SPLICE SWITCHING OLIGOMERS FOR TNF SUPERFAMILY RECEPTORS AND THEIR USE IN TREATMENT OF DISEASE

20170015697 ยท 2017-01-19

    Inventors

    Cpc classification

    International classification

    Abstract

    The present invention relates to compositions and methods for preparing splice variants of TNFalpha receptor (TNFR) in vivo or in vitro, and the resulting TNFR protein variants. Such variants may be prepared by controlling the splicing of pre-mRNA molecules and regulating protein expression with splice switching oligonucleotides or splice switching oligomers (SSOs). The preferred SSOs according to the invention target exon 7 or 8 of TNFR1 (TNFRSF1A) or TNFR2 (TNFRSF1A) pre-mRNA, typically resulting in the production of TNFR variants which comprise a deletion in part or the entire exon 7 or 8 respectfully. SSOs targeting exon 7 are found to result in a soluble form of the TNFR, which has therapeutic benefit for treatment of inflammatory diseases. The SSO's are characterized in that they are substantially incapable or incapable of recruiting RNaseH.

    Claims

    1. An oligomer of between 8 and 50 nucleobases in length, comprising of a contiguous nucleobase sequence which consists of between 8 and 50 nucleobases in length, wherein said contiguous nucleobase sequence is complementary to a corresponding region of contiguous nucleotides present in SEQ ID NO 1 or SEQ ID NO 2, SEQ ID NO 3, SEQ ID NO 4 and wherein said contiguous nucleobase sequence does not comprise 5 or more contiguous DNA (2-deoxyribosnucleoside) monomer units.

    2.-64. (canceled)

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0039] The following figures are identical to those described in PCT/US2006/043651 (FIGS. 1-20) and PCT/US2007/10557 (FIGS. 21-39), although reference numbers have been re-arranged accordingly. FIG. 40 is new to the present application.

    [0040] FIG. 1 depicts the structure of a portion of the tumor necrosis factor receptor pre-mRNA and spliced products for TNFR1 and TNFR2. These transcripts normally contain exon 7 and exon 8, which code for the transmembrane domain of the receptors. SSOs (bars) directed towards either or both of these exons elicit alternative splicing events, resulting in transcripts that lack the full transmembrane domain.

    [0041] FIG. 2 shows the splicing products of SSOs for murine TNFR1 in cell culture. NIH-3T3 cells were mock transfected [Lipofectamine 2000 (LFA2000 Only)] or transfected with the indicated concentration of either an exon 7 skipping TNFR1 SSO, A7-5 or A7-10, alone or a combination of exon 7 skipping SSO and an exon 8 skipping SSO, A8-3. Total RNA was isolated and RT-PCR performed 24 hours later. The PCR primers were used to amplify from Exon 5 to Exon 9, so that Full Length TNFR1 is represented by a 475 bp band. Transcripts lacking exon 7 (Delta Exon 7) and lacking both exon 7 and exon 8 (Delta Exon 7/8) are represented by 361 bp and 332 bp bands, respectively.

    [0042] FIG. 3 shows the splicing products of SSOs for murine TNFR2 in cell culture. NIH-3T3 cells were mock transfected (LFA2000 Only) or transfected with the indicated concentration of either an exon 7 skipping TNFR2 SSO, B7-6 or B7-1, alone or a combination of exon 7 skipping oligonucleotide and an exon 8 skipping oligonucleotide, B 8-4. Total RNA was isolated and RT-PCR performed 24 hours later. The PCR primers were used to amplify from Exon 5 to Exon 9, so that Full Length TNFR2 is represented by a 486 bp band. Transcripts lacking exon 7 (Delta Exon 7) and lacking both exon 7 and exon 8 (Delta Exon 7/8) are represented by 408 bp and 373 bp bands, respectively.

    [0043] FIGS. 4A and 4B present the sequences of exons 7 (4A) and 8 (4B) of murine TNFR1 and of the flanking introns. Also shown are the sequences of 2 O-Me-oligoribonucleoside-phosphorothioate SSOs that were assayed for splice switching activity.

    [0044] FIGS. 5A and 5B present the sequences of exons 7 (5A) and 8 (5B) of murine TNFR2 and of the flanking introns. Also shown are the sequences of 2 O-Me-oligoribonucleoside-phosphorothioate SSOs that were assayed for splice switching activity.

    [0045] FIG. 6 provides an alignment of the human and murine TNF receptor genes in the regions that encode the transmembrane exons. The murine sequences, SEQ ID Nos: 107, 108, 109, and 110, are homologous to the human sequences, SEQ ID Nos: 1, 2, 3, and 4, respectively.

    [0046] FIG. 7 shows the splicing products of SSOs for primary mouse hepatocyte cultures, in assays conducted as described in FIGS. 2 and 3.

    [0047] FIGS. 8A, 8B-1, 8B-2, 8C, 8D-1, and 8D-2 provide mouse and human TNFR2 (TNFRSF1B) (8A and 8B) and TNFR1 (TNFRSF1A) (8C and 8D) LNA SSO sequences from Tables 2 and 3. FIGS. 8A and 8C schematically illustrate the position of each SSO relative to the targeted exon. FIGS. 8B and 8D show the pre-mRNA sequence (5 to 3) and the SSOs (3 to 5) hybridized to it.

    [0048] FIG. 9 shows the splicing products for L929 murine cells treated with LNA SSOs. Cells were transfected with the indicated LNA SSO at a final concentration of 50 nM. After 24 hours, the cells were lysed and analyzed for splice switching by RT-PCR. Top panel, SSOs targeted to exon 7; bottom panel, SSOs targeted to exon 8. FL5 full length TNFR2 amplicon; Delta7, Delta8, Delta7/8, amplicons of the respective TNFR2 splice variants.

    [0049] FIG. 10 shows the splicing products for L929 murine cells using LNA SSO combinations targeted to TNFR2. L929 cells were treated with the indicated single or multiple LNA SSOs at 50 nM each and analyzed 24 hours later as described in FIG. 9.

    [0050] FIG. 11 the splicing products for L929 murine cells using LNA SSO combinations targeted to TNFR1. L929 cells were treated with the indicated single or multiple LNA SSOs at 50 nM each and analyzed 24 hours later as described in FIG. 9.

    [0051] FIG. 12 shows the splicing products for primary mouse hepatocytes treated with LNA SSOs. Primary mouse hepatocytes were transfected with 33 nM each final concentration of the indicated single or multiple LNA SSOs and analyzed as described in FIG. 9.

    [0052] FIG. 13 graphically illustrates detection of secreted TNFR2 splice variants from L929 cells (left) and primary mouse hepatocytes (right). Cells were transfected with the indicated LNA SSOs. After 72 hours, the extracellular media was removed and analyzed by enzyme linked immunosorbant assay (ELISA) using antibodies from the Quantikine Mouse sTNF RII ELISA kit from R and D Systems (Minneapolis, Minn.). The data are expressed as pg soluble TNFR2 per mL.

    [0053] FIG. 14 shows the splicing products for primary human hepatocytes treated with LNA SSOs targeted to TNFR2. Primary human hepatocytes were transfected with the indicated LNA SSO and analyzed for splice switching by RT-PCR after 24 hours as described in FIG. 9. The PCR primers were used to amplify from Exon 5 to Exon 9, so that Full Length (FL) TNFR2 is represented by a 463 bp band. Transcripts lacking exon 7 (Delta Exon 7), lacking exon 8 (Delta Exon 8), and lacking both exon 7 and exon 8 (Delta exon 7/8) are represented by 385 bp, 428 bp, and 350 bp bands, respectively.

    [0054] FIG. 15 shows the splicing products for intraperitoneal (i.p.) injection of LNA 3274 (top) and 3305 (bottom) in mice. LNA 3274 was injected i.p. at 25 mg/kg/day for either 4 days (4/1 and 4/10) or 10 days (10/1). Mice were sacrificed either 1 day (4/1 and 10/1) or 10 (4/10) days after the last injection and total RNA from liver was analyzed for splice switching of TNFR2 by RT-PCR. LNA 3305 was injected at the indicated dose per day for 4 days. Mice were sacrificed the next day and the livers analyzed as with 3274 treated animals.

    [0055] FIG. 16 (top panel) graphically illustrates the amount of soluble TNFR2 in mouse serum 10 days after SSO treatment. Mice were injected i.p. with the indicated SSO or saline (n=5 per group) at 25 mg/kg/day for 10 days. Serum collected 4 days before injections began and the indicated number of days after the last injection. Sera was analyzed by ELISA as described in FIG. 13. At day 10, mice were sacrificed and livers were analyzed for TNFR2 splice switching by RT-PCR (bottom panel) as described in FIG. 9.

    [0056] FIG. 17 graphically illustrates the amount of soluble TNFR1 in the serum after TNFR2 SSO treatment. Mouse serum from FIG. 16 was analyzed for soluble TNFR1 by ELISA using antibodies from the Quantikine Mouse sTNF RI ELISA kit from R and D Systems (Minneapolis, Minn.).

    [0057] FIG. 18 (top panel) graphically illustrates the amount of soluble TNFR2 in mouse serum 27 days after SSO treatment. Mice were treated as in FIG. 16, except that serum samples were collected until day 27 after the last injection. LNA 3083 and 3272 are control SSOs with no TNFR2 splice switching ability. At day 27, mice were sacrificed and livers were analyzed for TNFR2 splice switching by RT-PCR (bottom panel) as described in FIG. 9.

    [0058] FIG. 19 graphically depicts the anti-TNF-alpha activity in serum from LNA oligonucleotide-treated mice. L929 cells were treated with either 0.1 ng/mL TNF-alpha (TNF), or TNF-alpha plus 10% serum from mice treated with the indicated oligonucleotide (see also FIG. 18). Cell viability was measured 24 hours later and normalized to untreated cells (Untreated).

    [0059] FIG. 20 graphically compares the anti-TNF-alpha activity of serum from LNA oligonucleotide-treated mice to recombinant soluble TNFR2 (rsTNFR2) and to that of Enbrel using the cell survival assay described in FIG. 19.

    [0060] FIG. 21 schematically depicts the human TNFR2 structure. Relevant exons and introns are represented by boxes and lines, respectively. The signal sequence and the transmembrane region are shaded. Residues that form the boundaries of the signal sequence, the transmembrane region, and the final residue are indicated below the diagram. Exon boundaries are indicated above the diagram; if the 3 end of an exon and the 5 end of the following exon have the same residue number, then the splice junction is located within the codon encoding that residue.

    [0061] FIG. 22A graphically illustrates the amount of soluble TNFR2 from SSO treated primary human hepatocytes. The indicated SSO was transfected into primary human hepatocytes at 50 nM. After 48 hrs, the extracellular media was analyzed by enzyme linked immunosorbant assay (ELISA) for soluble TNFR2 using the Quantikine Human sTNF RII ELISA kit from R&D Systems (Minneapolis, Minn.). Error bars represent the standard deviation for 3 independent experiments.

    [0062] FIG. 22B Total RNA was analyzed for TNFR2 splice switching by RT-PCR using primers specific for human TNFR2. SSOs targeted to exon seven led to shifting from full length TNFR2 mRNA (FL) to TNFR2 7 mRNA (7). SSO 3083 is a control SSO with no TNFR2 splice switching ability.

    [0063] FIG. 23 shows the splicing products of L929 cells treated with SSO 10-mers targeted to mouse TNFR2 exon 7. L929 cells were transfected with the indicated SSO concentration (50 or 100 nM), and evaluated for splice switching of TNFR2 by RT-PCR 24 hrs later. PCR primers were used to amplify from Exon 5 to Exon 9, so that Full Length (FL) TNFR2 is represented by a 486 bp band. Transcripts lacking exon 7 (7) is represented by a 408 bp band.

    [0064] FIGS. 24A and 24B show the splicing products of mice treated with SSO 10-mers targeted to mouse TNFR2 exon 7. The indicated SSOs were resuspended in saline, and injected i.p. into mice at 25 mg/kg/day for 5 days. Mice were prebled before SSO injection, and 10 days after the final SSO injection and sacrificed. At the time of sacrifice, total RNA from livers was analyzed for TNFR2 splice switching by RT-PCR. FLfull length TNFR2; 7TNFR2 7 (FIG. 24A). The concentration of TNFR2 7 in the serum taken before (Pre) and after (Post) SSO injection was determined by ELISA using the Quantikine Mouse sTNF RII ELISA kit from R&D Systems (Minneapolis, Minn.) (FIG. 24B). Error bars represent the standard error from 3 independent readings of the same sample.

    [0065] FIG. 25 depicts the splice switching ability of SSOs of different lengths. Primary human hepatocytes were transfected with the indicated SSO and TNFR2 expression analyzed by RT-PCR (top panel) and ELISA (bottom panel) as in FIG. 2. Error bars represent the standard deviation from 2 independent experiments.

    [0066] FIGS. 26A and 26B illustrate TNFR2 7 mRNA induction in the livers of SSO treated mice. FIG. 26A: Total RNA from the livers of SSO 3274 treated mice were subjected to RT-PCR, and the products visualized on a 1.5% agarose gel. The sequence of the exon 6exon 8 junction is shown in FIG. 26B.

    [0067] FIGS. 27A and 27B illustrate TNFR2 7 mRNA induction in SSO treated primary human hepatocytes. FIG. 27A: Total RNA from SSO 3379 treated cells were subjected to RT-PCR, and the products visualized on a 1.5% agarose gel. The sequence of the exon 6exon 8 junction is shown in FIG. 27B.

    [0068] FIGS. 28A and 28B illustrate the dose dependence of TNFR2 pre-mRNA splicing shifting by SSO 3378, 3379 and 3384. Primary human hepatocytes were transfected with 1-150 nM of the indicated SSO. After 48 hrs, the cells were harvested for total RNA, and the extracellular media was collected. FIG. 28A: Total RNA was analyzed for TNFR2 splice switching by RT-PCR using primers specific for human TNFR2. For each SSO, amount of splice switching is plotted as a function of SSO concentration. FIG. 28B: The concentration of soluble TNFR2 in the extracellular media was determined by ELISA and plotted as a function of SSO. Error bars represent the standard deviation for at least 2 independent experiments.

    [0069] FIG. 29 graphically illustrates detection of secreted TNFR2 splice variants from L929 cells. Cells were transfected with the indicated SSOs. After 72 hrs, the extracellular media was removed and analyzed by ELISA. The data are expressed as pg soluble TNFR2 per mL.

    [0070] FIG. 30 shows the splicing products for intraperitoneal (i.p.) injection of SSO 3274 (top) and 3305 (bottom) in mice. SSO 3274 was injected i.p. at 25 mg/kg/day for either 4 days (4/1 and 4/10) or 10 days (10/1). Mice were sacrificed either 1 day (4/1 and 10/1) or 10 days (4/10) after the last injection and total RNA from liver was analyzed by RT-PCR for TNFR2 splice switching. SSO 3305 was injected at the indicated dose per day for 4 days. Mice were sacrificed the next day and the livers analyzed as with 3274 treated animals.

    [0071] FIGS. 31A and 31B graphically illustrates the amount of soluble TNFR2 in mouse serum 10 days after SSO treatment. Mice were injected i.p. with the indicated SSO or saline (n=5 per group) at 25 mg/kg/day for 10 days. Serum was collected 4 days before injections began and on the indicated days after the last injection. Sera was analyzed by ELISA as described in FIG. 22 At day 10, mice were sacrificed and livers were analyzed for TNFR2 splice switching by RT-PCR (FIG. 31B) as described in FIG. 30.

    [0072] FIGS. 32A and 32B graphically illustrates the amount of soluble TNFR2 in mouse serum 27 days after SSO treatment. Mice were treated as described in FIG. 31, except that serum samples were collected until day 27 after the last injection. SSOs 3083 and 3272 are control SSOs with no TNFR2 splice switching ability. At day 27, mice were sacrificed and livers were analyzed for TNFR2 splice switching by RT-PCR (FIG. 32B) as described in FIG. 31.

    [0073] FIGS. 33A and 33B graphically depict the anti-TNF- activity in a cell-based assay using serum from SSO treated mice, where serum samples were collected 5 days (FIG. 26A) and 27 days (FIG. 26B) after SSO treatment. L929 cells were treated with either 0.1 ng/mL TNF-, or TNF- plus 10% serum from mice treated with the indicated SSO. Cell viability was measured 24 hrs later and normalized to untreated cells.

    [0074] FIG. 34 graphically compares the anti-TNF- activity of serum from the indicated SSO oligonucleotide-treated mice to recombinant soluble TNFR2 (rsTNFR2) extracellular domain from Sigma and to Enbrel using the cell survival assay described in FIG. 33.

    [0075] FIGS. 35A and 35B compare the stability of muTNFR2 7 protein (FIG. 35A) and mRNA (FIG. 35B). Mice were injected at 25 mg/kg/day daily with either SSO 3272, SSO 3274 or SSO 3305 (n=5). Mice were bled on the indicated day after the last injection and the serum TNFR2 concentration was measured. Total RNA from mice sacrificed on the indicated day after the last injection of SSO was subjected to RT-PCR as described in FIG. 30.

    [0076] FIG. 36 plots TNFR2 7 protein (dashed line) and mRNA (solid line) levels over time, as a percentage of the amount of protein or mRNA, respectively, 10 days after the last injection.

    [0077] FIG. 37 graphically illustrates the dose dependant anti-TNF- activity of TNFR2 7 expressed in HeLa cells after transfection with TNFR2 7 mammalian expression plasmids. HeLa cells were transfected with the indicated mouse or human TNFR2 7 plasmid and extracellular media was collected after 48 hrs. The TNFR2 7 concentration in the media was determined by ELISA and serial dilutions were prepared. These dilutions were assayed for anti-TNF- activity by the L929 cytoxicity assay as in Figure. 34.

    [0078] FIGS. 38A and 38B shows expressed mouse (A) and human (B) TNFR2 D7 protein isolated by polyacrylamide gel electrophoresis (PAGE). HeLa cells were transfected with the indicated plasmid. After 48 hrs, the extracellular media was collected and concentrated, and cells were collected in RIPA lysis buffer. The proteins in the samples were separated by PAGE and a western blot was performed using a C-terminal TNFR2 primary antibody (Abcam) that recognizes both the human and mouse TNFR2 D7 proteins. Media, extracellular media samples from HeLa cells transfected with the indicated plasmid; Lysate, cell lysate from Hela cells transfected with the indicated plasmid. CM, control media from untransfected HeLa cells; CL, control cell lysates from untransfected HeLa cells. +, molecular weight markers (kDal).

    [0079] FIG. 39 shows purified His-tagged human and mouse TNFR2 D7. Unconcentrated extracellular media containing the indicated TNFR2 D7 protein was prepared as in FIG. 38. Approximately 32 mL of the media was applied to a 1 mL HisPur cobalt spin column (Pierce), and bound proteins were eluted in 1 mL buffer containing 150 mM imidazole. Samples of each were analyzed by PAGE and western blot was performed as in FIG. 38. The multiple bands in lanes 1144-4 and 1319-1 represent variably glycosylated forms of TNFR2 D7.

    [0080] FIGS. 40A, 40B, 40C and 40D shows Alignment of oligomer motifs according to the invention compared against their target sequenceSEQ ID NO 1 (FIG. 40A), SEQ ID NO 2 (FIG. 40B), SEQ ID NO 3 (FIG. 40C), and SEQ ID NO 4 (FIG. 40D).

    DETAILED DESCRIPTION OF THE INVENTION

    [0081] The present invention provides compositions and methods for controlling expression of TNF receptors (TNFR1 and TNFR2) and of other cytokine receptors from the TNFR superfamily by controlling the splicing of pre-mRNA that code for the said receptors. More specifically, the invention causes the increased expression of the secreted form and the decreased expression of the integral-membrane form. Furthermore, the invention can be used in the treatment of diseases associated with excessive cytokine activity.

    [0082] The exon or exons that are present in the integral membrane form mRNA but are removed from the primary transcript (the pre-mRNA) to make a secreted form mRNA are termed the transmembrane exons. The invention involves nucleic acids and nucleic acid analogs that are complementary to either of the transmembrane exons and/or adjacent introns of a receptor pre-mRNA. Complementarity can be based on sequences in the sequence of pre-mRNA that spans the splice site, which would include, but is not limited to, complementarity based on sequences that span the exon-intron junction, or complementarity can be based solely on the sequence of the intron, or complementarity can be based solely on the sequence of the exon.

    [0083] There are several alternative chemistries available and known to those skilled in the art. One important feature is the ability to hybridize to a target RNA without causing degradation of the target by RNase H as do 2-deoxy oligonucleotides (antisense oligonucleotides hereafter ASON). For clarity, such compounds will be termed splice-switching oligomers (SSOs). Those skilled in the art appreciate that SSO include, but are not limited to, 2 O-modified oligonucleotides and ribonucleosidephosphorothioates as well as peptide nucleic acids and other polymers lacking ribofuranosyl-based linkages.

    [0084] One embodiment of the invention is a method of treating an inflammatory disease or condition by administering SSOs to a patient or a live subject. The SSOs that are administered alter the splicing of a pre-mRNA to produce a splice variant that encodes a stable, secreted, ligand-binding form of a receptor of the TNFR superfamily, thereby decreasing the activity of the ligand for that receptor. In another embodiment, the invention is a method of producing a stable, secreted, ligand-binding form of a receptor of the TNFR superfamily in a cell by administering SSOs to the cell.

    [0085] One embodiment of the invention is a protein, either full length or mature, which can bind TNF, is encoded by a cDNA derived from a mammalian TNFR gene, and in the cDNA exon 6 is followed directly by exon 8 and as a result lacks exon 7 (TNFR 7). In another embodiment, the invention is a pharmaceutical composition comprising a TNFR 7. In a further embodiment, the invention is a method of treating an inflammatory disease or condition by administering a pharmaceutical composition comprising a TNFR 7.

    [0086] In yet another embodiment, the invention is a nucleic acid that encodes a TNFR 7. In a further embodiment, the invention is a pharmaceutical composition comprising a nucleic acid that encodes a TNFR 7.

    [0087] In another embodiment, the invention is an expression vector comprising a nucleic acid that encodes a TNFR 7. In a further embodiment, the invention is a method of increasing the level of a soluble TNFR in the serum of a mammal by transforming cells of the mammal with an expression vector comprising a nucleic acid that encodes a TNFR 7.

    [0088] In another embodiment, the invention is a cell transformed with an expression vector comprising a nucleic acid that encodes a TNFR 7. In a further embodiment, the invention is a method of producing a TNFR 7 by culturing, under conditions suitable to express the TNFR 7, a cell transformed with an expression vector comprising a nucleic acid that encodes a TNFR 7. In yet another embodiment, the invention is a method of treating an inflammatory disease or condition by administering an expression vector comprising a nucleic acid that encodes a TNFR 7.

    [0089] In yet another embodiment, splice-switching oligomers (SSOs) are disclosed that alter the splicing of a mammalian TNFR2 pre-mRNA to produce a mammalian TNFR2 protein, which can bind TNF and where exon 6 is followed directly by exon 8 and as a result lacks exon 7 (TNFR2 7). One embodiment of the invention is a method of treating an inflammatory disease or condition by administering SSOs to a patient or a live subject. The SSOs that are administered alter the splicing of a mammalian TNFR2 pre-mRNA to produce a TNFR2 7. In another embodiment, the invention is a method of producing a TNFR2 7 in a cell by administering SSOs to the cell.

    [0090] The foregoing and other objects and aspects of the present invention are discussed in detail in the drawings herein and the specification set forth below.

    The Oligomer

    [0091] In one embodiment the oligomer consists of the contiguous nucleobase sequence.

    [0092] However, it is also envisaged that the oligomer may comprise of other nucleobase sequence which typically flank the contiguous nucleobase sequence at either the 5 or 3 end or further nucleobase sequence at both the 5 and 3 ends. Suitably these 5 and or 3 flanking regions may be 1, 2, 3, 4, 5, or 6 nucleobases in length. DNA or RNA nucleobases which are at the termini of the oligomer of the invention are expected to be cleaved from the oligomer when used in vivo by endogenous exo-nucleasesas such the inclusion of flanking DNA or RNA units may not affect the in vivo performance of the oligomer.

    [0093] In one embodiment, the 3 end of the contiguous nucleobase sequence is flanked by 1, 2 or 3 DNA or RNA units. 3, DNA units are frequently used during solid state synthesis of oligomers.

    [0094] In one embodiment, the 5 end of the contiguous nucleobase sequence is flanked by 1, 2 or 3 DNA or RNA units.

    [0095] In one embodiment the invention provides an oligomer of between 8 and 50 nucleobases in length, comprising of a contiguous nucleobase sequence which consists of between 8 and 50 nucleobases in length, wherein said contiguous nucleobase sequence is complementary to a corresponding region of contiguous nucleotides present in SEQ ID NO 1 or SEQ ID NO 2, SEQ ID NO 3, or SEQ ID NO 4 (i.e. said contiguous nucleobase sequence is present in a region (correspondingor part of) of contiguous nucleotides present in SEQ ID NO 247 or SEQ ID NO 248, SEQ ID NO 249, or SEQ ID NO 250) and wherein said contiguous nucleobase sequence does not comprise 5 or more contiguous DNA (2-deoxyribosnucleoside) monomer units.

    [0096] In one embodiment the oligomer is essentially incapable of recruiting RNAseH when formed in a duplex with a complex with a complementary mRNA molecule.

    [0097] In one embodiment, the nucleotide analogues (X) are independently selected form the group consisting of: 2-O-alkyl-RNA unit, 2-OMe-RNA unit, 2 MOE RNA unit, 2-amino-DNA unit, 2-fluoro-DNA unit, LNA unit, PNA unit, HNA unit, INA unit.

    [0098] In one embodiment, the contiguous nucleobases sequence does not comprise 2OMe ribonucleotide analogues or 2-MOE ribonucleotide analogues.

    [0099] In one embodiment, the invention provides an oligomer of between 8 and 16 nucleobases in length, comprising of a contiguous nucleobase sequence which consists of between 8 and 16 nucleobases in length, wherein said contiguous nucleobase sequence is complementary to a corresponding region of contiguous nucleotides present in SEQ ID NO 1 or SEQ ID NO 2, SEQ ID NO 3, SEQ ID NO 4 and wherein said contiguous nucleobase sequence does not comprise 5 or more contiguous DNA (2-deoxyribosnucleoside) monomer units, wherein said contiguous nucleobases sequence comprises at least one nucleotide analogue selected from the group consisting of: beta-D-oxy LNA, thio-LNA, amino-LNA and ena-LNA.

