Genetically enhanced cyanobacteria for the production of a first chemical compound harbouring Zn2+, Co2+ or Ni2+ -inducible promoters

Abstract

One embodiment of the invention is directed to a genetically enhanced cyanobacterium for the production of a first chemical compound, comprising at least one first recombinant gene encoding a first biocatalyst for the production of the first chemical compound, wherein the gene is under the transcriptional control of a Co.sup.2+ or Zn.sup.2+-inducible promoter. Such a cyanobacterium can provide a tighter control of the production of the first chemical compound.

Claims

1. An ethanologenic recombinant cyanobacterium comprising a recombinant alcohol dehydrogenase gene and a heterologous pyruvate decarboxylase gene wherein said alcohol dehydrogenase gene is operably linked to a first promoter and wherein said pyruvate decarboxylase gene is operably linked to a second promoter and wherein said second promoter is a Co2+ inducible promoter or a Zn2+ inducible promoter.

2. The ethanologenic recombinant cyanobacterium of claim 1 wherein said first promoter is a Co2+ inducible promoter or a Zn2+ inducible promoter.

3. The ethanologenic recombinant cyanobacterium of claim 1 wherein said first promoter is constitutive.

4. The ethanologenic recombinant cyanobacterium of claim 3 wherein said first promoter is PrbcL.

5. The ethanologenic recombinant cyanobacterium of claim 1 wherein said second promoter is selected from the group consisting of PziaA from Synechocystis 6803, PsmtA from Synechococcus 7942 and Synechococcus 7002, PcorT from Synechocystis 6803, PaztA from Anabaena 7120, PbmtA from Oscillatoria brevis, Pbxa1 from Oscillatoria brevis, PzntA from Staphylococcus aureus, PczrB from Staphylococcus aureus 912, and PnmtA from Mycobacterium tuberculosis.

6. The ethanologenic recombinant cyanobacterium of claim 1, further comprising an extrachromosomal plasmid either comprising a first promoter, recombinant alcohol dehydrogenase gene, second promoter, and heterologous pyruvate decarboxylase gene, or comprising a second promoter and a heterologous pyruvate decarboxylase gene.

7. The ethanologenic recombinant cyanobacterium of claim 1 wherein said second promoter is inducible by Zn2+.

8. The ethanologenic recombinant cyanobacterium of claim 7 wherein said second promoter has a sequence that is at least 70% identical to the sequence of a ziaA promoter having the sequence of: TABLE-US-00025 (SEQIDNO.5) (N).sub.11AATATCTGAGCATATCTTCAGGTGTT(N).sub.13TACGGT(N).sub.6A (N).sub.16ACGTTGGCCGCCATG, wherein each of said N nucleotides is selected from a group consisting of A, T, C and G and wherein said 3ATG is the start codon of said heterologous pyruvate decarboxylase gene.

9. The ethanologenic recombinant cyanobacterium of claim 7 wherein said second promoter has a sequence that is at least 70% identical to the sequence of a aztA promoter having the sequence of: TABLE-US-00026 (SEQIDNO.44) (N).sub.12TGTACAATTGAATAGTTGTTCAATTGTTGTATTAGAAT (N).sub.5C(N).sub.17AATTCTAAAGCTGCTATG, wherein each of said N nucleotides is selected from a group consisting of A, T, C and G and wherein said 3ATG is the start codon of said heterologous pyruvate decarboxylase gene.

10. The ethanologenic recombinant cyanobacterium of claim 1 wherein said second promoter is inducible by Co2+.

11. The ethanologenic recombinant cyanobacterium of claim 10 wherein said second promoter has a sequence that is at least 70% identical to the sequence of a corT promoter having the sequence of: TABLE-US-00027 (SEQISNO.31) CAT(N).sub.7GTTTACTCAAAACCTTGACATTGACACTAATGTTAAGGTTTA GGCT(N).sub.15CAAGTTAAAAAGCATG, wherein each of said N nucleotides is selected from a group consisting of A, T, C and G and wherein said 5 CAT is the start codon of a corR gene in the antisense orientation, and wherein said 3ATG is the start codon of said heterologous pyruvate decarboxylase gene.

12. An ethanologenic recombinant cyanobacterium comprising a recombinant alcohol dehydrogenase gene and a heterologous pyruvate decarboxylase gene wherein said alcohol dehydrogenase gene is operably linked to a first promoter and wherein said pyruvate decarboxylase gene is operably linked to a second promoter and wherein said second promoter is a Ni2+ inducible promoter.

13. The ethanologenic recombinant cyanobacterium of claim 12 wherein said first promoter is a Ni2+ inducible promoter.

14. The ethanologenic recombinant cyanobacterium of claim 12 wherein said first promoter is constitutive.

15. The ethanologenic recombinant cyanobacterium of claim 14 wherein said first promoter is PrbcL.

16. The ethanologenic recombinant cyanobacterium of claim 12 wherein said second promoter is selected from the group consisting of nrsRS-PnrsB from Synechocystis PCC 6803 and nrsRS916-PnrsB916 from Synechococcus sp.

17. The ethanologenic recombinant cyanobacterium of claim 12 wherein said second promoter inducible by Ni2+ has a sequence that is at least 70% identical to the sequence of a nrsB promoter having the sequence of: TABLE-US-00028 (SEQIDNO.91) (N).sub.14GAGATTTTCACCTGAATTTCATACCCCCTTTGGCAGACTGGGAAA (N).sub.17AATTTGAGGTGGTGTGATG, wherein each of said N nucleotides is selected from a group consisting of A, T, C and G and wherein said 3ATG is the start codon of said heterologous pyruvate decarboxylase gene.

18. The ethanologenic recombinant cyanobacterium of claim 11 wherein said second promoter inducible by Ni2+ has a sequence that is at least 70% identical to the sequence of a nrsB promoter having the sequence of: TABLE-US-00029 (SEQIDNO.92) (N).sub.14GCCTATTTCACTTAGATTTCATACCCCCTCTGGCAAACTGGAAA AA(N).sub.24AATGTGAGGTGCTGTGATG, wherein each of said N nucleotides is selected from a group consisting of A, T, C and G and wherein said 3ATG is the start codon of said heterologous pyruvate decarboxylase gene.

Description

BRIEF DESCRIPTION OF THE FIGURES

(1) Plasmid maps shown in the following include restriction sites for the respectively denoted restriction endonucleases. Gm denotes a gene conferring resistance to Gentamycin, and aph (KanR2) denotes a gene coding for aminoglycoside (3) phosphotransferase conferring resistance to Kanamycin. Sp/Sm designates a gene imparting resistance for spectinomycin/streptomycin and Cm depicts a gene conferring resistance to Chloramphenicol.

(2) In general, plasmids were generated by inserting DNA constructs containing the promoters and the first and second recombinant genes into the plasmids pVZ322A and pVZ325A via a multiple cloning site using a SalI/SbfI restriction endonuclease digest.

(3) FIGS. 1A and 1B show the plasmid maps of the vectors pVZ322A and pVZ325A. The nucleotide sequences of these plasmids are shown in the sequence listing with SEQ ID NO 47 and 48.

(4) FIGS. 2A and 2B show the sequences of the primers used to create constructs with the PziaA, ziaR-PziaA DNA sequences and the nucleotide sequence of ziaR-PziaA (see also SEQ ID No. 1). The nucleotide sequences of these primers are listed as SEQ ID NO. 49 to 51.

(5) FIG. 2C depicts the promoter and gene orientation of ziaRA genes.

(6) FIGS. 3A and 3B shows the ethanol production rates % EtOH (v/v) per optical density of the culture at 750 nm (OD.sub.750 nm) of another cyanobacterial strain using the promoter petJ compared to a cyanobacterial strain including PziaA.

(7) FIGS. 4A and 4B depict the plasmid maps of the strains #1048 and #996.

(8) FIGS. 5A and 5B depict the plasmid maps of the strains #948 and #969.

(9) Optical densities at 750 nm, ethanol accumulation and ethanol production normalized to optical densities are shown in the FIGS. 6A and 6B for a prior art strain using the promoter petJ and another strain according to the invention employing PziaA.

(10) FIGS. 7A and 7B depict the plasmid maps of the plasmids #1047 and #1068.

(11) A comparison of the ethanol production rates for cyanobacterial strains including only PziaA and a combination of ziaR-PziaA is shown in the FIGS. 8A and 8B.

(12) FIG. 9A depicts various variants of the ziaA promoter sequence along with primers for generating these variants. The sequences of the ziaA promoter variants are as follows: SEQ ID NO. 97 is the ziaA promoter variantconstruct #1133, PziaA*. SEQ ID NO. 98 is the ziaA promoter variantconstruct #1134, PziaA*1. SEQ ID NO. 99 is the ziaA promoter variantconstruct #1135, PziaA*2. SEQ ID NO. 100 is the ziaA promoter variantconstruct #1136, PziaA*3. SEQ ID NO. 101 is the ziaA promoter variantconstruct #1147, PziaA*4. SEQ ID NO. 102 is the ziaA promoter variantconstruct #1148, PziaA*5. SEQ ID NO. 103 is the ziaA promoter variantconstruct #1149, PziaA*6. SEQ ID NO. 104 is the ziaA promoter variantconstruct #1150, PziaA*7. The primer sequences are as follows: Primer 1: SEQ ID NO. 59; primer 2: SEQ ID NO. 60; Primer 3: SEQ ID NO. 61; Primer 4: SEQ ID NO. 62; Primer 5: SEQ ID NO. 63; Primer 6: SEQ ID NO. 64. Ethanol production rates, OD.sub.750 nm, OD normalized ethanol production rates and induction factors obtained by using these promoter variants are shown in FIGS. 9B to 9E. FIGS. 9F to 9K show the plasmid map and the nucleotide sequence of PziaA*2ext as well as the ethanol production rates and acetaldehyde to ethanol ratios for cyanobacteria harboring a plasmid with the promoter PziaA*2ext.

(13) FIG. 10 shows a comparison of the DNA sequences of PziaA, PaztA, two different smtA promoters from Synechococcus PCC 7002 and Synechococcus PCC 7942 and the Co.sup.2+ responsive promoter PcorT and the Ni.sup.2+ inducible promoter PnrsB.

(14) The plasmid organization of the plasmid #1277 including PaztA/aztR is shown in FIG. 11A. FIG. 11B shows a graphical representation of the ethanol production rates of Synechocystis PCC 6803 and FIG. 11C of Synechococcus PCC 7002 including the plasmid #1277 aztR-PaztA, respectively.

(15) The plasmid organization of the plasmid #1217 including corR-PcorT is depicted in FIG. 12A. Ethanol formation rates using Synechocystis PCC 6803 harbouring the Co.sup.2+ dependent corT promoter is given in FIG. 12B and for Synechococcus PCC 7002 harboring the Co.sup.2+ dependent corT promoter in FIG. 12C.

