Riboregulator compositions and methods of use
09550987 ยท 2017-01-24
Assignee
Inventors
Cpc classification
C12N2320/12
CHEMISTRY; METALLURGY
C12N15/11
CHEMISTRY; METALLURGY
C12N15/113
CHEMISTRY; METALLURGY
C12Q1/6897
CHEMISTRY; METALLURGY
C12N2320/11
CHEMISTRY; METALLURGY
C12N15/67
CHEMISTRY; METALLURGY
C12N15/115
CHEMISTRY; METALLURGY
International classification
C12N15/67
CHEMISTRY; METALLURGY
C12N15/11
CHEMISTRY; METALLURGY
C12N15/113
CHEMISTRY; METALLURGY
Abstract
The invention provides novel and versatile classes of riboregulators, including inter alia activating and repressing riboregulators, switches, and trigger and sink RNA, and methods of their use for detecting RNAs in a sample such as a well and in modulating protein synthesis and expression.
Claims
1. A toehold riboregulator comprising an RNA comprising in a 5 to 3 order (1) a single-stranded toehold domain, (2) a fully or partially double-stranded stem domain comprising (i) an initiation codon, and (ii) a loop domain comprising a ribosome binding site, and (3) a coding domain.
2. The riboregulator of claim 1, further comprising a spacer domain.
3. The riboregulator of claim 2, wherein the spacer domain encodes low molecular weight amino acids.
4. The riboregulator of claim 2, wherein the spacer is about 9-33 nucleotides in length.
5. The riboregulator of claim 2, wherein the spacer is about 21 nucleotides in length.
6. The riboregulator of claim 2, wherein the spacer domain is situated between the stem domain and the coding domain.
7. The riboregulator of claim 1, wherein the stem domain comprises sequence upstream (5) and/or downstream (3) of the initiation codon.
8. The riboregulator of claim 7, wherein the sequence upstream of the initiation codon is about 6 nucleotides.
9. The riboregulator of claim 7, wherein the sequence downstream of the initiation codon is about 9 nucleotides.
10. The riboregulator of claim 7, wherein the sequence downstream of the initiation codon does not encode a stop codon.
11. The riboregulator of claim 1, wherein the coding domain encodes a reporter protein.
12. The riboregulator of claim 11, wherein the reporter protein is green fluorescent protein (GFP).
13. The riboregulator of claim 1, wherein the coding domain encodes a non-reporter protein.
14. The riboregulator of claim 1, wherein the toehold domain is complementary in sequence to a naturally occurring RNA.
15. The riboregulator of claim 1, wherein the toehold domain is complementary in sequence to a non-naturally occurring RNA.
16. A trans-activating RNA (taRNA) comprising a first domain that hybridizes to a toehold domain of a riboregulator of claim 1 and that comprises no or minimal secondary structure, and a second domain that hybridizes to a sequence in the stem domain of the riboregulator of claim 1.
17. The trans-activating RNA of claim 16, wherein the first domain is 100% complementary to the toehold domain.
18. A system comprising the riboregulator of claim 1, and the trans-activating RNA (taRNA) of claim 16.
19. The system of claim 18, wherein the system is a cell.
20. The system of claim 19, wherein the cell is a prokaryotic cell.
21. The system of claim 18, wherein the system is a cell-free in vitro system.
22. The system of claim 18, wherein the riboregulator and the taRNA are hybridized to each other.
23. The system of claim 18, wherein the ratio of riboregulator to taRNA is less than 1, less than 0.5, or less than 0.1.
24. The system of claim 18, wherein the riboregulator is comprised in a first nucleic acid and the taRNA is comprised in a second nucleic acid.
25. The system of claim 24, wherein the first nucleic acid is a first plasmid and the second nucleic acid is a second plasmid.
26. The system of claim 24, wherein the first plasmid comprises a medium copy origin of replication and the second plasmid comprises a high copy origin of replication.
27. A nucleic acid comprising the riboregulator of claim 1.
28. A host cell comprising the nucleic acid of claim 27.
29. A nucleic acid comprising the trans-activating RNA (taRNA) of claim 16.
30. A host cell comprising the nucleic acid of claim 29.
31. A method of detecting presence of an RNA in a sample, comprising combining a riboregulator of claim 1 with a sample, wherein the riboregulator comprises a toehold domain that is complementary to an endogenous RNA, and wherein the riboregulator comprises a coding domain that encodes a reporter protein, under conditions that allow translation of the coding domain in the presence of the endogenous RNA but not in the absence of the endogenous RNA, and detecting the reporter protein as an indicator of the endogenous RNA.
32. A method of detecting presence of an RNA in a cell, comprising introducing into the cell a riboregulator of claim 1, wherein the riboregulator comprises a toehold domain that is complementary to an endogenous RNA in the cell, and wherein the riboregulator comprises a coding domain that encodes a reporter protein, and detecting the reporter protein as an indicator of the endogenous RNA.
33. The method of claim 31, wherein the reporter protein is green fluorescent protein (GFP).
34. The method of claim 31, wherein amount of reporter protein is an indicator of amount of endogenous RNA.
35. A method of controlling protein translation, comprising combining a riboregulator of claim 1 with a taRNA of claim 16, wherein the riboregulator comprises a toehold domain that is complementary to the taRNA, and wherein the riboregulator comprises a coding domain that encodes a non-reporter protein, under conditions that allow translation of the coding domain in the presence of the taRNA but not in the absence of the taRNA.
Description
BRIEF DESCRIPTION OF DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
(21)
DETAILED DESCRIPTION OF INVENTION
(22) The invention provides two general classes of riboregulators: toehold riboregulators and beacon riboregulators. Both can be used to activate protein production (or translation) in various systems including cells such as prokaryotic cells. Unlike previous engineered riboregulators of gene expression, these devices can be trans-activated using separate RNAs of virtually arbitrary sequence. The sequence of the activating RNA need not be related to a ribosome binding site (RBS) sequence.
(23) The advantages of these new riboregulators are multifold. First, many riboregulators of the invention can be active in a single cell simultaneously, with each interacting only with its cognate (specific) targets. This allows simultaneous control over multiple cellular activities. Second, riboregulators of the invention can be incorporated into complex nucleic acid circuits in vivo with low system cross-talk and high programmability. Third, riboregulators of the invention can trigger protein (e.g., reporter protein) production from endogenous RNAs. When riboregulator output is coupled to a fluorescent protein reporter, these riboregulators act as genetically encodable sensors and imaging probes for endogenous RNAs in cells. For other proteins, such as those involved in cellular metabolism, activation of gene expression using these riboregulators can facilitate the interaction between pathways endogenous to the cell and synthetic gene networks for new applications in biotechnology.
(24) The invention therefore provides a variety of novel riboregulators and devices derived therefrom that offer greatly improved diversity, orthogonality, and functionality compared to previously described riboregulators. In contrast to prior art riboregulators that inhibit translation solely by disrupting binding of the ribosome to the RBS, certain riboregulators of the invention allow ribosome docking (in some cases) but prevent translation initiation by blocking ribosome access to the initiation codon (in all cases) and usually extension from it. A benefit of this approach is that the RBS is no longer required to be part of the trans-RNA sequence enabling new riboregulators to be designed without any dependence on the Shine-Dalgarno sequence and with only few overall sequence constraints. In addition, these new riboregulators do not rely on kissing-loop interactions to drive hybridization between the crRNA and the trans-RNA. Instead, they utilize linear-linear (or large-loop-linear) RNA interactions, whose strength can be rationally controlled simply by changing the number of nucleotides driving the initial RNA-RNA interaction and/or by changing its base composition. In contrast, changes in base composition and/or sequence length in a kissing loop interaction can affect the tertiary structure of interacting domains and decrease the kinetics of the hybridization reaction.
(25) Riboregulators Generally
(26) Riboregulators are RNA molecules that can be used to repress or activate translation of an open reading frame and thus production of a protein. Repression is achieved through the presence of a regulatory nucleic acid element (the cis-repressive RNA or crRNA) within the 5 untranslated region (5 UTR) of an mRNA molecule. The nucleic acid element forms a hairpin structure comprising a stem domain and a loop domain through complementary base pairing. The hairpin structure blocks access to the mRNA transcript by the ribosome, thereby preventing translation. In some embodiments, including for example embodiments involving prokaryotic cells, the stem domain of the hairpin structure sequesters the ribosome binding site (RBS). In some embodiments, including for example embodiments involving eukaryotic cells, the stem domain of the hairpin structure is positioned upstream of the start (or initiation) codon, within the 5 UTR of an mRNA. RNA expressed and acting in trans (and thus referred to as trans-activating RNA, or taRNA) interacts with the crRNA and alters the hairpin structure. This alteration allows the ribosome to gain access to the region of the transcript upstream of the start codon, thereby releasing the RNA from its repressed state and facilitating protein translation from the transcript. The crRNA are typically engineered RNA molecules. The taRNA may be engineering molecules although in some instances, as described herein, they may be regions of endogenous, naturally occurring RNAs within a system such as a cell.
(27) The invention generally provides nucleic acids, constructs, plasmids, host cells and methods for post-transcriptional regulation of protein expression using RNA molecules to modulate and thus control translation of an open reading frame.
(28) It is to be understood that the invention contemplates modular crRNA encoding nucleic acids and modular taRNA encoding nucleic acids. Modular crRNA encoding nucleic acids as used herein refer to nucleic acid sequences that do not comprise an open reading frame (or coding domain for a gene of interest). Such modular crRNA may be toehold crRNA or beacon crRNA. Thus the invention contemplates riboregulators in their final form (e.g., comprising a coding domain for a gene of interest) or riboregulator components (e.g., a toehold crRNA or a beacon crRNA not operably linked to gene of interest).
(29) The invention further provides oligonucleotides comprising a crRNA sequence and oligonucleotides comprising a taRNA sequence. In addition, the invention provides sets of two or more oligonucleotides. A first set of oligonucleotides includes two or more oligonucleotides whose sequences together comprise a crRNA sequence. The invention also provides a second set of oligonucleotides whose sequences together comprise a taRNA sequence. For ease of cloning, it may be preferable to employ two oligonucleotides each of which includes a single stem-forming portion, in different cloning steps, rather than a single oligonucleotide comprising two stem-forming portions, in order to avoid formation of a stem within the oligonucleotide, which may hinder cloning. The oligonucleotides may be provided in kits with any of the additional components mentioned herein. The oligonucleotides may include restriction sites at one or both ends.
(30) Toehold Riboregulators
(31) In a toehold riboregulator system, the interaction between the crRNA and the trans-RNA species is mediated through a single-stranded RNA domain that is located to the 5 end of the crRNA stem. This domain, which is referred to as the toehold domain, provides the trans-RNA with sufficient binding affinity to enable it to unwind the crRNA stem. The degree of complementarity between the trans-RNA and the toehold domain may vary. It some embodiments, it is at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or 100%. For optimal riboregulator kinetics, the trans-RNA should possess minimal secondary structure and full complementarity (i.e., 100%) to the toehold domain of the crRNA. As used herein, secondary structure refers to non-linear structures including for example hairpin structures, stem loop structures, and the like. Accordingly, it is preferable that the trans-RNA consists of a sequence with little to no probability of forming secondary structure under the conditions of its use. Those of ordinary skill in the art are able to determine such sequences either manually or through the use of computer programs available in the art.