    [0100] Optionally, in the above embodiment the contiguous nucleobase sequence comprises or consists of at least one further nucleotide analogue (X).

    [0101] In one embodiment, the further nucleotide analogue units, are independently selected form the group consisting of: 2-OMe-RNA units, 2-fluoro-DNA units, 2-MOE RNA unit, and LNA units.

    [0102] In one embodiment, the oligomer or contiguous nucleobase sequence consists of between 8 and 15 nucleobases in length, such 9, 10, 11, 12, 13 or 14 nucleobases.

    [0103] In one embodiment the contiguous nucleobase sequence comprises or consists of nucleotide analogues (X).

    [0104] In one embodiment the nucleotide analogues (X) are independently selected form the group consisting of: 2-O-alkyl-RNA unit, 2-OMe-RNA unit, 2-amino-DNA unit, 2-fluoro-DNA unit, LNA unit, PNA unit, HNA unit, INA unit.

    [0105] In one embodiment the contiguous nucleobase sequence comprises both nucleotide analogues (X) and nucleotides (x).

    [0106] In one embodiment the contiguous nucleobase sequence does not comprise a region of more than 7 consecutive nucleotide analogue units (X), such as not more than 6, not more than 5, not more than 4, not more than 3, or not more than 2 consecutive nucleotide analogue units (X).

    [0107] In one embodiment the 5 most nucleobase of the contiguous nucleobase sequence is a nucleotide analogue (X).

    [0108] In one embodiment the 5 most nucleobase of the contiguous nucleobase sequence is a nucleotide unit (x), such as a DNA (2-deoxyribosnucleoside) monomer unit.

    [0109] In one embodiment the 3 most nucleobase of the contiguous nucleobase sequence is a nucleotide analogue (X).

    [0110] In one embodiment the 3 most nucleobase of the contiguous nucleobase sequence is a nucleotide unit (x), such as a DNA (2-deoxyribosnucleoside) monomer unit.

    [0111] In one embodiment the contiguous nucleobase sequence comprises or consists of an alternating sequence of nucleotides and nucleobases.

    [0112] In one embodiment the alternating sequence of nucleotides and nucleobases is an, sequence selected from the group consisting of Xx, xX, Xxx, xXx, xxX, XXx, XxX, xXX, XXXx, XXxX, XxXX, xXXX, xxxX, xxXx, xXxx, Xxxx, XXXXx, XXXxX, XXxXX, XxXXX, xXXXX, xxxxX, xxxXx, xxXxx, xXxxx, Xxxxx, wherein said alternating sequence is optionally repeated.

    [0113] In one embodiment the repeated sequence is repeated for the entire length of the contiguous nucleobase sequence, wherein, optionally the 5 and/or 3 repeat may be truncated.

    [0114] In one embodiment the single stranded oligonucleotide comprises said at least one LNA analogue unit and at least one further nucleotide analogue unit other than LNA.

    [0115] In one embodiment the single stranded oligonucleotide consists of at least one sequence X.sup.1X.sup.2X.sup.1 or X.sup.2X.sup.1X.sup.2, wherein X.sup.1 is LNA and X.sup.2 is a nucleotide analogue other than LNA, such as either a 2-OMe RNA unit and 2-fluoro DNA unit.

    [0116] In one embodiment the sequence of nucleobases of the single stranded oligonucleotide consists of alternative X.sup.1 and X.sup.2 units.

    [0117] In one embodiment the nucleotide analogue units, such as X, are independently selected form the group consisting of: 2-OMe-RNA units, 2-fluoro-DNA units, and LNA units.

    [0118] In one embodiment the nucleotide analogue units (X) are LNA units.

    [0119] In one embodiment the LNA units are selected from the group consisting of oxy-LNA, amino-LNA, thio-LNA, and ena-LNA.

    [0120] In one embodiment the contiguous nucleobase sequence does not comprise a contiguous sub-sequence consisting of 5 or more contiguous nucleobases independently selected from DNA and LNA units, wherein the LNA units present in the contiguous sub-sequence are in the alpha-L-configuration.

    [0121] In one embodiment the contiguous nucleobase sequence does not comprise a contiguous sub-sequence consisting of 5 or more contiguous nucleobases independently selected from DNA and LNA units, wherein the LNA units present in the contiguous sub-sequence are alpha-L-oxy LNA.

    [0122] In one embodiment the all the LNA units are in the beta-D configuration.

    [0123] In one embodiment the length of the contiguous nucleobase sequence is between 8 and 16, such as 9, 10, 11, 12, 13, 14, 15 or 16 nucleobases, in length, or between 10-14 or 11-14 or 12-14.

    [0124] In one embodiment the length of the contiguous nucleobase sequence is between 8 and 15, such as 8, 9, 10, 11, 12, 13, 14, or 15 nucleobases, in length.

    [0125] In one embodiment the contiguous nucleobase sequence comprises a nucleobase sequence which is complementary to a corresponding region of SEQ ID NO 1 or SEQ ID NO 3, i.e is present in a (corresponding) region of contiguous nucleotides present in SEQ ID NO 247 or SEQ ID NO 249.

    [0126] In one embodiment the contiguous nucleobase sequence is complementary to a corresponding region of contiguous nucleotides present in a sequence selected from the group consisting of: 51-164 of SEQ ID NO 1, 51-79 of SEQ ID NO 2, 51-127 of SEQ ID NO 3, and 51-85 of SEQ ID NO 4.

    [0127] In one embodiment the contiguous nucleobase sequence is complementary to a corresponding region of contiguous nucleotides present in a sequence selected from the group consisting of: 1-50 of SEQ ID NO 1, 165-215 of SEQ ID NO 1, 1-50 of SEQ ID NO 2, 80-130 of SEQ ID NO 2, 1-50 of SEQ ID NO 3, 128-178 of SEQ ID NO 3, 1-50 of SEQ ID NO 4, and 86-136 of SEQ ID NO 4.

    [0128] In one embodiment the contiguous nucleobase sequence comprises a nucleobase sequence which is complementary to an 5 exon/intron 3 or 3 intron/exon 5 border.

    [0129] In one embodiment the 5 exon/intron 3 or 3 intron/exon 5 border is selected from the group consisting of nucleobases 50-51 of SEQ ID NO 1, 164-165 of SEQ ID NO 1, 50-51 of SEQ ID NO 2, 79-80 of SEQ ID NO 2, 51-52 of SEQ ID NO 3, 129-139 of SEQ ID NO 3, 50-51 of SEQ ID NO 4, 81-82 of SEQ ID No 4.

    [0130] In one embodiment the contiguous nucleobase sequence is identical to or is present in a nucleobase sequence present in a sequence selected from the group consisting of SEQ ID NO 74 to SEQ ID NO 105.

    [0131] In one embodiment the contiguous nucleobase sequence is identical to or is present in a nucleobase sequence selected from the group consisting of: SEQ ID NO 74, SEQ ID NO 75, SEQ ID NO 77, SEQ ID NO 78, SEQ ID NO 80, SEQ ID NO 82, and SEQ ID NO 84.

    [0132] In one embodiment the contiguous nucleobase sequence is identical to or is present in a nucleobase sequence selected from the group consisting of: SEQ ID NO 85, SEQ ID NO 86, SEQ ID NO 87, SEQ ID NO 88, and SEQ ID NO 89.

    [0133] In one embodiment the oligomer is selected from the group consisting of: SEQ ID NO 74, SEQ ID NO 75, SEQ ID NO 77, SEQ ID NO 78, SEQ ID NO 80, SEQ ID NO 82, and SEQ ID NO 84.

    [0134] In one embodiment the oligomer is selected from the group consisting of: SEQ ID NO 86, SEQ ID NO 87, SEQ ID NO 88, and SEQ ID NO 89.

    [0135] In one embodiment the contiguous nucleobase sequence comprises a nucleobase sequence which is complementary to a region of SEQ ID No 3 selected from nucleotides: 47-49, 54-56, and 122-124.

    [0136] In one embodiment the contiguous nucleobase sequence is identical to or is present in a nucleobase sequence or nucleobase sequence motif selected from the group consisting of: SEQ ID NO 130-SEQ ID No 145, SEQ ID NO 146-SEQ ID NO 161, and SEQ ID NO 162-177.

    [0137] In one embodiment the contiguous nucleobase sequence is identical to or is present in a nucleobase sequence or nucleobase sequence motif selected from the group consisting of: SEQ ID NO 131-SEQ ID No 145, SEQ ID NO 147-SEQ ID NO 161, and SEQ ID NO 163-177.

    [0138] In one embodiment the oligomer is selected from the group consisting of: SEQ ID NO 243, SEQ ID NO 244, SEQ ID NO 245 or SEQ ID NO 246.

    [0139] In one embodiment, the contiguous nucleobase sequence is identical to or is present in a nucleobase sequence or a nucleobase motif sequence selected from the group consisting of: SEQ ID NO 131-SEQ ID No 145, SEQ ID NO 147-SEQ ID NO 161, and SEQ ID NO 163-177.

    [0140] In one embodiment, the oligomer is selected from the group consisting of: SEQ ID NO 245-SEQ ID NO 246, SEQ ID NO 251-263, SEQ ID NO 264-SEQ ID NO 279, and SEQ ID NO 280-SEQ ID NO 295.

    [0141] In one embodiment, said contiguous nucleobase sequence is identical to or is present in a nucleobase sequence or a nucleobase motif sequence selected from the group consisting of: SEQ ID NO 130, SEQ ID NO 146, and SEQ ID NO 162.

    [0142] In one embodiment, the oligomer is selected from the group consisting of: SEQ ID NO 244, SEQ ID NO 264, and SEQ ID NO 280.

    [0143] In one embodiment the oligomer comprises at least one non-nucleotide moiety covalently attached to said oligomer.

    Splice-Switching Oligomers (SSOs):

    [0144] In another aspect, the present invention employs splice switching oligonucleotides or splice switching oligomers (SSOs) to control the alternative splicing of TNFR2 so that the amount of a soluble, ligand-binding form that lacks exon 7 is increased and the amount of the integral membrane form is decreased. The methods and compositions of the present invention can be used in the treatment of diseases associated with excessive tnf activity.

    [0145] Accordingly, one embodiment of the invention is a method of treating an inflammatory disease or condition by administering SSOs to a patient. The SSOs that are administered alter the splicing of a pre-mRNA to produce a mammalian TNFR2 protein that lacks exon 7. In another embodiment, the invention is a method of producing a mammalian TNFR2 protein that lacks exon 7 in a cell by administering SSOs to the cell.

    [0146] The length of the SSO (i.e. The number of monomers in the oligomer) is similar to an antisense oligonucleotide (ASON), typically between about 8 and 30 nucleotides. In preferred embodiments, the SSO will be between about 10 to 16 nucleotides. The invention can be practiced with SSOs of several chemistries that hybridize to RNA, but that do not activate the destruction of the RNA by RNAseH, as do conventional antisense 2-deoxy oligonucleotides. The invention can be practiced using 2o modified nucleic acid oligomers, such as where the 2O is replaced with OCH.sub.3, OCH.sub.2CH.sub.2OCH.sub.3, OCH.sub.2CH.sub.2CH.sub.2NH.sub.2, OCH.sub.2CH.sub.2CH.sub.2OH or F, where 2O-methyl or 2O-methyloxyethyl is preferred. The nucleobases do not need to be linked to sugars; so-called peptide nucleic acid oligomers or morpholine-based oligomers can be used. A comparison of these different linking chemistries is found in Sazani, p. et al., 2001, nucleic acids res. 29:3695. The term splice-switching oligonucleotide is intended to cover the above forms. Those skilled in the art will appreciate the relationship between antisense oligonucleotide gapmers and SSOs. Gapmers are ASON that contain an RNAse H activating region (typically a 2-deoxyribonucleoside phosphorothioate) which is flanked by non-activating nuclease resistant oligomers. In general, any chemistry suitable for the flanking sequences in a gapmer ASON can be used in an SSO.

    [0147] The SSOs of this invention may be made through the well-known technique of solid phase synthesis. Any other means for such synthesis known in the art may additionally or alternatively be used. It is well known to use similar techniques to prepare oligonucleotides such as the phosphorothioates and alkylated derivatives.

    [0148] The bases of the SSO may be the conventional cytosine, guanine, adenine and uracil or thymidine. Alternatively, modified bases can be used. Of particular interest are modified bases that increase binding affinity. One non-limiting example of preferred modified bases are the so-called g-clamp or 9-(aminoethoxy)phenoxazine nucleotides, cytosine analogues that form 4 hydrogen bonds with guanosine. (Flanagan, W. M., et al., 1999, proc. Natl. Acad. Sci. 96:3513; Holmes, S. C., 2003, Nucleic Acids Res. 31:2759). Specific examples of other bases include, but are not limited to, 5-methylcytosine (.sup.meC), isocytosine, pseudoisocytosine, 5-bromouracil, 5-propynyluracil, 5-propyny-6, 5-methylthiazoleuracil, 6-aminopurine, 2-aminopurine, inosine, 2,6-diaminopurine, 7-propyne-7-deazaadenine, 7-propyne-7-deazaguanine and 2-chloro-6-aminopurine.

    [0149] When LNA nucleotides are employed in an SSO it is preferred that non-LNA nucleotides also be present. LNA nucleotides have such high affinities of hybridization that there can be significant non-specific binding, which may reduce the effective concentration of the free-SSO. When LNA nucleotides are used they may be alternated conveniently with 2-deoxynucleotides. Alternating nucleotides, alternating dinucleotides or mixed patterns, e.g., LDLDLD or LLDLLD or LDDLDD can be used. For example in one embodiment, contains a sequence of nucleotides selected from the group consisting of: LDLDDLLDDLDLDLL, LDLDLLLDDLLLDLL, LMLMMLLMMLMLMLL, LMLMLLLMMLLLMLL, LFLFFLLFFLFLFLL, LFLFLLLFFLLLFLL, LDDLDDLDDL, DLDDLDDLDD, DDLDDLDDLD, LMMLMMLMML, MLMMLMMLMM, MMLMMLMMLM, LFFLFFLFFL, FLFFLFFLFF, FFLFFLFFLF, DLDLDLDLDL, LDLDLDLDL, MLMLMLMLML, LMLMLMLML, FLFLFLFLFL, LFLFLFLFL, where L is a LNA unit, D is a DNA unit, M is 2Moe, F is 2fluoro.

    [0150] When 2-deoxynucleotides or 2-deoxynucleoside phosphorothioates are mixed with LNA nucleotides it is important to avoid RNAse H activation. It is expected that between about one third and two thirds of the LNA nucleotides of an SSO will be suitable. When affinity-enhancing modifications are used, including but not limited to LNA or g-clamp nucleotides, the skilled person recognizes it can be necessary to increase the proportion of such affinity-enhancing modifications.

    [0151] Numerous alternative chemistries which do not activate RNAse H are available. For example, suitable SSOs can be oligonucleotides wherein at least one of the internucleotide bridging phosphate residues is a modified phosphate, such as methyl phosphonate, methyl phosphonothioate, phosphoromorpholidate, phosphoropiperazidate, and phosphoroamidate. For example, every other one of the internucleotide bridging phosphate residues may be modified as described. In another non-limiting example, such SSO are oligonucleotides wherein at least one of the nucleotides contains a 2 lower alkyl moiety (e.g., c.sub.1-c.sub.4, linear or branched, saturated or unsaturated alkyl, such as methyl, ethyl, ethenyl, propyl, 1-propenyl, 2-propenyl, and isopropyl). For example, every other one of the nucleotides may be modified as described. (see references in U.S. Pat. No. 5,976,879 col. 4). For in vivo use, phosphorothioate linkages are preferred.

    [0152] The length of the SSO will be from about 8 to about 30 bases in length. Those skilled in the art appreciate that when affinity-increasing chemical modifications are used, the SSO can be shorter and still retain specificity. Those skilled in the art will further appreciate that an upper limit on the size of the SSO is imposed by the need to maintain specific recognition of the target sequence, and to avoid secondary-structure forming self hybridization of the SSO and by the limitations of gaining cell entry. These limitations imply that an SSO of increasing length (above and beyond a certain length which will depend on the affinity of the SSO) will be more frequently found to be less specific, inactive or poorly active.

    [0153] SSOs of the invention include, but are not limited to, modifications of the SSO involving chemically linking to the SSO one or more moieties or conjugates which enhance the activity, cellular distribution or cellular uptake of the SSO. Such moieties include, but are not limited to, lipid moieties such as a cholesterol moiety, cholic acid, a thioether, e.g. Hexyl-s-tritylthiol, a thiocholesterol, an aliphatic chain, e.g., dodecandiol or undecyl residues, a phospholipids, e.g., di-hexadecyl-rac-glycerol or triethylammonium 1,2-di-o-hexadecyl-rac-glycero-3-h-phosphonate, a polyamine or a polyethylene glycol chain, an adamantane acetic acid, a palmityl moiety, an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety.

    [0154] It is not necessary for all positions in a given SSO to be uniformly modified, and in fact more than one of the aforementioned modifications may be incorporated in a single compound or even at a single nucleoside within an SSO.

    [0155] The SSOs may be admixed, encapsulated, conjugated, or otherwise associated with other molecules, molecule structures, or mixtures of compounds, as for example liposomes, receptor targeted molecules, oral, rectal, topical or other formulation, for assisting in uptake, distribution, and/or absorption.

    [0156] Those skilled in the art appreciate that cellular differentiation includes, but is not limited to, differentiation of the spliceosome. Accordingly, the activity of any particular SSO can depend upon the cell type into which they are introduced. For example, SSOs which are effective in one cell type may be ineffective in another cell type.

    [0157] The methods, oligonucleotides, and formulations of the present invention are also useful as in vitro or in vivo tools to examine splicing in human or animal genes. Such methods can be carried out by the procedures described herein, or modifications thereof which will be apparent to skilled persons.

    [0158] The SSOs disclosed herein can be used to treat any condition in which the medical practitioner intends to limit the effect of tnf or the signalling pathway activated by tnf. In particular, the invention can be used to treat an inflammatory disease. In one embodiment, the condition is an inflammatory systemic disease, e.g., rheumatoid arthritis or psoriatic arthritis. In another embodiment, the disease is an inflammatory liver disease. Examples of inflammatory liver diseases include, but are not limited to, hepatitis associated with the hepatitis a, b, or c viruses, alcoholic liver disease, and non-alcoholic steatosis. In yet another embodiment, the inflammatory disease is a skin condition such as psoriasis.

    RNAseH Recruitment

    [0159] The oligomer according to the invention does not mediate RNAseH based cleavage of a complementary single stranded RNA molecule. A stretch of at least 5 consecutive DNA nucleobases are required for an oligonucleotide to be effective in recruitment of RNAseH.

    [0160] EP 1 222 309 provides in vitro methods for determining RNaseH activity, which may be used to determine the ability to recruit RNaseH. A compound is deemed capable of recruiting RNase H if, when provided with the complementary RNA target, it has an initial rate, as measured in pmol/l/min, of at least 1%, such as at least 5%, such as at least 10% or less than 20% of the equivalent DNA only oligonucleotide, with no 2 substitutions, with phosphorothioate linkage groups between all nucleotides in the oligonucleotide, using the methodology provided by Example 91-95 of EP 1 222 309.

    [0161] A compound is deemed essentially incapable of recruiting RNaseH if, when provided with the complementary RNA target, and RNaseH, the RNaseH initial rate, as measured in pmol/l/min, is less than 20% such as less than 10% such as less than 5%, or preferably less than 1%, (or even less than 0.1%) of the initial rate determined using the equivalent DNA only oligonucleotide, with no 2 substitutions, with phosphorothioate linkage groups between all nucleotides in the oligonucleotide, using the methodology provided by Example 91-95 of EP 1 222 309.

    Nucleotide Analogues

    [0162] It will be recognised that when referring to a preferred nucleotide sequence motif or nucleotide sequence, which consists of only nucleotides, the oligomers of the invention which are defined by that sequence may comprise a corresponding nucleotide analogues in place of one or more of the nucleotides present in said sequence, such as LNA units or other nucleotide analogues, which raise the duplex stability/T.sub.m of the oligomer/target duplex (i.e. affinity enhancing nucleotide analogues).

    [0163] Furthermore, the nucleotide analogues may enhance the stability of the oligomer in vivo.

    [0164] Incorporation of affinity-enhancing nucleotide analogues in the oligomer, such as LNA or 2-substituted sugars, can allow the size of the specifically binding oligomer to be reduced, and may also reduce the upper limit to the size of the oligomer before non-specific or aberrant binding takes place.

    [0165] Suitably, when the nucleobase sequence of the oligomer, or the contiguous nucleobase sequence, is not fully complementary to the corresponding region of the TNFR target sequence, in one embodiment, when the oligomer comprises affinity enhancing nucleotide analogues, such nucleotide analogues form a complement with their corresponding nucleotide in the TNFR target.

    [0166] The oligomer may thus comprise or consist of a simple sequence of natural nucleotidespreferably 2-deoxynucleotides (referred to here generally as DNA), but also possibly ribonucleotides (referred to here generally as RNA)or it could comprise one or more (and possibly consist completely of) nucleotide analogues.

    [0167] Nucleotide analogues are variants of natural DNA or RNA nucleotides by virtue of modifications in the sugar and/or base and/or phosphate portions. The term nucleobase will be used to encompass natural (DNA- or RNA-type) nucleotides as well as such analogues thereof.

    [0168] Analogues could in principle be merely silent or equivalent to the natural nucleotides in the context of the oligonucleotide, i.e. have no functional effect on the way the oligonucleotide works to inhibit beta-catenin expression. Such equivalent analogues may nevertheless be useful if, for example, they are easier or cheaper to manufacture, or are more stable to storage or manufacturing conditions, or represent a tag or label. Preferably, however, the analogues will have a functional effect on the way in which the oligomer works to inhibit expression; for example by producing increased binding affinity to the target and/or increased resistance to intracellular nucleases and/or increased ease of transport into the cell.

    [0169] Examples of such modification of the nucleotide include modifying the sugar moiety to provide a 2-substituent group or to produce a bridged (locked nucleic acid) structure which enhances binding affinity and probably also provides some increased nuclease resistance; modifying the internucleotide linkage from its normal phosphodiester to one that is more resistant to nuclease attack, such as phosphorothioate or boranophosphate.

    [0170] A preferred nucleotide analogue is LNA, such as beta-D-oxy-LNA, alpha-L-oxy-LNA, beta-D-amino-LNA and beta-D-thio-LNA, most preferred beta-D-oxy-LNA.

    [0171] In some embodiments, the oligomer comprises from 3-8 nucleotide analogues, e.g. 6 or 7 nucleotide analogues. In the by far most preferred embodiments, at least one of said nucleotide analogues is a locked nucleic acid (LNA); for example at least 3 or at least 4, or at least 5, or at least 6, or at least 7, or 8, of the nucleotide analogues may be LNA. In some embodiments all the nucleotides analogues may be LNA.

    [0172] In some embodiments the nucleotide analogues present within the oligomer of the invention are independently selected from, for example: 2-O-alkyl-RNA units, 2-amino-DNA units, 2-fluoro-DNA units, LNA units, arabino nucleic acid (ANA) units, 2-fluoro-ANA units, HNA units, INA (intercalating nucleic acid) units and 2MOE units.

    [0173] In one embodiment the nucleotide analogue is 2-MOE, i.e. 2O-2methoxyethyl RNA.

    [0174] In one embodiment the nucleotide analogue is 2-MOE, i.e. 2O-2methoxyethyl RNA. Therefore in one embodiment X.sup.2 or M as referred to in nucleobases motifs herein may be 2-MOE.

    [0175] 2-O-methoxyethyl-RNA (2MOE), 2-fluoro-DNA monomers and LNA are preferred nucleotide analogues, and as such the oligonucleotide of the invention may comprise nucleotide analogues which are independently selected from these three types of analogue, or may comprise only one type of analogue selected from the three types.

    [0176] Preferably, the oligomer according to the invention comprises at least one Locked Nucleic Acid (LNA) unit, such as 1, 2, 3, 4, 5, 6, 7, or 8 LNA units, preferably between 4 to 8 LNA units, most preferably 4, 5 or 6 LNA units. Suitably, the oligomer may comprise both beta-D-oxy-LNA, and one or more of the following LNA units: thio-LNA, amino-LNA, oxy-LNA, ena-LNA and/or alpha-LNA in either the D-beta or L-alpha configurations or combinations thereof.

    [0177] In one embodiment of the invention, the oligomer may comprise both LNA and DNA units. Preferably the combined total of LNA and DNA units is 8-24, such as 8-15 or 10-25, or 10-20, or 12-16.

    [0178] In one embodiment of the invention, the nucleobase sequence of the oligomer, such as the contiguous nucleobase sequence consists of at least one LNA and the remaining nucleobase units are DNA units.

    [0179] In some embodiments of oligomer according to the invention, such as an antisense oligonucleotide which comprises LNA, all LNA C units are 5methyl-Cytosine. In some embodiments, all the nucleotide analogues are LNA.

    [0180] In most preferred embodiments the oligomer comprises only LNA nucleotide analogues and nucleotides (RNA or DNA, most preferably DNA nucleotides, optionally with modified internucleobase linkages such as phosphorothioate).

    [0181] In some embodiments at least one of said nucleotide analogues is 2-MOE-RNA, such as 2, 3, 4, 5, 6, 7 or 8 2-MOE-RNA nucleobase units.

    [0182] In some embodiments at least one of said nucleotide analogues is 2-fluoro DNA, such as 2, 3, 4, 5, 6, 7 or 8 2-fluoro-DNA nucleobase units.

    [0183] Specific examples of nucleoside analogues are described by e.g. Freier & Altmann; Nucl. Acid Res., 1997, 25, 4429-4443 and Uhlmann; Curr. Opinion in Drug Development, 2000, 3(2), 293-213, and in Scheme 1:

    ##STR00001## ##STR00002##

    [0184] The term LNA refers to a bicyclic nucleotide analogue, known as Locked Nucleic Acid. It may refer to an LNA monomer, or, when used in the context of an LNA oligonucleotide refers to an oligonucleotide containing one or more such bicyclic nucleotide analogues.