(16) The plasmid organization of the plasmid #1227 including nrsR-PnrsB is shown in FIG. 13A. FIG. 13B shows the ethanol production rates of Synechocystis PCC6803 harboring the plasmid #1227 including Pdc and Adh encoding genes under the transcriptional control of nrsR-PnrsB. FIGS. 13C and 13D show the plasmid map for the plasmid #1353 containing SynAdh gene under the transcriptional control of the Prbc* promoter and Pdc gene under the control of PnrsB with the regulators nrsR and nrsS and the corresponding ethanol production rates of Synechococcus PCC 7002 transformed with this plasmid.

(17) Optical densities at 750 nm, ethanol accumulation and ethanol production normalized to optical densities are shown in the FIG. 14A for Synechocystis PCC 6803 containing the plasmid #1068 including ziaR-PziaA, in the FIG. 14B for Synechocystis PCC 6803 containing the plasmid #1217 including corR-PcorT and in FIG. 14C for Synechocystis PCC 6803 containing the plasmid #1227 including nrsR-PnrsB.

(18) The plasmid organizations of the plasmids TK96 only including PsmtA and of the plasmid #TK115 including smtB-PsmtA are shown in the FIGS. 15A and 15B. Gas chromatography measurements over several time points (GC assay) for the ethanol production are shown in FIGS. 15C and 15D for both above mentioned strains transformed with the plasmids. The chlorophyll content, OD.sub.750, ethanol production rate (v/v in %) and ethanol production rate (v/v in % per OD.sub.750) are shown in FIG. 15E for Synechococcus sp. strain PCC 7002 transformed with the plasmid TK96 harboring ethanologenic genes under the transcriptional control of the smtA promoter.

(19) FIGS. 16A and 16 B shows the ethanol production over time of genetically enhanced Synechococcus PCC 7002 strains transformed with extrachromosomal plasmids #1121 with endogenous Zn.sup.2+ inducible promoter in comparison to the same cyanobacterial strain harboring an extrachromosomal plasmid #1348 with heterologous Zn.sup.2+ inducible promoter from PCC6803.

(20) The FIGS. 16C and D show the plasmid maps of the plasmids #1121 and #1348, whose nucleotide sequences are included in the sequence listing with SEQ ID NO. 75 and SEQ ID NO. 76.

(21) In plasmid #1121 the nucleotides 66 to 392 code for smtB, PsmtA runs from nucleotides 393 to 492, the gentamycin resistance cassette (Gm) runs from nucleotides 9721 to 10251, PrbcL (6803) runs from nucleotides 2276 to 2534, the terminator oop (derived from phage lambda oop RNA integrated downstream (3) of synAdh gene and ZmPdc) is located at nucleotides 2243 to 2275 and from nucleotides 3549 to 3579, and the gene synADH.sub.deg is present at nucleotides 2538 to 3548, the Kanamycin resistance cassette is located at nucleotides 10540 to 11354 and finally the gene coding for ZmPdc runs from 502 to 2202.

(22) The plasmid #1348 contains the following genes and regulatory elements:

(23) TABLE-US-00012 Nucleotides Gene/regulatory element 10209 to 11023 aph\(KanR2) 9414 to 9944 Gm 1969 to 2221 PrbcL(6803) 2231 to 3241 synADH.sub.deg 3242 to 3272 oop 158 to 1858 zmPDC 1884 to 1929 dsrA 1 to 144 PziaA(6803) Antisense 11343 to 11741 ziaR

(24) FIGS. 17A and 17B depict the activities of Pdc enzyme and Adh enzyme depending on the integration into the different endogenous plasmids in comparison to a pVZ322 based extrachromosomal plasmid #1535.

(25) FIGS. 17C and 17D show the ethanol production over time of the strains already mentioned in FIGS. 17A and 17B. The plasmid maps of the plasmids TK 161, and TK 165, respectively are shown in the FIGS. 17E, and 17F and the nucleotide sequence of the plasmids TK 115, TK 161, and TK 165 is listed as SEQ ID NO. 77, 78 and 79, respectively.

(26) The location of the genes and regulatory elements on these plasmids is as follows:

(27) TABLE-US-00013 Plasmid TK 115 nucleotides Gene/regulatory element 393 to 492 PsmtA Antisense 6 to 392 smtB 4698 to 5237 pAQ4-FB 3610 to 3670 PpsbA (psbA promoter from Amaranthus hybridus) 3710 to 4491 Nm Antisense 6105 to 6962 Amp 8179 to 8915 pAQ4-FA 2276 to 2534 PrbcL(6803) 2243 to 2275 oop 2538 to 3548 synADH.sub.deg 3549 to 3579 oop 502 to 2202 ZmPDC

(28) TABLE-US-00014 Plasmid TK 161 nucleotides Gene/regulatory element Antisense 8392 to 8778 smtB 8779 to 8878 PsmtA 5 to 1705 zmPDC 3052 to 3082 oop 2041 to 3051 synADH.sub.deg 1746 to 1778 oop 1779 to 2037 PrbcL(6803) 7818 to 8386 pAQ3-FA Antisense 5744 to 6601 Amp 4384 to 4876 pAQ3-FB 3239 to 4054 KmR (kanamycin resistance cassette)

(29) TABLE-US-00015 Plasmid TK 165 nucleotides Gene/regulatory element 502 to 2202 zmPDC 3549 to 3579 oop 2538 to 3548 synADH.sub.deg 2243 to 2275 oop 2276 to 2534 PrbcL(6803) 8330 to 9000 pAQ1-FA2 Antisense 6256 to 7113 Amp 4881 to 5388 pAQ1-FB2 Antisense 6 to 392 smtB 393 to 492 PsmtA 3736 to 4551 KmR (kanamycin resistance cassette)

(30) FIGS. 18A and 18B show the ethanol production over time and the specific activity of Pdc enzyme for Synechococcus PCC 7002 strains harboring plasmid pAQ1 into which an ethanologenic cassette including a heterologous Zn.sup.2+-inducible promoter ziaR-PziaA from Synechocystis PCC 6803 was integrated via transformation with the plasmid #1468 including flanking regions as platforms for homologous recombination for integration of the ethanologenic cassette into pAQ1.

(31) FIGS. 18C, 18D, 18E, 18F and 18 G show the ethanol production over time (v/v), the ethanol production over time (v/v) normalized to the OD.sub.750 nm, the OD.sub.750 nm and the specific Pdc activity for a 0.5 l cultivation of Synechococcus PCC 7002 over a time period for 19 days.

(32) The Plasmid map of plasmid #1468 is depicted in FIG. 18H and the DNA sequence of this plasmid is included in the sequence listing as SEQ ID NO. 80.

(33) The genes and regulatory elements included on this plasmid are as follows:

(34) TABLE-US-00016 Nucleotides Gene/regulatory element 573 to 2273 zmPDC 2312 to 2376 Prbc* (optimized promoter version based on PrbcL from PCC6803) 2378 to 3388 synADH 3418 to 3449 oop 4776 to 5283 pAQ1-FB2 Antisense 6151 to 7008 Amp 8225 to 8895 pAQ1-FA2 3664 to 4672 Sp/Sm Antisense 10 to 408 ziaR 416 to 559 PziaA(6803)

(35) FIG. 19A depicts the ethanol production over time (v/v) at different induction conditions normalized to the OD.sub.750 nm determined by the GC vial assay (multiple GC measurements over time sampled from an illuminated GC vial filled with culture) for Synechococcus PCC 7002 transformed with the plasmid #1332 for integration of the ethanologenic cassette with the Co.sup.2+-inducible promoter corR-PcorT into the endogenous plasmid pAQ4.

(36) FIG. 19B depicts the plasmid map of plasmid #1332, whose nucleic acid sequence is given as SEQ ID NO. 81. The location of genes and regulatory elements on this plasmid is as follows:

(37) TABLE-US-00017 Nucleotides Gene/regulatory element 2925 . . . 3021 native terminator of zpPDC 1251 . . . 2924 zpPDC 1167 . . . 1249 PcorT complement(57 . . . 1166) corR 4147 . . . 4178 oop 3107 . . . 4117 synADH 3041 . . . 3105 Prbc* 8777 . . . 9513 pAQ4-FA complement(6703 . . . 7560) Amp 4308 . . . 5089 Neomycin resistance cassette (Nm) 4208 . . . 4268 PpsbA (psbA promoter from Amaranthus hybridus) 5296 . . . 5835 pAQ4-FB

(38) FIGS. 20A and 20B depict the ethanol production over time (v/v) at different induction conditions normalized to the OD.sub.750 nm and the specific Adh and Pyruvate decarboxylase activities for cultivation over a time period of about 60 hours.

(39) The FIGS. 20C, 20D, 20E, and 20F show the ethanol production over time (v/v), the ethanol production over time (v/v) normalized to the OD.sub.750 nm, the growth as OD.sub.750 nm, and the specific activity of Pdc enzyme for a cultivation of a Synechococcus strain in 0.5 l bioreactors over a time period of 50 days.

(40) The plasmid map of plasmid #1449 is shown in FIG. 20G and its nucleic acid sequence is SEQ ID NO. 82. The location of genes on this plasmid is as follows:

(41) TABLE-US-00018 Nucleotides Gene/regulatory element 4136 to 4166 oop 3096 to 4106 synADH 10308 to 10838 Gm 1255 to 2955 zmPDC 2981 to 3026 dsrA terminator Antisense 57 to 1166 corR 1167 to 1249 PcorT(6803) 11103 to 11917 aph\(KanR2) 3027 to 3095 Prbc*(optRBS) (improved version of rbcL(6803) promoter with optimized RBS)

(42) FIGS. 21A and 21B show the ethanol production (v/v) normalized to the OD.sub.750 nm for a Synechococcus PCC 7002 strain transformed with two different plasmids #1507 and #1470.

(43) FIGS. 21C and 21D depict the plasmid maps of plasmids #1507 and 1470. FIG. 21E shows a comparison of the native corT and the modified corT*1 promoter including 5- and 3-neighboring nucleic acid sequences with restriction sites and start codons for genes transcriptionally controlled by the promoter. The nucleic acid sequence of plasmid #1507 is included in the sequence listing as SEQ ID NO. 83. SEQ ID NO. 84 shows the DNA sequence of the PcorT* promoter.

(44) The location of genes and regulatory elements on the plasmid #1507 is as follows:

(45) TABLE-US-00019 Nucleotides Gene/regulatory element Antisense 4437 to 4970 Gentamycin resistance cassette (Gm) Antisense 5388 to 5956 pAQ3-FA 7173 to 8030 Ampicillin resistance cassette (Amp) Antisense 8898 to 9390 pAQ3-FB 4131 to 4162 oop 3091 to 4101 synADH 3025 to 3089 Prbc*(improved version of rbcL promoter from PCC6803) 2958 to 3005 spf terminator (E. coli) Antisense 57 to 1166 corR 1167 to 1249 PcorT(6803) 1248 to 2954 zmPDCdeg

(46) FIGS. 22A and 22B show the ethanol production (v/v) normalized to the OD.sub.750 nm for Synechococcus PCC 7002 strains transformed with pVZ322 based extrachromosomal plasmids #1353 and #1354. The only difference between both plasmids are modifications in the ribosomal binding site of the heterologous Ni.sup.2+-inducible promoter PnrsB from Synechocystis PCC 6803 in plasmid #1354 resulting in the promoter PnrsB* controlling the transcription of the pdc gene. By introducing these specific nucleotide substitutions into the ribosomal binding site of the nrsR promoter in construct #1354 (nrsRS-PnrsB*) the ethanol production rate was increased by 35% compared to the native nrsRS-PnrsB promoter from PCC6803 (strain transformed with #1353). However compared to Synechococcus PCC7002 strains with Co.sup.2+ or Zn.sup.2+ inducible promoter systems (e.g. #1449 and #1121), the ethanol production rate is still below 50%. The tight repression behavior of the nrsRS-PnrsB promoter in Synechococcus PCC7002 is not negatively influenced by the nucleotide substitutions introduced into PnrsB*.

