to the improvement of the yield of L-threonine for the original strain producing L-threonine with either high or low yield.

EXAMPLE 2

[0120] (1) Construction of Plasmid pKOV-spoT.sup.(G520T) with spoT Gene Coding Region Having Site-Directed Mutation (G520T) (equivalent to that glycine is substituted with cysteine at the 174.sup.th site (G174C) in a protein-coding amino acid sequence SEQ ID NO: 15, the substituted amino acid sequence being SEQ ID NO: 16)

[0121] SPOT enzyme was encoded by a spoT gene, and in an E. coli K12 strain and a derivative strain thereof (such as W3110), an ORF sequence of the wild-type spoT gene is shown in a sequence 3815907-3818015 in GenBank accession No. AP009048.1. Two pairs of primers for amplifying spoT were designed and synthesized according to the sequence, and a vector was constructed for a base G mutating to a base T at the 520.sup.th site in a spoT gene coding region sequence of an original strain. The primers (synthesized by Shanghai Invitrogen Corporation) were designed as follows:

TABLE-US-00008 P1: (SEQ ID NO: 17) 5′ CGGGATCCGAACAGCAAGAGCAGGAAGC 3′ (the underlined part is a restriction endonuclease cutting site BamH I); P2: (SEQ ID NO: 18) 5′ TGTGGTGGATACATAAACG 3′; P3: (SEQ ID NO: 19) 5′ GCACCGTTTATGTATCCACC 3′; and P4: (SEQ ID NO: 20) 5′ AAGGAAAAAAGCGGCCGCACGACAAAGTTCAGCCAAGC 3′ (the underlined part is a restriction endonuclease cutting site Not I).

[0122] The construction method was as follows: using primers P1/P2 and P3/P4 for PCR amplification by taking a genome of a wild-type strain E. coli K12 as a template to obtain two DNA fragments having a length of 620 bp and 880 bp and point mutation (spoT.sup.(G520T)-Up and spoT.sup.(G520T)-Down fragments). PCR system: 10× Ex Taq buffer 5 μL, dNTP mixture (2.5 mM each) 4 μL, Mg.sup.2+ (25 mM) 4 μL, primers (10 pM) 2 μL each, Ex Taq (5 U/μL) 0.25 μL, total volume 50 μL, wherein the PCR was performed as follows: denaturing at 94° C. for 30 s, annealing at 52° C. for 30 s, and extending at 72° C. for 30 s (for 30 cycles). The two DNA fragments were separated and purified by agarose gel electrophoresis, and then the two purified DNA fragments were taken as templates, and P1 and P4 were taken as primers to perform overlap PCR to obtain a fragment (spoT.sup.(G520T)-Up-Down) having a length of about 1500 bp. PCR system: 10× Ex Taq buffer 5 μL, dNTP mixture (2.5 mM each) 4 μL, Mg.sup.2+ (25 mM) 4 μL, primers (10 pM) 2 μL each, Ex Taq (5 U/μL) 0.25 μL, total volume 50 μL, wherein the overlap PCR was performed as follows: denaturing at 94° C. for 30 s, annealing at 52° C. for 30 s, and extending at 72° C. for 60 s (for 30 cycles). The spoT.sup.(G520T)-Up-Down fragment was separated and purified by agarose gel electrophoresis, then the purified fragment and a pKOV plasmid (purchased from Addgene) were digested with BamH I/Not I, and the digested spoT.sup.(G520T)-Up-Down fragment and the digested pKOV plasmid were separated and purified by agarose gel electrophoresis followed by ligation with a DNA ligase to obtain a vector pKO V-spoT.sup.(G520T). The vector pKOV-spoT.sup.(G520T) was sent to a sequencing company for sequencing and identification, and the vector pKOV-spoT.sup.(G520T) with the correct point mutation (spoT.sup.(G520T)) was stored for later use.