    [0185] A particularly preferred chemistry is provided by locked nucleic acids (LNA) (Koshkin, A. A., et al., 1998, Tetrahedron 54:3607; Obika, S., et al., 1998, Tetrahedron Lett. 39:5401). As used herein, the terms LNA unit, LNA monomer, LNA residue, locked nucleic acid unit, locked nucleic acid monomer or locked nucleic acid residue, refer to a bicyclic nucleoside analogue. LNA units and methods of their synthesis are described in inter alia WO 99/14226, WO 00/56746, WO 00/56748, WO 01/25248, WO 02/28875, WO 03/006475 and WO 03/095467. The LNA unit may also be defined with respect to its chemical formula. Thus, an LNA unit, as used herein, has the chemical structure shown in Formula 1 below:

    ##STR00003##

    wherein,
    X is selected from the group consisting of O, S and NRH, where R is H or C.sub.1-C.sub.4-alkyl;
    Y is (CH.sub.2).sub.r, where r is an integer of 1-4; and
    a cells were seeded in at 1.0105 cells per well in 24d above.

    [0186] In a preferred embodiment, r is 1 or 2, and in a more preferred embodiment r is 1

    [0187] The LNA used in the oligonucleotide compounds of the invention preferably has the structure of the general formula

    ##STR00004##

    where X and Y are independently selected among the groups O,
    S, N(H), N(R), CH.sub.2 or CH (if part of a double bond), CH.sub.2O, CH.sub.2S, CH.sub.2N(H), CH.sub.2N(R), CH.sub.2CH.sub.2 or CH.sub.2CH (if part of a double bond), CHCH, where R is selected from hydrogen and C.sub.1-4-alkyl; Z and Z* are independently selected among an internucleoside linkage, a terminal group or a protecting group; B constitutes a natural or non-natural nucleotide base moiety; and the asymmetric groups may be found in either orientation.

    [0188] Preferably, the LNA used in the oligomer of the invention comprises at least one LNA unit according any of the formulas

    ##STR00005##

    wherein Y is O, S, NH, or N(R.sup.H); Z and Z* are independently selected among an internucleoside linkage, a terminal group or a protecting group; B constitutes a natural or non-natural nucleotide base moiety, and R.sup.H is selected from hydrogen and C.sub.1-4-alkyl.

    [0189] Preferably, the LNA used in the oligomer of the invention comprises internucleoside linkages selected from OP(O).sub.2O, OP(O,S)O, OP(S).sub.2O, SP(O).sub.2O, SP(O,S)O, SP(S).sub.2O, OP(O).sub.2S, OP(O,S)S, SP(O).sub.2S, OPO(R.sup.H)O, OPO(OCH.sub.3)O, OPO(NR.sup.H)O, OPO(OCH.sub.2CH.sub.2SR)O, OPO(BH.sub.3)O, OPO(NHR.sup.H)O, OP(O).sub.2NR.sup.H, NR.sup.HP(O).sub.2O, NR.sup.HCOO, where R.sup.H is selected form hydrogen and C.sub.1-4-alkyl.

    [0190] Specifically preferred LNA units are shown in scheme 2:

    ##STR00006##

    [0191] The term thio-LNA comprises a locked nucleotide in which at least one of X or Y in the general formula above is selected from S or CH.sub.2S. Thio-LNA can be in both beta-D and alpha-L-configuration.

    [0192] The term amino-LNA comprises a locked nucleotide in which at least one of X or Y in the general formula above is selected from N(H), N(R), CH.sub.2N(H), and CH.sub.2N(R) where R is selected from hydrogen and C.sub.1-4-alkyl. Amino-LNA can be in both beta-D and alpha-L-configuration.

    [0193] The term oxy-LNA comprises a locked nucleotide in which at least one of X or Yin the general formula above represents O or CH.sub.2O. Oxy-LNA can be in both beta-D and alpha-L-configuration.

    [0194] The term ena-LNA comprises a locked nucleotide in which Y in the general formula above is CH.sub.2O (where the oxygen atom of CH.sub.2O is attached to the 2-position relative to the base B).

    [0195] In a preferred embodiment LNA is selected from beta-D-oxy-LNA, alpha-L-oxy-LNA, beta-D-amino-LNA and beta-D-thio-LNA, in particular beta-D-oxy-LNA.

    [0196] Preferably, the oligomer according to the invention comprises at least one nucleotide analogue, such as Locked Nucleic Acid (LNA) unit, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotide analogues, such as Locked Nucleic Acid (LNA) units, preferably between 3 to 9 nucleotide analogues, such as LNA units, such as 4-8, nucleotide analogues, such as LNA units, such as 6-9 nucleotide analogues, such as LNA units, preferably 6, 7 or 8 nucleotide analogues, such as LNA units.

    [0197] The oligomer according to the invention, such as an antisense oligonucleotide, may comprises of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15 nucleotide analogues, such as LNA units, in particular 3, 4, 5, 6, 7, 8, 9 or 10 nucleotide analogues, such as LNA units, such as between 1 and 10 nucleotide analogues, such as LNA units such as between 2 and 8 nucleotide analogues such as LNA units.

    [0198] Preferably the LNA units comprise at least one beta-D-oxy-LNA unit(s) such as 2, 3, 4, 5, 6, 7, 8, 9, or 10 beta-D-oxy-LNA units.

    [0199] The oligomer of the invention, such as the antisense oligonucleotide, may comprise more than one type of LNA unit. Suitably, the compound may comprise both beta-D-oxy-LNA, and one or more of the following LNA units: thio-LNA, amino-LNA, oxy-LNA, ena-LNA and/or alpha-LNA in either the D-beta or L-alpha configurations or combinations thereof.

    [0200] Preferably, the oligomer, such as an antisense oligonucleotide, may comprise or consist of both nucleotide analogues, such as LNA units, and DNA units.

    [0201] LNA and DNA are preferred, but MOE, 2-O-Me, and other 2-substituted analogues and RNA could also be used.

    [0202] Preferred DNA analogues includes DNA analogues where the 2-H group is substituted with a substitution other than OH (RNA) e.g. by substitution with OCH3, OCH2-CH2-OCH3, OCH2-CH2-CH2-NH2, OCH2-CH2-CH2-OH or F.

    [0203] Preferred RNA analogues includes RNA analogues which have been modified in its 2-OH group, e.g. by substitution with a group other than H (DNA), for example OCH3, OCH2-CH2-OCH3, OCH2-CH2-CH2-NH2, OCH2-CH2-CH2-OH or F.

    [0204] In one embodiment the nucleotide analogue is ENA.

    [0205] In one embodiment, the oligomer of the invention does not comprise any RNA units.

    [0206] High affinity nucleotide analogues are nucleotide analogues which result in oligonucleotide which has a higher thermal duplex stability with a complementary RNA nucleotide than the binding affinity of an equivalent DNA nucleotide. This is typically determined by measuring the T.sub.m.

    [0207] Nucleotide analogues which increase the T.sub.m of the oligomer/target nucleic acid target, as compared to the equivalent nucleotide are preferred (affinity enhancing nucleotide analogues). The oligomers may suitably be capable of hybridising against the target nucleic acid, such as a TNFR mRNA, to form a duplex with a T.sub.m of at least 30 C., such as 37 C., such as at least 40 C., at least 50 C., at least 55 C., or at least 60 C. In one aspect, for example, the T.sub.m is between 30 C. and 80 C., such as between 40 C. and 70 C.

    [0208] In one embodiment at least 30%, such as at least 33%, such as at least 40%, such as at least 50%, such as at least 60%, such as at least 66%, such as at least 70%, such as at least 80%, such as at least 90% of the nucleobases of the oligomer of the invention are nucleotide analogues nucleobases, such as LNA. In one embodiment, all of the nucleobases of the oligomer of the invention are nucleotide analogues nucleobases, such as LNA.

    [0209] It will be recognized that for shorter oligonucleotides it may be necessary to increase the proportion of (high affinity) nucleotide analogues, such as LNA.

    [0210] The term oligonucleotide (or simply oligo) which is used interchangeably with the term oligomer refers, in the context of the present invention, to a molecule formed by covalent linkage of two or more nucleobases. When used in the context of the oligonucleotide of the invention (also referred to the single stranded oligonucleotide), the term oligonucleotide may have, in one embodiment, for example between 8-26 nucleobases, such as between 12 to 26 nucleobases. In a preferable embodiment, as detailed herein, the oligonucleotide of the invention has a length of between 10-16 nucleobases or 8-15 nucleobases.

    Variation of the Length of the Oligomer

    [0211] The length of the oligonucleotides of the invention may vary. Indeed it is considered advantageous to have short oligonucleotides, such as between 10-17 or 10-15 nucleobases.

    [0212] In such an embodiment, the oligonucleotide of the invention may have a length of 10, 11, 12, 13, 14, 15, or 16 nucleobases.

    [0213] In one embodiment, the oligonucleotide according to the present has a length of from 8 to 24 nucleotides, such as 10 to 24, between 12 to 24 nucleotides, such as a length of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23 or 24 nucleotides, preferably a length of from 10-22, such as between 12 to 22 nucleotides, such as a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 or 22 nucleotides, more preferably a length of from 10-20, such as between 12 to 20 nucleotides, such as a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 nucleotides, even more preferably a length of from 10 to 19, such as between 12 to 19 nucleotides, such as a length of 10, 11, 12, 13, 14, 15, 16, 17, 18 or 19 nucleotides, e.g. a length of from 10 to 18, such as between 12 to 18 nucleotides, such as a length of 10, 11, 12, 13, 14, 15, 16, 17 or 18 nucleotides, more preferably a length of from 10-17, such as from 12 to 17 nucleotides, such as a length of 10, 11, 12, 13, 14, 15, 16 or 17 nucleotides, most preferably a length of from 10 to 16, such as between 12 to 16 nucleotides, such as a length of 10, 11, 12, 13, 14, 15 or 16 nucleotides.

    Internucleoside Linkage Group

    [0214] The term internucleoside linkage group is intended to mean a group capable of covalently coupling together two nucleobases, such as between DNA units, between DNA units and nucleotide analogues, between two non-LNA units, between a non-LNA unit and an LNA unit, and between two LNA units, etc. Preferred examples include phosphate, phosphodiester groups and phosphorothioate groups.

    [0215] The internucleoside linkage may be selected form the group consisting of: OP(O)2-O, OP(O,S)O, OP(S)2-O, SP(O)2-O, SP(O,S)O, SP(S)2-O, OP(O)2-S, OP(O,S)S, SP(O)2-S, OPO(RH)O, OPO(OCH3)-O, OPO(NRH)O, OPO(OCH2CH2SR)O, OPO(BH3)-O, OPO(NHRH)O, OP(O)2-NRH, NRHP(O)2-O, NRHCOO, NRHCONRH, and/or the internucleoside linkage may be selected form the group consisting of: OCOO, OCONRH, NRHCOCH2-, OCH2-CONRH, OCH2-CH2-NRH, CONRHCH2-, CH2-NRHCO, OCH2-CH2-S, SCH2-CH2-O, SCH2-CH2-S, CH2-SO2-CH2-, CH2-CONRH, OCH2-CH2-NRHCO, CH2-NCH3-OCH2-, where RH is selected from hydrogen and C1-4-alkyl. Suitably, in some embodiments, sulphur (S) containing internucleoside linkages as provided above may be preferred.

    Modification of the Internucleoside Linkage Group

    [0216] Typical internucleoside linkage groups in oligonucleotides are phosphate groups, but these may be replaced by internucleoside linkage groups differing from phosphate. In a further interesting embodiment of the invention, the oligonucleotide of the invention is modified in its internucleoside linkage group structure, i.e. the modified oligonucleotide comprises an internucleoside linkage group which differs from phosphate. Accordingly, in a preferred embodiment, the oligonucleotide according to the present invention comprises at least one internucleoside linkage group which differs from phosphate.

    [0217] Specific examples of internucleoside linkage groups which differ from phosphate

    [0218] (OP(O)2-O) include OP(O,S)O, OP(S)2-O, SP(O)2-O, SP(O,S)O, SP(S)2-O, OP(O)2-S, OP(O,S)S, SP(O)2-S, OPO(RH)O, OPO(OCH3)-O, OPO(NRH)O, OPO(OCH2CH2SR)O, OPO(BH3)-O, OPO(NHRH)O, OP(O)2-NRH, NRHP(O)2-O, NRHCOO, NRHCONRH, OCOO, OCONRH, NRHCOCH2-, OCH2-CONRH, OCH2-CH2-NRH, CONRHCH2-, CH2-NRHCO, OCH2-CH2-S, SCH2-CH2-O, SCH2-CH2-S, CH2-SO2-CH2-, CH2-CONRH, OCH2-CH2-NRHCO, CH2-NCH3-OCH2-, where RH is hydrogen or C1-4-alkyl.

    [0219] When the internucleoside linkage group is modified, the internucleoside linkage group is preferably a phosphorothioate group (OP(O,S)O). In a preferred embodiment, all internucleoside linkage groups of the oligonucleotides according to the present invention are phosphorothioate.

    [0220] It is preferable for most therapeutic uses that the oligonucleotide is fully phosphorothiolatedthe exception being for therapeutic oligonucleotides for use in the CNS, such as in the brain or spine where phosphorothioation can be toxic, and due to the absence of nucleases, phosphodiester bonds may be used, even between consecutive DNA units.

    [0221] In one embodiment, the oligomer comprises alternating LNA and DNA units (Xx) or (xX).

    [0222] In one embodiment, the oligomer comprises a motif of alternating LNA followed by 2 DNA units (Xxx), xXx or xxX.

    [0223] In one embodiment, at least one of the DNA or non-LNA nucleotide analogue units are replaced with a LNA nucleobase in a position selected from the positions identified as LNA nucleobase units in any one of the embodiments referred to above.

    [0224] In one embodiment, X donates an LNA unit.

    [0225] In one embodiment, the oligomer comprises at least 3 nucleotide analogue units, such as at least 4 nucleotide analogue units, such as at least 5 nucleotide analogue units, such as at least 6 nucleotide analogue units, such as at least 7 nucleotide analogue units, such as at least 8 nucleotide analogue units, such as at least 9 nucleotide analogue units, such as at least 10, such as at least 11, such as at least 12 nucleotide analogue units.

    [0226] In one embodiment, the oligomer comprises at least 3 LNA units, such as at least 4 LNA units, such as at least 5 LNA units, such as at least 6 LNA units, such as at least 7 LNA units, such as at least 8 LNA units, such as at least 9 LNA units, such as at least 10 LNA units, such as at least 11 LNA units, such as at least 12 LNA units.

    [0227] In one embodiment wherein at least one of the nucleotide analogues, such as LNA units, is either cytosine or guanine, such as between 1-10 of the of the nucleotide analogues, such as LNA units, is either cytosine or guanine, such as 2, 3, 4, 5, 6, 7, 8, or 9 of the of the nucleotide analogues, such as LNA units, is either cytosine or guanine.

    [0228] In one embodiment at least two of the nucleotide analogues such as LNA units is either cytosine or guanine. In one embodiment at least three of the nucleotide analogues such as LNA units is either cytosine or guanine. In one embodiment at least four of the nucleotide analogues such as LNA units is either cytosine or guanine. In one embodiment at least five of the nucleotide analogues such as LNA units is either cytosine or guanine. In one embodiment at least six of the nucleotide analogues such as LNA units is either cytosine or guanine. In one embodiment at least seven of the nucleotide analogues such as LNA units is either cytosine or guanine. In one embodiment at least eight of the nucleotide analogues such as LNA units is either cytosine or guanine.

    [0229] In a preferred embodiment the nucleotide analogues have a higher thermal duplex stability a complementary RNA nucleotide than the binding affinity of an equivalent DNA nucleotide to said complementary RNA nucleotide.

    [0230] In one embodiment, the nucleotide analogues confer enhanced serum stability to the single stranded oligonucleotide.

    Further Designs for Oligomers of the Invention

    [0231] In one embodiment, the first nucleobase of the oligomer according to the invention, counting from the 3 end, is a nucleotide analogue, such as an LNA unit.

    [0232] In one embodiment, the second nucleobase of the oligomer according to the invention, counting from the 3 end, is a nucleotide analogue, such as an LNA unit.

    [0233] In one embodiment, x denotes a DNA unit.

    [0234] In one embodiment, the oligomer comprises a nucleotide analogue unit, such as an LNA unit, at the 5 end.

    [0235] In one embodiment, the nucleotide analogue units, such as X, are independently selected form the group consisting of: 2-O-alkyl-RNA unit, 2-OMe-RNA unit, 2-amino-DNA unit, 2-fluoro-DNA unit, 2-MOE-RNA unit, LNA unit, PNA unit, HNA unit, INA unit.

    [0236] In one embodiment, all the nucleobases of the oligomer of the invention are nucleotide analogue units.

    [0237] In one embodiment, the nucleotide analogue units, such as X, are independently selected form the group consisting of: 2-OMe-RNA units, 2-fluoro-DNA units, and LNA units,

    [0238] In one embodiment, the oligomer comprises said at least one LNA analogue unit and at least one further nucleotide analogue unit other than LNA.

    [0239] In one embodiment, the non-LNA nucleotide analogue unit or units are independently selected from 2-OMe RNA units and 2-fluoro DNA units.

    [0240] In one embodiment, the oligomer consists of at least one sequence X.sup.1X.sup.2X.sup.1 or X.sup.2X.sup.1X.sup.2, wherein X.sup.1 is LNA and X.sup.2 is either a 2-OMe RNA unit and 2-fluoro DNA unit.

    [0241] In one embodiment, the sequence of nucleobases of the oligomer consists of alternative X.sup.1 and X.sup.2 units.

    [0242] In one embodiment, the oligomer according to the invention does not comprise a region of more than 5 consecutive DNA nucleotide units. In one embodiment, the oligomer according to the invention does not comprise a region of more than 6 consecutive DNA nucleotide units. In one embodiment, the oligomer according to the invention does not comprise a region of more than 7 consecutive DNA nucleotide units. In one embodiment, the oligomer according to the invention does not comprise a region of more than 8 consecutive DNA nucleotide units. In one embodiment, the oligomer according to the invention does not comprise a region of more than 3 consecutive DNA nucleotide units. In one embodiment, the oligomer according to the invention does not comprise a region of more than 2 consecutive DNA nucleotide units.

    [0243] In one embodiment, the oligomer comprises at least region consisting of at least two consecutive nucleotide analogue units, such as at least two consecutive LNA units.

    [0244] In one embodiment, the oligomer comprises at least region consisting of at least three consecutive nucleotide analogue units, such as at least three consecutive LNA units.

    [0245] In one embodiment, the oligomer of the invention does not comprise a region of more than 7 consecutive nucleotide analogue units, such as LNA units. In one embodiment, the oligomer of the invention does not comprise a region of more than 6 consecutive nucleotide analogue units, such as LNA units. In one embodiment, the oligomer of the invention does not comprise a region of more than 5 consecutive nucleotide analogue units, such as LNA units. In one embodiment, the oligomer of the invention does not comprise a region of more than 4 consecutive nucleotide analogue units, such as LNA units. In one embodiment, the oligomer of the invention does not comprise a region of more than 3 consecutive nucleotide analogue units, such as LNA units. In one embodiment, the oligomer of the invention does not comprise a region of more than 2 consecutive nucleotide analogue units, such as LNA units.

    [0246] In one embodiment, the oligonucleotide of the invention comprises at least 50%, such as 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or such as 100% of the nucleobase units of the oligomer are (preferably high affinity) nucleotide analogues, such as a Locked Nucleic Acid (LNA) nucleobase unit,

    [0247] Table 3 and 4 below provides non-limiting examples of short microRNA sequences that could advantageously be targeted with an oligonucleotide of the present invention.

    [0248] The oligonucleotides according to the invention may, in one embodiment, have a sequence of nucleobases 5-3 selected form the group consisting of the following motifs:

    LxLxxLLxxLL

    LxLxLLLxxLL

    LxxLxxLxxL

    [0249] xLxxLxxLxx Every third
    xxLxxLxxLx Every third
    xLxLxLxLxL Every second
    LxLxLxLxL Every second

    LdLddLLddLL

    LdLdLLLddLLL

    LMLMMLLMMLL

    LMLMLLLMMLL

    LFLFFLLFFLL

    LFLFLLLFFLLL

    LLLLLL

    LLLLLLL

    LLLLLLLL

    LLLLLLLLL

    LLLLLLLLLL

    LLLLLLLLLLL

    LLLLLLLLLLLL

    LMMLMMLMML

    [0250] MLMMLMMLMM Every third
    MMLMMLMMLM Every third
    LFFLFFLFFL Every third
    FLFFLFFLFF Every third
    FFLFFLFFLF Every third
    dLdLdLdLdL Every second
    LdLdLdLdL Every second
    MLMLMLMLML Every second
    LMLMLMLML Every second
    FLFLFLFLFL Every second
    LFLFLFLFL Every second

    LdLddLLddLdLdLL

    LdLdLLLddLLLdLL

    LMLMMLLMMLMLMLL

    LMLMLLLMMLLLMLL

    LFLFFLLFFLFLFLL

    LFLFLLLFFLLLFLL

    LddLddLddL(d)(d)(L)(d)(d)(L)(d)

    [0251] dLddLddLdd(L)(d)(d)(L)(d)(d)(L)
    ddLddLddLd(d)(L)(d)(d)(L)(d)(d)

    LMMLMMLMML(M)(M)(L)(M)(M)(L)(M)

    MLMMLMMLMM(L)(M)(M)(L)(M)(M)(L)

    MMLMMLMMLM(M)(L)(M)(M)(L)(M)(M)

    LFFLFFLFFL(F)(F)(L)(F)(F)(L)(F)

    FLFFLFFLFF(L)(F)(F)(L)(F)(F)(L)

    FFLFFLFFLF(F)(L)(F)(F)(L)(F)(F)

    [0252] dLdLdLdLdL(d)(L)(d)(L)(d)(L)(d)

    LdLdLdLdL(d)(L)(d)(L)(d)(L)(d)(L)

    MLMLMLMLML(M)(L)(M)(L)(M)(L)(M)

    LMLMLMLML(M)(L)(M)(L)(M)(L)(M)(L)

    FLFLFLFLFL(F)(L)(F)(L)(F)(L)(F)

    LFLFLFLFL(F)(L)(F)(L)(F)(L)(F)(L)

    [0253] Wherein L=LNA unit, d=DNA units, M=2MOE RNA, F=2Fluoro and x=as defined herein. It will be recognized that for longer oligomers the above patterns may be repeated, and for shorter, a corresponding fraction of the above motifs may be usedbeginning from the 5 end, or from the 3 end and residues in brackets are optional

    [0254] In one embodiment, the invention further provides for a oligomer wherein said oligomer (or contiguous nucleobase sequence) comprises either at least one phosphorothioate linkage and/or at least one 3 terminal LNA unit, and/or at least one 5 terminal LNA unit.

    Proteins

    [0255] The invention further provides for an isolated, or purified, soluble form of TNFalpha receptor comprises a deletion in the trans-membrane binding domain encoded by exon 7, wherein said TNFalpha receptor is selected from the TNFalpha receptor TNFRSF1A or TNFRSF1B, or a variant, fragment or homologue thereof.

    [0256] In one embodiment, the isolated, or purified, soluble form of TNFalpha receptor according to the invention lacks the trans-membrane binding domain encoded by exon 7.

    [0257] In one embodiment, the isolated, or purified, soluble form of TNFalpha receptor is the human TNFR1 TNFalpha receptor (residues 1-455, or residues 30-455 of SEQ ID NO 123, or a variant, fragment or homologue thereof.), wherein said deletion is between residues 209 and 246 (or region which corresponds to residues 209 and 246 of SEQ ID No 123).

    [0258] In one embodiment, the isolated, or purified, soluble form of TNFalpha has a sequence consisting of residues 1-208 or residues 30-208 of SEQ ID NO 119, or is a variant, fragment or homologue thereof.

    [0259] In one embodiment, the isolated, or purified, soluble form of TNFalpha receptor is the human TNFR2 TNFalpha receptor (residues 1-435, or residues 23-435 of SEQ ID NO 127, or a variant, fragment or homologue thereof, wherein said deletion is between residues 263 and 289 (or region which corresponds to residues 209 and 246 of SEQ ID No 123).

    [0260] In one embodiment, the isolated, or purified, soluble form of TNFalpha receptor has a sequence consisting of residues 1-262 or 23-262 of SEQ ID NO 127, or is a variant, fragment or homologue thereof.

    [0261] In one preferred embodiment, the soluble form of the TNFalpha receptor is both isolated and purified.

    [0262] One embodiment of the present invention is a protein, either full length or mature, which is encoded by a cDNA derived from a mammalian TNFR gene, and in the cDNA exon 6 is followed directly by exon 8 and as a result lacks exon 7. Furthermore the protein can bind TNF, preferably TNF-, and can act as a TNF, preferably TNF-, antagonist. Preferably, TNFR of the present invention is capable of inhibition of TNF-mediated cytotoxicity to a greater extent than the soluble extracellular domain alone, and more preferably, to an extent comparable to or greater than TNFR:Fc. Mammalian TNFR according to the present disclosure includes, but is not limited to, human, primate, murine, canine, feline, bovine, ovine, equine, and porcine TNFR. Furthermore, mammalian TNFR according to the present disclosure includes, but is not limited to, a protein sequence that results from one or more single nucleotide polymorphisms, such as for example those disclosed in EP Pat. Appl. 1,172,444, as long as the protein retains a comparable biological activity to the reference sequence with which it is being compared.

    [0263] In one embodiment, the mammalian TNFR is a mammalian TNFR1, preferably a human TNFR1. For human TNFR1 two non-limiting examples of this embodiment are given by huTNFR1 7 which includes the signal sequence as shown in SEQ ID No: 122 and mature huTNFR1 7 (amino acids 30-417 of SEQ ID No: 122) which lacks the signal sequence. The sequences of these huTNFR1 7 proteins are either amino acids 1-208 of wild type human TNFR1 (SEQ ID No: 118) which includes the signal sequence or 30-208 of wild type human TNFR1 for mature huTNFR1 7 which lacks the signal sequence, and in either case is followed immediately by amino acids 247-455 of wild type human TNFR1.

    [0264] In another preferred embodiment, the mammalian TNFR is a mammalian TNFR2, most preferably a human TNFR2. For human TNFR2 two non-limiting examples of this embodiment are given by huTNFR2 7 which includes the signal sequence as shown in SEQ ID No: 126 or mature huTNFR2 7 (amino acids 23-435 of SEQ ID No: 126) which lacks the signal sequence. The sequences of these huTNFR2 7 proteins are either amino acids 1-262 of wild type human TNFR2 (SEQ ID No: 120) which includes the signal sequence or 23-262 of wild type human TNFR2 for mature huTNFR2 7 which lacks the signal sequence, followed in either case by the amino acid glutamate, because of the creation of a unique codon at the exon 6-8 junction, which is followed by amino acids 290-461 of wild type human TNFR2.