(47) FIG. 22C depicts the plasmid map of plasmid #1353, whose nucleotide sequence is included in the sequence listing as SEQ ID NO. 85. FIG. 22D shows the differences in the nucleic acid sequence in the ribosomal binding site (RBS) between the native PnrsB and the modified PnrsB*1. The nucleic acid sequence of the modified promoter PnrsB* is included as SEQ ID NO. 86.

(48) The location of the genes in plasmid #1353 is a follows:

(49) TABLE-US-00020 Nucleotides Gene/regulatory element Antisense 1476 to 2179 nrsR 2180 to 2300 PnrsB(6803) Antisense 117 to 1478 nrsS 4187 to 5197 synADH.sub.deg 5198 to 5228 oop 4034 to 4079 dsrA ter 2308 to 4008 zmPDC 12238 to 13248 Sp/Sm 11370 to 11900 Gm 4121 to 4185 Prbc* (improved version of rbcL promoter from PCC6803)

(50) FIGS. 23A and 23B show the ethanol production (v/v) normalized to the OD.sub.750 nm and the Pdc enzyme activity for Synechococcus PCC 7002 strains including an ethanologenic cassette integrated into the endogenous plasmid pAQ1 with a pdc gene transcriptionally controlled by a heterologous Ni.sup.2+-inducible promoter from Synechocystis PCC 6803.

(51) The plasmid map of the integrative plasmid #1441 is shown in FIG. 23C and its nucleic acid sequence is listed as SEQ ID NO. 87.

(52) The location of genes and regulatory elements on the plasmid #1441 is as follows:

(53) TABLE-US-00021 Nucleotides Gene/regulatory element 5399 to 6407 Sp/Sm 2180 to 2300 nrsB* Antisense 1476 to 2179 nrsR Antisense 117 to 1478 nrsS 9960 to 10630 pAQ1-FA2 Antisense 7886 to 8743 Amp 6511 to 7018 pAQ1-FB2 5153 to 5184 oop 4113 to 5123 synADH 4047 to 4111 Prbc* 2308 to 4008 zmPDC

(54) FIGS. 24A and 24B show the ethanol production normalized to the OD.sub.750 nm of a Synechococcus strain transformed with the plasmid #1460 and the plasmid map of this extrachromosomal plasmid, respectively. In plasmid #1460 the pdc is transcriptionally controlled by a heterologous Ni.sup.2+-inducible promoter from a Synechococcus species which is close related to Synechococcus PCC7003. The nucleic acid sequence of plasmid #1460 is presented as SEQ ID NO. 88.

(55) The location of the genes and regulatory elements on the plasmid #1460 is as follows:

(56) TABLE-US-00022 Nucleotides Gene/regulatory element complement (100 . . . 1461) nrsS complement (1458 . . . 2153) nrsR 2154 . . . 2282 PnrsB 4169 . . . 5179 synADH.sub.deg. 5180 . . . 5210 oop 4016 . . . 4061 dsrA ter 2290 . . . 3990 zmPDC 12220 . . . 13230 Sp/Sm 11352 . . . 11882 Gm 4103 . . . 4167 PrbcL*

(57) FIGS. 25A and 25B show the ethanol production normalized to the OD.sub.750 nm of a Synechococcus strain transformed with the plasmid #1473 for integration into the endogenous plasmid pAQ1 and the plasmid map of this integrative plasmid, respectively. The nucleic acid sequence of plasmid #1473 is shown as SEQ ID NO. 89.

(58) The location of the genes and regulatory elements on the plasmid #1473 is as follows:

(59) TABLE-US-00023 Nucleotides Gene/regulatory element Antisense 100 to 1461 nrsS antisense 1458 to 2153 nrsR 2154 to 2282 PnrsB 2290 to 3990 zmPDC 4029 to 4093 Prbc* 4095 to 5105 synADH 5135 to 5166 oop 6493 to 7000 pAQ1-FB2 9942 to 10612 pAQ1-FA2 5381 to 6389 Sp/Sm

DETAILED DESCRIPTION OF CERTAIN EMBODIMENTS OF THE INVENTION

(60) In the following, certain embodiments of the invention pertaining to PziaA as one example for a Zn.sup.2+-inducible promoter also in conjunction with ziaR as one example for a first control gene in comparison to prior art promoter systems will be discussed. Other embodiments are concerned with the transcriptional control of first and second recombinant genes coding for Pdc enzyme and Adh enzyme by Co.sup.2+ oder Ni.sup.2+ inducible promoters in various cyanobacteria. The concrete embodiments result in the generation of ethanol as one example of a first chemical compound.

(61) Generation of the Genetically Enhanced Cyanobacteria for the Production of Ethanol as a First Chemical Compound

(62) PziaA and ziaR-PziaA promoter fragments as examples of a Zn.sup.2+ inducible promoter and its first control gene were amplified by PCR with a proof-reading DNA polymerase using the primer pairs 451/449 and 450/449 shown in FIG. 2A with the SEQ ID No. 49 to 51, respectively. The nucleotide sequences of the ziaR gene and the ziaA promoter are given in FIG. 2B, wherein the nucleotide sequence of the ziaR gene runs in antisense direction from 3 to 5 indicated by the shaded nucleotides. The nucleotide sequence for PziaA follows in 5-direction downstream to the ziaR gene and underlined nucleotides denote the binding sites for the primers. A general representation of the gene organization and orientation is given in FIG. 2C.

(63) Both promoter fragments for PziaA and ziaR-PziaA were subcloned into pJET.1.2/blunt for sequencing and subsequent cloning steps. The PziaA promoter fragment was cut out by SalI/EcoRI digestion and ligated into the SalI/EcoRI digested constructs #946 pVZ325a-P.sub.petJ-PDC/SynADH and #948 pVZ325a-P.sub.petJ-PDC.sub.oop-P.sub.rbc-SynADH(deg).sub.oop leading to a swap of the initial present petJ promoter to the ziaA promoter. The plasmid map of the vector pVZ325a also indicating the SalI/EcoRI restriction site is given in FIG. 1B. Pdc and SynAdh encoding genes are ethanologenic genes whereas the Pdc gene encodes for Pyruvate decarboxylase and SynAdh gene for alcohol dehydrogenase for the production of ethanol as a first chemical compound. OOP denotes a terminator sequence taken from the phage Lambda OOP RNA. The OOP RNA is a major short (77 bases) transcript that is synthesized in the opposite direction to the mRNA for the Lambda cII gene.

(64) This cloning step resulted in the constructs #968 pVZ325a-P.sub.ziaA-PDC/SynADH and #969 pVZ325a-P.sub.ziaA-PDC.sub.oop-P.sub.rbc-SynADH(deg).sub.oop. For assembly of corresponding pVZ322a derivates from the new created constructs #968 and #969 the ziaA promoter along with a 5-part of the PDC coding sequence was cut by SalI/EagI digestion and ligated into the pre-existing constructs #990 pVZ322a-P.sub.petJ-PDC.sub.oop-P.sub.rbc-SynADH(deg).sub.oop and #996 pVZ322a-P.sub.petJ-PDC/SynADH also SalI/EagI cut respectively. The plasmid map of the vector pVZ322a also indicating the SalI/EagI restriction site is given in FIG. 1A. Resulting constructs are #1047 and #1048.

(65) The ziaR-PziaA promoter fragment was cut out by SalI/EcoRI digestion and ligated into the SalI/EcoRI digested construct #948 as described before. From the thereby created intermediate the ziaR-PziaA sequence along with a 5-part of the Pdc coding sequence was cut by SalI/Kpn2I digestion and ligated into the already mentioned constructs #990 and #996 (SalI/Kpn2I cut) leading to the resulting pVZ322a constructs #1068 pVZ322a-P.sub.petJ-PDC.sub.oop-P.sub.rbc-SynADH(deg).sub.oop and #1069 pVZ322a-P.sub.petJ-PDC/SynADH. P.sub.rbc denotes the native promoter of rbcLXS operon including the RBS and the ATG start codon of the rbcL gene (slr009) from Synechocystis PCC6803.

(66) Characteristics of Genetically Enhanced Synechocystis Cyanobacteria Harboring PziaA and ziaR-PziaA as Zn.sup.2+ Inducible Promoters for the Production of Ethanol as a First Chemical Compound

(67) For the first experiments six different ethanologenic Synechocystis sp. PCC6803 strains were used:

(68) #948 pVZ325a-P.sub.petJ-PDC.sub.oop-P.sub.rbc-SynADH(deg).sub.oop

(69) #969 pVZ325a-P.sub.ziaA-PDC.sub.oop-P.sub.rbc-SynADH(deg).sub.oop

(70) #996 pVZ322a-P.sub.petJ-PDC/SynADH

(71) #1047 pVZ322a-P.sub.ziaA-PDC.sub.oop-P.sub.rbc-SynADH(deg).sub.oop

(72) #1048 pVZ322a-P.sub.ziaA-PDC/SynADH

(73) #1068 pVZ322a-ziaR-P.sub.ziaA-PDC.sub.oop-P.sub.rbc-SynADH(deg).sub.oop

(74) The pVZ325a backbone comprises a Gentamycin/Streptomycin (Gm/St) resistance and the pVZ322a backbone comprises a Gentamycin/Kanamycin (Gm/Km) resistance after insertion of the ethanologenic gene cassette via SalI/SbfI (FIGS. 1A and 1B).

(75) GC Vial Measurements

(76) For GC vial measurements using a gas chromatograph (GC assay) the ethanol production of the culture has to be induced 1-3 days before the experiment that is realized by triggering the overexpression of Pdc and SynAdh. Induction of the petJ promoter occurs under copper depletion whereas the induction of the ziaA promoter occurs under zinc addition. Induced hybrid cells are either scratched from BG11 agar plates or harvested from liquid cultures by centrifugation and are resuspended in appropriate fresh medium ensuring induction conditions (for petJ promoter copper-free BG11 or marine BG11 (mBG11) prepared with seawater or a seawater supplement, for ziaA promoter mBG11 with 10 M zinc sulfate), supplemented with 50 mM TES, pH 7.3 and 20 mM NaHCO.sub.3.

(77) The sample will be adjusted to an OD.sub.750 of about 1 and 2 ml are filled in each 20 ml GC vial supplemented with 3 ml pure CO.sub.2. The tightly closed GC vials were placed onto temperature controlled and illuminated (150 E m.sup.2 s.sup.1) headspace auto sampler where the cultivation takes place. Samples from the cultures were analyzed on the same day on a Shimadzu GC-2010 gas chromatograph equipped with medium-bore capillary column (FS-CS-624, length 30 m; I.D. 0.32 mm; film 1.8 m) and flame ionisation detector. After completion of the GC measurements the final OD.sub.750 of cultures is determined for the calculation of the ethanol production rate per OD.sub.750. The average OD.sub.750 is calculated by addition of OD.sub.750 at t.sub.start and OD.sub.750 at t.sub.end divided by two.