(2) Construction of Engineered Strain with spoT.sup.(G520T) Having Point Mutation

[0123] A wild-type spoT gene was reserved on chromosomes of a wild-type Escherichia coli strain E. coli K12 (W3110) and a high-yield L-threonine production strain E. coli CGMCC 7.232 (preserved in China General Microbiological Culture Collection Center). The constructed plasmid pKOV-spoT.sup.(G520T) was transferred into E. coli K12 (W3110) and E. coli CGMCC 7.232, respectively, and through allele replacement, the base G mutated to the base T at the 520.sup.th site of the spoT gene sequences in the chromosomes of the two strains. The specific process was as follows: transforming the plasmid pKO V-spoT.sup.(G520T) into host bacterium competent cells through an electrotransformation process, and adding the cells into 0.5 mL of a SOC liquid culture medium; resuscitating the mixture in a shaker at 30° C. and 100 rpm for 2 h; coating an LB solid culture medium having a chloramphenicol content of 34 μg/mL with 100 μL of the culture solution, and culturing at 30° C. for 18 h; selecting grown monoclonal colonies, inoculating the colonies in 10 mL of an LB liquid culture medium, and culturing at 37° C. and at 200 rpm for 8 h; coating an LB solid culture medium having a chloramphenicol content of 34 μg/mL with 100 μL of the culture solution, and culturing at 42° C. for 12 h; selecting 1-5 single colonies, inoculating the colonies in 1 mL of an LB liquid medium, and culturing at 37° C. and 200 rpm for 4 h; coating an LB solid culture medium containing 10% of sucrose with 100 uL of the culture solution, and culturing at 30° C. for 24 h; selecting monoclonal colonies, and streaking the colonies on an LB solid culture medium having a chloramphenicol content of 34 μg/mL and an LB solid culture medium in a one-to-one correspondence manner; and selecting strains which grew on the LB solid culture medium and could not grow on the LB solid culture medium having the chloramphenicol content of 34 μg/mL for PCR amplification identification. The primers (synthesized by Shanghai Invitrogen Corporation) for use in PCR amplification were as follows:

TABLE-US-00009 P5: (SEQ ID NO: 21) 5′ ctttcgcaagatgattatgg 3′; and P6: (SEQ ID NO: 22) 5′ cacggtattcccgcttcctg 3′.

[0124] PCR system: 10× Ex Taq buffer 5 μL, dNTP mixture (2.5 mM each) 4 μL, Mg.sup.2+ (25 mM) 4 μL, primers (10 pM) 2 μL each, Ex Taq (5 U/μL) 0.25 μL, total volume 50 μL, wherein the PCR amplification was performed as follows: pre-denaturation at 94° C. for 5 min, (denaturing at 94° C. for 30 s, annealing at 52° C. for 30 s, and extending at 72° C. for 90 s, for 30 cycles), and over-extending at 72° C. for 10 min. SSCP (Single-Strand Conformation Polymorphism) electrophoresis was performed on the PCR-amplified product; the amplified fragment of the plasmid pKOV-spoT.sup.(G520T) was taken as a positive control, the amplified fragment of the wild-type Escherichia coli was taken as a negative control, and water was taken as a blank control. In SSCP electrophoresis, single-stranded oligonucleotide chains having the same length but different sequence arrangements formed different spatial structures in an ice bath and also had different mobilities during electrophoresis. Therefore, the fragment electrophoresis position was not consistent with that of negative control, and a strain having a fragment electrophoresis position consistent with that of positive control is the successfully allele-replaced strain. PCR amplification was performed on the target fragment by taking the successfully allele-replaced strain as a template and using primers P5 and P6, and then the target fragment was ligated to a pMD19-T vector for sequencing. Through sequence comparison of a sequencing result, a recon formed by the base G mutating to the base T at the 520.sup.th site in the spoT gene coding region sequence is the successfully modified strain. The recon derived from E. coli K12 (W3110) was named as YPThr03, and the recon derived from E. coli CGMCC 7.232 was named as YPThr04.