    [0265] The proteins of the present invention also include those proteins that are chemically modified. Chemical modification of a protein refers to a protein where at least one of its amino acid residues is modified by either natural processes, such as processing or other post-translational modifications, or by chemical modification techniques known in the art. Such modifications include, but are not limited to, acetylation, acylation, amidation, ADP-ribosylation, glycosylation, methylation, pegylation, prenylation, phosphorylation, or cholesterol conjugation.

    [0266] The proteins of the present invention may, in one embodiment, also include variants, fragments and homologues of the proteins of the invention. However, such proteins comprise a deletion in the amino acid sequence which is encoded by exon 7 or exon 8, as explained herein.

    Nucleic Acids

    [0267] The invention further provides a nucleic acid encoding the soluble form of TNFalpha receptor according to the invention.

    [0268] In one embodiment, the nucleic acid is selected from the group consisting of: nucleotides 1-1251 of SEQ ID NO 121, 88-1251 of SEQ ID NO 121, 1-1305 of SEQ ID NO 125 and 67-1305 of SEQ ID NO 125, or variant, homologue or fragment thereof, including a nucleic acid which encodes the same primary amino acid sequence as the nucleic acid, i.e. due to the degeneracy of the genetic code.

    [0269] One embodiment of the present invention is a nucleic acid that encodes a protein, either full length or mature, which is encoded by a cDNA derived from a mammalian TNFR gene, and in the cDNA exon 6 is followed directly by exon 8 and as a result lacks exon 7.

    [0270] Such sequences are preferably provided in the form of an open reading frame uninterrupted by internal nontranslated sequences, or introns, which are typically present in eukaryotic genes. Genomic DNA containing the relevant sequences can also be used. In one embodiment, the nucleic acid is either an mRNA or a cDNA. In another embodiment, it is genomic DNA.

    [0271] In one embodiment, the mammalian TNFR is a mammalian TNFR1. For this embodiment, the mammalian TNFR1 is preferably a human TNFR1. For human TNFR1, two non-limiting examples of this embodiment are nucleic acids which encode the huTNFR1 7 which includes the signal sequence as shown in SEQ ID No: 122 and mature huTNFR1 7 (amino acids 30-417 of SEQ ID No: 122) which lacks the signal sequence. Preferably, the sequences of these huTNFR1 7 nucleic acids are nucleotides 1-1251 of SEQ ID No: 121, which includes the signal sequence and nucleotides 88-1251 of SEQ ID No: 121 which lacks the signal sequence. The sequences of these huTNFR1 7 nucleic acids are either nucleotides 1-625 of wild type human TNFR1 (SEQ ID No: 117) which includes the signal sequence or 88-625 of wild type human TNFR1 for mature huTNFR2 7 which lacks the signal sequence, and in either case is followed immediately by amino acids 740-1368 of wild type human TNFR1.

    [0272] In another preferred embodiment, the mammalian TNFR is a mammalian TNFR2, most preferably a human TNFR2. For human TNFR2, two non-limiting examples of this embodiment are nucleic acids which encode the huTNFR2 7 which includes the signal sequence as shown in SEQ ID No: 126 or mature huTNFR2 7 (amino acids 23-435 of SEQ ID No: 126) which lacks the signal sequence. Preferably, the sequences of these huTNFR2 7 nucleic acids are nucleotides 1-1305 of SEQ ID No: 115 which includes the signal sequence and nucleotides 67-1305 of SEQ ID No: 115 which lacks the signal sequence. The sequences of these huTNFR2 7 nucleic acids are either nucleotides 1-787 of wild type human TNFR2 (SEQ ID No: 119) which includes the signal sequence or 67-787 of wild type human TNFR2 for mature huTNFR2 7 which lacks the signal sequence, and in either case is followed immediately by amino acids 866-1386 of wild type human TNFR2.

    [0273] The bases of the nucleic acids of the present invention can be the conventional bases cytosine, guanine, adenine and uracil or thymidine. Alternatively, modified bases can be used. Other suitable bases include, but are not limited to, 5-methylcytosine (.sup.MeC), isocytosine, pseudoisocytosine, 5-bromouracil, 5-propynyluracil, 5-propyny-6, 5-methylthiazoleuracil, 6-aminopurine, 2-aminopurine, inosine, 2,6-diaminopurine, 7-propyne-7-deazaadenine, 7-propyne-7-deazaguanine, 2-chloro-6-aminopurine and 9-(aminoethoxy)phenoxazine.

    [0274] Suitable nucleic acids of the present invention include numerous alternative chemistries. For example, suitable nucleic acids of the present invention include, but are not limited to, those wherein at least one of the internucleotide bridging phosphate residues is a modified phosphate, such as phosphorothioate, methyl phosphonate, methyl phosphonothioate, phosphoromorpholidate, phosphoropiperazidate, and phosphoroamidate. In another non-limiting example, suitable nucleic acids of the present invention include those wherein at least one of the nucleotides contain a 2 lower alkyl moiety (e.g., C.sub.1-C.sub.4, linear or branched, saturated or unsaturated alkyl, such as methyl, ethyl, ethenyl, propyl, 1-propenyl, 2-propenyl, and isopropyl).

    [0275] Nucleic acids of the present invention also include, but are not limited to, those wherein at least one, of the nucleotides is a nucleic acid analogue. Examples of such analogues include, but are not limited to, hexitol (HNA) nucleotides, 2O-4C-linked bicyclic ribofuranosyl (LNA) nucleotides, peptide nucleic acid (PNA) analogues, N3.fwdarw.P5 phosphoramidate analogues, phosphorodiamidate morpholino nucleotide analogues, and combinations thereof.

    [0276] Nucleic acids of the present invention include, but are not limited to, modifications of the nucleic acids involving chemically linking to the nucleic acids one or more moieties or conjugates. Such moieties include, but are not limited to, lipid moieties such as a cholesterol moiety, cholic acid, a thioether, e.g. hexyl-S-tritylthiol, a thiocholesterol, an aliphatic chain, e.g., dodecandiol or undecyl residues, a phospholipids, e.g., di-hexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate, a polyamine or a polyethylene glycol chain, an adamantane acetic acid, a palmityl moiety, an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety.

    Expression Vectors and Host Cells

    [0277] The invention also provides for a vector comprising the nucleic acid of the invention.

    [0278] In one embodiment, the vector comprises an expression cassette capable of driving the expression of said nucleic acid in a host cell.

    [0279] The invention also provides for a host cell comprising the nucleic acid or the vector according to the invention.

    [0280] The invention also provides for a method for the preparation of a soluble form of TNFalpha receptor, said method comprising the step of culturing the host cell according to the invention under conditions which allow the expression of said nucleic acid, and subsequently isolating said soluble form of TNFalpha receptor from said host cells.

    [0281] The present invention provides expression vectors to amplify or express DNA encoding mammalian TNFR of the current invention. The present invention also provides host cells transformed with the foregoing expression vectors. Expression vectors are replicable DNA constructs which have synthetic or cDNA-derived DNA fragments encoding mammalian TNFR or bioequivalent analogues operably linked to suitable transcriptional or translational regulatory elements derived from mammalian, microbial, viral, or insect genes. A transcriptional unit generally comprises an assembly of (a) a genetic element or elements having a regulatory role in gene expression, such as, transcriptional promoters or enhancers, (b) a structural or coding sequence which is transcribed into mRNA and translated into protein, and (c) appropriate transcription and translation initiation and termination sequences. Such regulatory elements can include an operator sequence to control transcription, and a sequence encoding suitable mRNA ribosomal binding sites. The ability to replicate in a host, usually conferred by an origin of replication, and a selection gene to facilitate recognition of transformants, can additionally be incorporated.

    [0282] DNA regions are operably linked when they are functionally related to each other. For example, DNA for a signal peptide (secretory leader) is operably linked to DNA for a polypeptide if it is expressed as a precursor which participates in the secretion of the polypeptide; a promoter is operably linked to a coding sequence if it controls the transcription of the sequence; or a ribosome binding site is operably linked to a coding sequence if it is positioned so as to permit translation. Generally, operably linked means contiguous and, in the case of secretory leaders, contiguous and in reading frame. Structural elements intended for use in yeast expression systems preferably include a leader sequence enabling extracellular secretion of translated protein by a host cell. Alternatively, where recombinant protein is expressed without a leader or transport sequence, it may include an N-terminal methionine residue. This residue may optionally be subsequently cleaved from the expressed protein to provide a final product.

    [0283] Mammalian TNFR DNA is expressed or amplified in a recombinant expression system comprising a substantially homogeneous monoculture of suitable host microorganisms, for example, bacteria such as E. coli or yeast such as S. cerevisiae, which have stably integrated (by transformation or transfection) a recombinant transcriptional unit into chromosomal DNA or carry the recombinant transcriptional unit as a component of a resident plasmid. Recombinant expression systems as defined herein will express heterologous protein either constitutively or upon induction of the regulatory elements linked to the DNA sequence or synthetic gene to be expressed.

    [0284] Transformed host cells are cells which have been transformed or transfected with mammalian TNFR vectors constructed using recombinant DNA techniques. Transformed host cells ordinarily express TNFR, but host cells transformed for purposes of cloning or amplifying TNFR DNA do not need to express TNFR. Suitable host cells for expression of mammalian TNFR include prokaryotes, yeast, fungi, or higher eukaryotic cells. Prokaryotes include gram negative or gram positive organisms, for example E. coli or bacilli. Higher eukaryotic cells include, but are not limited to, established insect and mammalian cell lines. Cell-free translation systems can also be employed to produce mammalian TNFR using RNAs derived from the DNA constructs of the present invention. Appropriate cloning and expression vectors for use with bacterial, fungal, yeast, and mammalian cellular hosts are well known in the art.

    [0285] Prokaryotic expression hosts may be used for expression of TNFR that do not require extensive proteolytic and disulfide processing. Prokaryotic expression vectors generally comprise one or more phenotypic selectable markers, for example a gene encoding proteins conferring antibiotic resistance or supplying an autotrophic requirement, and an origin of replication recognized by the host to ensure amplification within the host. Suitable prokaryotic hosts for transformation include E. coli, Bacillus subtilis, Salmonella typhimurium, and various species within the genera Pseudomonas, Streptomyces, and Staphylococcus, although others can also be employed as a matter of choice.

    [0286] Useful expression vectors for bacterial use can comprise a selectable marker and bacterial origin of replication derived from commercially available plasmids comprising genetic elements of the well known cloning vector pBR322 (ATCC 37017). These pBR322 backbone sections are combined with an appropriate promoter and the structural sequence to be expressed. pBR322 contains genes for ampicillin and tetracycline resistance and thus provides simple means for identifying transformed cells. Such commercial vectors include, for example, the series of Novagen pET vectors (EMD Biosciences, Inc., Madison, Wis.).

    [0287] Promoters commonly used in recombinant microbial expression vectors include the lactose promoter system, and the P.sub.L promoter, the T7 promoter, and the T7 lac promoter. A particularly useful bacterial expression system, Novagen pET system (EMD Biosciences, Inc., Madison, Wis.) employs a T7 or T7 lac promoter and E. coli strain, such as BL21(DE3) which contain a chromosomal copy of the T7 RNA polymerase gene.

    [0288] TNFR proteins can also be expressed in yeast and fungal hosts, preferably from the genus Saccharomyces, such as S. cerevisiae. Yeast of other genera, such as Pichia or Kluyveromyces can also be employed. Yeast vectors will generally contain an origin of replication from the 2 yeast plasmid or an autonomously replicating sequence (ARS), promoter, DNA encoding TNFR, sequences for polyadenylation and transcription termination and a selection gene. Preferably, yeast vectors will include an origin of replication and selectable marker permitting transformation of both yeast and E. coli, e.g., the ampicillin resistance gene of E. coli and S. cerevisiae TRP1 or URA3 gene, which provides a selection marker for a mutant strain of yeast lacking the ability to grow in tryptophan or uracil, respectively, and a promoter derived from a highly expressed yeast gene to induce transcription of a structural sequence downstream. The presence of the TRP1 or URA3 lesion in the yeast host cell genome then provides an effective environment for detecting transformation by growth in the absence of tryptophan or uracil, respectively.

    [0289] Suitable promoter sequences in yeast vectors include the promoters for metallothionein, 3-phosphoglycerate kinase or other glycolytic enzymes, such as enolase, glyceraldehyde-3-phosphate dehydrogenase, hexokinase, pyruvate decarboxylase, phosphofructokinase, glucose-6-phosphate isomerase, 3-phosphoglycerate mutase, pyruvate kinase, triosephosphate isomerase, phosphoglucose isomerase, and glucokinase. Suitable vectors and promoters for use in yeast expression are well known in the art.

    [0290] Preferred yeast vectors can be assembled using DNA sequences from pUC18 for selection and replication in E. coli (Amp gene and origin of replication) and yeast DNA sequences including a glucose-repressible ADH2 promoter and -factor secretion leader. The yeast -factor leader, which directs secretion of heterologous proteins, can be inserted between the promoter and the structural gene to be expressed. The leader sequence can be modified to contain, near its 3 end, one or more useful restriction sites to facilitate fusion of the leader sequence to foreign genes. Suitable yeast transformation protocols are known to those of skill in the art.

    [0291] Host strains transformed by vectors comprising the ADH2 promoter may be grown for expression in a rich medium consisting of 1% yeast extract, 2% peptone, and 1% or 4% glucose supplemented with 80 mg/ml adenine and 80 mg/ml uracil. Derepression of the ADH2 promoter occurs upon exhaustion of medium glucose. Crude yeast supernatants are harvested by filtration and held at 4 C. prior to further purification.

    [0292] Various mammalian or insect cell culture systems are also advantageously employed to express TNFR protein. Expression of recombinant proteins in mammalian cells is particularly preferred because such proteins are generally correctly folded, appropriately modified and completely functional. Examples of suitable mammalian host cell lines include the COS-7 lines of monkey kidney cells, and other cell lines capable of expressing an appropriate vector including, for example, L cells, such as L929, C127, 3T3, Chinese hamster ovary (CHO), HeLa and BHK cell lines. Mammalian expression vectors can comprise nontranscribed elements such as an origin of replication, a suitable promoter, for example, the CMVie promoter, the chicken beta-actin promoter, or the composite hEF1-HTLV promoter, and enhancer linked to the gene to be expressed, and other 5 or 3 flanking nontranscribed sequences, and 5 or 3 nontranslated sequences, such as necessary ribosome binding sites, a polyadenylation site, splice donor and acceptor sites, and transcriptional termination sequences. Baculovirus systems for production of heterologous proteins in insect cells are known to those of skill in the art.

    [0293] The transcriptional and translational control sequences in expression vectors to be used in transforming vertebrate cells can be provided by viral sources. For example, commonly used promoters and enhancers are derived from Polyoma, Adenovirus 2, Simian Virus 40 (SV40), human cytomegalovirus, such as the CMVie promoter, HTLV, such as the composite hEF1-HTLV promoter. DNA sequences derived from the SV40 viral genome, for example, SV40 origin, early and late promoter, enhancer, splice, and polyadenylation sites can be used to provide the other genetic elements required for expression of a heterologous DNA sequence.

    [0294] Further, mammalian genomic TNFR promoter, such as control and/or signal sequences can be utilized, provided such control sequences are compatible with the host cell chosen.

    [0295] In preferred aspects of the present invention, recombinant expression vectors comprising TNFR cDNAs are stably integrated into a host cell's DNA.

    Protein Expression and Purification:

    [0296] When mammalian or insect cells are used, properly expressed TNFR protein will be secreted into the extracellular media. The protein is recovered from the media, and is concentrated and is purified using standard biochemical techniques. After expression in mammalian cells by lentiviral or AAV transduction, plasmid transfection, or any similar procedure, or in insect cells after baculoviral transduction, the extracellular media of these cells is concentrated using concentration filters with an appropriate molecular weight cutoff, such as Amicon filtration units. To avoid loss of TNFR protein, the filter should allow proteins to flow through that are at or below 50 kDal.

    [0297] When TNFR protein is expressed in bacterial culture it can be purified by standard biochemical techniques. Bacteria are lysed, and the cellular extract containing the TNFR is desalted and is concentrated.

    [0298] In either case, the TNFR protein is preferably purified by affinity chromatography. The use of column chromatography with an affinity matrix comprising TNF- is preferred. Alternatively, an affinity purification tag can be added to either the N- or the C-terminus of the TNFR protein. For example, a polyhistidine-tag (His-tag), which is an amino acid motif with at least six histidines, can be used for this purpose (Hengen, P., 1995, Trends Biochem. Sci. 20:285-86). The addition of a His-tag can be achieved by the in-frame addition of a nucleotide sequence encoding the His-tag directly to either the 5 or 3 end of the TNFR open reading frame in an expression vector. One such nucleotide sequence for the addition of a C-terminal His-tag is given in SEQ ID No: 126. When a His-tag is incorporated into the protein, a nickel or cobalt affinity column is employed to purify the tagged TNFR, and the His-tag can optionally then be cleaved. Other suitable affinity purification tags and methods of purification of proteins with those tags are well known in the art.

    [0299] Alternatively, a non-affinity based purification scheme can be used, involving fractionation of the TNFR extracts on a series of columns that separate the protein based on size (size exclusion chromatography), charge (anion and cation exchange chromatography) and hydrophobicity (reverse phase chromatography). High performance liquid chromatography can be used to facilitate these steps.

    [0300] Other methods for the expression and purification of TNFR proteins are well known (See, e.g., U.S. Pat. No. 5,605,690 to Jacobs).

    DEFINITIONS

    [0301] The term internucleoside linkage group is intended to mean a group capable of covalently coupling together two nucleobases, such as between DNA units, between DNA units and nucleotide analogues, between two non-LNA units, between a non-LNA unit and an LNA unit, and between two LNA units, etc. Preferred examples include phosphate, phosphodiester groups and phosphorothioate groups.

    [0302] Herein, the term nitrogenous base is intended to cover purines and pyrimidines, such as the DNA nucleobases A, C, T and G, the RNA nucleobases A, C, U and G, as well as non-DNA/RNA nucleobases, such as 5-methylcytosine (.sup.MeC), isocytosine, pseudoisocytosine, 5-bromouracil, 5-propynyluracil, 5-propyny-6-fluorouracil, 5-methylthiazoleuracil, 6-aminopurine, 2-aminopurine, inosine, 2,6-diaminopurine, 7-propyne-7-deazaadenine, 7-propyne-7-deazaguanine and 2-chloro-6-aminopurine, in particular .sup.MeC. It will be understood that the actual selection of the non-DNA/RNA nucleobase will depend on the corresponding (or matching) nucleotide present in the microRNA strand which the oligonucleotide is intended to target. For example, in case the corresponding nucleotide is G it will normally be necessary to select a non-DNA/RNA nucleobase which is capable of establishing hydrogen bonds to G. In this specific case, where the corresponding nucleotide is G, a typical example of a preferred non-DNA/RNA nucleobase is .sup.MeC.

    [0303] As used herein, the terms tumor necrosis factor receptor, TNF receptor, and TNFR refer to proteins having amino acid sequences of or which are substantially similar to native mammalian TNF receptor sequences, and which are capable of binding TNF molecules. In this context, a native receptor or gene for such a receptor, means a receptor or gene that occurs in nature, as well as the naturally-occurring allelic variations of such receptors and genes.

    [0304] The term mature as used in connection with a TNFR means a protein expressed in a form lacking a leader or signal sequence as may be present in full-length transcripts of a native gene.

    [0305] The nomenclature for TNFR proteins as used herein follows the convention of naming the protein (e.g., TNFR2) preceded by a species designation, e.g., hu (for human) or mu (for murine), followed by a (to designate a deletion) and the number of the exon(s) deleted. For example, huTNFR2 7 refers to human TNFR2 lacking exon 7. In the absence of any species designation, TNFR refers generically to mammalian TNFR.

    [0306] The term secreted means that the protein is soluble, i.e., that it is not bound to the cell membrane. In this context, a form will be soluble if using conventional assays known to one of skill in the art most of this form can be detected in fractions that are not associated with the membrane, e.g., in cellular supernatants or serum.

    [0307] The term stable means that the secreted TNFR form is detectable using conventional assays by one of skill in the art, such as, western blots, ELISA assays in harvested cells, cellular supernatants, or serum.

    [0308] As used herein, the terms tumor necrosis factor and TNF refer to the naturally-occurring protein ligands that bind to TNF receptors. TNF includes, but is not limited to, TNF- and TNF-.

    [0309] As used herein, the term an inflammatory disease or condition refers to a disease, disorder, or other medical condition that at least in part results from or is aggravated by the binding of TNF to its receptor. Such diseases or conditions include, but are not limited to, those associated with increased levels of TNF, increased levels of TNF receptor, or increased sensitization or deregulation of the corresponding signaling pathway. The term also encompasses diseases and conditions for which known TNF antagonists have been shown useful. Examples of inflammatory diseases or conditions include, but are not limited to, rheumatoid arthritis, juvenile rheumatoid arthritis, psoriasis, psoriatic arthritis, ankylosing spondylitis, inflammatory bowel disease (including Crohn's disease and ulcerative colitis), hepatitis, sepsis, alcoholic liver disease, and non-alcoholic steatosis.

    [0310] As used herein, the term hepatitis refers to a gastroenterological disease, condition, or disorder that is characterized, at least in part, by inflammation of the liver. Examples of hepatitis include, but are not limited to, hepatitis associated with hepatitis A virus, hepatitis B virus, hepatitis C virus, or liver inflammation associated with ischemia/reperfusion.

    [0311] As used herein, the term TNF antagonist means that the protein is capable of measurable inhibition of TNF-mediated cytotoxicity using standard assays as are well known in the art. (See, e.g L929 cytotoxicity assay as described in the Examples below).

    [0312] The term binds TNF means that the protein can bind detectable levels of TNF, preferably TNF-, as measured by standard binding assays as are well known in the art (See, e.g., U.S. Pat. No. 5,945,397 to Smith, cols. 16-17). Preferably, receptors of the present invention are capable of binding greater than 0.1 nmoles TNF-/nmole receptor, and more preferably, greater than 0.5 nmoles TNF-/nmole receptor using standard binding assays.

    [0313] As used herein, the term regulatory element refers to a nucleotide sequence involved in an interaction of molecules that contributes to the functional regulation of a nucleic acid, including but not limited to, replication, duplication, transcription, splicing, translation, or degradation of the nucleic acid. The regulation may be enhancing or inhibitory in nature. Regulatory elements known in the art include, for example, transcriptional regulatory sequences such as promoters and enhancers. A promoter is a DNA region that is capable under certain conditions of aiding the initiation of transcription of a coding region usually located downstream (in the 3 direction) from the promoter. An expression vector typically comprises such regulatory elements operably linked to the nucleic acid of the invention.

    [0314] The terms oligomer and splice switching oligomer and oligonucleotide are used interchangeably herein.

    [0315] As used herein, the term operably linked refers to a juxtaposition of genetic elements, wherein the elements are in a relationship permitting them to operate in the expected manner. For example, a promoter is operably linked to a coding region if the promoter helps initiate transcription of the coding sequence (such as in an expression vector). As long as this functional relationship is maintained, there can be intervening residues between the promoter and the coding region.

    [0316] As used herein, the terms transformation or transfection refer to the insertion of an exogenous nucleic acid into a cell, irrespective of the method used for the insertion, for example, lipofection, transduction, infection or electroporation. The exogenous nucleic acid can be maintained as a non-integrated vector, for example, a plasmid, or alternatively, can be integrated into the cell's genome.

    [0317] As used herein, the term vector refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked. One type of vector is a plasmid, which refers to a circular double stranded DNA loop into which additional DNA segments can be ligated. Another type of vector is a viral vector, wherein additional DNA segments can be ligated into the viral genome. Certain vectors are capable of autonomous replication in a host cell into which they are introduced (e.g., bacterial vectors having a bacterial origin of replication and episomal mammalian vectors). Other vectors (e.g., non-episomal mammalian vectors) are integrated into the genome of a host cell upon introduction into the host cell, and thereby are replicated along with the host genome. Moreover, certain vectors, expression vectors, are capable of directing the expression of genes to which they are operably linked. In general, expression vectors of utility in recombinant DNA techniques are often in the form of plasmids. or viral vectors (e.g., replication defective retroviruses, adenoviruses and adeno-associated viruses).

    [0318] As used herein, the term isolated protein refers to a protein or polypeptide that is not naturally-occurring and/or is separated from one or more components that are naturally associated with it.

    [0319] As used herein, the term isolated nucleic acid refers to a nucleic acid that is not naturally-occurring and/or is in the form of a separate fragment or as a component of a larger construct, which has been derived from a nucleic acid isolated at least once in substantially pure form, i.e., free of contaminating endogenous materials, and in a quantity or concentration enabling identification and manipulation by standard biochemical methods, for example, using a cloning vector.

    [0320] As used herein the term purified protein refers to a protein that is present in the substantial absence of other protein. However, such purified proteins can contain other proteins added as stabilizers, carriers, excipients, or co-therapeutics. The term purified as used herein preferably means at least 50% such as at least 80% by dry weight, more preferably in the range of 95-99% by weight, and most preferably at least 99.8% by weight, of protein present, excluding proteins added as stabilizers, carriers, excipients, or co-therapeutics.

    [0321] As used herein, the term altering the splicing of a pre-mRNA refers to altering the splicing of a cellular pre-mRNA target resulting in an altered ratio of splice products. Such an alteration of splicing can be detected by a variety of techniques well known to one of skill in the art. For example, RT-PCR on total cellular RNA can be used to detect the ratio of splice products in the presence and the absence of an SSO.

    [0322] As used herein, the term complementary is used to indicate a sufficient degree of complementarity or precise pairing such that stable and specific binding occurs between an oligonucleotide and a DNA or RNA containing the target sequence. It is understood in the art that the sequence of an oligonucleotide need not be 100% complementary to that of its target. For example, for an SSO there is a sufficient degree of complementarity when, under conditions which permit splicing, binding to the target will occur and non-specific binding will be avoided. However, it is preferred that the oligonucleotide or contiguous nucleobase sequence is fully (i.e. perfectly) complementary to the target sequence (such as the region of SEQ ID NO 1-4, referred to herein).