(78) GC Measurements of Strains Harboring Constructs with PziaA and ziaR-PziaA

(79) In order to test the capacity of the new created hybrid strain #1048 for ethanol production gas chromatography (GC) measurements were performed in comparison to a reference strain carrying an isogenic pVZ325a plasmid however under control of the petJ promoter (#996). Cells of two independent clones were grown for at least 3 days on BG11 plates under repressed and induced conditions respectively before the GC vial assay was started. For the reference strain #996 agar plates containing 5 copper (1.5 M) and no copper (Cu) were used, whereas for the ziaA promoter strain #1048 agar plates with no additional (0.77 M ZnSO.sub.4) and 10 M ZnSO.sub.4 were used. The GC vial assay were done by measuring the ethanol production rates by gas chromatography over at least 18 hours of cultivation in an illuminated GC vial (150 E*m.sup.2*s.sup.1) as described above.

(80) FIGS. 3A and 3B show the ethanol production rates of the ethanologenic strains harboring the plasmids #996 and #1048 (the plasmid maps are shown in FIGS. 4A and 4B and the sequence of the inserts containing the ethanologenic genes and the promoters are shown in the sequence listing with the SEQ ID Numbers. 52 and 53. It can be clearly seen that both Synechocystis strains exhibit a similar ethanol production rate under induced conditions. In the repressed, uninduced state the strain harboring the ethanologenic genes under the control of PpetJ at a concentration of 1.5 m Cu.sup.2+, denoted with #996.2_5Cu and #996.1_5Cu produces higher amounts of ethanol compared to the strain with the ethanologenic enzymes under the control of PziaA in the repressed state at a concentration of 0.77 M Zn.sup.2+ (denoted with #1048.1_-Zn and #1048.2_-Zn). Consequently, the induction factor is much higher for the PziaA strain (induction factor of 5 at a concentration of 10 M Zn.sup.2+) compared to the PpetJ strain (induction factor of 2.5 in the absence of Cu.sup.2+). This means that under repressed conditions the ziaA promoter is less leaky than the petJ promoter and allows thereby a tighter control of ethanol production.

(81) In a further experiment the ethanol production and growth behavior of Synechocystis strains under control of the ziaA promoter in relation to the petJ promoter were analyzed in shaken 50 ml Erlenmeyer flasks. The strains used for this purpose were #948 with the petJ promoter and #969 with the ziaA promoter controlling the expression of the improved ethanologenic gene cassette P.sub.xxx-PDC.sub.oop-P.sub.rbc-SynADH(deg).sub.oop respectively comprising a separate, constitutive promoter (native rbc promoter of Synechocystis PCC6803) to drive the SynADH expression. Pxxx denotes either PpetJ or PziaA. Plasmid maps of these plasmids are shown in FIG. 5A and FIG. 5B, respectively and the nucleotide sequences of the inserts containing the ethanologenic genes and the promoters are shown in the sequence listing with the SEQ ID NOs. 54 and 55. Both strains were grown in 50 ml pre-cultures under repressed conditions (BG11 5 Cu for #948 and usual BG11 for #969) to an OD.sub.750 nm of about 2. The cells of the pre-cultures were harvested by centrifugation and afterwards divided into four new 50 ml BG11 subcultures containing either 5 copper, no copper, 5 copper plus 10 M ZnSO.sub.4 or no copper plus 10 M ZnSO.sub.4. Thus all together eight different Erlenmeyer flaks were cultivated in parallel in order to test the response of both ethanol producing hybrids to the availability of Zn.sup.2+ and Cu.sup.2+ in the growth medium.

(82) In FIGS. 6A and 6B the data for culture growth, ethanol accumulation as well as the ethanol accumulation normalized on the optical density (growth) collected over a time frame of about 30 days are summarized for PpetJ and PziaA, respectively. As shown in FIGS. 6A and 6B (left hand side) there are substantial differences in growth. While both strains show a similarly reduced growth under induced conditions (Cu.sup.2+ for PpetJ and 10 M Zn.sup.2+ for PziaA), the growth rate at repressed state is almost doubled for hybrid strain #969 with PziaA when compared to the PpetJ reference #948. This is a direct effect from the almost completely deactivated ethanol synthesis due to the tighter repressed ziaA promoter. If no ethanol is produced all carbon fixed by photosynthesis is used for cell growth and biomass formation whereas carbon that goes into ethanol is lost for biomass formation. Since the petJ promoter is rather a leaky promoter there is still carbon lost for growth even if 5 copper is added. So the lower ethanol accumulation and therefore reduced carbon loss of strain #969 at repressed state allows to grow faster compared to the #948 reference that exhibits a significant growth retardation even if the petJ promoter is repressed by addition of 5 copper.

(83) Furthermore in FIGS. 6A and 6B (in the middle) the ethanol accumulation is shown. As already detected in the GC online experiment described before, both strains exhibit a very similar ethanol accumulation under induced cultivation conditions. Also the ethanol accumulation at repressed state appears to be similar but one have to consider that the optical density of the PziaA strain is almost twice as high as for the PpetJ control strain at repressed conditions. Thus when for this experiment the OD normalized ethanol production is calculated (FIGS. 6A and 6Bright hand side) again a two times higher induction factor is obtained for the ziaA promoter (induction factor of about 8) in comparison to the reference strain (#948) with the petJ promoter (induction factor of about 4).

(84) So far the ziaA promoter sequence was taken without the coding region of the repressor gene ziaR that is needed for the zinc dependent transcriptional regulation by binding of the repressor protein to the operator sequence of the ziaA promoter. Because the repressor is present in the genome of Synechocystis it is actually not necessary to consider the repressor gene in respective ethanologenic pVZ plasmids. However if other species than Synechocystis were used it is necessary to employ the ziaA promoter along with its transcriptional repressor in order to ensure that PziaA can be used as a Zn.sup.2+-inducible promoter. On the other hand due to introduction of additional copies of the ziaA operator encoded on the pVZ-PziaA-Pdc/Adh plasmid the availability of binding sites for the ZiaR repressor is substantially elevated. This might lead to a repressor/operator imbalance and a less tight repression of Pdc (controlled by the ziaA promoter) as well as the ziaA gene (zinc transporting ATPase involved in zinc homeostasis). In order to address this question a new construct (#1068) was created that additionally to the previous constructs (e.g. #969 and #1047) contains the sequence of the ziaR repressor (see FIGS. 7A and 7B for the plasmid maps; the nucleotide sequence of the inserts containing the ethanologenic genes and the promoters for the plasmids #1068 and #1047 are included in the sequence listing with the SEQ ID NOs. 56 and 57). Respective Synechocystis cells with ziaR-PziaA promoter were analyzed in comparison to strains without ziaR repressor.

(85) In FIGS. 8A and 8B the results of respective GC online measurements comparing #1047 with #1068 are summarized for PziaA alone and PziaA in combination with ziaR, respectively. Both hybrid lines were tested without or in the presence of 5 M, 10 M, 15 M and 20 M ZnSO.sub.4. Cells were grown on BG11 agar plates (without additional zinc). For harvesting, the cells were scratched from the plates and suspended in mBG11 medium containing respective amounts of zinc. The GC vials were analyzed for a duration of 40 hours in continuous light (150 E/m.sup.2*s) at 35 C.

(86) As visible from FIGS. 8A and 8B for both strains there is a correlation of the ethanol produced to the amount of zinc added. The more zinc is present the more ethanol is produced by the cells, so that the ethanol production rate can be gradually adjusted by the addition of zinc. Highest ethanol production is achieved at 15 M and 20 M ZnSO.sub.4 with a low increase (#1047) or in case of #1068 without a further increase from 15 M to 20 M indicating that these zinc concentrations mark the upper threshold suited for induction of both ziaA promoter variants for ethanol production in Synechocystis PCC6803.

(87) Furthermore from FIGS. 8A and 8B it is evident that the hybrid strain #1068 exhibits especially at 5 M and 10 M zinc a slightly lower production rate when compared to respective production rates found for #1047 in the same experiment. However, at 15 M zinc comparable production rates were achieved for both promoter variants. The strongest effect as a consequence of addition of the ziaR repressor is found at the repressed state (without added zinc) where #1068 in contrast to #1047 shows almost no ethanol production. This indicates that the addition of the repressor improves the tightness of the ziaA promoter but only marginal influences the maximal production rate at fully induced state (15-20 M zinc). Due to the much lower production rate at a repressed state but at the same time similar productivity as #1047 at fully induced state the induction factor for the ziaA promoter along with the ziaR repressor is about 15 in #1068 whereas for #1047 in this experiment the factor is about 4.

(88) This result is of importance because the already tight regulation of the ziaA promoter previously shown in direct comparison to the prior art petJ promoter was further improved by the addition of the repressor to the promoter sequence. The better induction factor of #1068 in comparison to #1047 should lead to a superior performance of this hybrid especially under repressed state with regard to the growth rate and the genetic stability.

(89) Improvement of the ziaA Promoter from Synechocystis PCC6803 as Examples for Variants of a Native Zn.sup.2+ Inducible Promoter with Respect to the Production of Ethanol as a First Chemical Compound

(90) Furthermore the ziaA promoter from Synechocystis PCC6803 was optimized for better performance and/or control of ethanol production by introducing nucleotide changes in the TATA box, the operator sequence and/or the ribosomal binding site (RBS). ZiaA* denotes the native, however partly truncated ziaA promoter from Synechocystis PCC6803 containing all promoter elements necessary for a zinc-dependent regulation (operator, 35 and 10 region and RBS).

(91) FIG. 9A illustrates eight different recombinant ziaA* promoter variants which were tested in comparison to the native ziaA promoter present in plasmid #1116 (sequence of the insert containing the ethanologenic genes and the promoters is shown in the sequence listing with SEQ ID NO. 58) with respect to an improved performance for ethanol production. TATA box, the transcription start point (TSP), the operator sequence and the ribosomal binding site (RBS) are marked by boxes and changed nucleotides are indicated by shaded characters in bold face type. Underlined sequence at the 5- and 3-end indicate the introduced restriction sites SalI and EcoRI used for cloning into the ethanologenic pVZ constructs #1116 comprising Pdc and Adh encoding genes. ZiaA* promoter variants were created by PCR using of different combinations of partially overlapping synthetic oligonucleotides (primers 1-6) shown in FIG. 9A. The sequences are also included in the sequence listing with the SEQ ID NOs 59 to 64. The overlapping part of the respective forward (fw) and reverse (rev) primers at the 3-end as well as the introduced restriction sites at the 5-end are underlined.

(92) Synechocystis hybrid lines carrying ethanologenic pVZ constructs with the above described ziaA* promoter variants were grown on BG11 agar plates in the presence or absence of 15 M zinc) for 4 days in continuous light. For harvesting, the cells were scratched from the plates and suspended in mBG11 medium containing either no or 15 M of zinc. The GC vials were analyzed by GC measurements for a duration of about 20 hours in continuous light (150 E/m.sup.2*s) at 35 C.