(3) Threonine Fermentation Experiment

[0125] The E. coli K12 (W3110) strain, the E. coli CGMCC 7.232 strain, and the mutant strains YPThr03 and YPThr04 were inoculated in 25 mL of a liquid culture medium described in Table 1, respectively, and cultured at 37° C. and 200 rpm for 12 h. Then, 1 mL of the resulting culture of each strain was inoculated in 25 mL of a liquid culture medium described in Table 1, and subjected to fermentation culture at 37° C. and 200 rpm for 36 h. The content of L-threonine was determined by HPLC, three replicates of each strain were taken, the average was calculated, and the results are shown in Table 2.

TABLE-US-00010 TABLE 1 Culture medium formula Component Formula g/L Glucose 40 Ammonium sulfate 12 Potassium dihydrogen phosphate 0.8 Magnesium sulfate heptahydrate 0.8 Ferrous sulfate heptahydrate 0.01 Manganese sulfate monohydrate 0.01 Yeast extract 1.5 Calcium carbonate 0.5 L-methionine 0.5 pH value adjusted with pH 7.0 potassium hydroxide

TABLE-US-00011 TABLE 2 Threonine fermentation results Fermentation Mean value Multiple of Strains volume (g/L) (g/L) improvement E. coli K12 W3110 0.01 0.02 — 0.02 0.02 YPThr03 2.2 2.3  115 2.4 2.3 E. coli CGMCC 16.0 16.2 — 7.232 16.3 16.2 YPThr04 17.9 18.1 11.7% 18.2 18.1

[0126] As can be seen from the results of Table 2, the substitution of glycine at the 174.sup.th site of the amino acid sequence of the spoT gene with cysteine contributes to the improvement of the yield of L-threonine for the original strain producing L-threonine with either high or low yield.

EXAMPLE 3

[0127] (1) Construction of Plasmid pKOV-yebN.sup.(G74A) with yebN Gene Coding Region Having Site-Directed Mutation (G74A) (equivalent to that glycine is substituted with aspartic acid at the 25.sup.th site (G25D) in a protein-coding amino acid sequence SEQ ID NO: 25, the substituted amino acid sequence being SEQ ID NO: 26)

[0128] YEBN enzyme was encoded by a yebN gene, and in an E. coli K12 strain and a derivative strain thereof (such as W3110), an ORF sequence of the wild-type yebN gene is shown in a sequence 1907402-1907968 in GenBank accession No. AP009048.1. Two pairs of primers for amplifying yebN were designed and synthesized according to the sequence, and a vector was constructed for a base G mutating to a base A at the 74.sup.th site in a yebN gene coding region sequence of an original strain. The primers (synthesized by Shanghai Invitrogen Corporation) were designed as follows:

TABLE-US-00012 P1: (SEQ ID NO: 27) 5′ CGGGATCCCTTCGCCAATGTCTGGATTG 3′ (the underlined part is a restriction endonuclease cutting site BamH I); P2: (SEQ ID NO: 28) 5′ ATGGAGGGTGGCATCTTTAC 3′; P3: (SEQ ID NO: 29) 5′ TGCATCAATCGGTAAAGATG 3′; and P4: (SEQ ID NO: 30) 5′ AAGGAAAAAAGCGGCCGCCAACTCCGCACTCTGCTGTA 3′ (the underlined part is a restriction endonuclease cutting site Not I).