    [0323] The terms corresponding to and corresponds to as used in the context of oligonucleotides refers to the comparison between either a nucleobase sequence of the compound of the invention, and the reverse complement thereof, or in one embodiment between a nucleobase sequence and an equivalent (identical) nucleobase sequence which may for example comprise other nucleobases but retains the same base sequence, or complement thereof. Nucleotide analogues are compared directly to their equivalent or corresponding natural nucleotides. Sequences which form the reverse complement of a sequence are referred to as the complement sequence of the sequence.

    [0324] When referring to the length of a nucleotide molecule as referred to herein, the length corresponds to the number of monomer units, i.e. nucleobases, irrespective as to whether those monomer units are nucleotides or nucleotide analogues. With respect to nucleobases, the terms monomer and unit are used interchangeably herein.

    [0325] It should be understood that when the term about is used in the context of specific values or ranges of values, the disclosure should be read as to include the specific value or range referred to.

    [0326] The term variant as used in herein in the context of a protein or polypeptide (sequence), refers to a polypeptide which is prepared from the original (parent) polypeptide, or using the sequence information from the polypeptide, by insertion, deletion or substitution of one or more amino acids in said sequence, i.e. at least one amino acids, but preferably less than 50 amino acids, such as less than 40, less than 30, less than 20, or less than 10 amino acids, such as 1 amino acid, 1-2 amino acids, 1-3 amino acids, 1-4 amino acids, 1-5 amino acids.

    [0327] The term homologue as used herein in the context of a protein or polypeptide (sequence), refers to a polypeptide which is at least 70% homologous, such as at least 80% homologous, such as at least 85% homologous, or at least 90% homologous, such as at least 95%, 96%, 97%, 98% or 99% homologous to said polypeptide sequence. Homology between two polypeptide sequences may be determined using ClustalW alignment algorithm using the Blosum 62 algorithm, with Gap Extent=0.5, Gap open=10 (see http://www.ebi.ac.uk/emboss/align/index.html). The alignment may, in one embodiment be a local alignment (water) or a separate embodiment be a global alignment (needle). As the homologues of the exon deletion TNFR proteins referred to herein also comprise deletion in the respective exon, a global alignment may be preferred.

    [0328] The term fragment as used herein in the context of a protein or polypeptide (sequence), refers to a polypeptide which consists of only a part of the polypeptide sequence. A fragment may therefore comprise at least 5% such as at least 10% of said polypeptide sequence, including at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 95% of said polypeptide sequence.

    [0329] The above definitions of variant, fragment and homologue also apply to nucleic acid sequences, although the homology algorithm used is DNAfull. Obviously, when referring to nucleic acid variant, fragment or homologue, the terms protein, polypeptide and amino acid should be replaced with nucleic acid, polynucleotide or nucleobase/nucleotide accordingly.

    [0330] As used herein, the terms membrane bound form or integral membrane form refer to proteins having amino acid sequences that span a cell membrane, with amino acid sequences on each side of the membrane.

    [0331] As used herein, the term stable, secreted, ligand-binding form or as it is sometimes known stable, soluble, ligand-binding form. (where the terms secreted and soluble are synonymous and interchangeable herein) refer to proteins that are related to the native membrane bound form receptors, in such a way that they are secreted and stable and still capable of binding to the corresponding ligand. It should be noted that these forms are not defined by whether or not such secreted forms are physiological, only that the products of such splice variants would be secreted, stable, and still capable of ligand-binding when produced.

    [0332] The term secreted means that the form is soluble, i.e., that it is no longer bound to the cell membrane. In this context, a form will be soluble if using conventional assays known to one of skill in the art most of this form can be detected in fractions that are not associated with the membrane, e.g., in cellular supernatants or serum.

    [0333] The term stable means that the secreted form is detectable using conventional assays by one of skill in the art. For example, western blots, ELISA assays can be used to detect the form from harvested cells, cellular supernatants, or serum from patients.

    [0334] The term ligand-binding means that the form retains at least some significant level, although not necessarily all, of the specific ligand-binding activity of the corresponding integral membrane form.

    [0335] As used herein, the term to reduce the activity of a ligand refers to any action that leads to a decrease in transmission of an intracellular signal resulting from the ligand binding to or interaction with the receptor. For example, activity can be reduced by binding of the ligand to a soluble form of its receptor or by decreasing the quantity of the membrane form of its receptor available to bind the ligand.

    Pharmaceutical Compositions and Preparations

    [0336] Other embodiments of the invention are pharmaceutical compositions comprising the oligomers, proteins and nucleic acids according to the invention.

    [0337] The oligomers, nucleic acids and proteins of the present invention may be admixed, encapsulated, conjugated, or otherwise associated with other molecules, molecule structures, or mixtures of compounds, as for example liposomes, receptor targeted molecules, oral, rectal, topical or other formulations, for assisting in uptake, distribution, and/or absorption.

    [0338] Formulations of the present invention comprise the oligomers, nucleic acids or proteins according to the invention in a physiologically or pharmaceutically acceptable carrier, such as an aqueous carrier. Thus formulations for use in the present invention include, but are not limited to, those suitable for parenteral administration including intra-articular, intraperitoneal, intravenous, intraarterial, subcutaneous, or intramuscular injection or infusion, as well as those suitable for topical, ophthalmic, vaginal, oral, rectal or pulmonary administration (including inhalation or insufflation of powders or aerosols, including by nebulizer, intratracheal, and intranasal delivery). The formulations may conveniently be presented in unit dosage form and may be prepared by any of the methods well known in the art. The most suitable route of administration in any given case may depend upon the subject, the nature and severity of the condition being treated, and the particular active compound which is being used.

    [0339] Pharmaceutical compositions of the present invention include, but are not limited to, physiologically and pharmaceutically acceptable salts, i.e., salts that retain the desired biological activity of the parent compound and do not impart undesired toxicological properties. Examples of such salts are (a) salts formed with cations such as sodium, potassium, NH.sub.4.sup.+, magnesium, calcium, polyamines such as spermine and spermidine, etc.; (b) acid addition salts formed with inorganic acids, for example, hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, nitric acid and the like; and (c) salts formed with organic acids such as, for example, acetic acid, oxalic acid, tartaric acid, succinic acid, maleic acid, fumaric acid, gluconic acid, citric acid, malic acid, ascorbic acid, benzoic acid, tannic acid, palmitic acid, alginic acid, polyglutamic acid, napthalenesulfonic acid, methanesulfonic acid, p-toluenesulfonic acid, napthalenedisulfonic acid, polygalacturonic acid, and the like.

    [0340] The present invention provides for the use of the oligomers, proteins and nucleic acids as set forth above for the preparation of a medicament for treating a patient afflicted with an inflammatory disorder involving excessive activity of TNF, as discussed below. In the manufacture of a medicament according to the invention, the oligomers, nucleic acids and proteins of the present invention are typically admixed with, inter alia, an acceptable carrier. The carrier must, of course, be acceptable in the sense of being compatible with other ingredients in the formulation and must not be deleterious to the patient. The carrier may be a solid or liquid. Oligomers, nucleic acids and proteins of the present invention are incorporated in formulations, which may be prepared by any of the well known techniques of pharmacy consisting essentially of admixing the components, optionally including one or more accessory therapeutic ingredients.

    [0341] Formulations of the present invention may comprise sterile aqueous and non-aqueous injection solutions of the active compounds, which preparations are preferably isotonic with the blood of the intended recipient and essentially pyrogen free. These preparations may contain antioxidants, buffers, bacteriostats, and solutes which render the formulation isotonic with the blood of the intended recipient. Aqueous and non-aqueous sterile suspensions can include, but are not limited to, suspending agents and thickening agents. The formulations may be presented in unit dose or multi-dose containers, for example, sealed ampoules and vials, and may be stored in freeze-dried (lyophilized) condition requiring only the addition of the sterile liquid carrier, for example, saline or water-for-injection immediately prior to use.

    [0342] In the formulation the oligomers, nucleic acids and proteins of the present invention may be contained within a particle or vesicle, such as a liposome or microcrystal, which may be suitable for parenteral administration. The particles may be of any suitable structure, such as unilamellar or plurilameller, so long as the oligomers, nucleic acids and proteins of the present invention are contained therein. Positively charged lipids such as N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethyl-ammoniummethylsulfate, or DOTAP, are particularly preferred for such particles and vesicles. The preparation of such lipid particles is well known (See references in U.S. Pat. No. 5,976,879 col. 6).

    [0343] Accordingly one embodiment of the invention is a method of treating an inflammatory disease or condition by administering a stable, secreted, ligand-binding form of a TNF receptor, thereby decreasing the activity of TNF for the receptor. In another embodiment, the invention is a method of treating an inflammatory disease or condition by administering an oligonucleotide that encodes a stable, secreted, ligand-binding form of a TNF receptor, thereby decreasing the activity of TNF for the receptor. In another embodiment, the invention is a method of producing a stable, secreted, ligand-binding form of a TNF receptor.

    [0344] The following aspects of the present invention discussed below apply to the foregoing embodiments.

    [0345] The methods, nucleic acids, proteins, and formulations of the present invention are also useful as in vitro or in vivo tools.

    [0346] Embodiments of the invention can be used to treat any condition in which the medical practitioner intends to limit the effect of TNF or a signalling pathway activated by it. In particular, the invention can be used to treat an inflammatory disease. In one embodiment, the condition is an inflammatory systemic disease, e.g., rheumatoid arthritis or psoriatic arthritis. In another embodiment, the disease is an inflammatory liver disease. Examples of inflammatory liver diseases include, but are not limited to, hepatitis associated with the hepatitis A, B, or C viruses, alcoholic liver disease, and non-alcoholic steatosis. In yet another embodiment, the inflammatory disease is a skin condition such as psoriasis.

    [0347] The uses of the present invention include, but are not limited to, treatment of diseases for which known TNF antagonists have been shown useful. Three specific TNF antagonists are currently FDA-approved. The drugs are etanercept (Enbrel), infliximab (Remicade) and adalimumab (Humira). One or more of these drugs is approved for the treatment of rheumatoid arthritis, juvenile rheumatoid arthritis, psoriasis, psoriatic arthritis, ankylosing spondylitis, and inflammatory bowel disease (Crohn's disease or ulcerative colitis).

    Use of Proteins for the Treatment of Inflammatory Diseases:

    [0348] Accordingly one embodiment of the invention is a method of treating an inflammatory disease or condition by administering SSOs to a patient, The SSOs that are administered alter the splicing of a pre-mRNA to produce a splice variant that encodes a stable, secreted, ligand-binding form of a receptor of the TNFR superfamily, thereby decreasing the activity of the ligand for that receptor. In another embodiment, the invention is a method of producing a stable, secreted, ligand-binding form of a receptor of the TNFR superfamily in a cell by administering SSOs to the cell.

    [0349] For therapeutic use, purified TNFR proteins of the present invention are administered to a patient, preferably a human, for treating TNF-dependent inflammatory diseases, such as arthritis. In the treatment of humans, the use of huTNFRs is preferred. The TNFR proteins of the present invention can be administered by bolus injection, continuous infusion, sustained release from implants, or other suitable techniques. Typically, TNFR therapeutic proteins will be administered in the form of a composition comprising purified protein in conjunction with physiologically acceptable carriers, excipients or diluents. Such carriers will be nontoxic to recipients at the dosages and concentrations employed. Ordinarily, the preparation of such compositions entails combining the TNFR with buffers, antioxidants such as ascorbic acid, polypeptides, proteins, amino acids, carbohydrates including glucose, sucrose or dextrins, chelating agents such as EDTA, glutathione and other stabilizers and excipients. Neutral buffered saline or saline mixed with conspecific serum albumin are exemplary appropriate diluents. Preferably, product is formulated as a lyophilizates using appropriate excipient solutions, for example, sucrose, as diluents. Preservatives, such as benzyl alcohol may also be added. The amount and frequency of administration will depend of course, on such factors as the nature and the severity of the indication being treated, the desired response, the condition of the patient and so forth.

    [0350] TNFR proteins of the present invention are administered systemically in therapeutically effective amounts preferably ranging from about 0.1 mg/kg/week to about 100 mg/kg/week. In preferred embodiments, TNFR is administered in amounts ranging from about 0.5 mg/kg/week to about 50 mg/kg/week. For local administration, dosages preferably range from about 0.01 mg/kg to about 1.0 mg/kg per injection.

    Use of Expression Vectors to Increase the Levels of a TNF Antagonist in a Mammal

    [0351] The present invention provides a process of increasing the levels of a TNF antagonist in a mammal. The process includes the step of transforming cells of the mammal with an expression vector described herein, which drives expression of a TNFR as described herein.

    [0352] The process is particularly useful in large mammals such as domestic pets, those used for food production, and primates. Exemplary large mammals are dogs, cats, horses cows, sheep, deer, and pigs. Exemplary primates are monkeys, apes, and humans.

    [0353] The mammalian cells can be transformed either in vivo or ex vivo. When transformed in vivo, the expression vector are administered directly to the mammal, such as by injection. Means for transforming cells in vivo are well known in the art. When transformed ex vivo, cells are removed from the mammal, transformed ex vivo, and the transformed cells are reimplanted into the mammal.

    [0354] The uses of the present invention include, but are not limited to, treatment of diseases for which known TNF antagonists have been shown useful. Three specific TNF antagonists are currently FDA-approved. The drugs are etanercept (Enbrel), infliximab (Remicade) and adalimumab (Humira). One or more of these drugs is approved for the treatment of rheumatoid arthritis, juvenile rheumatoid arthritis, psoriasis, psoriatic arthritis, ankylosing spondylitis, and inflammatory bowel disease (Crohn's disease or ulcerative colitis).

    [0355] The administration of the SSO to subjects can be accomplished using procedures developed for ASON. ASON have been successfully administered to experimental animals and human subjects by intravenous administration in saline in doses as high as 6 mg/kg three times a week (Yacysyhn, B. R., et al., 2002, Gut 51:30 (anti-ICAM-1 ASON for treatment of Crohn's disease); Stevenson, J., et al., 1999, J. Clinical Oncology 17:2227 (anti-RAF-1 ASON targeted to PBMC)). The pharmacokinetics of 2O-MOE phosphorothioate ASON, directed towards TNF- has been reported (Geary, R. S., et al., 2003, Drug Metabolism and Disposition 31:1419). The systemic efficacy of mixed LNA/DNA molecules has also been reported (Fluiter, K., et al., 2003, Nucleic Acids Res. 31:953).

    [0356] The systemic activity of SSO in a mouse model system was investigated using 2O-MOE phosphorothioates and PNA chemistries. Significant activity was observed in all tissues investigated except brain, stomach and dermis (Sazani, P., et al., 2002, Nature Biotechnology 20, 1228).

    [0357] In general any method of administration that is useful in conventional antisense treatments can be used to administer the SSO of the invention. For testing of the SSO in cultured cells, any of the techniques that have been developed to test ASON or SSO may be used.

    [0358] Formulations of the present invention comprise SSOs in a physiologically or pharmaceutically acceptable carrier, such as an aqueous carrier. Thus formulations for use in the present invention include, but are not limited to, those suitable for parenteral administration including intraperitoneal, intraarticular, intravenous, intraarterial, subcutaneous, or intramuscular injection or infusion, as well as those suitable for topical, ophthalmic, vaginal, oral, rectal or pulmonary (including inhalation or insufflation of powders or aerosols, including by nebulizer, intratracheal, intranasal delivery) administration. The formulations may conveniently be presented in unit dosage form and may be prepared by any of the methods well known in the art. The most suitable route of administration in any given case may depend upon the subject, the nature and severity of the condition being treated, and the particular active compound which is being used.

    [0359] Pharmaceutical compositions of the present invention include, but are not limited to, physiologically and pharmaceutically acceptable salts, i.e, salts that retain the desired biological activity of the parent compound and do not impart undesired toxicological properties. Examples of such salts are (a) salts formed with cations such as sodium, potassium, NH.sub.4.sup.+, magnesium, calcium, polyamines such as spermine and spermidine, etc.; (b) acid addition salts formed with inorganic acids, for example, hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, nitric acid and the like; and (c) salts formed with organic acids such as, for example, acetic acid, oxalic acid, tartaric acid, succinic acid, maleic acid, fumaric acid, gluconic acid, citric acid, malic acid, ascorbic acid, benzoic acid, tannic acid, palmitic acid, alginic acid, polyglutamic acid, napthalenesulfonic acid, methanesulfonic acid, p-toluenesulfonic acid, napthalenedisulfonic acid, polygalacturonic acid, and the like.

    [0360] The present invention provides for the use of SSOs having the characteristics set forth above for the preparation of a medicament for increasing the ratio of a mammalian TNFR2 protein that lacks exon 7 to its corresponding membrane bound form, in a patient afflicted with an inflammatory disorder involving TNF-, as discussed above. In the manufacture of a medicament according to the invention, the SSOs are typically admixed with, inter alia, an acceptable carrier. The carrier must, of course, be acceptable in the sense of being compatible with any other ingredients in the formulation and must not be deleterious to the patient. The carrier may be a solid or liquid. SSOs are incorporated in the formulations of the invention, which may be prepared by any of the well known techniques of pharmacy consisting essentially of admixing the components, optionally including one or more accessory therapeutic ingredients.

    [0361] Formulations of the present invention may comprise sterile aqueous and non-aqueous injection solutions of the active compounds, which preparations are preferably isotonic with the blood of the intended recipient and essentially pyrogen free. These preparations may contain antioxidants, buffers, bacteriostats, and solutes which render the formulation isotonic with the blood of the intended recipient. Aqueous and non-aqueous sterile suspensions can include, but are not limited to, suspending agents and thickening agents. The formulations may be presented in unit dose or multi-dose containers, for example, sealed ampoules and vials, and may be stored in freeze-dried (lyophilized) condition requiring only the addition of the sterile liquid carrier, for example, saline or water-for-injection immediately prior to use.

    [0362] In the formulation the SSOs may be contained within a particle or vesicle, such as a liposome, or microcrystal, which may be suitable for parenteral administration. The particles may be of any suitable structure, such as unilamellar or plurilameller, so long as the SSOs are contained therein. Positively charged lipids such as N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethyl-ammoniummethylsulfate, or DOTAP, are particularly preferred for such particles and vesicles. The preparation of such lipid particles is well known. [See references in U.S. Pat. No. 5,976,879 col. 6]

    [0363] The SSO can be targeted to any element or combination of elements that regulate splicing, including the 3 splice site, the 5 splice site, the branch point, the polypyrimidine tract, exonic splicing enhancers, exonic splicing silencers, intronic splicing enhancers, and intronic splicing silencers.

    [0364] Those skilled in the art can appreciate that the invention as directed toward human TNFR2 can be practiced using SSO having a sequence that is complementary to at least 8, to at least 9, to at least 10, to at least 11, to at least 12, to at least 13, to at least 14, to at least 15, preferably between 10 and 16 nucleotides of the portions of the TNFR1 or TNFR2 gene comprising exons 7 and its adjacent introns.

    [0365] SEQ ID No: 3 contains the sequence of exon 7 of TNFR2 and 50 adjacent nucleotides of the flanking introns. For example, SSO targeted to human TNFR2 can have a nucleobase sequence selected from the sequences listed in Table 4. When affinity-enhancing modifications are used, including but not limited to LNA or G-clamp nucleotides, the skilled person recognizes the length of the SSO can be correspondingly reduced.

    [0366] Those skilled in the art will also recognize that the selection of SSO sequences must be made with care to avoid a self-complementary SSO, which may lead to the formation of partial hairpin duplex structures. In addition, high GC content should be avoided to minimize the possibility of non-specific base pairing. Furthermore, SSOs matching off-target genes, as revealed for example by BLAST, should also be avoided.

    [0367] In some situations, it may be preferred to select an SSO sequence that can target a human and at least one other species. These SSOs can be used to test and to optimize the invention in said other species before being used in humans, thereby being useful for regulatory approval and drug development purposes. For example, SSOs with sequences selected from SEQ ID Nos: 14, 30, 46, 70 and 71 which target human TNFR2 are also 100% complementary to the corresponding Macaca Mullata sequences. As a result these sequences can be used to test treatments in monkeys, before being used in humans.

    [0368] The following aspects of the present invention discussed below apply to the foregoing embodiments.

    [0369] The length of the SSO is similar to an antisense oligonucleotide (ASON), typically between about 10 and 24 nucleotides. The invention can be practiced with SSOs of several chemistries that hybridize to RNA, but that do not activate the destruction of the RNA by RNase H, as do conventional antisense 2.sup.r-deoxy oligonucleotides. The invention can be practiced using 20 modified nucleic acid oligomers, such as 2O-methyl or 2O-methyloxyethyl phosphorothioate. The nucleobases do not need to be linked to sugars; so-called peptide nucleic acid oligomers or morpholine-based oligomers can be used. A comparison of these different linking chemistries is found in Sazani, P. et al, 2001, Nucleic Acids Res. 29:3695. The term splice-switching oligonucleotide is intended to cover the above forms. Those skilled in the art will appreciate the relationship between antisense oligonucleotide gapmers and SSOs. Gapmers are ASON that contain an RNase H activating region (typically a 2-deoxyribonucleoside phosphorothioate) which is flanked by non-activating nuclease resistant oligomers. In general, any chemistry suitable for the flanking sequences in a gapmer ASON can be used in an SSO.

    [0370] The SSOs of this invention may be made through the well-known technique of solid phase synthesis. Any other means for such synthesis known in the art may additionally or alternatively be used. It is well known to use similar techniques to prepare oligonucleotides such as the phosphorothioates and alkylated derivatives.

    [0371] A particularly preferred chemistry is provided by locked nucleic acids (LNA) (Koshkin, A. A., et al., 1998, Tetrahedron 54:3607; Obika, S., et al., 1998, Tetrahedron Lett. 39:5401). LNA are conventional phosphodiester-linked ribonucleotides, except the ribofuranosyl moiety is made bicyclic by a bridge between the 20 and the 4.sup.1C. This bridge constrains the conformation of ribofuranosyl ring into the conformation, the V-endo conformation, which is adopted when a oligonucleotide hybridizes to a complementary RNA. Recent advances in the synthesis of LNA are described in WO 03/095467. The bridge is most typically a methylene or an ethylene. The synthesis of 20,4C-ethylene-bridged nucleic acids (ENA), as well as other LNA, is described in Morita, et al., 2003, Bioorg. and Med. Chem. 11:2211. However, alternative chemistries can be used and the 2O may be replaced by a 2N. LNA and conventional nucleotides can be mixed to form a chimeric SSO. For example, chimeric SSO of alternating LNA and 2deoxynucleotides or alternating LNA and 2O-Me or 2O-MOE can be employed. An alternative to any of these chemistries, not merely the 2-deoxynucleotides, is a phosphorothioatediester linkage replacing phosphodiester. For in vivo use, phosphorothioate linkages are preferred.

    [0372] When LNA nucleotides are employed in an SSO it is preferred that non-LNA nucleotides also be present. LNA nucleotides have such high affinities of hybridization that there can be significant non-specific binding, which may reduce the effective concentration of the free-SSO. When LNA nucleotides are used they may be alternated conveniently with 2-deoxynucleotides. Alternating nucleotides, alternating dinucleotides or mixed patterns, e.g., LDLDLD or LLDLLD or LDDLDD can be used, When 2-deoxynucleotides or 2-deoxynucleoside phosphorothioates are mixed with LNA nucleotides it is important to avoid RNase H activation. It is expected that between about one third and two thirds of the LNA nucleotides of an SSO will be suitable. For example if the SSO is a 12-mer, then at least four LNA nucleotides and four conventional nucleotides will be present.

    [0373] The bases of the SSO may be the conventional cytosine, guanine, adenine and uracil or thymidine. Alternatively modified bases can also be used. Of particular interest are modified bases that increase binding affinity. One non-limiting example of preferred modified bases are the so-called G-clamp or 9-(aminoethoxy)phenoxazine nucleotides, cytosine analogs that form 4 hydrogen bonds with guanosine. (Flanagan, W. M., et al., 1999, Proc. Natl. Acad. Sci. 96:3513; Holmes, S. C., 2003, Nucleic Acids Res. 31:2759).

    [0374] Numerous alternative chemistries which do not activate RNase H are available. For example, suitable SSOs may be oligonucleotides wherein at least one, or all, of the internucleotide bridging phosphate residues are modified phosphates, such as methyl phosphonates, methyl phosphonothioates, phosphoromorpholidates, phosphoropiperazidates, and phosphoroamidates. For example, every other one of the internucleotide bridging phosphate residues may be modified as described. In another non-limiting example, such SSO are oligonucleotides wherein at least one, or all, of the nucleotides contain a 2 lower alkyl moiety (e.g., C1-C4, linear or branched, saturated or unsaturated alkyl, such as methyl, ethyl, ethenyl, propyl, 1-propenyl, 2-propenyl, and isopropyl). For example, every other one of the nucleotides may be modified as described. [See references in U.S. Pat. No. 5,976,879 col. 4].

    [0375] The length of the SSO (i.e. the number of monomers in the oligomer) will be from about 10 to about 30 bases in length. In one embodiment, 20 bases of 2O-Me-ribonucleosides phosphorothioates are effective. Those skilled in the art appreciate that when affinity-increasing chemical modifications are used, the SSO can be shorter and still retain specificity. Those skilled in the art will further appreciate that an upper limit on the size of the SSO is imposed by the need to maintain specific recognition of the target sequence, and to avoid secondary-structure forming self hybridization of the SSO and by the limitations of gaining cell entry. These limitations imply that an SSO of increasing length (above and beyond a certain length which will depend on the affinity of the SSO) will be more frequently found to be less specific, inactive or poorly active.

    [0376] SSOs of the invention include, but are not limited to, modifications of the SSO involving chemically linking to the SSO one or more moieties or conjugates which enhance the activity, cellular distribution or cellular uptake of the SSO. Such moieties include, but are not limited to, lipid moieties such as a cholesterol moiety, cholic acid, a thioether, e.g. hexyl-S-tritylthiol, a thiocholesterol, an aliphatic chain, e.g., dodecandiol or undecyl residues, a phospholipids, e.g., di-hexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate, a polyamine or a polyethylene glycol chain, an adamantane acetic acid, a palmityl moiety, an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety.

    [0377] It is not necessary for all positions in a given SSO to be uniformly modified, and in fact more than one of the aforementioned modifications may be incorporated in a single compound or even at a single nucleoside within an SSO.