(93) FIG. 9B illustrates the final optical densities at 750 nm (OD.sub.750 nm) for different promoter variants PziaA* to PziaA*7 in gas chromatography (GC) online experiments in the presence or absence of 15 M zinc in comparison to the wild-type ziaA promoter after 20 hours in the light (150 E/m.sup.2*s and each culture started with an OD750 nm of 1.0). All variants show a higher final OD.sub.750 in the absence of zinc compared to the OD.sub.750 in the presence of 15 M zinc indicating a better growth at the repressed condition of the promoter. Interestingly all variants comprising the TATA box modification show a substantial reduced growth (lower final OD.sub.750) at the repressed but also at the induced condition. In the presence of 15 M zinc for the variants of the TATA box consensus sequence (PziaA*1, PziaA*3 and PziaA*7) almost no increase in OD.sub.750 and therefore no growth is detectable. All other variants show comparable OD.sub.750 values to the wild-type PziaA promoter after 20 hours growth in the repressed and induced state.

(94) FIG. 9C shows the ethanol production rates per day and FIG. 9D the OD.sub.750 normalized ethanol production rates for the different PziaA* variants in the GC online experiments in comparison to the wild-type PziaA. Some of the variants (PziaA*, PziaA*2, PziaA*4 and PziaA*6) show a comparable ethanol production rate to PziaA wild type in the induced state, but different rates in the repressed state. For example PziaA*4 and PziaA*6 accumulate only 30% of the ethanol produced by the wild-type PziaA at the repressed state which indicates a tighter control of those promoter variants. On the other hand the promoter variants comprising the TATA box consensus (PziaA*1, PziaA*3 and PziaA*7) show a higher ethanol production rate at the repressed state than under induced conditions. This result is somehow puzzling and might indicate that those promoter variants exhibit a substantial enhancement of the promoter activity in the repressed as well as the induced state. Further analyses revealed that at the induced state of the promoter variants PziaA*1 and PziaA*3 the PDC activity raises above a critical threshold for the cell where further ethanol production collapses. This finding is supported by Western Blot detection of the Pdc protein amount as well as by the fact that both promoter variants are not able to grow at induced conditions (addition of 15 M zinc). This effect is obviously not advantageous for an inducible ethanol production in Synechocystis using that kind of ethanologenic plasmid, however it might be useful for genomic integration or plasmids with lower copy number leading to a lower gene dosage and gene expression. Furthermore the PziaA* variants might be useful for cyanobacteria other than Synechocystis as well as for other products of interest where higher expression rates of respective heterologous pathway enzymes are needed for sufficient formation of the first chemical compound. Another possibility of using these strong PziaA*1 and PziaA*3 promoters for the production of a first chemical compound is inserting directly downstream of these promoters a second recombinant gene coding for a second biocatalyst for the production of the first chemical compound (upstream of the first recombinant gene coding for the first biocatalyst), which is either already present in the wild type cyanobacterium or which does not divert the naturally occurring carbon flux away from the wild type metabolism or which does not produce an intermediate harmful for the cyanobacterium. An example for such an enzyme is Adh enzyme for the production of ethanol. The first recombinant gene encoding a first biocatalyst for the production of the first chemical compound, which does interfere with the wild type metabolism to a greater extent, because it diverts the carbon flux away from the natural occurring metabolism of the cyanobacterium can then be located downstream to the second recombinant gene. In this case, the transcriptional activation by the strong Zn.sup.2+, Co.sup.2+ or Ni.sup.2+ inducible promoter will be stronger for the second than for the first recombinant gene so that the harmful consequences of the expression of the first biocatalyst for the cyanobacterial cell are reduced. One example of such a first biocatalyst is Pdc enzyme. FIG. 9E depicts the induction factors for the different ziaA* promoter variants (ethanol production per OD.sub.750 in the induced state divided by the ethanol production per OD.sub.750 in the uninduced state). In particular the variants PziaA*4 and PziaA*6 exhibit a 3-fold increased induction factor in comparison to PziaA due to the tighter control at repressed state and at the same time limited decrease in the production rate at the induced state (75% of wild-type PziaA). However the slight decrease in the production rate at the induced state observed for PziaA*4 and PziaA*6 could be compensated by a higher gene dose (e.g. by a higher plasmid copy number) if necessary. This would allow for taking advantage of the higher induction level too. For the promoter variants of the consensus TATA box (PziaA*1, PziaA*3 and PziaA*7) the observed effects are too strong. It could be useful to employ variants of the consensus TATA box with only one or maximal two nucleotide changes, which could give the intended effect of a higher production rate at induced condition but at the same time also a tight control in the repressed state. The described ziaA promoter variants have demonstrated the big potential of an artificial optimization of ziaA-like promotors (e.g. PsmtA or PaztA) in order to improve cyanobacteria for the synthesis of first chemical compounds. Taken all the possibilities to manipulate such metal-ion inducible promoter systems into account, there is a high potential to end up with a perfect, absolutely fine-tuned inducible promoter system for ethanol production in cyanobacteria. This is certainly not restricted in terms of the species Synechocystis and the product ethanol, it is applicable for any first chemical compound that can be produced by a specific cyanobacterium at a certain environmental condition (temperature and salinity) and culture condition (e.g. culture density and growth phase), resp. However for each specific application the promoter has to be optimized individually for the cyanobacterial host strain and the intended first chemical compound.

(95) Another example for a PziaA variant is PziaA*2ext shown in FIG. 9F (listed in the sequence listing as SEQ ID No. 71). The two primers ziaR-PziaA-SalI-fw and PziaA*2ext-NdeI-rev used for the amplification of this promoter are listed in the sequence listing as SEQ ID NO. 72 and 73. This artificial PziaA variant contains the sequence of PziaA, a part of a RNA-based thermosensor untranslated region (UTR) derived from the hspA gene (sll1514) of Synechocystis PCC6803 (see publication Kortmann et al.: Translation on demand by a simple RNA-based thermosensor, Nucleic Acids Res. 2011 April; 39(7): 2855-2868) in which the ribosomal binding site is embedded and a 5-extension of the first recombinant gene by three amino acids. The inventors surprisingly found out that this promoter is much stronger than the native PziaA* promoter, but is still Zn2+ inducible. This promoter only contains a part of the thermosensor of the hspA gene reported in the above publication, which is used for the temperature controlled expression of hspA and therefore does not appear to show a strong temperature dependent protein expression. Without being bound by any theory, the PziaA*2ext promoter seems to enhance the stability of the mRNA transcript and/or the efficiency of translation. A more generalized form of the PziaA*2ext promoter is:

(96) TABLE-US-00024 (SEQIDNO.90)
wherein the boldfaced and underlined nucleotides denote mutations in comparison to the wild type PziaA and wherein boldfaced framed nucleotides denote nucleotides coding for N-terminal extension of the second or first recombinant gene.

(97) Due to the potency of this promoter, a first recombinant gene encoding a biocatalyst for the production of the first chemical compound, which does interfere with the wild type metabolism to a greater extent, because it diverts the carbon flux away from the natural occurring metabolism of the cyanobacterium can be located further downstream of the PziaA*2ext promoter than it is usually the case for weaker promoters. In particular, the first recombinant gene can encode Pdc enzyme. The second recombinant gene coding for a second biocatalyst such as Adh enzyme, which catalyzes a chemical reaction already present in the wild type cyanobacterium not diverting the carbon flux away from the natural occurring metabolism can be located immediately downstream of the PziaA*2ext promoter. If ethanol is the first chemical compound, an alcohol dehydrogenase encoding gene can be located immediately downstream of the promoter followed by a Pdc enzyme encoding gene so that the transcriptional activation is higher for the adh gene than for the pdc gene which is co-transcribed.

(98) FIG. 9G depicts the plasmid map of the plasmid #1318, which includes an insert with an ethanologenic cassette wherein PziaA*2ext controls the transcription of both a SynAdh gene and a ZmPdc gene located downstream of the SynAdh gene so that the transcriptional activation for the SynAdh gene is higher than for the ZmPdc gene. The SEQ ID NO. 74 shows the nucleotide sequence of this insert pVZ325-ziaR-PziaA*2ext-synADH-zmPDCdsrA.

(99) The FIG. 9H shows the activities of the Pdc enzyme and the Adh enzyme of Synechocystis PCC6803 cells transformed with this plasmid #1318 in comparison to cells transformed with the above described plasmid #1068 harboring Adh enzyme under the transcriptional control of the constitutive P.sub.rbcL promoter and Pdc under the control of the native ziaA promoter. For the Pdc enzyme as well as for the Adh enzyme the activities in the induced state are both higher for plasmid #1318 than for plasmid #1068. The addition of 100 M EDTA sufficiently suppresses the actual induction due to addition of 15 M Zn.sup.2+ for cells transformed with this plasmid #1318 and #1068 by chelating the metal-ions and preventing thereby the release of ZiaR protein from the operator of the ziaA promoter. Titration of metal-ions by addition of EDTA (<100 M) is an efficient way to further tighten and/or modify the induction behavior metal ion responsive promoters and respective production genes transcriptionally controlled thereby.

(100) FIG. 9I shows that the ethanol production over time (v/v) are also slightly higher for #1318 than for #1068, whereas the acetaldehyde accumulation in % (v/v) is lower for the Synechocystis strain with the PziaA*2ext promoter indicating that acetaldehyde is converted to ethanol to a higher extent than for #1068 so that intermediate accumulation of toxically acetaldehyde is decreased.

(101) FIG. 9 J shows a direct comparison of the ethanol production (v/v) and of the ethanol production (v/v) normalized to the OD.sub.750 nm for the cyanobacterial strains transformed with the plasmids #1068 and #1318 over a cultivation period of 30 days. It can clearly be seen that the ethanol production rate is much higher for #1318.

(102) FIG. 9K shows a direct comparison of the growth rate (OD.sub.750 nm) and of the specific Pdc enzyme activity (mol/min*mg.sub.protein) for the cyanobacterial strains transformed with the plasmids #1068 and #1318 over a cultivation period of 30 days. It is evident that on one hand the Pdc activity of strain #1318 is higher than the Pdc activity of strain #1068, but one the other hand the growth is lower for strain #1318.

(103) Sequence Comparison of PziaA with Other Zn.sup.2+, Co.sup.2+ and Ni.sup.2+ Inducible Promoters

(104) FIG. 10 shows a comparison of the nucleotide sequences of the Zn2+ inducible PziaA, PaztA, PsmtA from Synechococcus PCC 7002 and PsmtA from Synechococcus PCC 7942. The nucleotide sequences of the Co.sup.2+ and Ni.sup.2+ inducible promoters PcorT and PnrsB are also shown. These promoters are already included in the sequence listing with the SEQ ID NOs. 1, 2, 3, 4 and 45.

(105) FIG. 10 also indicates the anti-sense orientation of the genes coding for the various regulator proteins ziaR, aztR, smtB, corR and nrsR and the sense orientation of the Zn.sup.2+, Co.sup.2+ or Ni.sup.2+ transporting proteins, whose transcription is controlled by the above promoters. The positions of the various operator sequences, TATA boxes and ribosomal binding sites are also indicated.