(32) Toehold riboregulator crRNAs do not sequester the RBS within their stem domain. Instead, RBS are confined to the loop domain formed by the repressing stem domain. This allows the region immediately before (upstream or 5) and after (downstream or 3) the initiation codon to be sequestered within the stem domain, thus frustrating translation initiation. The respective lengths of the crRNA toehold, stem, and loop domains can be changed to a large extent without affecting the performance of the toehold riboregulator as will be detailed below. In addition, the crRNA stem domain can retain its repression efficiency even if it contains a number of bulges or mispaired bases, which enables trans-RNAs that do not contain the start codon AUG sequence to trigger the riboregulator. In principle, the tolerance of bulges enables arbitrary taRNA sequences, including endogenous RNAs, to act as input RNAs into the toehold riboregulator, although other criteria such as high secondary structure can affect the response of the regulator.
(33) An exemplary, non-limiting, class of toehold riboregulators has design parameters shown in
(34) It is to be understood that the embodiment illustrated in
(35) Further toehold riboregulator system designs are described in Example 7.
(36) As shown in
(37) Additional experimental testing has also enabled us to gain a better understanding of the crRNA secondary structure and domain lengths required for optimal toehold riboregulator operation. A toehold domain of at least 5 or 6 nts in length is preferable for taRNA initial binding. The toehold domain can therefore be 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more nucleotides in length. Moreover, it was also found that the taRNA need only unwind two-thirds of the crRNA stem in order to allow translation of the GOI. Based on these findings, the stem domain may be as small as 12 bps for adequate repression in the crRNA. The stem domain may however be longer than 12 bps, including 13, 14, 15, 16, 17, 18, 19, 20, or more base pairs in length. Furthermore, expanding the loop length to 12-nts and replacement of the RBS with a slightly stronger version with the canonical Shine-Dalgarno sequence did not decrease the degree of repression by the crRNA. Accordingly, the length of the loop domain may be 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more nucleotides. Variations of toehold riboregulators are shown in
(38) The invention further provides crRNA/switches having additional features. In some instances, the top three bases of the hairpin stem may be A-U base pairs. In some instances, the bottom three base pairs of the stem may comprise two strong G-C base pairs and one A-U base pair. In some instances, the length of the switch toehold may range from about 12- to about 15-nts. This latter feature may in some instances strengthen the initial binding between a trigger RNA and its switch RNA. In some instances, the size of the hairpin loop may range from about 11- to about 15-nts to enhance translation of the output protein upon switch activation. In some instances, the loop size is 15-nts. In yet other instances, the cognate trigger may be used that unwinds the first 15 of the 18 bases in the switch stem. In some instances, one or more, including all, of these features may be used simultaneously. The Examples demonstrate the results using such riboregulators.
(39) The toehold riboregulators described herein may be used in logic gates that function through more than one trigger RNA or that sense more than one trigger RNA.
(40)
(41) In still other aspects, the invention recognizes that it is useful to prevent a trigger RNA from acting on its cognate switch RNA to prevent activation of a system or as a means of adding another layer of logic to an in vivo circuit. Provided herein is a method to reduce or eliminate the activity of a trigger RNA using an RNA referred to herein as a sink RNA. The sink RNA is designed to outcompete the switch RNA for binding to its cognate trigger strand. In these systems, flanking sequences v* and u* are added to the 5 and 3 ends of the trigger RNA, respectively (
(42)
(43) This approach can also be directly applied to the toehold repressors discussed below. When a trigger/sink combination is used with a repressor, the system turns off only when the trigger RNA is expressed in the absence of the sink RNA. This behavior is equivalent to an A IMPLY B operation where the trigger serves as the A input and the sink is the B input.
(44) The sink RNA/trigger RNA system can be applied to thresholding circuits. The experiments shown in
(45) The invention therefore contemplates toehold riboregulator compositions (or systems or devices) comprising a switch RNA (comprising a coding sequence for a gene of interest), a trigger RNA, and a sink RNA. In some instances, the trigger RNA is an activating RNA (i.e., its presence, at a sufficient level, activates protein expression (or translation) from the switch RNA and thus of the coding sequence of interest). In some instances, the trigger RNA is a repressing RNA (i.e., its presence, at a sufficient level, represses protein expression (or translation) from the switch RNA and thus of the coding sequence of interest). The inter-related structural features of the switch RNA, trigger RNA and sink RNA are as described herein.
(46) As discussed briefly herein, toehold riboregulators may also function as repressors of protein translation. In accordance with the invention, a new class of riboregulators is provided that can repress translation of a gene of interest in response to a trigger RNA by a novel strand reconfiguration mechanism. These switch RNA/trigger RNA riboregulator systems are referred to herein as toehold repressors as a result of their toehold-based interaction mechanism. The molecular implementation of these RNA devices is shown in
(47) The trigger RNA is a single-stranded RNA containing a sequence that is perfectly complementary to the early region of the switch RNA as shown in
(48) Like the toehold activator switches, toehold repressors can adopt trigger RNAs with virtually arbitrary sequences. Consequently, it is possible to design large repressor libraries with a high degree of orthogonality. In addition, they can be used to trigger translational repression in response to exogenous and endogenous RNAs.
(49) The invention further contemplates and provides higher order logic circuitry based on toehold repressors. Given their similarities to the toehold activator switches, toehold repressor switches can be incorporated into complex logic systems in much the same way as the translational activators.
(50) Thus, some aspects provide NAND logic gates, which are repressor versions of the systems shown in
(51) Other aspects provide NOR logic gates, which are repressor versions of the systems shown in
(52) The riboregulators provided herein can be used in complex logic circuitry. As an example, toehold switches and toehold repressors can be incorporated into higher-order logic circuits for AND/NAND, OR/NOR, and IMPLY/N-IMPLY operations. The modularity of this computational approach enables even more complex calculations by combining all these operations in a single extended gate RNA containing concatenated toehold regulator hairpins along with a network of affiliated input trigger and sink RNAs. Importantly, the base set of computational elements provided herein enables evaluation of any logic operation by decomposing it into an expression in disjunctive normal form (i.e., an outer OR operation applied to nested NOT and AND expressions), such as:
(53) (A AND B) OR (C AND D) OR (E AND F AND G),
(54) or with the addition of sink RNAs:
(55) NOT (A AND B) OR (C AND (NOT D)) OR (E AND F AND G).
(56) Analogous expressions can be evaluated with the NAND and NOR gates incorporated as well. Computations using the toehold regulators operate in a single computational layer (i.e., they do not require the output from one operation to be used as an input for a later operation) and can readily integrate multiple input species, which increases their computation speed and enables fewer gates to be used. This is in contrast to other molecular computation techniques such as those described by Qian et al. Science, 332:1196-1201, 2011 and Moon et al. Nature, 491:249-253, 2012.
(57) Still further embodiments provide and apply multiple input XOR and XNOR logic. As an example, N-bit XOR (XNOR) calculations can be performed using a combination of the OR (NOR) gates and trigger/sink RNAs. The main concepts behind this operation can be described using the simple 2-bit XOR case. The constitutively-expressed gate RNA for this operation is a 2-bit OR system containing a pair of concatenated orthogonal toehold switches upstream of the regulated gene. These switches accept cognate triggers A and B. Expression of triggers A and B is controlled by two orthogonal chemical inducers indA and indB, respectively. Each of the triggers has a cognate sink RNA A* and B* that preferentially bind to their corresponding trigger to prevent activation of the switch hairpin in the gate. Importantly, these sink RNAs are expressed from a higher copy plasmid or using a stronger promoter than the trigger RNAs to ensure they reach higher concentrations when induced in the cell. Furthermore, production of sink RNAs A* and B* is tied to indB and indA, respectively. Consequently, addition of indA to the growth media will cause expression of trigger A and sink B*, while addition indB will cause trigger B and sink A* to be produced.
(58) When only one inducer is present, expression of the trigger RNA and a non-cognate sink RNA allows activation of one of the switch hairpins within the gate RNA. However, when both inducers are present, the two trigger RNAs are expressed, but sink RNAs are also transcribed at higher levels. These sink RNAs outcompete the gate RNA for trigger molecules and prevent activation of protein translation. In the case where neither inducer is present, triggers are not expressed and the gate remains off. As a result, this synthetic gene network carries out 2-bit XOR logic.
(59) This general approach can be extended to N-bit XOR logic in which each of the N inducers initiates expression of a single trigger RNA along with a complement of N-1 non-cognate sink RNAs. Lastly, N-bit XNOR is evaluated by replacing the N-bit OR gate formed from N concatenated toehold switches with a set of N concatenated toehold repressors.
(60) Beacon Riboregulators
(61) In a beacon riboregulator system, the crRNA comprise a stem domain of variable length that contains the RBS and, in some cases, the start codon (see
(62) Beacon riboregulators were tested using identical conditions to those used for the toehold riboregulator devices.
(63) Variations of toehold riboregulators are shown in
(64) As described herein, the trans-activating RNA (taRNA) (also referred to herein as trigger RNA) may be small RNA molecules encompassing only those sequences that hybridize to the binding domains (first or second or first and second domains) of the toehold or beacon riboregulators, or they may be longer RNA molecules such as mRNA molecules that hybridize to the binding domains of the toehold or beacon riboregulators using only part of their sequence. In still other instances, activation of the crRNA may require two or more RNA or other nucleic acid molecules that work in concert to unwind the hairpin structure of the crRNA. The taRNA may be of varied length. In some instances, the taRNA is about 30 nts in length. Such a taRNA may bind to a crRNA having a 12 nt toehold domain, as described in herein including in Example 7.
(65) The crRNA of the invention comprise a hairpin structure that minimally comprises a stem domain and a loop domain. The crRNA and its hairpin typically comprise a single nucleic acid molecule or portion thereof that adopts secondary structure to form (a) a duplex (double helical, partially or fully double-stranded) region (referred to herein as the stem domain) when complementary sequences within the molecule hybridize to each other via base pairing interactions and (b) a single-stranded loop domain at one end of the duplex.
(66) It will be appreciated that although a hairpin is formed from a single nucleic acid molecule, the two regions or sequences of the molecule that form the stem domain may be referred to herein as strands. Thus the stem may be referred to herein as being partially or fully double-stranded. Nucleic acid sequences within a single molecule that are complementary to each other and are capable of forming a stem domain are said to be self-complementary or to self-hybridizing or able to self-hybridize. In general, the hairpin and stem domains described herein form at and are stable under physiological conditions, e.g., conditions present within a cell (e.g., conditions such as pH, temperature, and salt concentration that approximate physiological conditions). Such conditions include a pH between 6.8 and 7.6, more preferably approximately 7.4. Typical temperatures are approximately 37 C., although prokaryotes and some eukaryotic cells such as fungal cells can grow at a wider temperature range including at temperatures below or above 37 C.
(67) Various of the nucleic acids of the invention may be referred to herein as non-naturally occurring, artificial, engineered or synthetic. This means that the nucleic acid is not found naturally or in naturally occurring, unmanipulated, sources. A non-naturally occurring, artificial, engineered or synthetic nucleic acid may be similar in sequence to a naturally occurring nucleic acid but may contain at least one artificially created insertion, deletion, inversion, or substitution relative to the sequence found in its naturally occurring counterpart. A cell that contains an engineered nucleic acid may be referred to as an engineered cell.
(68) Various embodiments of the invention involve nucleic acid sequences that are complementary to each other. In some instances, the sequences are preferably fully complementary (i.e., 100% complementary). In other instances, however the sequences are only partially complementary. Partially complementary sequences may be at least 60%, at least 70%, at least 80%, at least 90%, or at least 95% complementary. Sequences that are only partially complementary, when hybridized to each other, will comprise double-stranded regions and single-stranded regions. The single-stranded regions may be single mismatches, loops (where for instances a series of consecutive nucleotides on one strand are unhybridized), bulges (where for instances a series of consecutive nucleotides on both strands, opposite to each other, are unhybridized). It will be appreciated that complementarity may be determined with respect to the entire length of the two sequences or with respect to portions of the sequences.