[0129] The construction method was as follows: using primers P1/P2 and P3/P4 for PCR amplification by taking a genome of a wild-type strain E. coli K12 as a template to obtain two DNA fragments having a length of 690 bp and 700 bp and point mutation (yebN.sup.G74A)-Up and yebN.sup.G74A)-Down fragments). PCR system: 10× Ex Taq buffer 5 μL, dNTP mixture (2.5 mM each) 4 μL, Mg.sup.2+ (25 mM) 4 μL, primers (10 pM) 2 μL each, Ex Taq (5 U/μL) 0.25 μL, total volume 50 μL, wherein the PCR was performed as follows: denaturing at 94° C. for 30 s, annealing at 52° C. for 30 s, and extending at 72° C. for 30 s (for 30 cycles). The two DNA fragments were separated and purified by agarose gel electrophoresis, and then the two purified DNA fragments were taken as templates, and P1 and P4 were taken as primers to perform overlap PCR to obtain a fragment (yebN.sup.(G74A)-Up-Down) having a length of about 1340 bp.

[0130] PCR system: 10× Ex Taq buffer 5 μL, dNTP mixture (2.5 mM each) 4 μL, Mg.sup.2+ (25 mM) 4 μL, primers (10 pM) 2 μL each, Ex Taq (5 U/μL) 0.25 μL, total volume 50 μL, wherein the overlap PCR was performed as follows: denaturing at 94° C. for 30 s, annealing at 52° C. for 30 s, and extending at 72° C. for 60 s (for 30 cycles). The yebN.sup.(G74A)-Up-Down fragment was separated and purified by agarose gel electrophoresis, then the purified fragment and a pKOV plasmid (purchased from Addgene) were digested with BamH I/Not I, and the digested yebN.sup.(G74A)-Up-Down fragment and the digested pKOV plasmid were separated and purified by agarose gel electrophoresis followed by ligation to obtain a vector pKO V-yebN.sup.(G74A). The vector pKOV-yebN.sup.(G74A) was sent to a sequencing company for sequencing and identification, and the vector pKOV-yebN.sup.(G74A) with the correct point mutation (yebN.sup.(G74A)) was stored for later use.

(2) Construction of Engineered Strain with yebN.sup.(G74A) Having Point Mutation

[0131] A wild-type yebN gene was reserved on chromosomes of a wild-type Escherichia coli strain E. coli K12 (W3110) and a high-yield L-threonine production strain E. coli CGMCC 7.232 (preserved in China General Microbiological Culture Collection Center). The constructed plasmid pKOV-yebN.sup.(G74A) was transferred into E. coli K12 (W3110) and E. coli CGMCC 7.232, respectively, and through allele replacement, the base G mutated to the base A at the 74.sup.th site of the yebN gene sequences in the chromosomes of the two strains.

[0132] The specific process was as follows: transforming the plasmid pKO V-yebN.sup.(G74A) into host bacterium competent cells through an electrotransformation process, and adding the cells into 0.5 mL of a SOC liquid culture medium; resuscitating the mixture in a shaker at 30° C. and 100 rpm for 2 h; coating an LB solid culture medium having a chloramphenicol content of 34 μg/mL with 100 μL of the culture solution, and culturing at 30° C. for 18 h; selecting grown monoclonal colonies, inoculating the colonies in 10 mL of an LB liquid culture medium, and culturing at 37° C. and at 200 rpm for 8 h; coating an LB solid culture medium having a chloramphenicol content of 34 μg/mL with 100 μL of the culture solution, and culturing at 42° C. for 12 h; selecting 1-5 single colonies, inoculating the colonies in 1 mL of an LB liquid medium, and culturing at 37° C. and 200 rpm for 4 h; coating an LB solid culture medium containing 10% of sucrose with 100 uL of the culture solution, and culturing at 30° C. for 24 h; selecting monoclonal colonies, and streaking the colonies on an LB solid culture medium having a chloramphenicol content of 34 μg/mL and an LB solid culture medium in a one-to-one correspondence manner; and selecting strains which grew on the LB solid culture medium and could not grow on the LB solid culture medium having the chloramphenicol content of 34 μg/mL for PCR amplification identification. The primers (synthesized by Shanghai Invitrogen Corporation) for use in PCR amplification were as follows:

TABLE-US-00013 P5: (SEQ ID NO: 31) 5′ CCATCACGGCTTGTTGTTC 3′; and P6: (SEQ ID NO: 32) 5′ ACGAAAACCCTCAATAATC 3′.