(106) The boxed upper part of FIG. 10 shows the identified gene cluster composed of eleven open reading frames involved in Ni.sup.2+, Co.sup.2+, and Zn.sup.2+ sensing and tolerance from Synechocystis PCC 6803 (Garca-Domnguez M, Lopez-Maury L, Florencio F J, Reyes J C. J Bacteriol. 2000 March; 182(6):1507-14).

(107) Characteristics of Genetically Enhanced Cyanobacteria Harboring aztR-PaztA as a Further Example of a Zn.sup.2+ Inducible Promoter from Anabaena PCC7120 for the Production of Ethanol as a First Chemical Compound

(108) FIG. 11A shows a map of the plasmid #1277 (sequence of the insert including the ethanologenic genes and the promoters is part of the sequence listing with SEQ ID NO. 65) used for conjugation of Synechocystis PCC 6803 including the ethanologenic genes coding for pyruvate decarboxylase enzyme under the transcriptional control of PaztA from Anabaena PCC 7120 and alcohol dehydrogenase enzyme under the transcriptional control of the constitutive PrbcL* (truncated rbc core promoter from Synechocystis PCC6803). The plasmid also harbors the gene aztR coding for a repressor binding to PaztA. Apart from the oop terminator a further terminator sequence derived from the small non-coding RNA DsrA from E. coli was introduced. Four independent Synechocystis clones carrying the ethanologenic pVZ construct #1277 were grown on BG11 agar plates containing different amounts of zinc (no, 3 M and 10 M zinc) for 3 days in continuous light. For harvesting, the cells were scratched from the plates and suspended in mBG11 medium containing either no, 3 M and 10 M zinc. The EtOH production in the GC vials was analyzed by GC measurements for a duration of about 16 hours in continuous light (150E/m.sup.2*s) at 37 C.

(109) FIG. 11B shows that in mBG11 medium the aztR-PaztA promoter seems to be repressed to a comparable extent like ziaR-PziaA in the absence of Zn.sup.2+. However, upon addition of 3 M Zn.sup.2+ the ethanol production appears to be still repressed. This might indicate an advantage of the aztR-PaztA promoter in comparison to ziaR-PziaA with regard to potential zinc contaminations in seawater or instant ocean extracts used for preparation of the mBG11 culture medium which might have an impact on the tightness of the zinc-inducible promoter. If an amount of 10 M Zn.sup.2+ is added, the ethanol production is substantially increased to a production rate of around 0.008% (v/v)/OD.sub.750*d that is slightly lower than for the corresponding ziaR-PziaA strain (#1068). FIG. 11C depicts a similar GC online experiment as described before for Synechococcus PCC7002 carrying the plasmid #1277 (see FIG. 11A). FIG. 11C indicates a zinc dependent regulation of the ethanol production using the aztR-PaztA promoter from Anabaena PCC7120. In the absence of zinc, only a marginal ethanol accumulation is detectable whereas upon addition of 5 M and 10 M zinc the ethanol production can be switched on to a production rate of about 0.014% (v/v)/OD.sub.750*d. As shown in FIGS. 11A and 11B the aztA promoter with the repressor gene aztR (smtB-like) seems to be functional and well suited for inducible production of ethanol and probably many other first chemical compounds in Synechocystis PCC6803 and Synechococcus PCC7002. It is very likely that the results obtained here with plasmid #1277 are transferable also to other cyanobacterial genera beside Synechocystis and Synechococcus.

(110) Characteristics of Genetically Enhanced Cyanobacteria Harboring corR-PcorT as an Example for a Co.sup.2+ Inducible Promoter from Synechocystis PCC6803 for the Production of Ethanol as a First Chemical Compound

(111) FIG. 12A shows a map of the plasmid #1217 (sequence of the insert including the ethanologenic genes and the promoters is shown in the sequence listing with SEQ ID NO. 66) used for conjugation of Synechocystis PCC 6803 that includes the ethanologenic genes coding for Pdc under the transcriptional control of the endogenous corT promoter and the SynAdh under the transcriptional control of the constitutive PrbcL*. The plasmid also harbors the gene corR coding for a transcriptional regulator that binds to the corT promoter. A Synechocystis hybrid carrying the ethanologenic pVZ construct #1217 was cultivated by growing on BG11 agar plates containing different amounts of cobalt (no, 5 M and 10 M cobalt) for 3 days in continuous light. For harvesting, the cells were scratched from the plates and suspended in mBG11 medium containing the same concentrations of cobalt (no, 5 M and 10 M cobalt) and transferred to GC vials. The ethanol production in GC vials was analyzed by GC measurements for a duration of about 16 hours in continuous light (150 E/m.sup.2*s) at 37 C. FIG. 12B depicts the ethanol production of Synechocystis harboring the plasmid #1217 including the Co.sup.2+-inducible promoter corT along with the corR gene. In the absence of cobalt the corT promoter seems to be very tight repressed in mBG11 similar to ziaR-PziaA (without zinc). In the presence of 5 M cobalt the ethanol production substantial increased to a production rate of around 0.008% (v/v)/OD.sub.750*d that is slightly lower than measured for the corresponding ziaR-PziaA strain (#1068). Interestingly addition of 10 M cobalt does not show significantly higher ethanol production rates than observed for a Co2+ concentrations of 5 M. FIG. 12C depicts a similar GC assay experiment for Synechococcus PCC7002 carrying the plasmid #1217 (see FIG. 12A). Cells were cultivated by growing on BG11 agar plates containing different amounts of cobalt (no, 2.5 M, 5 M and 10 M cobalt) for 3 days in continuous light. For harvesting, the cells were scratched from the plates and suspended in mBG11 medium containing the same concentrations of cobalt (no, 2.5 M, 5 M and 10 M cobalt) and transferred to GC vials. The ethanol production of cultures in the GC vials were analyzed by GC measurements for a duration of about 60 hours in continuous light (150 E/m.sup.2*s) at 37 C. FIG. 12C depicts the ethanol accumulation per OD.sub.750 nm and shows that a cobalt dependent regulation of the ethanol production using the corR-PcorT promoter from Synechocystis PCC6803 can be achieved. In the absence of cobalt the ethanol accumulation is very low whereas upon addition of 5 M and 10 M cobalt the ethanol production can be boosted to a production rate of about 0.004% (v/v)/OD.sub.750*d. As shown in FIGS. 12B and 12C the corT promoter with the regulator gene corR is functional in Synechocystis PCC6803 and Synechococcus PCC7002 and is well suited for inducible production of ethanol and potentially also of other first chemical compounds in cyanobacteria.

(112) Characteristics of Genetically Enhanced Cyanobacteria Harboring nrsR-PnrsB as an Example of a Ni.sup.2+ Inducible Promoter from Synechocystis PCC6803 for the Production of Ethanol as a First Chemical Compound

(113) FIG. 13A shows a map of the plasmid #1227 (sequence of the insert with the ethanologenic genes and the promoters is included in the sequence listing with SEQ ID NO: 67) used for conjugation of Synechocystis PCC6803 that includes the ethanologenic genes coding for Pdc under the transcriptional control of the endogenous nrsB promoter and the SynAdh under the transcriptional control of the constitutive PrbcL*. The plasmid also harbors the gene nrsR coding for a transcriptional activator that binds to the nrsB promoter. A Synechocystis hybrid carrying the ethanologenic pVZ construct #1227 was cultivated by growing on BG11 agar plates containing different amounts of nickel (no, 3 M and 7 M nickel) for 3 days in continuous light. For harvesting, the cells were scratched from the plates and suspended in mBG11 medium containing the same concentrations of nickel as the BG11 agar plates before. The ethanol production in GC vials was analyzed by GC measurements for a duration of about 17 hours in continuous light (150 E/m.sup.2*s) at 37 C. FIG. 13B depicts the recorded ethanol accumulation normalized to OD.sub.750 nm of Synechocystis harboring the plasmid #1227. As visible from FIG. 13B the ethanol production of Synechocystis harboring the plasmid #1227 is induced upon induction with nickel. In the absence of Ni.sup.2+ there is almost no ethanol formed indicating a very tight promoter control whereas in the presence of 3 M and 7 M Ni.sup.2+ the ethanol production is strongly increased to a production rate of around 0.008% (v/v)/OD.sub.750*d that is similar to the construct #1217 (corR-PcorT) and slightly lower than measured for the corresponding ziaR-PziaA strain (#1068) in Synechocystis PCC6803. The nrsB promoter seems to allow a very tight control of the ethanol production in Synechocystis.

(114) FIG. 13C shows the plasmid map for the plasmid #1353 containing SynAdh encoding gene under the transcriptional control of the Prbc* promoter and Pdc encoding gene under the control of PnrsB with the regulators nrsR and nrsS. The insert containing the ethanologenic genes and the promoters is included in the sequence listing with SEQ ID NO. 70.

(115) FIG. 13D depicts the corresponding ethanol production rates of Synechococcus PCC 7002 per OD.sub.750 transformed with the plasmid #1353. It can be clearly seen that with increasing nickel concentrations ranging from 2.5 M to 10 M the ethanol production rate increases.

(116) Comparison of Genetically Enhanced Synechocystis Strains Harboring ziaR-PziaA, corR-PcorT and nrsR-PnrsB

(117) In FIGS. 14A-14C the data for culture growth, ethanol accumulation as well as the ethanol accumulation normalized to the optical density collected in a cultivation experiment over a period of 14 days in Erlenmeyer flasks using mBG11 are summarized for the hybrid strains ziaR-PziaA (#1068), corR-PcorT (#1217) and nrsR-PnrsB (#1227), respectively. As shown in FIGS. 14A-C (left hand side) there are substantial differences in growth depending on the amount of the corresponding metal, which is added for induction of the ethanologenic genes. All three strains show a similarly reduced growth behavior at the highest concentration of respective metal-ion in the culture, so that for ziaR-PziaA (#1068) at 20 M zinc, for corR-PcorT (#1217) at 10 M cobalt and for nrsR-PnrsB (#1227) at 10 M nickel the final OD.sub.750 nm reached after 14 days of cultivation is only about 2. In contrast to that, the OD.sub.750 nm at repressed conditions (without added zinc, cobalt or nickel) is about 2.5 as high as found for the respective induced culture condition. This large difference between the induced and repressed state is obviously a direct effect of the almost completely deactivated ethanol synthesis due to the tight repression realized by the mode of action of these metal-ion inducible promoters. Furthermore in FIGS. 14A-14C (in the middle) the ethanol accumulation is shown. As already detected in the GC assay experiment described before, all three strains show a similar ethanol accumulation under induced cultivation conditions. The ethanol accumulation at the repressed state is very low for all three ethanologenic strains although the optical density and therefore the amount of cells per ml is about 2.5 as high as for the culture at fully induced state. Thus when for this experiment the OD normalized ethanol accumulation is calculated (FIGS. 14A-14C right hand side) the corresponding induction factors for each of the hybrid strains are very high reaching values of about 40-60 that exceed by far the results obtained in a similar cultivation experiment using plasmid #969 containing the ziaA promoter without ziaR repressor encoded on the plasmid (see FIG. 6Binduction factor of 8 for #969). Furthermore in FIG. 14D the measured Pdc activities from the cultivation experiment shown in FIG. 14A-14C for the ziaR-PziaA (#1068), for corR-PcorT (#1217) and for nrsR-PnrsB (#1227) cultures at the different metal ion concentrations are shown (activities of Pyruvate decarboxylase determined according to Hoppner, T. C. and Doelle, H. W. (1983). Purification and kinetic characteristics of pyruvate decarboxylase and ethanol dehydrogenase from Zymomonas mobilis in relation to ethanol production. Eur. J. Appl. Microbiol. Biotechnol). It is evident that as long as no metal ion is present in the growth medium all three promoters are almost completely switched off leading to a remaining Pdc base activity below a value of 0.05 mol/mg.sub.protein*min. In contrast to that if the respective metal ions are added the measured PDC activities reach values of 4-5 mol/mg.sub.protein*min that is about 100 times higher than found for the respective repressed state. This additionally demonstrates the excellent characteristics of the three tested metal-ion inducible promoters from Synechocystis PCC6803. The results shown in FIGS. 14A-14D demonstrate the superior functioning of the ziaA promoter in combination with the ziaR gene encoded on the same plasmid and also show the superior performance of corR-PcorT and nrsR-PnrsB in direct comparison to PziaA.