(69) Nucleic acids and/or other moieties of the invention may be isolated. As used herein, isolated means separate from at least some of the components with which it is usually associated whether it be from a naturally occurring source or made synthetically.
(70) Nucleic acids and/or other moieties of the invention may be purified. As used herein, purified means separate from the majority of other compounds or entities. A compound or moiety may be partially purified or substantially purified. Purity may be denoted by a weight by weight measure and may be determined using a variety of analytical techniques such as but not limited to mass spectrometry, HPLC, etc.
(71) Nucleic acids generally refer to polymers comprising nucleotides or nucleotide analogs joined together through backbone linkages such as but not limited to phosphodiester bonds. Nucleic acids include deoxyribonucleic acids (DNA) and ribonucleic acids (RNA) such as messenger RNA (mRNA), transfer RNA (tRNA), etc. Nucleic acids may be single-stranded, double-stranded, and also tripled-stranded.
(72) A naturally occurring nucleotide consists of a nucleoside, i.e., a nitrogenous base linked to a pentose sugar, and one or more phosphate groups which is usually esterified at the hydroxyl group attached to C-5 of the pentose sugar (indicated as 5) of the nucleoside. Such compounds are called nucleoside 5-phosphates or 5-nucleotides. In DNA the pentose sugar is deoxyribose, whereas in RNA the pentose sugar is ribose. The nitrogenous base can be a purine such as adenine or guanine (found in DNA and RNA), or a pyrimidine such as cytosine (found in DNA and RNA), thymine (found in DNA) or uracil (found in RNA). Thus, the major nucleotides of DNA are deoxyadenosine 5-triphosphate (dATP), deoxyguanosine 5-triphosphate (dGTP), deoxycytidine 5-triphosphate (dCTP), and deoxythymidine 5-triphosphate (dTTP). The major nucleotides of RNA are adenosine 5-triphosphate (ATP), guanosine 5-triphosphate (GTP), cytidine 5-triphosphate (CTP) and uridine 5-triphosphate (UTP). In general, stable base pairing interactions occur between adenine and thymine (AT), adenine and uracil (AU), and guanine and cytosine (GC). Thus adenine and thymidine, adenine and uracil, and guanine and cytosine (and the corresponding nucleosides and nucleotides) are referred to as being complementary to each other.
(73) In general, one end of a nucleic acid has a 5-hydroxyl group and the other end of the nucleic acid has a 3 -hydroxyl group. As a result, the nucleic acid has polarity. The position or location of a sequence or moiety or domain in a nucleic acid may be denoted as being upstream or 5 of a particular marker, intending that it is between the marker and the 5 end of the nucleic acid. Similarly, the position or location of a sequence or moiety or domain in a nucleic acid may be denoted as being downstream or 3 of a particular marker, intending that it is between the marker and the 3 end of the nucleic acid.
(74) Nucleic acids may comprise nucleotide analogs including non-naturally occurring nucleotide analogs. Such analogs include nucleoside analogs (e.g., 2-aminoadenosine, 2-thiothymidine, inosine, 3-methyl adenosine, C5-propynylcytidine, C5-propynyluridine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-methylcytidine, 7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, O(6)-methylguanine, and 2-thiocytidine), chemically modified bases, biologically modified bases (e.g., methylated bases), intercalated bases, modified sugars (e.g., 2-fluororibose, ribose, 2-deoxyribose, arabinose, and hexose), or modified phosphate groups (e.g., phosphorothioates and 5-N-phosphoramidite linkages).
(75) The nucleic acids of the invention, including the crRNA and taRNA, may be provided or present in a larger nucleic acid. The larger nucleic acid may be responsible for the transcription and thus production of the crRNA and taRNA, as described in Example 1, for example. The larger nucleic acid may comprise a nucleotide sequence that is transcribed to produce the crRNA and taRNA of the invention. For convenience, the invention may refer to the larger nucleic acid as comprising the crRNA and/or taRNA although it is to be understood that in practice this intends that the larger nucleic acid comprises a sequence that encodes the crRNA and/or taRNA. Such encoding sequences may be operable linked to other sequences in the larger nucleic acid such as but not limited to origins of replication. As used herein, operably linked refers to a relationship between two nucleic acid sequences wherein the production or expression of one of the nucleic acid sequences is controlled by, regulated by, modulated by, etc., the other nucleic acid sequence. For example, the transcription of a nucleic acid sequence is directed by an operably linked promoter sequence; post-transcriptional processing of a nucleic acid is directed by an operably linked processing sequence; the translation of a nucleic acid sequence is directed by an operably linked translational regulatory sequence; the transport or localization of a nucleic acid or polypeptide is directed by an operably linked transport or localization sequence; and the post-translational processing of a polypeptide is directed by an operably linked processing sequence. Preferably a nucleic acid sequence that is operably linked to a second nucleic acid sequence is covalently linked, either directly or indirectly, to such a sequence, although any effective association is acceptable.
(76) As used herein, a regulatory sequence or element intends a region of nucleic acid sequence that directs, enhances, or inhibits the expression (e.g., transcription, translation, processing, etc.) of sequence(s) with which it is operatively linked. The term includes promoters, enhancers and other transcriptional and/or translational control elements. The crRNA and taRNA moieties of the invention may be considered to be regulatory sequences or elements to the extent they control translation of a gene of interest that is operably linked to the crRNA. The invention contemplates that the crRNA and taRNA of the invention may direct constitutive or inducible protein expression. Inducible protein expression may be controlled in a temporal or developmental manner.
(77) The term vector refers to a nucleic acid capable of mediating entry of, e.g., transferring, transporting, etc., a second nucleic acid molecule into a cell. The transferred nucleic acid is generally linked to, e.g., inserted into, the vector nucleic acid. A vector may include sequences that direct autonomous replication, or may include sequences sufficient to allow integration into host cell DNA. Useful vectors include, for example, plasmids (typically DNA molecules although RNA plasmids are also known), cosmids, and viral vectors.
(78) In the context of the invention, reporter proteins are typically used to visualize activation of the crRNA. Reporter proteins suitable for this purpose include but are not limited to fluorescent or chemiluminescent reporters (e.g., GFP variants, luciferase, e.g., luciferase derived from the firefly (Photinus pyralis) or the sea pansy (Renilla reniformis) and mutants thereof), enzymatic reporters (e.g., -galactosidase, alkaline phosphatase, DHFR, CAT), etc. The eGFPs are a class of proteins that has various substitutions (e.g., Thr, Ala, Gly) of the serine at position 65 (Ser65). The blue fluorescent proteins (BFP) have a mutation at position 66 (Tyr to His mutation) which alters emission and excitation properties. This Y66H mutation in BFP causes the spectra to be blue-shifted compared to the wtGFP. Cyan fluorescent proteins (CFP) have a Y66W mutation with excitation and emission spectra wavelengths between those of BFP and eGFP. Sapphire is a mutant with the suppressed excitation peak at 495 nM but still retaining an excitation peak at 395 and the emission peak at 511 nM. Yellow FP (YFP) mutants have an aromatic amino acid (e.g. Phe, Tyr, etc.) at position 203 and have red-shifted emission and excitation spectra.
(79) It is to be understood that although various embodiments of the invention are described in the context of RNA, the nucleic acids of the invention can be RNA or DNA. In general, RNA and DNA can be produced using in vitro systems, within cells, or by chemical synthesis using methods known in the art. It will be appreciated that insertion of crRNA elements upstream of an open reading frame (ORF) can be accomplished by modifying a nucleic acid comprising the ORF.
(80) The invention provides DNA templates for transcription of a crRNA or taRNA. The invention also provides DNA constructs and plasmids comprising such DNA templates. In certain embodiments, the invention provides a construct comprising the template for transcription of a crRNA or a taRNA operably linked to a promoter.
(81) In certain embodiments, the invention provides a DNA construct comprising (i) a template for transcription of a crRNA; and (ii) a promoter located upstream of the template. In certain embodiments, a construct or plasmid of the invention includes a restriction site downstream of the 3 end of the portion of the construct that serves as a template for the crRNA, to allow insertion of an ORF of choice. The construct may include part or all of a polylinker or multiple cloning site downstream of the portion that serves as a template for the crRNA. The construct may also include an ORF downstream of the crRNA.
(82) In certain embodiments, the invention provides a DNA construct comprising (i) a template for transcription of a taRNA; and (ii) a promoter located upstream of the template. The invention further provides a DNA construct comprising: (i) a template for transcription of a crRNA; (ii) a promoter located upstream of the template for transcription of the crRNA; (iii) a template for transcription of a taRNA; and (iv) a promoter located upstream of the template for transcription of the taRNA. The promoters may be the same or different.
(83) The constructs may be incorporated into plasmids, e.g., plasmids capable of replicating in bacteria. In certain embodiments, the plasmid is a high copy number plasmid (e.g., a pUC-based or pBR322-based plasmid), while in other embodiments, the plasmid is a low or medium copy number plasmid, as these terms are understood and known in the art. The plasmid may include any of a variety of origins of replication, which may provide different copy numbers. For example, any of the following may be used (copy numbers are listed in parenthesis): ColE1 (50-70 (high)), pl5A (20-30 (medium)), pSClO1 (10-12 (low)), pSOO1* (<4 (lowest). It may be desirable to use plasmids with different copy numbers for transcription of the crRNA and the taRNA in order to alter their relative amounts in a cell or system. In addition, in certain embodiments a tunable copy number plasmid is employed.
(84) The invention further provides viruses and cells comprising the nucleic acids, constructs (such as DNA constructs), and plasmids described above. In various embodiments, the cell is a prokaryotic cell. In various embodiments, the cell is a eukaryotic cell (e.g., a fungal cell, mammalian cell, insect cell, plant cell, etc.). The nucleic acids or constructs may be integrated into a viral genome using recombinant nucleic acid technology, and infectious virus particles comprising the nucleic acid molecules and/or templates for their transcription can be produced. The nucleic acid molecules, DNA constructs, plasmids, or viruses may be introduced into cells using any of a variety of methods known in the art, e.g., electroporation, calcium-phosphate mediated transfection, viral infection, etc.
(85) As discussed herein, the nucleic acid constructs can be integrated into the genome of a cell. Such cells may be present in vitro (e.g., in culture) or in vivo (e.g., in an organism). The invention further provides transgenic plants and non-human transgenic animals comprising the nucleic acids, DNA constructs, and/or plasmids of the invention. Methods for generating such transgenic organisms are known in the art.
(86) The invention further provides a variety of kits. For example, the invention provides a kit comprising a plasmid, wherein a first plasmid comprises (i) a template for transcription of a crRNA, and (ii) a promoter located upstream of the template for transcription of the crRNA element, and optionally a second plasmid that comprises (i) a template for transcription of a cognate (complementary) taRNA element, and (ii) a promoter located upstream of the template for transcription of the taRNA element. The promoters may be the same or, preferably, different. One or more of the promoters may be inducible. The plasmids may have the same or different copy numbers. The invention further provides a kit comprising a single plasmid that comprises a template for transcription of a crRNA element and a promoter located upstream of the template for transcription of the crRNA element and further comprises a template for transcription of a cognate taRNA element and a promoter located upstream of the template for transcription of the cognate taRNA element. In certain embodiments, the plasmids comprise one or more restriction sites upstream or downstream of the template for transcription of the crRNA element. If downstream, the restriction sites may be used for insertion of an open reading frame of choice. The kits may further include one or more of the following components: (i) one or more inducers; (ii) host cells (e.g., prokaryotic or eukaryotic host cells); (iii) one or more buffers; (iv) one or more enzymes, e.g., a restriction enzyme; (v) nucleic acid isolation and/or purification reagents; (vi) a control plasmid lacking a crRNA or taRNA sequence; (vii) a control plasmid containing a crRNA or taRNA sequence or both; (viii) sequencing primers; (ix) instructions for use. The control plasmids may comprise a reporter sequence.