[0133] PCR system: 10× Ex Taq buffer 5 μL, dNTP mixture (2.5 mM each) 4 μL, Mg.sup.2+ (25 mM) 4 μL, primers (10 pM) 2 μL each, Ex Taq (5 U/μL) 0.25 μL, total volume 50 μL, wherein the PCR amplification was performed as follows: pre-denaturation at 94° C. for 5 min, (denaturing at 94° C. for 30 s, annealing at 52° C. for 30 s, and extending at 72° C. for 30 s, for 30 cycles), and over-extending at 72° C. for 10 min. SSCP (Single-Strand Conformation Polymorphism) electrophoresis was performed on the PCR-amplified product; the amplified fragment of the plasmid pKOV-yebN.sup.(G74A) was taken as a positive control, the amplified fragment of the wild-type Escherichia coli was taken as a negative control, and water was taken as a blank control. In SSCP electrophoresis, single-stranded oligonucleotide chains having the same length but different sequence arrangements formed different spatial structures in an ice bath and also had different mobilities during electrophoresis. Therefore, the fragment electrophoresis position was not consistent with that of negative control, and a strain having a fragment electrophoresis position consistent with that of positive control is the successfully allele-replaced strain. PCR amplification was performed on the target fragment by taking the successfully allele-replaced strain as a template and using primers P5 and P6, and then the target fragment was ligated to a pMD19-T vector for sequencing. Through sequence comparison of a sequencing result, a recon formed by the base G mutating to the base A at the 74.sup.th site in the yebN gene coding region sequence is the successfully modified strain. The recon derived from E. coli K12 (W3110) was named as YPThr05, and the recon derived from E. coli CGMCC 7.232 was named as YPThr 06.

(3) Threonine Fermentation Experiment

[0134] The E. coli K12 (W3110) strain, the E. coli CGMCC 7.232 strain, and the mutant strains YPThr05 and YPThr06 were inoculated in 25 mL of a liquid culture medium described in Table 1, respectively, and cultured at 37° C. and 200 rpm for 12 h. Then, 1 mL of the resulting culture of each strain was inoculated in 25 mL of a liquid culture medium described in Table 1, and subjected to fermentation culture at 37° C. and 200 rpm for 36 h. The content of L-threonine was determined by HPLC, three replicates of each strain were taken, the average was calculated, and the results are shown in Table 2.

TABLE-US-00014 TABLE 1 Culture medium formula Component Formula g/L Glucose 40 Ammonium sulfate 12 Potassium dihydrogen phosphate 0.8 Magnesium sulfate heptahydrate 0.8 Ferrous sulfate heptahydrate 0.01 Manganese sulfate monohydrate 0.01 Yeast extract 1.5 Calcium carbonate 0.5 L-methionine 0.5 pH value adjusted with potassium pH 7.0 hydroxide

TABLE-US-00015 TABLE 2 Threonine fermentation results Fermentation Mean value Multiple of Strains volume (g/L) (g/L) improvement E. coli K12 (W3110) 0.02 0.02 — 0.03 0.02 YPThr05 2.2 2.2 110 2.1 2.3 E. coli CGMCC 7.232 16.0 16.2 — 16.3 16.2 YPThr06 17.6 17.8 9.9% 17.9 18.0

[0135] As can be seen from the results of Table 2, the substitution of glycine at the 25.sup.th site of the amino acid sequence of the yebN gene with aspartic acid contributes to the improvement of the yield of L-threonine for the original strain producing L-threonine with either high or low yield.

[0136] The examples of the present disclosure have been described above. However, the present disclosure is not limited to the above examples. Any modification, equivalent, improvement and the like made without departing from the spirit and principle of the present disclosure shall fall within the protection scope of the present disclosure.