(118) Characteristics of Genetically Enhanced Synechococcus PCC 7002 Cyanobacteria Harboring smtB-PsmtA as an Example of a Zn.sup.2+ Inducible Promoter for the Production of Ethanol as a First Chemical Compound

(119) FIG. 15A shows a map of the plasmid TK96 (plasmid sequence of TK96 including the ethanologenic genes is part of the sequence listing with SEQ ID NO. 68) used for transformation of Synechococcus PCC 7002 via integration into the endogenous pAQ4 plasmid that includes the ethanologenic genes coding for Pdc and SynAdh under the transcriptional control of the endogenous smtA promoter. FIG. 15B shows a map of the plasmid #TK115 (sequence of the complete plasmid TK 115 available in the sequence listing under SEQ ID NO. 69) used for conjugation of Synechococcus PCC 7002 via integration into the endogenous pAQ4 plasmid that comprises the ethanologenic genes coding for Pdc under the transcriptional control of the endogenous smtA promoter and the SynAdh.sub.deg under the transcriptional control of the constitutive PrbcL* from Synechocystis. Plasmid #TK115 also harbors the gene smtB coding for a transcriptional repressor that binds to the smtA promoter. FIGS. 15C and 15D depict the ethanol production of Synechococcus PCC 7002 TK96 vs. #TK115 in dependence from the zinc availability in the growth medium measured by GC online experiment over more than 40 hours. It can clearly be seen that upon addition of 2.5, 5 and 10 M Zn.sup.2+ high ethanol production rates with induction factors of 8 and 10, respectively were achieved.

(120) FIG. 15E shows the chlorophyll content, the OD.sub.750 and the ethanol production rates (absolute and normalized on OD) of Synechococcus PCC 7002 containing the ethanologenic gene cassette present in plasmid TK96 (see FIG. 15A) integrated into the endogenous pAQ4 plasmid from Synechococcus PCC 7002 via homologous recombination. Cultures were cultivated in 0.5 L flasks aerated with CO.sub.2 enriched air. Upon induction with 5, 10 or 15 M Zn.sup.2+ a high ethanol production rate can be observed, whereas the OD.sub.750 goes down, because more carbon is shuffled into ethanol synthesis and not into the growth of the culture. If no zinc is added to the culture medium, the ethanol accumulation remains low, so that the induction factor which is indicated by the double arrows shown in the diagram with the ethanol production per OD (bottom right in FIG. 15E) is about 6 when calculated for the cultures with 10 M and 15 M zinc whereas for 5 M zinc the factor is about 4.

(121) Comparison of the Ethanol Production Rate of Synechococcus PCC 7002 Strains Harboring Plasmids for Ethanol Production with an Endogenous Zn.sup.2+ Inducible Promoter and Plasmids with a Heterologous Zn.sup.2+ Inducible Promoter

(122) FIGS. 16A and 16 B shows the ethanol production of genetically enhanced Synechochoccus PCC 7002 strains transformed with extrachromosomal plasmids #1121 including an endogenous PsmtA/smtB promoter/regulator pair in comparison to the same cyanobacterial strain harboring an extrachromosomal plasmid #1348 including a heterologous promoter/regulator pair PziaA/ziaR from Synechocystis PCC 6803. The ethanol production rates were measured via the GC vial assay as mentioned above. The Synechococcus strain with plasmid #1121 shows much higher ethanol production rates compared to the same cyanobacterial strain plasmid #1348 comprising the heterologous promoter system. However the endogenous smtB-PsmtA promoter system is less tightly repressed in the absence of Zn.sup.2+ in the growth medium whereas the ziaR-PziaA construct #1348 appears very tight without Zn.sup.2+ addition. With increasing Zn.sup.2+ concentrations the ethanol production of the cells including construct #1348 gradually increases while for cyanobacterial cells including plasmid #1121 (smtB-PsmtA) addition of 4 M Zn.sup.2+ already leads to full promoter activation, and further Zn.sup.2+ addition does not increase ethanol production significantly.

(123) The FIGS. 16C and D show the plasmid maps of the plasmids #1121 and #1348, whose nucleotide sequences are included in the sequence listing with SEQ ID NO. 75 and SEQ ID NO. 76.

(124) Characterization of Synechococcus PCC 7002 Strains with Inserted Ethanol Cassettes into the Endogenous Extrachromosomal Plasmids pAQ4, pAQ3 and pAQ1

(125) Synechococcus PCC 7002 strains were transformed with the plasmids TK 115, TK 161, and TK 165, respectively, which all contain a gene coding for ZmPDC enzyme transcriptionally controlled by the promoter/regulator pair PsmtA/smtB and which also include a SynAdh.sub.deg gene, which is constitutively transcribed under control of PrbcL (6803). The main difference between these plasmids is that they all contain different integrative platforms, homologous sequences named FA2 and FB2 respectively, which are used for homologous recombination of the ethanologenic cassettes of these plasmids into the endogenous plasmids pAQ4, pAQ3 and pAQ1 of Synechococcus PCC 7002, respectively.

(126) FIGS. 17A and 17B depict the activities of the Pdc enzyme and the Adh enzyme depending on the integration of the different endogenous plasmids in comparison to a pVZ322 based extrachromosomal plasmid #1121 in Synechococcus PCC7002. It is evident from these graphs that both the activities of Pdc enzyme and Adh enzyme are correlating with increasing copy number of respective plasmids, i.e. the higher the number of copies of used endogenous plasmid for integration, the higher the activities are. In particular, the determined Pdc and Adh activities for pAQ4 integration (15 copies per cell) and the above mentioned broad-host range plasmid #1121 are very similar under induced conditions (Zn.sup.2+ addition) and repressed conditions indicating a similar copy number/gene dosage for both plasmids. In contrast, cyanobacterial strains with higher copy number plasmids generated by integration into pAQ3 (27 copies per cell) and pAQ1 (50 copies per cell) exhibit substantially elevated Pdc and Adh activities respectively, compared to the broad-host range shuttle plasmid #1121.

(127) FIGS. 17C and 17D show the ethanol production over time of the strains already mentioned above and discussed in FIGS. 17A and 17B measured by the GC vial assay. According to the determined Pdc and Adh activity for the different pAQ integrations, the observed ethanol production rates are increasing gradually with increasing copy number/gene dosage of corresponding pAQ plasmid used for integration of the ethanologenic gene cassette. At the same time with increasing copy number (pAQ4<pAQ3<pAQ1) the applied smtB-PsmtA promoter system gets more leaky due to the higher gene dosage of the ethanologenic gene cassette.

(128) The plasmid maps of these plasmids TK 161, and TK 165, respectively are shown in the FIGS. 17E, and 17F, and the nucleotide sequence of the plasmids TK 115, TK 161 and TK 165 is listed as SEQ ID NO. 77, 78 and 79, respectively, in the sequence listing.

(129) Characteristics of Synechococcus PCC 7002 Strains Including an Ethanologenic Cassette with a Heterologous Zn.sup.2+-Inducible Promoter

(130) FIGS. 18A and 18B show the ethanol production and the specific activity of the Pdc enzyme depending on the induction condition (0, 5, 10 and 15 M zinc) for Synechococcus PCC 7002 strains for a time period of about 60 hours. An ethanologenic cassette including a heterologous Zn.sup.2+-inducible promoter ziaR-PziaA from Synechocystis PCC 6803 was integrated into this strain via transformation with the plasmid #1468 including homologous platforms for integration of the ethanologenic cassette into the endogenous pAQ1. The ethanol production rates were determined via the GC vial assay as described above. The low efficiency/activity of the ziaR-PziaA promoter system in Synechococcus strains as detected for plasmid #1348 (FIG. 16B) can be successfully compensated by integration of the ethanologenic gene cassette into the high copy number plasmid pAQ1 present in PCC7002, instead of using a broad-host range shuttle plasmid like #1348. The higher gene dosage when integrated into pAQ1 elevates substantially the gene expression from the ziaR-PziaA promoter which is less active than the endogenous smtB-PsmtA promoter upon Zn.sup.2+ induction (FIG. 16A). By combining ziaR-PziaA with a pAQ1 integration strategy this heterologous promoter provides a transcriptional activity comparable to endogenous promoters despite its rather weak activity in Synechococcus PCC7002. In comparison to pAQ1 with the endogenous Zn2+ inducible promoter system (FIGS. 17C and 17D) the Synechococcus including plasmid #1468 appears to be more tightly repressed and needs at the same time higher Zn.sup.2+ concentrations (up to 15 M Zn.sup.2+) for its complete activation. Thereby the induction of ethanol production can be realized more gradually. The determined Pdc activity confirms the tighter controllable gene expression for Synechococcus including plasmid #1468 compared to TK165 (FIGS. 17C and 17D).

(131) FIGS. 18C, 18D, 18E, 18F and 18G show the ethanol production (v/v), the ethanol production (v/v) normalized to the OD.sub.750 nm, the OD.sub.750 nm and the specific Pdc activity for a 0.5 l cultivation of Synechococcus PCC 7002 over a time period of 19 days. This strain was transformed with the plasmid #1468 for integration of the ethanologenic cassette into the high copy number plasmid pAQ1. The low efficiency/activity observed for the ziaR-PziaA from Synechocystis PCC6803 in Synechococcus strains was compensated by integration of the ethanologenic gene cassette into the high copy number plasmid pAQ1. The accomplished ethanol production rate of about 0.025%/day (12 h/12 h day night cycle) over 2 weeks is substantial higher than detected for a conventional pVZ322 based ethanologenic plasmid comprising a ziaR-PziaA controlled ethanologenic gene cassette. Measured Pdc activities indicate a sufficient high expression level enabling high ethanol production rates.