(87) The riboregulators of the invention in some instances comprise a consensus prokaryotic RBS. However, in various embodiments of the invention any of a variety of alternative sequences may be used as the RBS. The sequences of a large number of bacterial ribosome binding sites have been determined, and the important features of these sequences are known. Preferred RBS sequences for high level translation contain a G-rich region at positions 6 to 11 with respect to the AUG and typically contain an A at position 3. Exemplary RBS sequences for use in the present invention include, but are not limited to, AGAGGAGA (or subsequences of this sequence, e.g., subsequences at least 6 nucleotides in length, such as AGGAGG). Shorter sequences are also acceptable, e.g., AGGA, AGGGAG, GAGGAG, etc. Numerous synthetic ribosome binding sites have been created, and their translation initiation activity has been tested. In various embodiments any naturally occurring RBS may be used in the crRNA constructs. The activity of any candidate sequence to function as an RBS may be tested using any suitable method. For example, expression may be measured as described in Example 1 of published PCT application WO 2004/046321, or as described in reference 53 of that published PCT application, e.g., by measuring the activity of a reporter protein encoded by an mRNA that contains the candidate RBS appropriately positioned upstream of the AUG. Preferably an RBS sequence for use in the invention supports translation at a level of at least 10% of the level at which the consensus RBS supports translation (e.g., as measured by the activity of a reporter protein). For example, if the candidate RBS is inserted into a control plasmid in place of the consensus RBS, the measured fluorescence will be at least 10% of that measured using the consensus RBS. In certain embodiments, an RBS that supports translation at a level of at least 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or more relative to the level at which the consensus RBS supports translation is used. In certain embodiments of the invention an RBS that supports translation at higher levels than the consensus RBS is used.
(88) Further general teachings relating to riboregulators are found in published PCT application WO 2004/046321, the entire contents of which are incorporated by reference herein.
(89) Advantages of Toehold and Beacon Riboregulators
(90) Riboregulators of the invention offer a number of benefits compared to existing techniques. For instance, quantitative real-time PCR (qRT-PCR) offers highly sensitive detection of RNA levels, northern blots exhibit high specificity, and microarrays enable simultaneous detection of thousands of targets. However, in all these techniques, cells must be sacrificed to obtain the RNA for quantitation and thus it is challenging to measure RNA levels in real time. Fluorescence in situ hybridization (FISH) and the use of fluorescent RNA aptamers enable visualization of RNA localization inside cells. FISH requires cells to be fixed for visualization and hybridization takes a number of hours using expensive probes. RNA aptamers can be used to image RNA in living cells; however, those aptamers with the highest fluorescence intensity still require copy numbers far exceeding those of endogenous RNAs in order to be detected in most optical microscopes. RNA levels can also be measured using a fluorescent reporter protein driven from the same promoter as the RNA target. The reporter in this method can reflect the level of RNA target, yet it cannot recapitulate regulatory behavior from chromosomal regions distant (e.g. multiple kilobases) from the promoter region. Furthermore, the presence of additional copies of the promoter can titrate RNA polymerase activity away from the target gene. Lastly, RNAs tagged with protein binding aptamers have also been used to measure localization and levels of RNAs inside cells using fusions of the binding protein with fluorescent protein reporters. This technique, however, requires chromosomal modifications to either tag or knockout the gene corresponding to the RNA to be visualized. The riboregulators of the invention are not encumbered by these various limitations of the prior art techniques.
EXAMPLES
Example 1
Toehold Riboregulator and Reporter Protein/GOI
(91) An exemplary riboregulator of
(92) The riboregulator was tested in E. coli BL21 DE3 star, an RNase E deficient strain that contained a lambda phage lysogen bearing T7 RNA polymerase under the control of the IPTG inducible lacUV5 promoter. crRNA and taRNA constructs were expressed from separate plasmids to enable rapid characterization of the interaction of the crRNA with cognate and non-cognate taRNA sequences. For both the crRNA and the taRNA, transcription was initiated from an upstream T7 promoter and transcription terminated using a T7 RNA polymerase termination signal. The crRNA-GFP transcripts were generated from a plasmid with a medium copy number colA origin, while the taRNAs transcripts were generated from a higher copy number plasmid with a colE1 origin. These variations in plasmid copy number led to an estimated 7-fold excess of taRNA compared to crRNAs inside fully-induced cells. This ratio is similar to previous studies and typical copy number differences observed for anti-sense RNAs and their targets.
(93) In vivo testing was performed in E. coli transformed with either a crRNA and its cognate taRNA target (ON state strains) or a crRNA and a non-cognate taRNA (OFF state strains) and grown overnight in 1 mL of selective LB media at 37 C. in deep well 96-well plates covered with a gas permeable seal. Transformation of E. coli with two plasmids in both ON and OFF state riboregulator conditions ensured that both strains were subject to similar metabolic loads, at least with respect to the number of exogenous RNAs that were being transcribed. Overnight cultures were diluted 100-fold and grown up for 80 minutes at 37 C. in the deep well plates. The early log phase cells were then induced with 0.1 mM of IPTG with aliquots taken at 1 hour time points for characterization via flow cytometry. For comparison of GFP fluorescence intensity between samples, the mode GFP intensity was calculated from fluorescence intensity histograms generate from flow cytometry data.
(94) As a first measure of riboregulator performance, the fluorescence intensity of the crRNA-GFP constructs was compared to the fluorescence from a non-cis-repressed GFP construct induced at the same level of IPTG in the same BL21 DE3 star E. coli strain. These measurements demonstrated extremely high levels of translational repression with six tested riboregulator crRNAs reducing fluorescence output by 99.5% or more (see
(95) The same measurements were performed in vivo on an additional 60 toehold riboregulator designs and the on/off ratios are displayed in
Example 2
Beacon Riboregulators
(96) Beacon riboregulators, such as those having a structure shown in
Example 3
Endogenous RNA Sensing
(97) The novel riboregulators described herein can be used for the detection of endogenous RNAs. As a proof of concept, a beacon riboregulator was designed and generated that could be triggered by the small RNA ryhB in E. coli. RyhB is a 90-nt long non-coding RNA that is upregulated when iron levels are low in E. coli. This RNA can be induced through the addition of the iron chelator 2,2-dipyridyl to the culture medium.
(98) To test this endogenous sensor, a plasmid was constructed that contained the beacon riboregulator upstream of a GFP reporter. Expression of the crRNA transcript was controlled using the IPTG-inducible PllacO-1 promoter. MG1655 E. coli cells transformed with the riboregulator sensor plasmid were induced with 1 mM IPTG in early log phase. At the same time, ryhB expression was induced through the addition of the iron chelator. Flow cytometry measurements taken from cells harvested after 2 hours demonstrated a five-fold increase in GFP fluorescence intensity for the ryhB containing cells compared to a control population that was not induced with 2,2-dipyridyl (
Example 4
Genetic Encoding of Complex OR Logic Operations Using Riboregulators
(99) We have used members of the riboregulator library to successfully carry out multiple logical OR operations in vivo. The simplest OR operation involves two inputs, A and B, that activate a logic gate if either of the inputs is present. We implemented this system in vivo simply by taking two high performance riboregulators and placing them one after the other along the same mRNA upstream of the coding sequence for GFP (
(100) Motivated by the successful implementation of the 2-input gate, we pursued a 6-input OR logic system featuring six crRNA modules placed upstream of GFP (
Example 5
Genetic Encoding of Complex AND Logic Operations Using Riboregulators
(101) We have developed generalizable systems for carrying out AND logic operations using toehold riboregulators.
(102) AND gates based on toehold riboregulators have been successfully extended to 6-bit operation. As shown in
Example 6
Riboregulator Toehold Repressors
(103) We constructed a library of 44 toehold repressors (devices/systems) and tested their function in E. coli BL21 Star DE3. We used flow cytometry to test the performance of the systems, calculating the mode GFP fluorescence from the switch in its OFF state (i.e., in the presence of its cognate trigger); and in its ON state (i.e., in the absence of its cognate trigger). We then calculated percent repression levels using the equation:
% repression=1[OFF state mode fluorescenceON state mode fluorescence].
(104)
Example 7
Toehold Switches
(105) As described herein, the invention provides a new class of post-transcriptional riboregulators of gene expression in called toehold switches that have no known natural counterparts. Toehold switches activate expression of a regulated gene in response to a trans-acting trigger RNA. Their operation in living cells is facilitated by two novel mechanisms: toehold-based linear-linear RNA interactions pioneered in in vitro studies and efficient translational repression via base pairing in regions surrounding the initiation codon. We demonstrate that toehold switches routinely enable modulation of protein expression by over 100 fold, with the best switches rivaling the dynamic range of protein-based regulators. We validate large sets of orthogonal components, including a library of 18 toehold switches exhibiting system cross talk levels below 2%, which constitutes the largest and most stringent family of orthogonal regulatory elements, protein or RNA based, ever reported. We then forward engineered a set of 13 toehold switches with an average on/off fluorescence ratio of 406. We further applied thermodynamic analyses to predict variations in system performance. Furthermore, we demonstrate a set of toehold switches that are capable of effective triggering from functional mRNA molecules. The high dynamic range, orthogonality, programmability, and versatility of these toehold switches suggest they will be powerful new tools for synthetic biology.
(106) Methods
(107) Strains, plasmids, and growth conditions. The following E. coli strains were used in this study: BL21 Star DE3 (F.sup. ompT hsdS.sub.B (r.sub.B.sup.m.sub.B.sup.) gal dcm rne131 (DE3); Invitrogen), BL21 DE3 (F.sup. ompT hsdS.sub.B (r.sub.B.sup.m.sub.B.sup.) gal dcm (DE3); Invitrogen), MG1655Pro (F.sup. .sup.ilvG-rfb-50 rph-1 Sp.sup.R lacR tetR), and DH5a (endA1 recA1 gyrA96 thi-1 glnV44 relA1 hsdR17(r.sub.K.sup.m.sub.K.sup.+) .sup.). All strains were grown in LB medium with appropriate antibiotics. Antibiotics were used at the following concentrations: ampicillin (50 g mL.sup.1), kanamycin (30 g mL.sup.1), and chloramphenicol (34 g mL.sup.1).
(108) To characterize the toehold switches, chemically competent E. coli were transformed with the desired combination of toehold switch and trigger plasmids, and spread onto LB/agar plates containing the appropriate pair of antibiotics. For colony GFP fluorescence measurements, LB/agar plates were supplemented with 0.1 mM isopropyl -D-1-thiogalactopyranoside (IPTG) to induce RNA expression. For flow cytometry measurements, LB medium containing antibiotics was inoculated with cells picked from individual colonies and incubated overnight with shaking at 37 C. Cells were then diluted 100-fold into fresh selective LB medium and returned to shaking at 37 C. in 96-well plates. For T7 RNA polymerase driven expression in BL21 Star DE3 and BL21 DE3, cells were induced with 0.1 mM IPTG at 0.2-0.3 OD600 after 80 minutes of growth. Unless otherwise noted, measurements on cell cultures were taken 3 hours after addition of IPTG. For expression using the constitutive PN25 promoter, overnight cultures were diluted 100-fold into selective LB media. The time of this dilution was defined as t=0 for subsequent measurements.