    [0378] The SSOs may be admixed, encapsulated, conjugated, or otherwise associated with other molecules, molecule structures, or mixtures of compounds, as for example liposomes, receptor targeted molecules, oral, rectal, topical or other formulation, for assisting in uptake, distribution, and/or absorption.

    [0379] Those skilled in the art appreciate that cellular differentiation includes, but is not limited to, differentiation of the spliceosome. Accordingly, the activity of any particular SSO of the invention can depend upon the cell type into which they are introduced. For example, SSOs which are effective in cell type may be ineffective in another cell type.

    [0380] The methods, oligonucleotides, and formulations of the present invention are also useful as in vitro or in vivo tools to examine splicing in human or animal genes. Such methods can be carried out by the procedures described herein, or modifications thereof which will be apparent to skilled persons.

    [0381] The invention can be used to treat any condition in which the medical practitioner intends to limit the effect of a TNF superfamily ligand or the signalling pathway activated by such ligand. In particular, the invention can be used to treat an inflammatory disease. In one embodiment, the condition is an inflammatory systemic disease, e.g., rheumatoid arthritis or psoriatic arthritis. In another embodiment, the disease is an inflammatory liver disease. Examples of inflammatory liver diseases include, but are not limited to, hepatitis associated with the hepatitis A, B, or C viruses, alcoholic liver disease, and non-alcoholic steatosis. In yet another embodiment, the inflammatory disease is a skin condition such as psoriasis.

    [0382] The uses of the present invention include, but are not limited to, treatment of diseases for which known TNF antagonists have been shown useful. Three specific TNF antagonists are currently FDA-approved. The drugs are etanercept (Enbrel), infliximab (Remicade) and adalimumab (Humira). One or more of these drugs is approved for the treatment of rheumatoid arthritis, juvenile rheumatoid arthritis, psoriasis, psoriatic arthritis, ankylosing spondylitis, and inflammatory bowel disease (Crohn's disease or ulcerative colitis).

    [0383] In a preferred embodiment, the receptor is either the TNFR1 or TNFR2 receptors. In other embodiments, the receptor is a member of the TNFR superfamily that is sufficiently homologous to TNFR1 and TNFR2, e.g., TNFRSF3, TNFRSF5, or TNFRSF1IA, so that deletion of either or both exons homologous to exons 7 and 8 results in a secreted form. Those skilled in the art appreciate that the operability of the invention is not determined by whether or not such secreted forms are physiological, only that the products of such splice variants are secreted, stable, and capable of ligand-binding.

    [0384] The administration of the SSO to subjects can be accomplished using procedures developed for ASON. ASON have been successfully administered to experimental animals and human subjects by intravenous administration in saline in doses as high as 6 mg/kg three times a week (Yacysyhn, B. R., et al, 2002, Gut 51:30 (anti-ICAM-1 ASON for treatment of Crohn's disease); Stevenson, J., et al., 1999, J. Clinical Oncology 17:2227 (anti-RAF-1 ASON targeted to PBMC)). The pharmacokinetics of 20-MOE phosphorothioate ASON, directed towards TNF-alpha has been reported (Geary, R. S., et al., 2003, Drug Metabolism and Disposition 31:1419). The systemic efficacy of mixed LNA/DNA molecules has also been reported (Fluiter, K., et al., 2003, Nucleic Acids Res. 31:953).

    [0385] The systemic activity of SSO in a mouse model system was investigated using 20-MOE phosphorothioates and PNA chemistries. Significant activity was observed in all tissues investigated except brain, stomach and dermis (Sazani, P., et al., 2002, Nature Biotechnology 20, 1228).

    [0386] In general any method of administration that is useful in conventional antisense treatments can be used to administer the SSO of the invention. For testing of the SSO in cultured cells, any of the techniques that have been developed to test ASON or SSO may be used.

    [0387] Formulations of the present invention comprise SSOs in a physiologically or pharmaceutically acceptable carrier, such as an aqueous carrier. Thus formulations for use in the present invention include, but are not limited to, those suitable for parenteral administration including intraperitoneal, intravenous, intraarterial, subcutaneous, or intramuscular injection or infusion, as well as those suitable topical (including ophthalmic and to mucous membranes including vaginal delivery), oral, rectal or pulmonary (including inhalation or insufflation of powders or aerosols, including by nebulizer, intratracheal, intranasal delivery) administration. The formulations may conveniently be presented in unit dosage form and may be prepared by any of the methods well known in the art. The most suitable route of administration in any given case may depend upon the subject, the nature and severity of the condition being treated, and the particular active compound which is being used.

    [0388] Pharmaceutical compositions of the present invention include, but are not limited to, the physiologically and pharmaceutically acceptable salts thereof: i.e, salts that retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto. Examples of such salts are (a) salts formed with cations such as sodium, potassium, NH.sub.4.sup.+, magnesium, calcium, polyamines such as spermine and spermidine, etc.; (b) acid addition salts formed with inorganic acids, for example, hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, nitric acid and the like; (c) salts formed with organic acids such as, for example, acetic acid, oxalic acid, tartaric acid, succinic acid, maleic acid, fumaric acid, gluconic acid, citric acid, malic acid, ascorbic acid, benzoic acid, tannic acid, palmitic acid, alginic acid, polyglutamic acid, napthalenesulfonic acid, methanesulfonic acid, p-toluenesulfonic acid, napthalenedisulfonic acid, polygalacturonic acid, and the like; and (d) salts formed from elemental anions such as chlorine, bromine, and iodine.

    [0389] The present invention provides for the use of SSOs having the characteristics set forth above for the preparation of a medicament for increasing the ratio of a soluble form of a TNFR superfamily member to its corresponding membrane bound form, in a patient afflicted with an inflammatory disorder involving excessive activity of a cytokine, such as TNF-, as discussed above. In the manufacture of a medicament according to the invention, the SSOs are typically admixed with, inter alia, an acceptable carrier. The carrier must, of course, be acceptable in the sense of being compatible with any other ingredients in the formulation and must not be deleterious to the patient. The carrier may be a solid or liquid. SSOs are incorporated in the formulations of the invention, which may be prepared by any of the well known techniques of pharmacy consisting essentially of admixing the components, optionally including one or more accessory therapeutic ingredients.

    [0390] Formulations of the present invention may comprise sterile aqueous and nonaqueous injection solutions of the active compounds, which preparations are preferably isotonic with the blood of the intended recipient and essentially pyrogen free. These preparations may contain antioxidants, buffers, bacteriostats, and solutes which render the formulation isotonic with the blood of the intended recipient. Aqueous and non-aqueous sterile suspensions can include, but are not limited to, suspending agents and thickening agents. The formulations may be presented in unit dose or multi-dose containers, for example, sealed ampoules and vials, and may be stored in freeze-dried (lyophilized) condition requiring only the addition of the sterile liquid carrier, for example, saline or water-for-injection immediately prior to use.

    [0391] In the formulation the SSOs may be contained within a lipid particle or vesicle, such as a liposome or microcrystal, which may be suitable for parenteral administration. The particles may be of any suitable structure, such as unilamellar or plurilameller, so long as the SSOs are contained therein. Positively charged lipids such as N-[1-(2,3-dioleoyloxi)propyl]-N,N,N-trimethyl-ammoniummethylsulfate, or DOTAP, are particularly preferred for such particles and vesicles. The preparation of such lipid particles is well known. [See references in U.S. Pat. No. 5,976,879 col. 6]

    [0392] The SSO can be targeted to any element or combination of elements that regulate splicing, including the 3 splice site, the 5 splice site, the branch point, the polypyrimidine tract, exonic splicing enhancers, exonic splicing silencers, intronic splicing enhancers, and intronic splicing silencers. The determination of the sequence of the SSO can be guided by the following tables that shows the activities of the SSOs whose sequences and locations are found as depicted in FIGS. 4, 5, and 8. The person skilled in the art will note that: 1) SSOs complementary to the exon need not be complementary to either the splice acceptor or splice donor sites, note SSOs A7-10, B7-7 and B7-9, Table 1; 2) SSOs complementary to sequences of the intron and as few as one nucleotide of the exon can be operative, note A8-5 and B7-6,

    [0393] Table 1; 3) SSOs complementary to the intron immediately adjacent to the exon can also be effective, note 3312, Table 2; and 4) efficacy of an oligonucleotide alone is usually predictive of the efficacy of the SSO in combination with other SSOs.

    [0394] Those skilled in the art can appreciate that the invention as directed toward human TNF-alpha receptors can be practiced using SSO having a sequence that is complementary to at least 10, preferably between 15 and 20 nucleotides of the portions of the TNFR1 or TNFR2 genes comprising exons 7 or 8 and their adjacent introns. It is further preferred that at least one nucleotide of the exon itself is included within the complementary sequence. SEQ ID Nos: 1-4 contain the sequence of Exons 7 and 8 of the TNFR1 (SEQ ID Nos: 1 and 2) and TNFR2 (SEQ ID Nos; 3 and 4) and 50 adjacent nucleotides of the flanking introns. When affinity-enhancing modifications are used, including but not limited to LNA or G-clamp nucleotides, the skilled person recognizes the length of the SSO can be correspondingly reduced. When alternating conventional and LNA nucleotides are used a length of 16 is effective.

    [0395] Those skilled in the art will also recognize that the selection of SSO sequences must be made with care to avoid self-complementary SSO, which may lead to the formation of partial hairpin duplex structures. In addition, high GC content should be avoided to minimize the possibility of non-specific base pairing. Furthermore, SSOs matching off-target genes, as revealed for example by BLAST, should also be avoided.

    [0396] In some situations, it may be preferred to select an SSO sequence that can target a human and at least one other species. These SSOs can be used to test and to optimize the invention in said other species before being used in humans, thereby being useful for regulatory approval and drug development purposes. For example, SEQ ID Nos: 74, 75, 77, 78, 80, and 89, which target human TNFR2 are also 100% complementary to the corresponding Macaca Mullata sequences. As a result these sequences can be used to test treatments in monkeys, before being used in humans.

    [0397] It will be appreciated by those skilled in the art that various omissions, additions and modifications may be made to the invention described above without departing from the scope of the invention, and all such modifications and changes are intended to fall within the scope of the invention, as defined by the appended claims. All references, patents, patent applications or other documents cited are herein incorporated by reference.

    [0398] In the sequence listing below, SEQ ID NOs 1-116 are as disclosed in WO2007/058894. SEQ IDs NOs 117-242 are as disclosed as SEQ ID NOs 1-126 of PCT/US2007/10557. SEQ IDs NOs 243-246 are new to the present application, and are preferred oligomers according to the invention.

    TABLE-US-00001 TABLE4 SpliceSwitchingOligomerstargetinghumanTNFR2:Capitalletters= LNA, smallletters= DNA)-NoteSEQIDNo243targetsthemouseTNFR2. SEQ ID Name Sequence(5-3) Description NucleobaseMotif 3378 130 SK100 CcAcAaTcAgTcCtA 3378FullLength CCACAATCAGTC g CTAG 131 SK101 AcAaTcAgTcCtAg -2nt5 (14mer) ACAATCAGTC CTAG 132 SK102 AaTcAgTcCtAg -4nt5 (12mer) AATCAGTC CTAG 133 SK103 TcAgTcCtAg -6nt5 (10mer) TCAGTCCTA G 134 SK104 CcAcAaTcAgTcCt -2nt3 (14mer) CCACAATCAGTC CT 135 SK105 CcAcAaTcAgTc -4nt3 (12mer) CCACAATCAGTC 136 SK106 CcAcAaTcAg -6nt3 (10mer) CCACAATCAG 137 SK107 CaCaAtCaGtCcTa -1nt5;-1nt3 (14mer) CACAATCAGTC CTA 138 SK108 CaCaAtCaGtCc -1nt5;-3nt3 (12mer) CACAATCAGTC C 139 SK109 AcAaTcAgTcCt -2nt5;-2nt3 (12mer) ACAATCAGTC CT 140 SK110 CaAtCaGtCcTa -3nt5;-1nt3 (12mer) CAATCAGTC CTA 141 SK111 CaCaAtCaGt -1nt5;-5nt3 (10mer) CACAATCAGT 142 SK112 AcAaTcAgTc -2nt5;-4nt3 (10mer) ACAATCAGTC 143 SK113 CaAtCaGtCc -3nt5;-3nt3 (10mer) CAATCAGTCC 144 SK114 AaTcAgTcCt -4nt5;-2nt3 (10mer) AATCAGTCCT 145 SK115 AtCaGtCcTa -5nt5;-1nt3 (10mer) ATCAGTCCTA 3379 146 SK116 CaGtCcTaGaAaGaA 3379FullLength CCACAATCAGTC a CTAG 147 SK117 GtCcTaGaAaGaAa -2nt5 (14mer) GTCCTAGAAA GAAA 148 SK118 CcTaGaAaGaAa -4nt5 (12mer) CCTAGAAAGAA A 149 SK119 TaGaAaGaAa -6nt5 (10mer) TAGAAAGAAA 150 SK120 CaGtCcTaGaAaGa -2nt3 (14mer) CAGTCCTAGAAA GA 151 SK121 CaGtCcTaGaAa -4nt3 (12mer) CAGTCCTAGAAA 152 SK122 CaGtCcTaGa -6nt3 (10mer) CAGTCCTAGA 153 SK123 AgTcCtAgAaAgAa -1nt5;-1nt3 (14mer) AGTCCTAGAAA GAA 154 SK124 AgTcCtAgAaAg -1nt5;-3nt3 (12mer) AGTCCTAGAAAG 155 SK125 GtCcTaGaAaGa -2nt5;-2nt3 (12mer) GTCCTAGAAAGA 156 SK126 TcCtAgAaAgAa -3nt5;-1nt3 (12mer) TCCTAGAAAGAA 157 SK127 AgTcCtAgAa -1nt5;-5nt3 (10mer) AGTCCTAGAA 158 SK128 GtCcTaGaAa -2nt5;-4nt3 (10mer) GTCCTAGAAA 159 SK129 TcCtAgAaAg -3nt5;-3nt3 (10mer) TCCTAGAAAG 160 SK130 CcTaGaAaGa -4nt5;-2nt3 (10mer) CCTAGAAAGA 161 SK131 CtAgAaAgAa -5nt5;-1nt3 (10mer) CTAGAAAGAA 3384 162 SK132 AcTtTtCaCcTgGgT 3384FullLength CCACAATCAGTC c CTAG 163 SK133 TtTtCaCcTgGgTc -2nt5 (14mer) TTTTCACCTGGGT C 164 SK134 TtCaCcTgGgTc -4nt5 (12mer) TTCACCTGGGT C 165 SK135 CaCcTgGgTc -6nt5 (10mer) CACCTGGGTC 166 SK136 AcTtTtCaCcTgGg -2nt3 (14mer) ACTTTTCACCTG GG 167 SK137 AcTtTtCaCcTg -4nt3 (12mer) ACTTTTCACCTG 168 SK138 AcTtTtCaCc -6nt3 (10mer) ACTTTTCACC 169 SK139 CtTtTcAcCtGgGt -1nt5;-1nt3 (14mer) CTTTTCACCTG GGT 170 SK140 CtTtTcAcCtGg -1nt5;-3nt3 (12mer) CTTTTCACCTGG 171 SK141 TtTtCaCcTgGg -2nt5;-2nt3 (12mer) TTTTCACCTGGG 172 SK142 TtTcAcCtGgGt -3nt5;-1nt3 (12mer) TTTCACCTGGGT 173 SK143 CtTtTcAcCt -1nt5;-5nt3 (10mer) CTTTTCACCT 174 SK144 TtTtCaCcTg -2nt5;-4nt3 (10mer) TTTTCACCTG 175 SK145 TtTcAcCtGg -3nt5;-3nt3 (10mer) TTTCACCTGG 176 SK146 TtCaCcTgGg -4nt5;-2nt3 (10mer) TTCACCTGGG 177 SK147 TcAcCtGgGt -5nt5;-1nt3 (10mer) TCACCTGGGT SEQID Sequence lenght SEQID custom-character a.sub.scustom-character t.sub.scustom-character a.sub.scustom-character t.sub.scustom-character c.sub.scustom-character a.sub.scustom-character g.sub.scustom-character a 16 243 SEQID custom-character c.sub.scustom-character c.sub.scustom-character a.sub.scustom-character c.sub.scustom-character g.sub.scustom-character c.sub.scustom-character t.sub.scustom-character g 16 244 SK100 SEQID custom-character a.sub.scustom-character a.sub.scustom-character t.sub.scustom-character a.sub.scustom-character tscustom-character c.sub.scustom-character a 14 245 SK107 SEQID custom-character c.sub.scustom-character a.sub.scustom-character c.sub.scustom-character g.sub.scustom-character c.sub.scustom-character t 12 246 SK109 SEQID custom-character c.sub.scustom-character a.sub.scustom-character c.sub.scustom-character g.sub.scustom-character c.sub.scustom-character t.sub.scustom-character g 14 251 SK101 SEQID custom-character a.sub.scustom-character c.sub.scustom-character g.sub.scustom-character c.sub.scustom-character t.sub.scustom-character g 12 252 SK102 SEQID custom-character c.sub.scustom-character g.sub.scustom-character c.sub.scustom-character t.sub.scustom-character g 10 253 SK103 SEQID custom-character c.sub.scustom-character c.sub.scustom-character a.sub.scustom-character c.sub.scustom-character g.sub.scustom-character c.sub.scustom-character t 14 254 SK104 SEQID custom-character c.sub.scustom-character c.sub.scustom-character a.sub.scustom-character c.sub.scustom-character g.sub.scustom-character c 12 255 SK105 SEQID custom-character c.sub.scustom-character c.sub.scustom-character a.sub.scustom-character c.sub.scustom-character g 10 256 SK106 SEQID custom-character a.sub.scustom-character a.sub.scustom-character t.sub.scustom-character a.sub.scustom-character t.sub.scustom-character c 12 257 SK108 SEQID custom-character a.sub.scustom-character t.sub.scustom-character a.sub.scustom-character t.sub.scustom-character c.sub.scustom-character a 12 258 SK110 SEQID custom-character a.sub.scustom-character a.sub.scustom-character t.sub.scustom-character a.sub.scustom-character t 10 259 SK111 SEQID custom-character c.sub.scustom-character a.sub.scustom-character c.sub.scustom-character g.sub.scustom-character c 10 260 SK112 SEQID custom-character a.sub.scustom-character t.sub.scustom-character a.sub.scustom-character t.sub.scustom-character c 10 261 SK113 SEQID custom-character a.sub.scustom-character c.sub.scustom-character g.sub.scustom-character c.sub.scustom-character t 10 262 SK114 SEQID custom-character t.sub.scustom-character a.sub.scustom-character t.sub.scustom-character c.sub.scustom-character a 10 263 SK115 SEQID custom-character a.sub.scustom-character t.sub.scustom-character c.sub.scustom-character a.sub.scustom-character a.sub.scustom-character a.sub.scustom-character a.sub.scustom-character a 16 264 SK116 SEQID custom-character t.sub.scustom-character c.sub.scustom-character a.sub.scustom-character a.sub.scustom-character a.sub.scustom-character a.sub.scustom-character a 14 265 SK117 SEQID custom-character c.sub.scustom-character a.sub.scustom-character a.sub.scustom-character a.sub.scustom-character a.sub.scustom-character a 12 266 SK118 SEQID custom-character a.sub.scustom-character a.sub.scustom-character a.sub.scustom-character a.sub.scustom-character a 10 267 SK119 SEQID custom-character a.sub.scustom-character t.sub.scustom-character c.sub.scustom-character a.sub.scustom-character a.sub.scustom-character a.sub.scustom-character a 14 268 SK120 SEQID custom-character a.sub.scustom-character t.sub.scustom-character c.sub.scustom-character a.sub.scustom-character a.sub.scustom-character a 12 269 SK121 SEQID custom-character a.sub.scustom-character t.sub.scustom-character c.sub.scustom-character a.sub.scustom-character a 10 270 SK122 SEQID custom-character g.sub.scustom-character c.sub.scustom-character t.sub.scustom-character g.sub.scustom-character a.sub.scustom-character g.sub.scustom-character a 14 271 SK123 SEQID custom-character g.sub.scustom-character c.sub.scustom-character t.sub.scustom-character g.sub.scustom-character a.sub.scustom-character g 12 272 SK124 SEQID custom-character t.sub.scustom-character c.sub.scustom-character a.sub.scustom-character a.sub.scustom-character a.sub.scustom-character a 12 273 SK125 SEQID custom-character c.sub.scustom-character t.sub.scustom-character g.sub.scustom-character a.sub.scustom-character g.sub.scustom-character a 12 274 SK126 SEQID custom-character g.sub.scustom-character c.sub.scustom-character t.sub.scustom-character g.sub.scustom-character a 10 275 SK127 SEQID custom-character t.sub.scustom-character c.sub.scustom-character a.sub.scustom-character a.sub.scustom-character a 10 276 SK128 SEQID custom-character c.sub.scustom-character t.sub.scustom-character g.sub.scustom-character a.sub.scustom-character g 10 277 SK129 SEQID custom-character c.sub.scustom-character a.sub.scustom-character a.sub.scustom-character a.sub.scustom-character a 10 278 SK130 SEQID custom-character t.sub.scustom-character g.sub.scustom-character a.sub.scustom-character g.sub.scustom-character a 10 279 SK131 SEQID custom-character c.sub.scustom-character t.sub.scustom-character t.sub.scustom-character a.sub.scustom-character c.sub.scustom-character g.sub.scustom-character g.sub.scustom-character c 16 280 SK132 SEQID custom-character t.sub.scustom-character t.sub.scustom-character a.sub.scustom-character c.sub.scustom-character g.sub.scustom-character g.sub.scustom-character c 14 281 SK133 SEQID custom-character t.sub.scustom-character a.sub.scustom-character c.sub.scustom-character g.sub.scustom-character g.sub.scustom-character c 12 282 SK134 SEQID custom-character a.sub.scustom-character c.sub.scustom-character g.sub.scustom-character g.sub.scustom-character c 10 283 SK135 SEQID custom-character c.sub.scustom-character t.sub.scustom-character t.sub.scustom-character a.sub.scustom-character c.sub.scustom-character g.sub.scustom-character g 14 284 SK136 SEQID custom-character c.sub.scustom-character t.sub.scustom-character t.sub.scustom-character a.sub.scustom-character c.sub.scustom-character g 12 285 SK137 SEQID custom-character c.sub.scustom-character t.sub.scustom-character t.sub.scustom-character a.sub.scustom-character c 10 286 SK138 SEQID custom-character t.sub.scustom-character t.sub.scustom-character c.sub.scustom-character c.sub.scustom-character t.sub.scustom-character g.sub.scustom-character t 14 287 SK139 SEQID custom-character t.sub.scustom-character t.sub.scustom-character c.sub.scustom-character c.sub.scustom-character t.sub.scustom-character g 12 288 SK140 SEQID custom-character t.sub.scustom-character t.sub.scustom-character a.sub.scustom-character c.sub.scustom-character g.sub.scustom-character g 12 289 SK141 SEQID custom-character t.sub.scustom-character c.sub.scustom-character c.sub.scustom-character t.sub.scustom-character g.sub.scustom-character t 12 290 SK142 SEQID custom-character t.sub.scustom-character t.sub.scustom-character c.sub.scustom-character c.sub.scustom-character t 10 291 SK143 SEQID custom-character t.sub.scustom-character t.sub.scustom-character a.sub.scustom-character c.sub.scustom-character g 10 292 SK144 SEQID custom-character t.sub.scustom-character c.sub.scustom-character c.sub.scustom-character t.sub.scustom-character g 10 293 SK145 SEQID custom-character t.sub.scustom-character a.sub.scustom-character c.sub.scustom-character g.sub.scustom-character g 10 294 SK146 SEQID custom-character c.sub.scustom-character c.sub.scustom-character t.sub.scustom-character g.sub.scustom-character t 10 295 SK147 Capital letters = LNA, preferably oxy LNA (superscript o), preferably phosphorothioate linkages = subscript s, small letters = DNA). .sup.mC = preferably, 5-methylcytosine.

    FURTHER EMBODIMENTS OF THE INVENTION

    [0399] The invention provides for a method of treating an inflammatory disease or condition which comprises administering one or more splice switching oligomers (SSOs) to a subject for a time and in an amount to reduce the activity of a ligand for a receptor of the tumor necrosis factor receptor (TNFR) superfamily, wherein said one or more SSOs are capable of altering the splicing of a pre-mRNA encoding said receptor to increase production of a stable, secreted, ligand-binding form of said receptor.

    [0400] In one embodiment the mammalian receptor selected from the group consisting of TNFRSF1A, TNFRSF1B, TNFRSF3, TNFRSF5, TNFRSF8, and TNFRSF11A.

    [0401] In one embodiment the receptor is a human TNFRSF1A or a human TNFRSF1B.

    [0402] In one embodiment the receptor is a human TNFRSF1B.

    [0403] In one embodiment the ligand is TNF-.alpha., RANKL, CD40L, LT-.alpha., or LT-.beta.

    [0404] In one embodiment the disease or condition is selected from the group consisting of rheumatoid arthritis, juvenile rheumatoid arthritis, psoriasis, psoriatic arthritis, ankylosing spondylitis, inflammatory bowel disease (Crohn's disease or ulcerative colitis), hepatitis, sepsis, alcoholic liver disease, and non-alcoholic steatosis.

    [0405] In one embodiment of the method of treating an inflammatory disease or condition the two or more SSOs are administered.

    [0406] In one embodiment the receptor is TNFRSF1A, TNFRSF1B, TNFRSF3, TNFRSF5, or TNFRSF11A, and said altering the splicing of said pre-mRNA comprises excising exon 7, exon 8, or both from said pre-mRNA.

    [0407] In one embodiment said altering the splicing of said pre-mRNA comprises excising exon 7.

    [0408] In one embodiment said receptor is a human TNFRSF1A or a human TNFRSF1B, and said SSO comprises from at least 10 to at least 20 nucleotides which are complementary to a contiguous sequence from SEQ ID Nos: 1, 2, 3 or 4.

    [0409] In one embodiment the sequence of said SSO comprises a sequence selected from the group consisting of SEQ ID Nos: 74, 75, 77, 78, 80, 82, 84, and 86-89.