(132) The plasmid map of plasmid #1468 is depicted in FIG. 18H and the DNA sequence of this plasmid is included in the sequence listing as SEQ ID NO. 80.

(133) Characterization of Synechococcus PCC 7002 Comprising an Ethanologenic Cassette with a Heterologous Co.sup.2+-Inducible Promoter Integrated into the Extrachromosomal Plasmid pAQ4

(134) FIG. 19A depicts the ethanol production over time (v/v) depending on the induction condition (0, 5, 10 and 20 M cobalt) normalized to the OD.sub.750 nm determined by the GC vial assay for Synechococcus PCC 7002 transformed with the plasmid #1332 for integration of the ethanologenic cassette with the Co.sup.2+-inducible promoter corR-PcorT into the endogenous plasmid pAQ4. In comparison to pAQ4-based genetically enhanced Synechococcus strains with the endogenous Zn.sup.2+-inducible smtB-PsmtA promoter system (FIGS. 17C and 17D) the genetically enhanced strain transformed with plasmid #1332 appears to be very tightly repressed and is gradually inducible by increasing Co.sup.2+ concentrations. The more Co2+ is added, the stronger the ethanol production is.

(135) FIG. 19B depicts the plasmid map of plasmid #1332, whose nucleic acid sequence is given as SEQ ID NO. 81.

(136) Characterization of Synechococcus PCC 7002 Transformed with the Extrachromosomal Plasmid #1449 Including an Ethanologenic Cassette with a Co.sup.2+-Inducible Promoter System

(137) FIGS. 20A and 20B depict the ethanol production (v/v) depending on the induction condition (0, 5 and 10 M cobalt) normalized to the OD.sub.750 nm and the specific Adh and Pdc activities for cultivation over a time period of about 60 hours in GC vials of Synechococcus #1449 comprising an ethanologenic gene cassette with a heterologous Co.sup.2+ inducible promoter system, corR-PcorT from Synechocystis PCC6803 integrated into the extrachromosomal pVZ322 based shuttle plasmid. The ethanol production rate as well as the response to Co.sup.2+ addition is very similar to the pAQ4 based genetically enhanced strain transformed with the plasmid #1332 with corR-PcorT promoter system (see FIG. 19A). Pdc activity measurements reveal that this heterologous promoter system is very tightly repressed and is gradually inducible by an increasing Co.sup.2+ addition. In contrast, the Adh activity from the separately transcribed adh gene controlled by a modified version of the Synechocystis rbcL core promoter reveals a constantly high ADH expression level independent from the addition of Co.sup.2+.

(138) The FIGS. 20C, 20D, 20E, and 20F show the ethanol production (v/v), the ethanol production (v/v) normalized to the OD.sub.750 nm, the growth as OD.sub.750 nm, and the specific activity of Pdc enzyme for a cultivation of a Synechococcus strain in 0.5 l bioreactors over a time period of 50 days. The Synechococcus PCC 7002 strain was transformed with the pVZ322-based broad host range shuttle plasmid #1449, which comprises an ethanologenic gene cassette with a heterologous Co.sup.2+ inducible promoter system (corR-PcorT from Synechocystis PCC6803). The accomplished ethanol production rates between 0.030%/day and 0.035%/day (12 h/12 h day night cycle) over almost 50 days appears to be very good and meet the needs for commercial ethanol production and appears to be remarkably stable. Measured Pdc activities indicate a sufficient high and stable expression level enabling a very high ethanol production rate with long duration (arrows indicate cell dilution steps with complete medium removal).

(139) The plasmid map of plasmid #1449 is shown in FIG. 20G and its nucleic acid sequence is SEQ ID NO. 82.

(140) Characterization of a Synechococcus Strain Including Two Variants of a Heterologous Co.sup.2+-Inducible Promoter System

(141) FIGS. 21A and 21B show the ethanol production (v/v) normalized to the OD750 nm for two Synechococcus PCC 7002 hybrid strains one was transformed with the plasmids #1507 and the other with plasmid #1470. The only difference between both plasmids is that in plasmid #1507 the native version of the heterologous promoter/regulator pair PcorT/corR from Synechocystis PCC6803 is included, whereas in plasmid #1470 a modified variant PcorT* of the promoter PcorT is used, harboring specific nucleotide modifications in the ribosomal binding site (RBS) of the promoter. Both plasmids are integrative plasmids able to integrate into the endogenous plasmid pAQ3, respectively. The ethanol production rates were measured by the GC vial assay. By introducing specific nucleotide substitutions into the ribosomal binding site of the corT promoter as realized in construct #1470 (corR-PcorT*1) the ethanol production rate was increased by about 50% compared to the native corR-PcorT promoter from PCC6803 (#1507). The tight repression behavior of the corR-PcorT promoter is thereby not negatively impacted. The Pdc encoding gene variant Zmpdc.sub.deg (codon degenerated version of Zzmpdc) that was used normally leads to a lower Pdc enzyme expression level in general. Due to this fact one would not expect higher ethanol production from these constructs compared to constructs described before as #1332 (FIG. 19A) and #1449 (FIGS. 20A and 20B) with the same Co.sup.2+ inducible promoter system but the native pdc gene from Zymomonas mobilis. However, the promoter efficiency can be compared between #1470 and #1507.

(142) FIGS. 21C and 21D depict the plasmid maps of plasmids #1507 and 1470. FIG. 21E shows a comparison of the native corT and the modified corT*1 promoter including 5- and 3-neighboring nucleic acid sequences with restriction sites and start codons for genes transcriptionally controlled by the promoter. The nucleic acid sequence of plasmid #1507 is included in the sequence listing as SEQ ID NO. 83. SEQ ID NO. 84 shows the DNA sequence of the PcorT* promoter.

(143) Comparison of Synechococcus PCC 7002 Strains Transformed with Extrachromosomal Plasmids Containing an Ethanologenic Cassette with a Pdc Gene Under the Control of a Heterologous Ni.sup.2+- and a Modified Ni.sup.2+-Inducible Promoter

(144) FIGS. 22A and 22B show the ethanol production (v/v) normalized to the OD.sub.750 nm for two Synechococcus PCC 7002 strains transformed with pVZ322 based extrachromosomal plasmids #1353 and #1354. The only difference between both plasmids are modifications in the ribosomal binding site of the heterologous Ni.sup.2+-inducible promoter PnrsB from Synechocystis PCC 6803 in plasmid #1354 resulting in the promoter PnrsB* controlling the transcription of the pdc gene. By introducing these specific nucleotide substitutions into the ribosomal binding site of the nrsR promoter in construct #1354 (nrsRS-PnrsB*) the ethanol production rate was increased by 35% compared to the native nrsRS-PnrsB promoter from PCC6803 (strain transformed with #1353). However compared to Synechococcus PCC7002 strains with Co.sup.2+ or Zn.sup.2+ inducible promoter systems (e.g. #1449 and #1121), the ethanol production rate is still below 50%. The tight repression behavior of the nrsRS-PnrsB promoter in Synechococcus PCC7002 is not negatively influenced by the nucleotide substitutions introduced into PnrsB*.

(145) FIG. 22C depicts the plasmid map of plasmid #1353, whose nucleotide sequence is included in the sequence listing as SEQ ID NO. 85. The nucleic acid sequence of the modified promoter PnrsB* is included as SEQ ID NO. 86.

(146) Characterization of Synechococcus PCC 7002 Including an Ethanologenic Cassette with a Pdc Gene Under the Control of a Heterologous Ni.sup.2+-Inducible Promoter

(147) FIGS. 23A and 23B show the ethanol production (v/v) normalized to the OD.sub.750 nm and the Pdc enzyme activity for Synechococcus PCC 7002 strains including an ethanologenic cassette integrated into the endogenous plasmid pAQ1 with a pdc gene transcriptionally controlled by a heterologous Ni.sup.2+-inducible promoter from Synechocystis PCC 6803. The relatively low efficiency/activity of the nrsRS-PnrsB promoter system from Synechocystis PCC6803 in Synechococcus PCC 7002 as detected for the strains transformed with plasmid #1353 (FIG. 22A) was successfully compensated by integration of a respective ethanologenic gene cassette into the high copy number plasmid pAQ1 present in PCC7002 by transformation with the integrative plasmid #1441. The higher gene dosage when integrated into pAQ1 elevates substantially the gene expression from the nrsRS-PnrsB promoter upon Ni.sup.2+ induction. By combining the improved nrsRS-PnrsB* variant of the native PCC6803 promoter (FIG. 22B #1354) with the pAQ1 integration strategy this heterologous promoter becomes applicable despite its rather moderate activity in PCC7002. Pdc enzyme activity measurements reveal that PDC activity of PCC7002 #1441 hybrid is gradually inducible by increasing Ni.sup.2+ concentrations.

(148) The plasmid map of the integrative plasmid #1441 is shown in FIG. 23C and its nucleic acid sequence is listed as SEQ ID NO. 87.

(149) Characterization of Another Synechococcus PCC 7002 Strain Transformed with an Extrachromosomal Plasmid Harboring a Pdc Gene Under the Control of a Further Heterologous Ni.sup.2+-Inducible Promoter

(150) FIGS. 24A and 24B show the ethanol production normalized to the OD.sub.750 nm of a Synechococcus strain transformed with the plasmid #1460 and the plasmid map of this extrachromosomal plasmid, respectively. This plasmid contains a pdc gene transcriptionally controlled by another heterologous Ni.sup.2+-inducible promoter from another Synechococcus strain with the internal denomination 916 that is closely related to Synechococcus PCC 7002. Compared to the native nrsRS-PnrsB promoter from PCC6803 this Synechococcus promoter appears less tight in the repressed state, but enables at the same time a higher ethanol production than observed for Synechococcus PCC7002 carrying plasmid #1353 (FIG. 22A). The nucleic acid sequence of plasmid #1460 is presented as SEQ ID NO. 88.

(151) Characterization of Another Synechococcus PCC 7002 Strain Transformed with an Integrative Plasmid Harboring a Pdc Gene Under the Control of a Heterologous Ni.sup.2+-Inducible Promoter from a Closely Related Synechococcus Species

(152) FIGS. 25A and 25B show the ethanol production normalized to the OD.sub.750 nm of a Synechococcus PCC 7002 strain transformed with the plasmid #1473 for integration into the endogenous plasmid pAQ1 and the plasmid map of this integrative plasmid, respectively. It can clearly be seen that the ethanol production in comparison to the last embodiment (see FIG. 24A) can strongly be increased by integration of the respective ethanologenic gene cassette into the endogenous high-copy number plasmid pAQ1 instead using a and broad-host range extrachromosomal plasmid like #1460. This integration into pAQ1 elevates substantially the gene expression from the heterologous nrsRS-PnrsB promoter. The ethanol production rate is thereby increased 3-fold compared to the pVZ322 based shuttle plasmid #1460 (FIG. 24A). However the promoter system appears to be leakier. The nucleic acid sequence of plasmid #1473 is shown as SEQ ID NO. 89.

(153) The scope of the protection of the invention is not limited to the example given herein above. The invention is embodied in each novel characteristic and each combination of characteristics, which particularly includes every combination of any features which are stated in the claims, even if this feature or this combination of features is not explicitly stated in the claims or in the examples.