(109) Plasmid Construction.
(110) All DNA oligonucleotides were purchased from Integrated DNA Technologies, Inc. Double-stranded trigger and switch DNA was produced from either single >100-nt oligonucleotides amplified using universal primers or using gene assembly from short <50-nt oligonucleotides segmented using gene2oligo (Rouillard et al., Nucleic Acids Res 32:W176-180, 2004). These PCR products were then inserted into vector backbones using Gibson assembly with 30-bp overlap regions (Gibson et al., Nat. Methods 6:343-345, 2009). Vector backbones were PCR amplified using the universal backbone primers and digested prior to assembly using DpnI (New England Biolabs, Inc.). Backbones were generated from the T7-based expression plasmids pET15b, pCOLADuet, and pACYCDuet (EMD Millipore). pET15b, pCOLADuet, and pACYCDuet plasmids all contain a constitutively expressed lad gene, a T7 RNA polymerase promoter and terminator pair, and the following respective resistance markers/replication origins: ampicillin/ColE1, kanamycin/ColA, and chloramphenicol/P15A. All trigger RNAs presented herein were expressed using pET15b backbones, and the switch mRNAs were expressed using either pCOLADuet or pACYCDuet backbones. Reverse primers for the backbones were designed to bind to the region upstream of the T7 promoter. Forward primers for trigger backbones amplified from the beginning of the T7 promoter. Forward primers for the switch backbones were designed to prime off the 5 end of either GFPmut3b-ASV or mCherry and add a 30-nt sequence containing the linker for Gibson assembly. Constructs were cloned inside DH5a and sequenced to ensure all toehold switch components were synthesized correctly. All transformations were performed using established chemical transformation protocols (Inoue et al., Gene, 96:23-28, 1990).
(111) Flow Cytometry Measurements and Analysis.
(112) Flow cytometry was performed using a BD LSRFortessa cell analyzer equipped with a high throughput sampler. GFP fluorescence intensities were measured using 488 nm excitation laser and a 530/30 nm filter. mCherry fluorescence intensities were measured using a 561 nm laser and a 610/20 nm emission filter. In a typical experiment, cells were diluted by a factor of 65 into phosphate buffered saline (PBS) and sampled from 96-well plates. Forward scatter (FSC) was used for trigger and 30,000 individual cells analyzed.
(113) Error levels for the fluorescence measurements of on state and off state cells were calculated from the standard deviation of measurements from at least three biological replicates. The relative error levels for the on/off fluorescence ratios were then determined by adding the relative errors of on and off state fluorescence in quadrature. For measurements of in vivo system cross talk, single colonies of each of the 676 strains of transformed cells were measured using flow cytometry. To estimate colony-to-colony variations in GFP output for these strains, we measured a randomly selected subset of 18 transformants and measured them in sextuplicate. The relative uncertainties for these measurements was 12% on average, which is comparable to uncertainties obtained for flow cytometry experiments used for determining on/off fluorescence ratios for library components.
(114) Colony Fluorescence Imaging.
(115) Images of fluorescence from E. coli colonies were obtained using a Typhoon FLA 9000 biomolecular imaging system. All images were obtained using the same PMT voltage, an imaging resolution of 0.1 mm, 473 nm laser excitation, and an LPB (>510 nm long pass) filter for detection of GFP. Induced cells were imaged 18 hours after they were plated. Since IPTG exhibits low-level fluorescence in the same channel as GFP, variations in the thickness of the LB/agar in the plates result in variations in background fluorescence levels. To compensate for this effect, the minimum GFP intensity measured over each plate was subtracted from the intensity levels of the entire plate, thereby removing most background IPTG fluorescence.
(116) Results
(117) Provided herein is a new system of riboregulators that enable post-transcriptional activation of protein translation. Unlike conventional riboregulators, the synthetic riboregulators of the invention take advantage of toehold-mediated linear-linear interactions to initiate RNA-RNA strand displacement interactions. Furthermore, they rely on sequestration of the region around the start codon to repress protein translation, eschewing any base pairing to the RBS or start codon itself to frustrate translation. As a result, these riboregulators can be designed to activate protein translation in response to a trigger RNA with virtually arbitrary sequence, enabling substantial improvements in component orthogonality. The absence of binding to the RBS and use of thermodynamically favorable linear-linear interactions also enables facile tuning of translational efficiency via RBS engineering. Consequently, these systems routinely enable modulation of protein expression over two orders of magnitude. Based on their interaction mechanism near-digital signal processing behavior, these riboregulator systems are referred to herein as toehold switches.
(118) This disclosure further demonstrates the utility of toehold switches by validating dozens of translational activators in E. coli that increase protein production by more than 100-fold in response to a prescribed trigger RNA. Furthermore, we capitalize on the expanded RNA sequence space afforded by the novel riboregulator design to construct libraries of components with unprecedented part orthogonality, including a set of 26 systems that exhibit less than 12% cross talk across the entire set, which exceeds the size of all previous orthogonal regulator libraries by a factor of more than 3. Sequence and thermodynamic analyses of the toehold switches yield a set of design principles that can be used to forward engineer new riboregulators. These forward engineered parts on average exhibit on/off ratios exceeding 400, a dynamic range typically reserved for protein-based genetic networks using components constructed from a purely rational design framework.
(119) Toehold Switch Design.
(120) The toehold switch systems are composed of two programmed RNA strands referred to as the switch and trigger (
(121) The hairpin processing unit functions as a repressor of translation in the absence of the trigger strand. Unlike previous riboregulators, the RBS sequence is left completely unpaired within the 11-nt loop of the hairpin. Instead, the bases immediately before and after the initiation codon are sequestered within RNA duplexes that are six and nine base pairs long, respectively. The start codon itself is left unpaired in the switches we tested, leaving a 3-nt bulge near the midpoint of the 18-nt hairpin stem. Since the repressing domain b (
(122) From this base toehold switch design, we used the NUPACK nucleic acid sequence design package (Zadeh et al., J. Comput. Chem. 32:170-173, 2011) to generate a library of translational activators. A common 21-nt sequence was used to link the hairpin module of the switch mRNAs to the coding sequence of the gene of interest. This linker sequence was programmed to encode low molecular weight amino acids to minimize its effect on folding of the gene of interest, which was selected in this case to be a GFP reporter. To reduce computational load, only the first 29-nts of GFP were considered for secondary structure analysis. The complete trigger transcript, however, was simulated during the design process. This transcript included a GGG leader sequence to promote efficient transcription from the T7 RNA polymerase promoter, a 5 hairpin domain to increase RNA stability, and the 47-nt T7 RNA polymerase terminator at the 3 end of the transcript. NUPACK was used to generate toehold switch designs satisfying the prescribed secondary structures and having the specified RBS and terminator sequences. Unspecified bases in the designs were random and thus allowed to become any of the four RNA bases, with some sequence constraints applied to NUPACK to preclude extended runs of the same bases. We initially designed a set of 24 toehold switches to gauge in vivo performance and constructed them as described in the Methods section. After confirming that a number of these switches exhibited high dynamic range, we began to design an extended library of toehold switches containing elements selected for low crosstalk with the rest of the library.
(123) To generate this library, a total of 672 toehold switch designs with randomized sequences were generated using NUPACK. Of the resulting designs, 25 were found to encode stop codons in the hairpin region after the start codon. In the remaining systems, one duplicate design was found leaving 646 unique riboregulator designs in the library.
(124) We next selected a subset of 144 of these toehold switch designs for testing in E. coli that exhibited the lowest levels of unintended riboregulator-trigger cross talk. In silico screening for cross talk served two purposes. First, the resulting library of orthogonal regulators could provide a large set of components to independently regulate translation in vivo. Second, systems screened for orthogonality would necessarily span a large portion of the sequence space of possible toehold switches and inform future system designs. We simulated pairwise interactions between riboregulator and trigger strands for the complete set of 646 corresponding to 417,316 RNA-RNA interactions. These simulations determined the concentration of any resulting riboregulator-trigger complexes and their secondary structures. The integrity of the toehold switch stem in these riboregulator-trigger complexes was used to determine the likelihood of unintended trigger activation, since the destruction of the duplex regions nearby the start codon would lead to translation of the gene of interest. Through this stem integrity metric, we used a Monte Carlo algorithm to select 144 toehold switch designs with the predicted lowest net system cross talk. This resulted in a toehold switch library composed of 168 different components with random sequences subject to the same secondary structure constraints.
(125) Component Validation.
(126) The toehold switches were tested in E. coli BL21 Star DE3 with the switch mRNA expressed off a medium copy plasmid (ColA origin) and the trigger RNA expressed from a high copy plasmid (ColE1 origin). Expression of both strands was induced using IPTG, which triggered production of both RNA species through T7 RNA polymerase. To enable quantitative assessment of switch performance, we used an ASV-tagged GFPmut3b with a reported half-life of 110 min (Andersen et al., Appl. Environ. Microbiol. 64:2240-2246, 1998) as a fluorescent reporter. In these experimental conditions, the copy number differences in the plasmids expressing switch and trigger RNAs led to a 6-8 fold excess of trigger compared to switch molecules as determined by fluorescence measurements of GFPmut3b-ASV expressed separately from each plasmid.
(127) Flow cytometry was used to characterize the performance of the toehold switches. Cells were measured at one-hour intervals after induction with IPTG. ON fluorescence was measured for cells transformed with the riboregulator and its cognate trigger, while OFF fluorescence was determined from cells containing the riboregulator and a randomly selected non-cognate trigger. Fluorescence histograms from both activated and repressed toehold switches are almost exclusively unimodal, highlighting their potential use in cellular digital logic (data not shown). The mode fluorescence value from the histograms was used to calculate the on/off ratios of each riboregulator design.
(128) Activation of the systems was observed within one hour of induction and increased over time with accumulation of GFP (
(129) Evaluation of Toehold Switch Orthogonality.
(130) To evaluate the orthogonality of the translational activators, we selected the top 35 riboregulators from the 144 orthogonal component library and performed additional in silico screening to isolate a subset of 26 that displayed extremely low levels of cross talk, both in terms of stem integrity and unwanted binding between non-cognate trigger and switch strands. The pairwise interactions between the 26 riboregulators were then assayed in E. coli by transforming cells with all 676 combinations of riboregulator and trigger plasmids.
(131) To gain quantitative information, we used flow cytometry to measure the GFP output from all pairwise trigger-switch interactions. Crosstalk was calculated by dividing the GFP fluorescence obtained from a non-cognate trigger and a given switch mRNA by the fluorescence of the switch in its triggered state. The resulting matrix of crosstalk interactions is shown in
(132) When choosing toehold switches for a given application, a potentially more relevant metric for assessing their performance is the reciprocal of the threshold crosstalk level. For translational activators, this parameter represents the minimum fold change to expect between when using the set of switches to regulate a protein with similar output characteristics to our GFPmut3b-ASV reporter.
(133) Component Analysis and Forward Engineering.