    [0410] In one embodiment said SSOs comprise one or more nucleotides or nucleosides independently selected from the group consisting of 2-deoxyribonucleotides, 2O-Me ribonucleotides, 2O-MOE ribonucleotides, hexitol (HNA) nucleotides or nucleosides, 2O-4C-linked bicyclic ribofuranosyl (LNA) nucleotides or nucleosides, phosphorothioate analogs of any of the foregoing, peptide nucleic acid (PNA) analogs of any of the foregoing; methylphosponate analogs of any of the foregoing, peptide nucleic acid analogs of any of the foregoing, N3.fwdarw.P5 phosphoramidate analogs of any of the foregoing, and phosphorodiamidate morpholino nucleotide analogs of any of the foregoing, and combinations thereof.

    [0411] In one embodiment said SSOs comprise one or more nucleotides or nucleosides independently selected from the group consisting of 2O-Me ribonucleotides and 2O-4C-linked bicyclic ribofuranosyl (LNA) nucleotides or nucleosides.

    [0412] In one embodiment said administration is parenteral, topical, oral, rectal, or pulmonary.

    [0413] In one embodiment the invention provides for a method of increasing the production of a stable, secreted, ligand-binding form of a receptor from the TNFR superfamily in a cell, which comprises administering one or more splice switching oligomers (SSOs) to said cell, wherein said one or more SSOs are capable of altering the splicing of a pre-mRNA encoding said receptor to increase production of a stable, secreted, ligand-binding form of said receptor.

    [0414] In one embodiment the method is performed in vivo.

    [0415] In one embodiment said receptor is a mammalian receptor selected from the group consisting of TNFRSF1A, TNFRSF1B, TNFRSF3, TNFRSF5, TNFRSF8, and TNFRSF1A.

    [0416] In one embodiment said receptor is a human TNFRSF1A or a human TNFRSF1B.

    [0417] In one embodiment said receptor is a human TNFRSF1B.

    [0418] In one embodiment said SSO comprises from at least 10 to at least 20 nucleotides which are complementary to a contiguous sequence from SEQ ID Nos: 1, 2, 3 or 4.

    [0419] In one embodiment the invention provides for a splice switching oligomer (SSO) comprising from at least 10 to at least 20 nucleotides, said SSO capable of altering the splicing of a pre-mRNA encoding a receptor from the TNFR superfamily to produce a stable, secreted, ligand-binding form of said receptor.

    [0420] In one embodiment said receptor is a mammalian receptor selected from the group consisting of TNFRSF1A, TNFRSF1B, TNFRSF3, TNFRSF5, TNFRSF8, and TNFRSF11A.

    [0421] In one embodiment said receptor is a human TNFRSF1A or a human TNFRSF1B.

    [0422] In one embodiment said receptor is a human TNFRSF1B.

    [0423] In one embodiment the SSO comprises from at least 10 to at least 20 nucleotides which are complementary to a contiguous sequence from SEQ ID Nos: 1, 2, 3 or 4.

    [0424] In one embodiment the SSO comprises one or more nucleotides or nucleosides independently selected from the group consisting of 2-deoxyribonucleotides, 2O-Me ribonucleotides, 2O-MOE ribonucleotides, hexitol (HNA) nucleotides or nucleosides, 2O-4C-linked bicyclic ribofuranosyl (LNA) nucleotides or nucleosides, phosphorothioate analogs of any of the foregoing, peptide nucleic acid (PNA) analogs of any of the foregoing; methylphosponate analogs of any of the foregoing, peptide nucleic acid analogs of any of the foregoing, N3.fwdarw.P5 phosphoramidate analogs of any of the foregoing, and phosphorodiamidate morpholino nucleotide analogs of any of the foregoing, and combinations thereof.

    [0425] In one embodiment said 2O-4C-linked bicyclic ribofuranosyl (LNA) nucleotides or nucleosides are 2O-4C-(methylene)-ribofuranosyl nucleotides or nucleosides, respectively, or 2O-4C-(ethylene)-ribofuranosyl nucleotides or nucleosides, respectively.

    [0426] In one embodiment said SSOs comprise one or more nucleotides or nucleosides independently selected from the group consisting of 2O-Me ribonucleotides and 2O-4C-linked bicyclic ribofuranosyl (LNA) nucleotides or nucleosides.

    [0427] In one embodiment the sequence of said SSO comprises a sequence selected from the group consisting of SEQ ID Nos: 8, 9, 14, 17-21, 24-29, 32, 33, 38-42, 44-46, 50-52, 55-57, 60, 68-71, 74, 75, 77, 78, 80, 82, 84, and 86-89.

    [0428] In one embodiment the invention provides a pharmaceutical composition comprising the SSO and a pharmaceutically acceptable carrier.

    [0429] In one embodiment said SSO comprises from at least 10 to at least 20 nucleotides which are complementary to a contiguous sequence from SEQ ID Nos: 1, 2, 3 or 4.

    [0430] In one embodiment the invention provides an isolated protein capable of binding tumor necrosis factor (TNF), said protein having a sequence comprising the amino acids encoded by a cDNA derived from a mammalian tumor necrosis factor receptor (TNFR) gene, wherein the cDNA comprises in 5 to 3 contiguous order, the codon encoding the first amino acid after the cleavage point of the signal sequence of said gene through exon 6 of said gene and exon 8 of said gene through exon 10 of said gene; or the codon encoding the first amino acid of the open reading frame of said gene through exon 6 of said gene and exon 8 of said gene through exon 10 of said gene.

    [0431] In one embodiment said TNF is TNF-.

    [0432] In one embodiment said protein contains at least one processing, chemical, or post-translational modification, and wherein said modification is selected from the group consisting of acetylation, acylation, amidation, ADP-ribosylation, glycosylation, methylation, pegylation, prenylation, phosphorylation, or cholesterol conjugation.

    [0433] In one embodiment said receptor is TNFR1, such as human TNFR1, In one embodiment, said receptor is TNFR2, such as human TNFR2. In one embodiment said protein comprises a sequence selected from the group consisting of SEQ ID No: 6, amino acids 30-417 of SEQ ID No: 6, SEQ ID No: 8, amino acids 30-416 of SEQ ID No: 8, SEQ ID No: 10, amino acids 23-435 of SEQ ID No: 10, SEQ ID No: 12, and amino acids 23-448 of SEQ ID No: 12. In one embodiment, the invention provides a pharmaceutical composition comprising the protein according to the invention in admixture with a pharmaceutically acceptable carrier. In one embodiment, the invention provides a composition comprising the purified protein according to the invention.

    [0434] In one embodiment, the invention provides a method of treating an inflammatory disease or condition which comprises administering the pharmaceutical composition according to the invention a subject for a time and in an amount effective to reduce the activity of TNF. In one embodiment, said disease or condition is selected from the group consisting of rheumatoid arthritis, juvenile rheumatoid arthritis, psoriasis, psoriatic arthritis, ankylosing spondylitis, inflammatory bowel disease (Crohn's disease or ulcerative colitis), hepatitis associated with hepatitis A virus, hepatitis associated with hepatitis B virus, hepatitis associated with hepatitis C virus, hepatitis associated with ischemia/reperfusion, sepsis, alcoholic liver disease, and non-alcoholic steatosis. In one embodiment, the invention provides an isolated nucleic acid derived from a mammalian tumor necrosis factor receptor (TNFR) gene and encoding a protein capable of binding tumor necrosis factor (TNF), wherein the cDNA of said protein comprises in 5 to 3 contiguous order, the codon encoding the first amino acid after the cleavage point of the signal sequence of said gene through exon 6 of said gene and exon 8 of said gene through exon 10 of said gene; or the codon encoding the first amino acid of the open reading frame of said gene through exon 6 of said gene and exon 8 of said gene through exon 10 of said gene. In such as embodiment, the sequence of said protein comprises a sequence selected from the group consisting of SEQ ID No: 6, amino acids 30-417 of SEQ ID No: 6, SEQ ID No: 8, amino acids 30-416 of SEQ ID No: 8, SEQ ID No: 10, amino acids 23-435 of SEQ ID No: 10, SEQ ID No: 12, and amino acids 23-448 of SEQ ID No: 12. In one embodiment, the sequence of said nucleic acid comprises a sequence selected from the group consisting of nucleotides 1-1251 of SEQ ID No: 5, nucleotides 88-1251 of SEQ ID No: 5, nucleotides 1-1248 of SEQ ID No: 7, nucleotides 88-1248 of SEQ ID No: 7, nucleotides 1-1305 of SEQ ID No: 9, nucleotides 67-1305 of SEQ ID No: 9, nucleotides 1-1344 of SEQ ID No: 11, and nucleotides 67-1344 of SEQ ID No: 11. In one embodiment, the invention provides for an expression vector comprising the nucleic acid of the invention operably linked to a regulatory sequence.

    [0435] In one embodiment, the invention provides a method of increasing the level of a TNF antagonist in a mammal which comprises transforming cells of said mammal with the expression vector according to the invention to thereby express said TNF antagonist, wherein said vector drives expression of said TNFR.

    [0436] In one embodiment the mammal is a human, such as a human is an individual having an inflammatory disease or condition.

    [0437] In one embodiment said expression vector is a plasmid, or a virus.

    [0438] In one embodiment cells are transformed in vivo.

    [0439] In one embodiment cells are transformed ex vivo.

    [0440] In one embodiment, said expression vector comprises a tissue specific promotersaid tissue specific promoter may, for example be derived from a hepatocyte or a macrophage.

    [0441] In one embodiment the cells are selected from the group consisting of hepatocytes, hematopoietic cells, spleen cells, and muscle cells.

    [0442] The invention provides for a cell transformed with the expression vector of the invention, such as a mammalian cell, an insect cell, or a microbial cell.

    [0443] The invention provides for a process for producing a protein capable of binding tumor necrosis factor (TNF) which comprises culturing the cell of the invention under conditions suitable to express said protein, and recovering said protein.

    [0444] The invention provides for a pharmaceutical composition comprising the nucleic acid or vector of the invention, in admixture with a pharmaceutically acceptable carrier.

    [0445] The invention provides a method of treating an inflammatory disease or condition which comprises administering the expression vector of the invention to a subject for a time and in an amount sufficient to reduce TNF activity, such as TNF- activity.

    [0446] In one embodiment, disease or condition is selected from the group consisting of rheumatoid arthritis, juvenile rheumatoid arthritis, psoriasis, psoriatic arthritis, ankylosing spondylitis, inflammatory bowel disease (Crohn's disease or ulcerative colitis), hepatitis associated with hepatitis A virus, hepatitis associated with hepatitis B virus, hepatitis associated with hepatitis C virus, hepatitis associated with ischemia/reperfusion, sepsis, alcoholic liver disease, and non-alcoholic steatosis.

    [0447] In one embodiment, the invention provides for a method of treating an inflammatory disease or condition which comprises administering one or more splice switching oligomers (SSOs) to a subject for a time and in an amount to reduce the activity of TNF, wherein said one or more SSOs are capable of altering the splicing of a pre-mRNA encoding a mammalian tumor necrosis factor receptor 2 (TNFR2) (or TNFR1) to increase production of a protein capable of binding tumor necrosis factor (TNF), wherein said protein has a sequence comprising the amino acids encoded by a cDNA derived from a gene for said receptor, wherein the cDNA comprises in 5 to 3 contiguous order, the codon encoding the first amino acid after the cleavage point of the signal sequence of said gene through exon 6 of said gene and exon 8 of said gene through exon 10 of said gene; or the codon encoding the first amino acid of the open reading frame of said gene through exon 6 of said gene and exon 8 of said gene through exon 10 of said gene.

    [0448] In one embodiment, said disease or condition is selected from the group consisting of rheumatoid arthritis, juvenile rheumatoid arthritis, psoriasis, psoriatic arthritis, ankylosing spondylitis, inflammatory bowel disease (Crohn's disease or ulcerative colitis), hepatitis associated with hepatitis A virus, hepatitis associated with hepatitis B virus, hepatitis associated with hepatitis C virus, hepatitis associated with ischemia/reperfusion, sepsis, alcoholic liver disease, and non-alcoholic steatosis. In one embodiment, the administration is parenteral, topical, oral, rectal, or pulmonary.

    [0449] In one embodiment, the invention provides a splice switching oligomer (SSO) comprising at least 8 nucleotides, said SSO capable of altering the splicing of a pre-mRNA encoding a mammalian tumor necrosis factor receptor 2 (TNFR2) (or TNFR1) to produce a protein capable of binding tumor necrosis factor (TNF), wherein said protein has a sequence comprising the amino acids encoded by a cDNA derived from a gene for said receptor, wherein the cDNA comprises in 5 to 3 contiguous order, the codon encoding the first amino acid after the cleavage point of the signal sequence of said gene through exon 6 of said gene and exon 8 of said gene through exon 10 of said gene; or the codon encoding the first amino acid of the open reading frame of said gene through exon 6 of said gene and exon 8 of said gene through exon 10 of said gene.

    [0450] In one embodiment, the invention provides for a SSO which comprises at least 8 nucleotides which are complementary to a contiguous sequence from SEQ ID No: 13.

    [0451] In one embodiment the sequence of said SSO comprises a sequence selected from the group consisting of SEQ ID Nos: 14, 30, 46, 70, 71, 72, and 73, and subsequences thereof at least 8 nucleotides.

    [0452] In one embodiment the sequence of said SSO comprises a sequence selected from the group consisting of SEQ ID Nos: 14-61.

    [0453] The invention provides for a method of increasing the production of a protein capable of binding tumor necrosis factor (TNF), in a cell, which comprises administering one or more splice switching oligomers (SSOs) to said cell, wherein said protein has a sequence comprising the amino acids encoded by a cDNA derived from a mammalian tumor necrosis factor receptor 2 (TNFR2) (or TNFR1) gene, wherein the cDNA comprises in 5 to 3 contiguous order, the codon encoding the first amino acid after the cleavage point of the signal sequence of said gene through exon 6 of said gene and exon 8 of said gene through exon 10 of said gene; or the codon encoding the first amino acid of the open reading frame of said gene through exon 6 of said gene and exon 8 of said gene through exon 10 of said gene, and wherein said one or more SSOs are capable of altering the splicing of a pre-mRNA encoding said receptor to increase production of said protein. In one embodiment, the method is performed in vivo.

    [0454] The invention provides for a pharmaceutical composition comprising the SSO of the invention and a pharmaceutically acceptable carrier.

    EXAMPLES

    [0455] The following Examples are identical to those described in PCT/US2006/043651 (Examples 1-11) and PCT/US2007/10557 (Examples 12-44), although reference numbers have been re-arranged accordingly.

    Example 1

    Materials and Methods

    Oligonucleotides.

    [0456] All uniformly modified 2-O-methyl-ribonucleoside-phosphorothioate (2-OMe) 20-mers were synthesized by Trilink Biotechnologies, San Diego, Calif. Their sequences are listed in Table 1. Tables 2 and 3 show the sequences of chimeric LNA SSOs with alternating 2deoxy- and 2O-4-(methylene)-bicyclic-ribonucleoside phosphorothioates. These were synthesized by Santaris Pharma, Denmark. For each LNA oligonucleotide, the 5-terminal nucleoside was a 2O-4-methylene-ribonucleoside and the 3-terminal ribonucleoside was a 2 deoxy-ribonucleoside.

    Cell Culture and Transfections.

    [0457] NIH-3T3 cells were maintained (37 C., 5% CO.sub.2) in Dulbecco's modified Eagle's media (DMEM) supplemented with 10% Colorado fetal calf serum and antibiotic. L929 cells were maintained (37 C., 5% CO.sub.2) in minimal essential media supplemented with 10% fetal bovine serum and antibiotic. For transfection, either NIH-3T3 or L929 cells were seeded in 24-well plates at 10.sup.5 cells per well and transfected 24 hours later.

    [0458] Oligonucleotides were complexed, at the indicated concentrations, with 2 L of Lipofectamine 2000 transfection reagent (Invitrogen) as per the manufacturer's directions. The nucleotide/lipid complexes were then applied to the cells and incubated for hours. The media was then aspirated and cells harvested with TRI-Reagent (MRC, Cincinnati, Ohio).

    RT-PCR.

    [0459] Total RNA was isolated with TRI-Reagent (MRC, Cincinnati, Ohio) and TNFR1 or TNFR2 mRNA was amplified by RT-PCR using rTth polymerase (Applied Biosystems) following supplier directions. Murine TNFR1 mRNA was amplified using forward primer PS009 (SEQ ID No: 111) (5-GAA AGT GAG TGC GTC CCT TGC-3) and reverse primer PS010 (SEQ ID No: 112) (5-GCA CGG AGC AGA GTG ATT CG-3). Murine TNFR2 mRNA was amplified using forward primer PS003 (SEQ ID No: 113) (5-GAG CCC CAA ATG GAA ATG TGC-3) and reverse primer PS004 (SEQ ID No: 114) (5-GCT CAA GGC CTA CTG CC-3). Human TNFR2 mRNA was amplified using forward primer (SEQ ID No: 115) (5-ACT GAA ACA TCA GAC GTG GTG TGC-3) and reverse primer (SEQ ID No: 116) (5-CCT TAT CGG CAG GCA AGT GAG-3). A Cy5-labeled dCTP (GE Healthcare) was included in the PCR step for visualization (0.1 L per 50 L PCR reaction). Cycles of PCR proceeded: 95 C., 60 sec; 56 C., 30 sec; 72 C., 60 sec for 22 cycles total. The PCR products were separated on a 10% non-denaturing polyacrylamide gel, and Cy5-labeled bands were visualized with a Typhoon 9400 Scanner (GE Healthcare). Scans were quantified with ImageQuant (GE Healthcare) software.

    Mouse Hepatocyte Cultures.

    [0460] For hepatocyte collection, livers of mice were perfused with RPMI medium containing 0.53 mg/ml of collagenase (Worthington Type 1, code CLS). After perfusion, the cell suspension was collected and seeded in a stop solution of RPMI with 10% (vol/vol) FBS and 0.5% penicillin-streptomycin plus 1 nM insulin and 13 nM dexamethASONe. Approximately 310.sup.5 cells were seeded on a six-well collagen-coated plate. The seeding medium was replaced 1 hour later with maintenance medium consisting of seeding medium without the 10% (vol/vol) FBS. Varying amounts of oligonucleotide-lipid complexes were applied 24 hours later. Cells were lysed 24 hours after transfection with TRI-Reagent.

    Human Hepatocyte Cultures.

    [0461] Human hepatocytes were obtained in suspension either from ADMET technologies, or from The UNC Cellular Metabolism and Transport Core at UNC-Chapel Hill. Cells were washed and suspended in RPMI 1640 supplemented with 10% FBS, 1 g/ml human insulin, and 13 nM DexamethASONe. Hepatocytes were plated in 6-well plates at 0.510.sup.6 cells per plate in 3 mL media. After 1-1.5 hours, non-adherent cells were removed, and the media was replaced with RPMI 1640 without FBS, supplemented with 1 microg/ml human insulin, and 130 nM DexamethASONe.

    [0462] For delivery of LNA SSOs to hepatocytes in 6-well plates, 10 L of a 5 M LNA stock was diluted into 100 L of OPTI-MEM, and 4 L of Lipofectamine 2000 was diluted into 100 of OPTI-MEM. The 200 L complex solution was then applied to the cells in the 6-well plate containing 2800 L of media, for a total of 3000 L. The final LNA concentration was 17 nM. After 24 hours, cells were harvested in TRI-Reagent. Total RNA was isolated per the manufacturers directions. Approximately 200 ng of total RNA was subjected to reverse transcription-PCR (RT-PCR).

    ELISA.

    [0463] To determine the levels of soluble TNFR2 in cell culture media or mouse sera, the Quantikine Mouse sTNF RII ELISA kit from R&D Systems (Minneapolis, Minn.) was used. To determine the levels of soluble TNFR1 in cell culture media or mouse sera, the Quantikine Mouse sTNF RI ELISA kit from R&D Systems (Minneapolis, Minn.) was used. Note, the antibodies used for detection also detect the protease cleavage forms of the receptor.

    [0464] For cell culture studies, extracellular media was collected at 72 hours post transfection. The assay was performed according to the manufacturer's guide, using 50 L of undiluted media. The assay readings were performed using a microplate reader set at 450 nm, with wavelength correction set at 570 nm.

    [0465] For mouse in vivo studies, blood from the animals was clotted for 1 hour at 37 C. and centrifuged for 10 min at 14,000 rpm (Jouan BRA4i centrifuge). Sera was collected and assayed according to the manufacturer's guide, using 50 L of mouse sera, diluted 1:10. The assay readings were performed using a microplate reader set at 450 nm, with wavelength correction set at 570 nm.

    L929 Cytotoxicity Assay.

    [0466] L929 cells plated in 96-well plates at 10.sup.4 cells per plate were treated with 0.1 ng/mL TNF-alpha (TNF) and actinomycin D (ActD) in the presence of 10% serum from mice treated with the indicated oligonucleotide in 100 L total cell culture media. Control lanes were plated in 10% serum from untreated mice. 24 hours later, cell viability was measured by adding 20 L CellTiter 96 Aqueous Solution (Promega) and measuring absorbance at 490 nm with a microplate reader. Cell viability was normalized to cells untreated with TNF/ActD.

    Example 2

    Testing of SSOs for Splice Switching Activity

    [0467] SSOs were synthesized, transfected into either NIH-3T3 or L929 cells. Total RNA from the cells was analyzed by RT-PCR to assess the splice switching ability of the SSO. Table 1 contains the sequences and the splice switching activities of 20 nucleotide 2O-Me-ribonucleoside-phosphorothioate murine SSOs. Table 2 contains the sequences and the splice switching activities of 16 nucleotide chimeric LNA murine SSOs. Table 3 contains the sequences and the splice switching activities of 16 nucleotide chimeric LNA human SSOs. Each table also lists the target site for each SSO by complementary regions and number of nucleotides; e.g., I6:E7(8:8) means complementary to the 3-most 8 nucleotides of intron 6 and the 5-most 8 nucleotides of exon 7; E7(16) means complementary to 16 nucleotides in exon 7; and E8:I8(7:9) means complementary to the 3-most 7 nucleotides of exon 8 and the 5-most 9 nucleotides of intron 8.

    TABLE-US-00002 TABLE1 2O-Me-ribonucleoside-phosphorothioatemousetargetedSSO SEQID. Name* Sequence(5-3) Activity TargetSite 5 A7-1 CCGCAGUACCUGCAGACCAG - I6:E7(6:14) 6 A7-2 GUACCUGCAGACCAGAGA - I6:E7(13:7) GG 7 A7-3 CUGCAGACCAGAGAGGUU - I6:E7(18:2) GC 8 A7-4 ACUGAUGGAGUAGACUUC + E7:I7(18:2) GG 9 A7-5 AGUCCUACUUACUGAUGG + E7:I7(8:12) AG 10 A7-6 CCAAAGUCCUACUUACUG - E7:I7(1:19) AU 11 A7-7 AGAUAACCAGGGGCAACA - E7(20) GC 12 A7-8 AGGAUAGAAGGCAAAGAC - E7(20) CU 13 A7-9 GGCACAUUAAACUGAUGA - E7(20) AG 14 A7-10 GGCCUCCACCGGGGAUAU + E7(20) CG 15 A8-1 CUGGAGAACAAAGAAACA - I7:E8(19:1) AG 16 A8-2 AUCCCUACAAACUGGAGA - I7:E8(8:12) AC 17 A8-3 GGCACGGGAUCCCUACAA ++ E8(20) AC 18 A8-4 CUUCUCACCUCUUUGACA ++ E8:I8(12:8) GG 19 A8-5 UGGAGUCGUCCCUUCUCACC + E8:I8(1:19) 20 B7-1 CUCCAACAAUCAGACCUA +++ I6:E7(5:15) GG 21 B7-2 CAAUCAGACCUAGGAAAA + I6:E7(11:9) CG 22 B7-3 AGACCUAGGAAAACGGCA - I6:E7(16:4) GG 23 B7-4 CCUUACUUUUCCUCUGCACC - E7:I8(14:6) 24 B7-5 GAGCAGAACCUUACUUUU ++ E7:I8(6:14) CC 25 B7-6 GACGAGAGCAGAACCUUA ++ E7:I7(1:19) CU 26 B7-7 UCAGCAGACCCAGUGAUG ++ E7(20) UC 27 B7-8 AUGAUGCAGUUCACCAGU + E7(20) CC 28 B7-9 UCACCAGUCCUAACAUCAGC ++ E7(20) 29 B7-10 CCUCUGCACCAGGAUGAU ++ E7(20) GC 30 B8-1 UUCUCUACAAUGAAGAGA - I7:E8(16:4) GG 31 B8-2 GGCUUCUCUACAAUGAAG - I7:E8(13:7) AG 32 B8-3 UGUAGGCAGGAGGGCUUC ++ I7:E8(1:19) UC 33 B8-4 ACUCACCACCUUGGCAUCUC ++ E8:I8(14:6) 34 B8-5 GCAGAGGGAUACUCACCA - E8:I8(4:16) CC *SSOs with the prefix A are directed to TNFR1 and with B to TNFR2.