(134) Flow cytometry data from the toehold switches provided a substantial dataset with which to determine sequence-dependent variations in riboregulator performance. As a coarse screen for sequence-dependent effects, we began to investigate toehold switch output as a function of base pairing at the top and bottom in the stem of the riboregulator strand (
(135) The bias toward low G-C content at the top of the riboregulator stem suggested potential interaction between the bound ribosome and the nearby RNA duplex in the activated riboregulator-trigger complex. In particular, weak base pairing at the end of the RNA duplex could allow the duplex to breathe open, spontaneously freeing bases upstream of the RBS to facilitate ribosome binding. To investigate this effect, we studied a series of riboregulators with different hairpin loop sizes to tune the size of the pre-RBS region (
(136) Previous riboregulators have been designed on a case-by-case basis (Isaacs et al., Nat. Biotechnol. 22:841-847, 2004; and Callura et al., Proc. Natl. Acad. Sci. USA 109:5850-5855, 2012) and those that have utilized computer-assisted design have not demonstrated consistently high on/off levels (Rodrigo et al., Proc. Natl. Acad. Sci. USA 109:15271-15276, 2012). In silico designed riboregulators forward engineered to exhibit high performance in vivo have the potential to significantly reduce the time required for generating new genetic circuits, in turn enabling the realization of more complex cellular logic. Consequently, we integrated the above findings into designs for a set of toehold switches forward engineered for high dynamic range. Our forward engineered systems retain the same general secondary structure and interaction mechanisms of the library of 168 toehold switches, but adopt several of the insights described above to significantly improve their dynamic range. First, we incorporated the combination of switch mRNA sequence constraints revealed in
(137) We employed NUPACK to design 13 forward engineered toehold switches with the four system modifications detailed above.
(138) We quantified the effectiveness of our forward engineering strategy by calculating the percentage of forward engineered designs with on/off ratios exceeding a given minimal level and comparing them to the same calculation performed on the library of 168 toehold switches with random sequences (
(139) Thermodynamic Analysis of System Performance.
(140) Our forward engineering resulted in riboregulators with 92% likelihood of high dynamic range. To develop a predictive model of riboregulator activity, on/off ratios of the 168 initial switches with random sequences were analyzed in terms of a number of thermodynamic parameters falling into six different categories (
(141) Based on the sequence-dependent effects observed in
(142) Having identified the importance of GRBS-linker, we proceeded to investigate its relationship with on/off levels from the forward engineered systems. We found that GRBS-linker exhibited a much stronger correlation with on/off levels, yielding R.sup.2=0.79 (
(143) Multiplexed Regulation.
(144) The orthogonality of the toehold switches can enable them to independently regulate multiple proteins simultaneously within the cell. To demonstrate this capability, we transformed cells with plasmids expressing two orthogonal toehold switch mRNAs expressing spectrally distinct fluorescent proteins GFP and mCherry, denoted A* and B*, respectively (
(145) Toehold Switches Triggered by Functional mRNAs.
(146) The sequence space afforded by the toehold switch design enables them to be triggered by functional mRNAs (
(147) We incorporated all the design features discussed above to generate toehold switches that were responsive to mRNAs. The switch hairpin modules were derived from the toehold switch number 1 sequence. Specifically, the top 12-bases and loop of the switch number 1 stem were used in all mRNA sensors (
(148) The resulting mRNA sensors were tested in the same manner as previous experiments, with the trigger mRNA expressed from a high copy ColE1 origin vector and toehold switches regulating GFP expressed from a medium copy ColA origin vector. We selected a trio of exogenous mRNA triggers, mCherry, chloramphenicol acetyltransferase (cat, conferring chloramphenicol resistance), and aadA (conferring spectinomycin resistance), for sensing experiments to minimize the likelihood of switch activation by endogenous RNAs. The mCherry trigger RNA featured an RBS region to enable efficient translation, while the two antibiotic resistance conferring mRNAs lacked an RBS, as translation by the ribosome could interfere with recognition and binding of the toehold switch.
(149) To establish the effect of toehold switch binding to translation from the trigger mRNA, we also performed experiments measuring mCherry output in the presence or absence of the mCherry sensor.
(150) Discussion
(151) Toehold switches represent a versatile and powerful new platform for regulating translation at the post-transcriptional level. They combine an unprecedented degree of component orthogonality with system dynamic range comparable to widely used protein-based regulatory elements22. Comprehensive evaluation of in vivo switch-trigger pairwise interactions resulted in a set of 26 toehold switches with sub-12% cross talk levels. To our knowledge, this represents the largest library of orthogonal regulatory elements ever reported and exceeds previous libraries by a factor of over three in size (Takahashi et al., Nucleic Acids Res., 2013). At this point, the ultimate size of the orthogonal sets of toehold switches is limited by the throughput of our cross talk assay, not design features intrinsic to the riboregulators. Furthermore, forward engineering of 13 toehold switch systems yielded a subset of 12 new high performance components that exhibited an average on/off fluorescence ratio of 406, with the performance of the complete set predicted by a two parameter thermodynamic model.
(152) Crucial to these advances was the adoption of new mechanisms for translational repression and initiation of RNA-RNA interactions in vivo. Toehold switches strongly repress translation in their off state by sequestering the sequences nearby the initiation codon of the regulated gene within RNA duplexes, in contrast to previous riboregulators that repress by blocking access to the RBS and in some cases the start codon (Isaacs et al., Nat. Biotechnol. 22:841-847, 2004; Rodrigo et al., Proc. Natl. Acad. Sci. USA 109:15271-15276, 2012; and Mutalik et al., Nat. Chem. Biol. 8:447-454, 2012). While earlier riboregulators have relied on loop-linear (Isaacs et al., Nat. Biotechnol. 22:841-847, 2004; and Mutalik et al., Nat. Chem. Biol. 8:447-454, 2012) and loop-loop (Lucks et al., Proc. Natl. Acad. Sci. USA 108:8617-8622, 2011; Rodrigo et al., Proc. Natl. Acad. Sci. USA 109:15271-15276, 2012; and Takahashi et al., Nucleic Acids Res. 2013) interactions, toehold switches exploit toehold-mediated linear-linear RNA interactions to initiate binding between the riboregulator mRNA and trigger RNA. Taken together, these operating mechanisms enable the toehold switches to accept trigger RNAs with nearly arbitrary sequences, greatly expanding the sequence space for orthogonal operation, and they promote RNA-RNA interactions with high reaction kinetics by using extended toehold domains 12- to 15-nts in length. In contrast to earlier reports, thermodynamic analyses of toehold switch performance did not reveal significant correlations between riboregulator on/off levels and the free energy of the riboregulator-trigger interaction nor the free energy of toehold-trigger binding Mutalik et al., Nat. Chem. Biol. 8:447-454, 2012). These observations suggest that RNA-RNA interactions for the toehold switches are strongly thermodynamically and kinetically favoured.
(153) We attribute the increased dynamic range of our toehold switches to three main factors. First, the increased kinetics and thermodynamic free energy driving trigger-switch interaction causes a higher percentage of the total switch mRNAs present in the cell to be triggered to produce the output produce. We found that the fraction of activated switch mRNAs was around 100% based on comparison measurements with unrepressed versions of the switch mRNA (
(154) Sequences for various riboregulators described herein:
(155) TABLE-US-00001 TABLE1 Sequenceandperformanceinformationforcertain toeholdswitchesandtriggersfromtheinitial setof24randomsequencetoeholdswitches. Toehold switch number Switchsequence Triggersequence On/off 4 GGGAAUUGAUAUUGUGAUUAUGU GGGACAUACGGACUCACGUGUC 264.6 19.9 GAUGAUUGUAAACAGAGGAGAUA CGUAUGUCAAUACAAUCAUCAC CAAUAUGCACAUAAUCAACCUGG AUAAUCACAAUAUCAAUUACU CGGCAGCGCAAAAGAUGCGUAAA (SEQIDNO:2) (SEQIDNO:1) 10 GGGAAUUGAUAUUGUUCGUUUCG GGGACAUACGGACUCACGUGUC 192.4 26.9 UAUGAUCUAAGACAGAGGAGAUU CGUAUGUAACUUAGAUCAUACG AGAUAUGACGAAACGAAACCUGG AAACGAACAAUAUCAAUUACU CGGCAGCGCAAAAGAUGCGUAAA (SEQIDNO:4) (SEQIDNO:3) 14 GGGAAUUGAUAUUGUAGUAUGUU GGGACAUACGGACUCACGUGUC 153.4 10.1 GAAGUGAUUGAACAGAGGAGACA CGUAUGUCAGCAAUCACUUCAA AUCAAUGCAACAUACUAACCUGG CAUACUACAAUAUCAAUUACU CGGCAGCGCAAAAGAUGCGUAAA (SEQIDNO:6) (SEQIDNO:5)
(156) TABLE-US-00002 TABLE2 Sequenceandperformanceinformationforcertaintoeholdswitchesand triggersfromthesetof144orthogonalrandomsequencetoeholdswitches. Toehold switch number Switchsequence Triggersequence On/off 1 GGGUGAAUGAAUUGUAGGCUUGU GGGACCGUGGACCGCAUGAGGU 292.0 19.5 UAUAGUUAUGAACAGAGGAGACA CCACGGUAAACAUAACUAUAAC UAACAUGAACAAGCCUAACCUGG AAGCCUACAAUUCAUUCAAAC CGGCAGCGCAAAAGAUGCGUAAA (SEQIDNO:8) (SEQIDNO:7) 2 GGGUAUAAGUAAAUCGCUUGCUG GGGAUGCCCGUAGUUCAUUCUA 279.6 17.6 UAUGUCGUUAAACAGAGGAGAUA CGGGCAUGAAUAACGACAUACA ACGAAUGACAGCAAGCAACCUGG GCAAGCGAUUUACUUAUACUA CGGCAGCGCAAAAGAUGCGUAAA (SEQIDNO:10) (SEQIDNO:9) 3 GGGUGAUGGAAUAAGGCUGUGUA GGGUCAGUUCCUGAGGUACCAG 265.3 28.2 UAUGAUGUUAGACAGAGGAGAUA GAACUGAAACUAACAUCAUAUA ACAUAUGAUACACAGCAACCUGG CACAGCCUUAUUCCAUCACAC CGGCAGCGCAAAAGAUGCGUAAA (SEQIDNO:12) (SEQIDNO:11) 5 GGGUAGAUAUUGAAUGCUGCUGU GGGACGCGAAAUGCUAUUCCAU 253.0 12.5 UAUGUCGUUAAACAGAGGAGAUA UUCGCGUGACUAACGACAUAAC ACGAAUGAACAGCAGCAACCUGG AGCAGCAUUCAAUAUCUAAAC CGGCAGCGCAAAAGAUGCGUAAA (SEQIDNO:14) (SEQIDNO:13) 6 GGGAUAAGUAGAUAAGAUUGUUA GGGUCGUGCGCUCUGAGCCGAG 219.8 16.5 GAUGGCUUCGAACAGAGGAGACG CGCACGAGAACGAAGCCAUCUA AAGCAUGCUAACAAUCAACCUGG ACAAUCUUAUCUACUUAUCAC CGGCAGCGCAAAAGAUGCGUAAA (SEQIDNO:16) (SEQIDNO:15) 7 GGGAUCACUUAUUGUCGUCUUUG GGGACGUCGAUUCACCGUCGAA 213.3 28.3 UAUGUCUGUAAACAGAGGAGAUA UCGACGUAGAUACAGACAUACA CAGAAUGACAAAGACGAACCUGG AAGACGACAAUAAGUGAUAGA CGGCAGCGCAAAAGAUGCGUAAA (SEQIDNO:18) (SEQIDNO:17) 8 GGGACAAAGAUUGGUCGUUUCAU GGGACUCCAGGCGGAAUAACGC 200.8 13.5 UACCGUUAGAAACAGAGGAGAUC CUGGAGUAAAUCUAACGGUAAU UAACAUGAAUGAAACGAACCUGG GAAACGACCAAUCUUUGUAUG CGGCAGCGCAAAAGAUGCGUAAA (SEQIDNO:20) (SEQIDNO:19) 9 GGGCGAAAGUGUAUGGCUGAUAU GGGUCGCACGGUUCCGCCUAAC 194.4 31.3 GAUGUAGUUAAACAGAGGAGAUA CGUGCGAGAAUAACUACAUCAU ACUAAUGCAUAUCAGCAACCUGG AUCAGCCAUACACUUUCGAAC CGGCAGCGCAAAAGAUGCGUAAA (SEQIDNO:22) (SEQIDNO:21) 11 GGGUAAGAUUUGAUGGCUAUUUG GGGACCAUUCGCCCUACUUGGC 181.2 13.0 UACGUGUUCGAACAGAGGAGACG GAAUGGUAAGCGAACACGUACA AACAAUGACAAAUAGCAACCUGG AAUAGCCAUCAAAUCUUAACU CGGCAGCGCAAAAGAUGCGUAAA (SEQIDNO:24) (SEQIDNO:23) 12 GGGAAUUGGAUGAAGGCGGUAAG GGGUCCAGUCUAGACUGACCUA 169.9 16.7 UAUGAUUGUAGACAGAGGAGAUA GACUGGACAAUACAAUCAUACU CAAUAUGACUUACCGCAACCUGG UACCGCCUUCAUCCAAUUACU CGGCAGCGCAAAAGAUGCGUAAA (SEQIDNO:26) (SEQIDNO:25) 13 GGGUAGAAUUUGAUACUUGAUUU GGGUCUAAUGCGAGUAAAGUCG 155.3 8.6 GAUGGCUUGAAACAGAGGAGAUC CAUUAGAAUAUCAAGCCAUCAA AAGCAUGCAAAUCAAGAACCUGG AUCAAGUAUCAAAUUCUAAAG CGGCAGCGCAAAAGAUGCGUAAA (SEQIDNO:28) (SEQIDNO:27) 15 GGGCGUUAUACUUUGUCGUUCUG GGGACUGAGGUACCUCGAAGUA 124.7 11.0 CGUGUCGUUAAACAGAGGAGAUA CCUCAGUAGAUAACGACACGCA ACGAAUGGCAGAACGAAACCUGG GAACGACAAAGUAUAACGAAA CGGCAGCGCAAAAGAUGCGUAAA (SEQIDNO:30) (SEQIDNO:29) 16 GGGUAAGAAUGAUAAAGGUAAGU GGGCCAUGACUCCUAAUUCGGA 123.2 23.0 AGUGAGUUGAAACAGAGGAGAUC GUCAUGGAAAUCAACUCACUAC AACUAUGUACUUACCUAACCUGG UUACCUUUAUCAUUCUUACUU CGGCAGCGCAAAAGAUGCGUAAA (SEQIDNO:32) (SEQIDNO:31) 17 GGGCGAUAAAGACUGAGGCUGGG GGGCCUCGACGUUCGUGAUAAC 122.6 0.8 UAUGGUUAGAAACAGAGGAGAUC GUCGAGGCAAUCUAACCAUACC UAACAUGACCCAGCCUAACCUGG CAGCCUCAGUCUUUAUCGCAA CGGCAGCGCAAAAGAUGCGUAAA (SEQIDNO:34) (SEQIDNO:33) 18 GGGAUAGAUGAUUGUGCUUAGUU GGGACAUCCUAAGUUGACUCUU 115.1 7.9 UAUGAUUCUGAACAGAGGAGACA AGGAUGUAAACAGAAUCAUAAA GAAUAUGAAACUAAGCAACCUGG CUAAGCACAAUCAUCUAUACA CGGCAGCGCAAAAGAUGCGUAAA (SEQIDNO:36) (SEQIDNO:35) 19 GGGAUAAUGAUGAUGAGUAUGUU GGGUCGUGUGAUGCUAUCUCAU 103.5 10.5 GAAGGUGUAAGACAGAGGAGAUU CACACGACAAUUACACCUUCAA ACACAUGCAACAUACUAACCUGG CAUACUCAUCAUCAUUAUCAC CGGCAGCGCAAAAGAUGCGUAAA (SEQIDNO:38) (SEQIDNO:37) 20 GGGCGUUAAUCUCUGGCUUGCUU GGGUCAUGACUGGGACACGCCA 101.9 8.4 UAUGUCUGUAAACAGAGGAGAUA GUCAUGAGAAUACAGACAUAAA CAGAAUGAAAGCAAGCAACCUGG GCAAGCCAGAGAUUAACGAAG CGGCAGCGCAAAAGAUGCGUAAA (SEQIDNO:40) (SEQIDNO:39) 21 GGGUAAAGAUGAAACGCGUGAAU GGGUCACCUCCAGGCACGACUG 86.6 14.5 GAUAGUAUUGAACAGAGGAGACA GAGGUGAAUACAAUACUAUCAU AUACAUGCAUUCACGCAACCUGG UCACGCGUUUCAUCUUUACUU CGGCAGCGCAAAAGAUGCGUAAA (SEQIDNO:42) (SEQIDNO:41) 22 GGGCAUUAAGAUUGUACUUGUAA GGGACCUAGCGGAGCGCAGUCC 83.1 2.0 GAUCGUGUCGAACAGAGGAGACG GCUAGGUAAACGACACGAUCUU ACACAUGCUUACAAGUAACCUGG ACAAGUACAAUCUUAAUGAAA CGGCAGCGCAAAAGAUGCGUAAA (SEQIDNO:44) (SEQIDNO:43) 23 GGGUAUGAAUUGAUGUCGAUUGU GGGACCCGACCGCGUCCUGGCG 75.2 4.9 UAUGUCUUGAGACAGAGGAGAUC GUCGGGUAAAUCAAGACAUAAC AAGAAUGAACAAUCGAAACCUGG AAUCGACAUCAAUUCAUACUA CGGCAGCGCAAAAGAUGCGUAAA (SEQIDNO:46) (SEQIDNO:45) 24 GGGUAAAGAUGAGAACGCUUGUG GGGUCGGGACACGGGCAUACGU 74.8 13.0 AAUGAUGUGAAACAGAGGAGAUC GUCCCGACAAUCACAUCAUUCA ACAUAUGUCACAAGCGAACCUGG CAAGCGUUCUCAUCUUUACUU CGGCAGCGCAAAAGAUGCGUAAA (SEQIDNO:48) (SEQIDNO:47) 25 GGGUGAUAGAUGAAGGCAGGCGU GGGUCGUGGGCCUGCCUAAAGG 72.6 3.7 UAUAGUUUAGAACAGAGGAGACU CCCACGAGAACUAAACUAUAAC AAACAUGAACGCCUGCAACCUGG GCCUGCCUUCAUCUAUCAAAC CGGCAGCGCAAAAGAUGCGUAAA (SEQIDNO:50) (SEQIDNO:49) 26 GGGUAAGUAAUGAAGUCUAAGUG GGGACGAACUUGAUCAAAUUCA 68.2 10.3 UAUCGUGUCGGACAGAGGAGACG AGUUCGUAAACGACACGAUACA ACACAUGACACUUAGAAACCUGG CUUAGACUUCAUUACUUACAU CGGCAGCGCAAAAGAUGCGUAAA (SEQIDNO:52) (SEQIDNO:51) 27 GGGAUAGAAUUAGAAAUGAAAUA GGGUCGCUUGUACUCUUGCGUA 67.3 10.7 GAUGGUUACGAACAGAGGAGACG CAAGCGAAAGCGUAACCAUCUA UAACAUGCUAUUUCAUAACCUGG UUUCAUUUCUAAUUCUAUCUA CGGCAGCGCAAAAGAUGCGUAAA (SEQIDNO:54) (SEQIDNO:53) 28 GGGAUAGAAAUUGAUCGUUAGUU GGGUAUCUACUCGACUUCGCGA 66.9 8.0 UAUGUUGCCGGACAGAGGAGACG GUAGAUAAAGCGGCAACAUAAA GCAAAUGAAACUAACGAACCUGG CUAACGAUCAAUUUCUAUAAC CGGCAGCGCAAAAGAUGCGUAAA (SEQIDNO:56) (SEQIDNO:55) 29 GGGAGUUUGAAUAUGGCGAAAUG GGGACGAGAGCUCCUAGCAGAG 63.1 6.6 AAUGCUUUGAAACAGAGGAGAUC CUCUCGUAUAUCAAAGCAUUCA AAAGAUGUCAUUUCGCAACCUGG UUUCGCCAUAUUCAAACUAAC CGGCAGCGCAAAAGAUGCGUAAA (SEQIDNO:58) (SEQIDNO:57) 30 GGGUAAAGAUGAUAAGAUGUGAG GGGCACGACUAGAAACCGAUCU 63.0 5.6 UAAGGUAGUAAACAGAGGAGAUA AGUCGUGCAAUACUACCUUACU CUACAUGACUCACAUCAACCUGG CACAUCUUAUCAUCUUUACUU CGGCAGCGCAAAAGAUGCGUAAA (SEQIDNO:60) (SEQIDNO:59) 31 GGGAUCUAAAUGUAUUCGUUCGU GGGCGUCGCUGUUCGGGUAAAC 62.0 62 UAUGGUAUUGAACAGAGGAGACA AGCGACGGAACAAUACCAUAAC AUACAUGAACGAACGAAACCUGG GAACGAAUACAUUUAGAUACU CGGCAGCGCAAAAGAUGCGUAAA (SEQIDNO:62) (SEQIDNO:61) 32 GGGUCAAUUUCGUAUUAGUAUGU GGGACUCGGUCUCUAUGUCGAG 59.4 7.6 UAUGGUUCUGAACAGAGGAGACA ACCGAGUAAACAGAACCAUAAC GAACAUGAACAUACUAAACCUGG AUACUAAUACGAAAUUGAAGC CGGCAGCGCAAAAGAUGCGUAAA (SEQIDNO:64) (SEQIDNO:63) 33 GGGAAUUUGGAAGUAGAGUAGUA GGGCAGAGCGGUCUGUUUCGAC 58.5 9.6 GAUAGUUAUGAACAGAGGAGACA CGCUCUGAAACAUAACUAUCUA UAACAUGCUACUACUCAACCUGG CUACUCUACUUCCAAAUUCUA CGGCAGCGCAAAAGAUGCGUAAA (SEQIDNO:66) (SEQIDNO:65) 34 GGGAGUAAUGAUGAUAUAGUUUG GGGACCGUCACCCUACAUCGGG 57.1 5.0 AAUGUAGUGAAACAGAGGAGAUC UGACGGUAAAUCACUACAUUCA ACUAAUGUCAAACUAUAACCUGG AACUAUAUCAUCAUUACUAAC CGGCAGCGCAAAAGAUGCGUAAA (SEQIDNO:68) (SEQIDNO:67) 35 GGGAUAAUGGAGAUGGAGUAGGG GGGCCUAGAAACUGUACGAAGU 53.9 4.5 UAUGAUUGUAGACAGAGGAGAUA UUCUAGGCAUUACAAUCAUACC CAAUAUGACCCUACUCAACCUGG CUACUCCAUCUCCAUUAUCUU CGGCAGCGCAAAAGAUGCGUAAA (SEQIDNO:70) (SEQIDNO:69) 36 GGGAUGAAUAUGGACAGUUGAGU GGGAGUCAGGACCGCAUCAGGU 53.4 6.7 AGUGAUGUGAAACAGAGGAGAUC CCUGACUAAAUCACAUCACUAC ACAUAUGUACUCAACUAACCUGG UCAACUGUCCAUAUUCAUCUU CGGCAGCGCAAAAGAUGCGUAAA (SEQIDNO:72) (SEQIDNO:71) 37 GGGAUGGAGAUUGAUUAUGAUUG GGGUCGACCGCUCCUGCUCGAG 52.7 1.8 GAUGUGCUUAAACAGAGGAGAUA CGGUCGACAAUAAGCACAUCCA AGCAAUGCCAAUCAUAAACCUGG AUCAUAAUCAAUCUCCAUAAC CGGCAGCGCAAAAGAUGCGUAAA (SEQIDNO:74) (SEQIDNO:73) 38 GGGAGUAAGAAUUGUGAUAAAGU GGGUCACGGAGCGGAUUUGCGC 51.0 4.5 AAUGUGCGUGAACAGAGGAGACA UCCGUGAGAACACGCACAUUAC CGCAAUGUACUUUAUCAACCUGG UUUAUCACAAUUCUUACUUCA CGGCAGCGCAAAAGAUGCGUAAA (SEQIDNO:76) (SEQIDNO:75)
(157) TABLE-US-00003 TABLE3 Sequenceandperformanceinformationforthesetof forwardengineeredtoeholdswitches. Toehold switch number Switchsequence Triggersequence On/off 1 GGGUCUUAUCUUAUCUAUCUCGUUU GGGACUGACUAUUCUGUGCAAU 665 135 AUCCCUGCAUACAGAAACAGAGGAG AGUCAGUAAAGCAGGGAUAAAC AUAUGCAAUGAUAAACGAGAACCUG GAGAUAGAUAAGAUAAGAUAG GCGGCAGCGCAAAAGAUGCGUAAA (SEQIDNO:78) (SEQIDNO:77) 2 GGGAGUUUGAUUACAUUGUCGUUUA GGGACAGAUCCACUGAGGCGUG 586 92 GUUUAGUGAUACAUAAACAGAGGAG GAUCUGUGAACACUAAACUAAA AUAUCACAUGACUAAACGAAACCUG CGACAAUGUAAUCAAACUAAC GCGGCAGCGCAAAAGAUGCGUAAA (SEQIDNO:80) (SEQIDNO:79) 3 GGGAUCUAUUACUACUUACCAUUGU GGGUGAUGGGACAUUCCGAUGU 557 68 CUUGCUCUAUACAGAAACAGAGGAG CCCAUCAAUAAGAGCAAGACAA AUAUAGAAUGAGACAAUGGAACCUG UGGUAAGUAGUAAUAGAUAAG GCGGCAGCGCAAAAGAUGCGUAAA (SEQIDNO:82) (SEQIDNO:81) 4 GGGCGAUUAUGGAUUAGAGCUCCGU GGGACGAAUUCACCCUAAUGUG 483 40 UUACUGUCAUACAAGAACAGAGGAG AAUUCGUAAAGACAGUAAACGG AUAUGACAUGAAACGGAGCAACCUG AGCUCUAAUCCAUAAUCGAAC GCGGCAGCGCAAAAGAUGCGUAAA (SEQIDNO:84) (SEQIDNO:83) 5 GGGUAUGUAAUUGAUUUGGCUUCUG GGGUCCAUUCUAGGUGAUACUA 453 119 UUAGUUUCAUACAAGAACAGAGGAG GAAUGGAGCAGAAACUAACAGA AUAUGAAAUGAACAGAAGCAACCUG AGCCAAAUCAAUUACAUACUA GCGGCAGCGCAAAAGAUGCGUAAA (SEQIDNO:86) (SEQIDNO:85) 6 GGGCUUAAUCUUACCUUCGCUUGUU GGGACAAUCGGGACGACACUCC 409 62 CUGUUCCGAUACAGAAACAGAGGAG CGAUUGUGAACGGAACAGAACA AUAUCGGAUGAGAACAAGCAACCUG AGCGAAGGUAAGAUUAAGGUA GCGGCAGCGCAAAAGAUGCGUAAA (SEQIDNO:88) (SEQIDNO:87) 7 GGGUCACUUAAUCAUUUGUCGUCGU GGGUCGAGUAGACAGAGCUGUC 403 99 UUCUAUCUAUACAAGAACAGAGGAG UACUCGAAUAAGAUAGAAACGA AUAUAGAAUGAAACGACGAAACCUG CGACAAAUGAUUAAGUGAGAA GCGGCAGCGCAAAAGAUGCGUAAA (SEQIDNO:90) (SEQIDNO:89) 8 GGGACCUCUACUUACUCUCACUCUU GGGACUGAGCUGCUAUCACGCA 393 41 ACUUCUGCAUAGUAGAACAGAGGAG GCUCAGUAGAGCAGAAGUAAGA AUAUGCAAUGGUAAGAGUGAACCUG GUGAGAGUAAGUAGAGGUAGA GCGGCAGCGCAAAAGAUGCGUAAA (SEQIDNO:92) (SEQIDNO:91) 9 GGGCUUACUACUUUGACACCUGAUU GGGUCAAUUACCCGUGGUAGGG 381 32 CUGACACGAUAACAGAACAGAGGAG UAAUUGAAAGCGUGUCAGAAUC AUAUCGUAUGAGAAUCAGGAACCUG AGGUGUCAAAGUAGUAAGUAG GCGGCAGCGCAAAAGAUGCGUAAA (SEQIDNO:94) (SEQIDNO:93) 10 GGGAAUGGAAUGAAUGAACUGCUUG GGGCGAAGUGUCCGUAUGAGGA 343 64 UCUUAUGUAUACAGAAACAGAGGAG CACUUCGACGACAUAAGACAAG AUAUACAAUGGACAAGCAGAACCUG CAGUUCAUUCAUUCCAUUUAG GCGGCAGCGCAAAAGAUGCGUAAA (SEQIDNO:96) (SEQIDNO:95) 11 GGGCGAAUAGAAAUGAAGGCUAGUG GGGACUCCACGCCGACCGUGGC 292 40 UCGUUGUCAUACAGAAACAGAGGAG GUGGAGUAAAGACAACGACACU AUAUGACAUGGACACUAGCAACCUG AGCCUUCAUUUCUAUUCGAUU GCGGCAGCGCAAAAGAUGCGUAAA (SEQIDNO:98) (SEQIDNO:97) 12 GGGCAAUUUCGUAUAUGUUCGUCUU GGGCGACGAUGCCAGGUAUGGC 288 19 UGCUGUUCAUACAAGAACAGAGGAG AUCGUCGGACGAACAGCAAAGA AUAUGAAAUGCAAAGACGAAACCUG CGAACAUAUACGAAAUUGAAA GCGGCAGCGCAAAAGAUGCGUAAA (SEQIDNO:100) (SEQIDNO:99) 13 GGGAUGGAAUUGAGAUGGGCUUUCG GGGUGCGGUAGUAGGUUCCUAC 33 3 CGAGAUUGAUACAGAAACAGAGGAG UACCGCAAUACAAUCUCGCGAA AUAUCAAAUGCGCGAAAGCAACCUG AGCCCAUCUCAAUUCCAUACU GCGGCAGCGCAAAAGAUGCGUAAA (SEQIDNO:102) (SEQIDNO:101)
EQUIVALENTS
(158) While several inventive embodiments have been described and illustrated herein, those of ordinary skill in the art will readily envision a variety of other means and/or structures for performing the function and/or obtaining the results and/or one or more of the advantages described herein, and each of such variations and/or modifications is deemed to be within the scope of the inventive embodiments described herein. More generally, those skilled in the art will readily appreciate that all parameters, dimensions, materials, and configurations described herein are meant to be exemplary and that the actual parameters, dimensions, materials, and/or configurations will depend upon the specific application or applications for which the inventive teachings is/are used. Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific inventive embodiments described herein. It is, therefore, to be understood that the foregoing embodiments are presented by way of example only and that, within the scope of the appended claims and equivalents thereto, inventive embodiments may be practiced otherwise than as specifically described and claimed. Inventive embodiments of the present disclosure are directed to each individual feature, system, article, material, kit, and/or method described herein. In addition, any combination of two or more such features, systems, articles, materials, kits, and/or methods, if such features, systems, articles, materials, kits, and/or methods are not mutually inconsistent, is included within the inventive scope of the present disclosure.
(159) All definitions, as defined and used herein, should be understood to control over dictionary definitions, definitions in documents incorporated by reference, and/or ordinary meanings of the defined terms.
(160) All references, patents and patent applications disclosed herein are incorporated by reference with respect to the subject matter for which each is cited, which in some cases may encompass the entirety of the document.
(161) The indefinite articles a and an, as used herein in the specification and in the claims, unless clearly indicated to the contrary, should be understood to mean at least one.
(162) The phrase and/or, as used herein in the specification and in the claims, should be understood to mean either or both of the elements so conjoined, i.e., elements that are conjunctively present in some cases and disjunctively present in other cases. Multiple elements listed with and/or should be construed in the same fashion, i.e., one or more of the elements so conjoined. Other elements may optionally be present other than the elements specifically identified by the and/or clause, whether related or unrelated to those elements specifically identified. Thus, as a non-limiting example, a reference to A and/or B, when used in conjunction with open-ended language such as comprising can refer, in one embodiment, to A only (optionally including elements other than B); in another embodiment, to B only (optionally including elements other than A); in yet another embodiment, to both A and B (optionally including other elements); etc.
(163) As used herein in the specification and in the claims, or should be understood to have the same meaning as and/or as defined above. For example, when separating items in a list, or or and/or shall be interpreted as being inclusive, i.e., the inclusion of at least one, but also including more than one, of a number or list of elements, and, optionally, additional unlisted items. Only terms clearly indicated to the contrary, such as only one of or exactly one of, or, when used in the claims, consisting of, will refer to the inclusion of exactly one element of a number or list of elements. In general, the term or as used herein shall only be interpreted as indicating exclusive alternatives (i.e. one or the other but not both) when preceded by terms of exclusivity, such as either, one of, only one of, or exactly one of. Consisting essentially of, when used in the claims, shall have its ordinary meaning as used in the field of patent law.
(164) As used herein in the specification and in the claims, the phrase at least one, in reference to a list of one or more elements, should be understood to mean at least one element selected from any one or more of the elements in the list of elements, but not necessarily including at least one of each and every element specifically listed within the list of elements and not excluding any combinations of elements in the list of elements. This definition also allows that elements may optionally be present other than the elements specifically identified within the list of elements to which the phrase at least one refers, whether related or unrelated to those elements specifically identified. Thus, as a non-limiting example, at least one of A and B (or, equivalently, at least one of A or B, or, equivalently at least one of A and/or B) can refer, in one embodiment, to at least one, optionally including more than one, A, with no B present (and optionally including elements other than B); in another embodiment, to at least one, optionally including more than one, B, with no A present (and optionally including elements other than A); in yet another embodiment, to at least one, optionally including more than one, A, and at least one, optionally including more than one, B (and optionally including other elements); etc.
(165) It should also be understood that, unless clearly indicated to the contrary, in any methods claimed herein that include more than one step or act, the order of the steps or acts of the method is not necessarily limited to the order in which the steps or acts of the method are recited.
(166) In the claims, as well as in the specification above, all transitional phrases such as comprising, including, carrying, having, containing, involving, holding, composed of, and the like are to be understood to be open-ended, i.e., to mean including but not limited to. Only the transitional phrases consisting of and consisting essentially of shall be closed or semi-closed transitional phrases, respectively, as set forth in the United States Patent Office Manual of Patent Examining Procedures, Section 2111.03.