    TABLE-US-00003 TABLE2 LNA-2deoxy-ribonucleosidephosphorothioatechimericmousetargetedSSO SEQID. Name Sequence5 to3 Activity TargetSite TNFR2Exon7 35 3272 CAATCAGACCTAGGAA - I6:E7(7:9) 36 3303 CAACAATCAGACCTAG - I6:E7(4:12) 37 3304 CAGACCTAGGAAAACG - I6:E7(11:5) 38 3305 AGCAGACCCAGTGATG ++ E7(16) 39 3306 CCAGTCCTAACATCAG + E7(16) 40 3307 CACCAGTCCTAACATC + E7(16) 41 3308 CTGCACCAGGATGATG + E7(16) 42 3309 ACTTTTCCTCTGCACC + E7:I7(14:2) 43 3310 CCTTACTTTTCCTCTG - E7:I7(8:8) 44 3311 CAGAACCTTACTTTTC ++ E7:I7(5:11) 45 3274 AGAGCAGAACCTTACT ++ E7:I7(1:15) 46 3312 GAGAGCAGAACCTTAC ++ E7:I7(0:16) 47 3273 ACCTTACTTTTCCTCT - E7:I7(9:7) TNFR2Exon8 48 3313 CTTCTCTACAATGAAG - I7:E8(11:5) 49 3314 CCTTGGCATCTCTTTG - E8(16) 50 3315 TCACCACCTTGGCATC + E8:18(12:4) 51 3316 ACTCACCACCTTGGCA + E8:18(10:6) 52 3317 GATACTCACCACCTTG + E8:I8(7:9) 53 3631 CTACAATGAAGAGAGG - 17(16) 54 3632 CTCTACAATGAAGAGA - I7:E8(14:2) 55 3633 AGGGATACTCACCACC + E8:I8(4:12) 56 3634 CAGAGGGATACTCACC + E8:18(1:15) 57 3635 CGCAGAGGGATACTCA + 18(16) 58 3636 GAACAAGTCAGAGGCA - 17(16) 59 3637 GAGGCAGGACTTCTTC - 17(16) TNFR1Exon7 60 3325 CGCAGTACCTGCAGAC + I6:E7(8:8) 61 3326 AGTACCTGCAGACCAG - I6:E7(11:5) 62 3327 GGCAACAGCACCGCAG - E7(16) 63 3328 CTAGCAAGATAACCAG - E7(16) 64 3329 GCACATTAAACTGATG - E7(16) 65 3330 CTTCGGGCCTCCACCG - E7(16) 66 3331 CTTACTGATGGAGTAG - E7:I7(11:5) 67 3332 CCTACTTACTGATGGA - E7:I7(7:9) 68 3333 GTCCTACTTACTGATG + E7:I7(5:11) TNFR1Exon8 69 3334 TCCCTACAAACTGGAG + E7:I7(5:11) 70 3335 GGCACGGGATCCCTAC + E8(16) 71 3336 CTCTTTGACAGGCACG + E8(16) 72 3337 CTCACCTCTTTGACAG - E8:I8(11:5) 73 3338 CCTTCTCACCTCTTTG - E8:I8(7:9)

    TABLE-US-00004 TABLE3 LNA-2deoxy-ribonucleosidephosphorothioatechimerichumantargetedSSO SEQID. Name Sequence5 to3 Activity TargetSite TNFR2Exon7 74 3378 CCACAATCAGTCCTAG ++ I6:E7(4:12) 75 3379 CAGTCCTAGAAAGAAA ++ I6:E7(11:5) 76 3380 AGTAGACCCAAGGCTG - E7(16) 77 3381 CCACTCCTATTATTAG + E7(16) 78 3382 CACCACTCCTATTATT + E7(16) 79 3383 CTGGGTCATGATGACA - E7(16) 80 3384 ACTTTTCACCTGGGTC ++ E7:I7(14:2) 81 3385 TCTTACTTTTCACCTG - E7:I7(10:6) 82 3459 TGGACTCTTACTTTTC ++ E7:I7(5:11) 83 3460 AGGATGGACTCTTACT - E7:I7(1:15) 84 3461 AAGGATGGACTCTTAC + I7(16) TNFR2Exon8 85 3462 CTTCTCTATAAAGAGG - I7:E8(11:5) 86 3463 CCTTGGCTTCTCTCTG + E8(16) 87 3464 TCACCACCTTGGCTTC + E8:I8(12:4) 88 3465 ACTCACCACCTTGGCT + E8:I8(10:6) 89 3466 GACACTCACCACCTTG + E8:I8(7:9) TNFR1Exon7 90 3478 TGTGGTGCCTGCAGAC N/A I6:E7(8:8) 91 3479 GGTGCCTGCAGACAAA N/A I6:E7(11:5) 92 3480 GGCAACAGCACTGTGG N/A E7(16) 93 3481 CAAAGAAAATGACCAG N/A E7(16) 94 3482 ATACATTAAACCAATG N/A E7(16) 95 3483 GCTTGGACTTCCACCG N/A E7(16) 96 3484 CTCACCAATGGAGTAG N/A E7:I7(11:5) 97 3485 CACTCACCAATGGAGT N/A E7:I7(9:7) 98 3587 CCCACTCACCAATGGA N/A E7:I7(7:9) 99 3588 CCCCCACTCACCAATG N/A E7:I7(5:11) 100 3589 AAAGCCCCCACTCACC N/A E7:I7(1:15) TNFR1Exon8 101 3590 TTTCCCACAAACTGAG N/A I7:E8(5:11) 102 3591 GGTGTCGATTTCCCAC N/A E8(16) 103 3592 CTCTTTTTCAGGTGTC N/A E8(16) 104 3593 CTCACCTCTTTTTCAG N/A E8:I8(11:5) 105 3594 TCATCTCACCTCTTTT N/A E8:I8(7:9) Control 106 3083 GCTATTACCTTAACCC N/A N/A

    Example 4

    Effect of SSOs on L929 Mouse Cells

    [0468] Single LNA SSOs were transfected into L929 murine cells and analyzed for splice switching of TNFR2. FIG. 9 (top) shows the splice switching results of LNAs targeted towards mouse exon 7. Of the LNAs tested, at least 9 showed some activity. In particular, LNA 3312, 3274 and 3305 induced skipping of exon 7 to 50% or greater; LNA 3305 treatment resulted in almost complete skipping. FIG. 9 (bottom) shows the activity of SSOs targeted towards mouse exon 8. The data indicate that LNA 3315 and 3316 are equally potent at inducing an approximately 20% skipping of exon 8. Note that exon 8 is small (35 nts), and therefore the difference in exon 8-containing and exon 8-lacking PCR fragments is also small.

    Example 5

    Effect of Multiple SSOs on L929 Mouse Cells

    [0469] LNA SSOs targeting exon 7 and 8 were transfected in combination into L929 cells to determine whether such treatment would result in generation of TNFR2 7/8 mRNA. The data in FIG. 10 show that the combination of exon 8 targeted 3315 or 3316 with one of exon 7 targeted LNA 3305, 3309, 3312, or 3274 induced skipping of both exons simultaneously. In particular, the combination of LNAs 3305 and 3315 resulted in greater than 60% shift to the 7/8 mRNA, with the remainder being almost entirely 7 mRNA. Other combinations were also effective; 3274 with 3315 led to a 50% shift to the 7/8 mRNA. These data indicate that LNA SSOs are very effective at inducing alternatively spliced TNFR2 mRNAs. Similarly, combinations of LNA SSOs targeted to TNFR1 exon 7 and 8 also induced shifting of their respective exons in L929 cells (FIG. 11).

    Example 6

    Effect of LNA SSOs on Primary Mouse Hepatocytes

    [0470] The TNFR2 LNA SSOs were transfected into primary mouse hepatocytes, and were found to be equally effective in splice switching in these cells. In particular, treatment with LNA 3274 or 3305 in combination with LNA 3315 showed splice shifting profiles very similar to those found in L929 cells (FIG. 12). These data confirm splice shifting occurs in intended in vivo cellular targets.

    Example 7

    Secretion of TNFR2 Splice Variants from Murine Cells

    [0471] The ability of LNA SSOs to induce soluble TNFR2 protein production and secretion into the extracellular media was tested. L929 cells were treated with the LNA SSOs as above, and extracellular media samples were collected 48 hours after transfection. The samples were quantified by an ELISA specific for soluble TNFR2 (for either 7 and 7/8 protein isoforms). The FIG. 13 left panel indicates that the LNAs that best induced shifts in RNA splicing, also secreted the most protein into the extracellular media. In particular, LNAs 3305, 3312 and 3274 performed best, increasing soluble TNFR2 at least 3.5-fold over background, and yielding 250 pg/mL soluble splice variant. Increases were also seen in similarly treated primary mouse hepatocytes (FIG. 13, right panel). In these primary cells, treatment with LNA 3274 or 3305 alone gave approximately 2.5-fold increases in soluble TNFR2 in the extracellular media, yielding 200 pg/mL of the soluble splice variant, and the combination of 3274 or 3305 with 3315 also increased protein production. Consequently, induction of the splice variant mRNA correlated with production and secretion of the soluble TNFR2.

    Example 8

    Effect of LNA SSOs on Primary Human Hepatocytes

    [0472] LNA SSOs for human TNFR2 pre-mRNA were transfected into cultured primary human hepatocytes. FIG. 14 shows that 7 of 10 SSOs targeted to exon 7 exhibited some splice switching activity. In particular, LNAs 3378, 3384 and 3479 showed at least 75% skipping of exon 7. Likewise, 4 of the 5 exon 8 targeted SSOs showed activity. Interestingly, LNAs 3464, 3465, or 3466 alone was sufficient to induce 7/8 splice removal, an observation not seen in mouse cells. Hence, only one SSO may be required to induce skipping of both exon 7 and exon 8. These data confirm splice shifting occurs in intended human therapeutic targets.

    Example 9

    In Vivo Injection of LNA SSOs in Mice

    [0473] LNA 3305, at doses from 3 mg/kg to 25 mg/kg diluted in saline only, were injected intraperitoneal (i.p.) once a day for 4 days into mice. The mice were sacrificed on day 5 and total RNA from the liver was analyzed by RT-PCR. The data show splice switching efficacy similar to that found in cell culture. At the maximum dose of 25 mg/kg, LNA 3305 induced almost full conversion to 7 mRNA (FIG. 15, bottom panel).

    [0474] A similar procedure using LNA 3274 induced about 20% conversion to 7 mRNA. To optimize the induction of 7 mRNA LNA 3274, both the dose regimen and time between the last injection, and sacrifice of the animals was varied. LNA 3274, at 25 mg/kg diluted in saline only, were injected (i.p.) once a day for 4 days into mice. In mice analyzed on day 15, whereas those analyzed on day five demonstrated only a 20% shift to 7 mRNA (FIG. 15, top panel). Furthermore, mice given injections for 10 days, and sacrificed on day 11 showed a 50% induction of 7 mRNA (FIG. 15 top). These in vivo data suggest that TNFR2 LNA SSOs can persist in the liver and induce splice switching for at least 10 days after administration.

    Example 9

    Circulatory TNFR Splice Variants

    [0475] Induction of the 7 mRNA in liver should produce soluble TNFR, which can be secreted and accumulate in the circulation. Accordingly, mice were treated with LNA 3274, 3305, or the control 3083 alone i.p. at 25 mg/kg/day for 10 days. Mice were bled before injection and again 1, 5 and 10 days after the last injection. Serum was quantified for concentration of soluble TNFR2. FIG. 16 shows that LNA treatment induced 6000-8000 pg/mL of soluble TNFR2 (7), which was significantly over background for at least 10 days.

    [0476] The same samples were assayed for production of soluble TNFR1. No increase in soluble TNFR1 was observed (FIG. 17).

    [0477] To test the effects at longer time points, the same experiment was carried out, and mice were analyzed for soluble TNFR2 in the serum up to 27 days after the last injection. The results show only a slight decrease in soluble TNFR2 levels 27 days after the last LNA SSO injection (FIG. 18). This data suggests that the effects of the LNAs persist for at least 27 days.

    Example 10

    Measurement of Anti-TNF- Activity of Mice Treated with LNA SSOs

    [0478] The anti-TNF- activity of serum from LNA 3274 treated mice was tested in an L929 cytotoxicity assay. In this assay, serum is tested for its ability to protect cultured L929 cells from the cytotoxic effects of a fixed concentration of TNF-. L929 cells were seeded in 96-well plates at 210.sup.4 cells per well in 100 L of complete MEM media (containing 10% regular FBS) and allowed to grow for 24 hours at 37 C. As shown in FIG. 19, serum from mice treated with LNA 3274 but not control LNAs (3083 or 3272) increased viability of the L929 cells exposed to 0.1 ng/mL TNF-. Hence, the LNA 3274 serum contained 7 TNFR2 TNF- antagonist, sufficient to bind and inactivate TNF-, and thereby protect the cells from the cytotoxic effects of TNF-. This anti-TNF- activity was present in the serum of animals 5 and 27 days after the last injection of the 3274 LNA.

    Example 11

    Comparison of LNA SSOs to Other Anti-TNF- Agents

    [0479] L929 cells were seeded as described previously. Samples were prepared containing 90 L of serum-free MEM, 0.1 ng/ml TNF- (TNF) and 1 g/ml of actinomycin D (ActD), with either (i) rsTNFR2 (recombinant soluble) (0.01-3 g/mL), (ii) serum from LNA 3274 treated mice (1.25-10%, diluted in serum from untreated mice) or (iii) Enbrel (0.45-150 pg/ml) to a final volume of 100 l with a final mouse serum concentration of 10%. The samples were incubated at room temperature for 30 minutes. Subsequently, the samples were applied to the plated cells and incubated for 24 hours at 37 C. in a 5% CO.sub.2 humidified atmosphere. Cell viability was measured by adding 20 L CellTiter 96 Aqueous Solution (Promega) and measuring absorbance at 490 nm with a microplate reader. Cell viability, as shown in FIG. 20, was normalized to cells untreated with TNF/ActD.

    Example 12

    Oligonucleotides

    [0480] Table 6 lists chimeric locked nucleic acid (LNA) SSOs with alternating 2deoxy- and 2O-4-(methylene)-bicyclic-ribonucleoside phosphorothioates and having sequences as described as above. These were synthesized by Santaris Pharma, Denmark. For each SSO, the 5-terminal nucleoside was a 2O-4-methylene-ribonucleoside and the 3-terminal nucleoside was a 2deoxy-ribonucleoside. Table 7 shows the sequences of chimeric LNA SSOs with alternating 2-O-methyl-ribonucleoside-phosphorothioates (2-OMe) and 2O-4-(methylene)-bicyclic-ribonucleoside phosphorothioates. These were synthesized by Santaris Pharma, Denmark. The LNA is shown in capital letters and the 2-OME is shown in lower case letters.

    Cell Culture and Transfections.

    [0481] L929 cells were maintained in minimal essential media supplemented with 10% fetal bovine serum and antibiotic (37 C., 5% CO.sub.2). For transfection, L929 cells were seeded in 24-well plates at 10.sup.5 cells per well and transfected 24 hrs later. Oligonucleotides were complexed, at the indicated concentrations, with 2 L of Lipofectamine 2000 transfection reagent (Invitrogen) as per the manufacturer's directions. The nucleotide/lipid complexes were then applied to the cells and incubated for 24 hrs. The media was then aspirated and cells harvested with TRI-Reagent (MRC, Cincinnati, Ohio).

    RT-PCR.

    [0482] Total RNA was isolated with TRI-Reagent (MRC, Cincinnati, Ohio) and TNFR1 or TNFR2 mRNA was amplified by GeneAmp RT-PCR using rTth polymerase (Applied Biosystems) following supplier directions. Approximately 200 ng of RNA was used per reaction. Primers used in the examples described herein are included in Table 2. Cycles of PCR proceeded: 95 C., 60 sec; 56 C., 30 sec; 72 C., 60 sec for 22-30 cycles total.

    [0483] In some instances a Cy5-labeled dCTP (GE Healthcare) was included in the PCR step for visualization (0.1 L per 50 L PCR reaction). The PCR products were separated on a 10% non-denaturing polyacrylamide gel, and Cy5-labeled bands were visualized with a Typhoon 9400 Scanner (GE Healthcare). Scans were quantified with ImageQuant (GE Healthcare) software. Alternatively, in the absence of the inclusion of Cy5-labeled dCTP, the PCR products were separated on a 1.5% agarose gel containing trace amounts of ethidium bromide for visualization.

    PCR.

    [0484] PCR was performed with Platinum Taq DNA Polymerase (Invitrogen) according to the manufacturer's directions. For each 50 L reaction, approximately 30 pmol of both forward and reverse primers were used. Primers used in the examples described herein are included in Table 5. Thermocycling reaction proceeded, unless otherwise stated, as follows: 94 C., 3 minutes; then 30-40 cycles of 94 C., 30 sec; 55 C., 30 sec; and 72 C., 105 sec; followed by 72 C., 3 minutes. The PCR products were analyzed on 1.5% agarose gels and visualized with ethidium bromide.

    TABLE-US-00005 TABLE5 RT-PCRandPCRPrimers SEQ ID. Name Sequence5 to3 HumanTNFR2 190 TR001 ACTGGGCTTCATCCCAGCATC 191 TR002 CACCATGGCGCCCGTCGCCGTCTGG 192 TR003 CGACTTCGCTCTTCCAGTTGAGAAGCCCTTGTGCCTGCAG 193 TR004 TTAACTGGGCTTCATCCCAGCATC 194 TR005 CTGCAGGCACAAGGGCTTCTCAACTGGAAGAGCGAAGTCG 195 TR026 TTAACTGGGCTTCATCCCAGC 196 TR027 CGATAGAATTCATGGCGCCCGTCGCCGTCTGG 197 TR028 CCTAACTCGAGTTAACTGGGCTTCATCCCAGC 198 TR029 GACTGAGCGGCCGCCACCATGGCGCCCGTCGCCGTCTGG 199 TR030 CTAAGCGCGGCCGCTTAACTGGGCTTCATCCCAGCATC 200 TR047 CGTTCTCCAACACGACTTCA 201 TR048 CTTATCGGCAGGCAAGTGAGG 202 TR049 ACTGAAACATCAGACGTGGTGTGC 203 TR050 CCTTATCGGCAGGCAAGTGAG HumanTNFR1 204 TR006 CCTCATCTGAGAAGACTGGGCG 205 TR007 GCCACCATGGGCCTCTCCACCGTGC 206 TR008 GGGCACTGAGGACTCAGTTTGTGGGAAATCGACACCTG 207 TR009 CAGGTGTCGATTTCCCACAAACTGAGTCCTCAGTGCCC 208 TR010 CACCATGGGCCTCTCCACCGTGC 209 TRO11 TCTGAGAAGACTGGGCG 210 TR031 CGATAGGATCCATGGGCCTCTCCACCGTGC 211 TR032 CCTAACTCGAGTCATCTGAGAAGACTGGGCG 212 TR033 GACTGAGCGGCCGCCACCATGGGCCTCTCCACCGTGC 213 TR034 CTAAGCGCGGCCGCTCATCTGAGAAGACTGGGCG MouseTNFR2 214 TR012 GGTCAGGCCACTTTGACTGC 215 TR013 CACCGCTGCCCCTATGGCG 216 TR014 CACCGCTGCCACTATGGCG 217 TR015 GGTCAGGCCACTTTGACTGCAATC 218 TR016 GCCACCATGGCGCCCGCCGCCCTCTGG 219 TR017 GGCATCTCTCTTCCAATTGAGAAGCCCTCCTGCCTACAAAG 220 TR018 CTTTGTAGGCAGGAGGGCTTCTCAATTGGAAGAGAGATGCC 221 TR019 GGCCACTTTGACTGCAATCTG 222 TR035 CACCATGGCGCCCGCCGCCCTCTGG 223 TR036 TCAGGCCACTTTGACTGCAATC 224 TR037 CGATAGAATTCATGGCGCCCGCCGCCCTCTGG 225 TR038 CCTAACTCGAGTCAGGCCACTTTGACTGCAATC 226 TR039 GACTGAGCGGCCGCCACCATGGCGCCCGCCGCCCTCTGG 227 TR040 CTAAGCGCGGCCGCTCAGGCCACTTTGACTGCAATC 228 TR045 GAGCCCCAAATGGAAATGTGC 229 TR046 GCTCAAGGCCTACTGCATCC MouseTNFR1 230 TR020 GGTTATCGCGGGAGGCGGGTCG 231 TR021 GCCACCATGGGTCTCCCCACCGTGCC 232 TR022 CACAAACCCCCAGGACTCAGTTTGTAGGGATCCCGTGCCT 233 TR023 AGGCACGGGATCCCTACAAACTGAGTCCTGGGGGTTTGTG 234 TR024 CACCATGGGTCTCCCCACCGTGCC 235 TR025 TCGCGGGAGGCGGGTCGTGG 236 TR041 CGATAGTCGACATGGGTCTCCCCACCGTGCC 237 TR042 CCTAAGAATTCTTATCGCGGGAGGCGGGTCG 238 TR043 GACTGAGCGGCCGCCACCATGGGTCTCCCCACCGTGCC 239 TR044 CTAAGCGCGGCCGCTTATCGCGGGAGGCGGGTCG

    Human Hepatocyte Cultures.

    [0485] Human hepatocytes were obtained in suspension either from ADMET technologies, or from The UNC Cellular Metabolism and Transport Core at UNC-Chapel Hill. Cells were washed and suspended in RPMI 1640 supplemented with 10% FBS, 1 mg/mL human insulin, and 13 nM DexamethASONe. Hepatocytes were plated in 6-well plates at 0.510.sup.6 cells per plate in 3 mL media. After 1-1.5 hrs, non-adherent cells were removed, and the media was replaced with RPMI 1640 without FBS, supplemented with 1 mg/mL human insulin, and 130 nM DexamethASONe.

    [0486] For delivery of SSOs to hepatocytes in 6-well plates, 10 mL of a 5 mM SSO stock was diluted into 100 mL of OPTI-MEM, and 4 mL of Lipofectamine 2000 was diluted into 100 mL of OPTI-MEM. The 200 mL complex solution was then applied to the cells in the 6-well plate containing 2800 mL of media, for a total of 3000 mL. The final SSO concentration was 17 nM. After 24 hrs, cells were harvested in TRI-Reagent. Total RNA was isolated per the manufacturer's directions. Approximately 200 ng of total RNA was subjected to reverse transcription-PCR (RT-PCR).

    ELISA.

    [0487] To determine the levels of soluble TNFR2 in cell culture media or sera, the Quantikine Mouse sTNF RII ELISA kit from R&D Systems (Minneapolis, Minn.) or Quantikine Human sTNF RII ELISA kit from R&D Systems (Minneapolis, Minn.) were used. The antibodies used for detection also detect the protease cleavage forms of the receptor. ELISA plates were read using a microplate reader set at 450 nm, with wavelength correction set at 570 nm.

    [0488] For mouse in vivo studies, blood from the animals was clotted for 1 hour at 37 C. and centrifuged for 10 min at 14,000 rpm (Jouan BRA4i centrifuge) at 4 C. Sera was collected and assayed according to the manufacturer's guide, using 50 mL of mouse sera diluted 1:10.

    L929 Cytotoxicity Assay.

    [0489] L929 cells plated in 96-well plates at 10.sup.4 cells per well were treated with 0.1 ng/mL TNF- and 1 mg/mL actinomycin D in the presence of 10% serum from mice treated with the indicated oligonucleotide in 100 mL total of complete MEM media (containing 10% regular FBS) and allowed to grow for 24 hrs at 37 C. Control lanes were plated in 10% serum from untreated mice. Cell viability was measured 24 hrs later by adding 20 mL CellTiter 96 AQ.sub.ueous One Solution Reagent (Promega) and measuring absorbance at 490 nm with a microplate reader. Cell viability was normalized to untreated cells.

    Western Blots.

    [0490] Twenty mL of media or 20 mg of lysate were loaded in each well of a 4-12% NuPAGE polyacrylamide gel (Invitrogen). The gel was run 40 min at 200V. The protein was transferred, for 1 hr at 30V, to an Invitrolon PVDF membrane (Invitrogen), which was then blocked with StartingBlock Blocking Buffer (Pierce) for 1 hr at room temperature. The membrane was incubated for 3 hrs at room temperature with a rabbit polyclonal antibody that recognizes the C-terminus of human and mouse TNFR2 (Abcam), Following three washes in PBS-T buffer (1PBS, 0.1% Tween-20), the membrane was incubated for one hour at room temperature with secondary goat anti-rabbit antibody (Abcam) and again washed three times with PBS-T buffer. The protein was then detected with ECL Plus (GE Healthcare), according to the manufacturer's recommendations and then photographed.

    Example 13

    SSO Splice Switching Activity with TNFR mRNA

    [0491] Table 6 shows the splice switching activities of SSOs having sequences as described in U.S. application Ser. No. 11/595,485 and targeted to mouse and human TNFRs. Of SSOs targeted to mouse TNFR2 exon 7, at least 8 generated some muTNFR2 7 mRNA. In particular, SSO 3312, 3274 and 3305 induced at least 50% skipping of exon 7; SSO 3305 treatment resulted in almost complete skipping. Of SSOs transfected into primary human hepatocytes, and targeted to human TNFR2 exon 7, at least 7 SSOs generated some huTNFR2 7 mRNA. In particular, SSOs 3378, 3379, 3384 and 3459 induced at least 75% skipping of exon 7 (FIG. 22B), and significant induction of huTNFR2 7 into the extracellular media (FIG. 22A).

    TABLE-US-00006 TABLE 6 SSO Splice Switching Activity SEQ ID. Name Activity Mouse TNFR2 3272 3304 3305 + 3306 + 3307 + 3308 + 3309 + 3310 3311 + 62 3274 + 3312 + 3273 Mouse TNFR1 3333 + Human TNFR2 14 3378 + 30 3379 + 3380 70 3381 + 71 3382 + 3383 46 3384 + 72 3459 + 3460 73 3461 + Control 3083

    [0492] Table 7 contains the sequences of 10 nucleotide chimeric SSOs with alternating 2-O-methyl-ribonucleoside-phosphorothioates (2-OMe) and 2O-4-(methylene)-bicyclic-ribonucleoside phosphorothioates. These SSOs are targeted to exon 7 of mouse TNFR2.

    TABLE-US-00007 TABLE7 LNA/21-OMe-ribonucleosidephosphorothioate chimericmousetargetedSSO SEQID. Name Sequence5 to3* 178 3274 AgAgCaGaAcCtTaCt 179 3837 gAaCcTuAcT 180 3838 aGaGcAgAaC 181 3839 gAgCaGaAcC 182 3840 aGcAgAaCcT 183 3841 gCaGaAcCuT 184 3842 cAgAaCcTuA 185 3843 aGaAcCuTaC *Capital letters are 2O-4-(methylene)-bicyclic-ribonucleosides; lowercase letters are 2-OMe

    [0493] To analyze the in vitro splice-switching activity of the SSOs listed in Table 7, L929 cells were cultured and seeded as described in Example 12. For delivery of each of the SSOs in Table 7 to the L929 cells, SSOs were diluted into 50 mL of OPTI-MEM, and then 50 mL Lipofectamine 2000 mix (1 part Lipofectamine 2000 to 25 parts OPTI-MEM) was added and incubated for 20 minutes. Then 400 mL of serum free media was added to the SSOs and applied to the cells in the 24-well plates. The final SSO concentration was either 50 or 100 nM. After 24 hrs, cells were harvested in 800 mL TRI-Reagent. Total RNA was isolated per the manufacturer's directions and analyzed by RT-PCR (FIG. 23) using the forward primer TR045 (SEQ ID No: 228) and the reverse primer TR046 (SEQ ID No: 229).

    [0494] To analyze the in vivo splice-switching activity of the SSOs listed in Table 7, mice were injected with the SSOs listed in Table 4 intraperitoneal (i.p.) at 25 mg/kg/day for 5 days. Mice were bled before injection and again 1, 5 and 10 days after the last injection. The concentration of soluble TNFR2 7 in the sera taken before the first injection and 10 days after the last injection were measured by ELISA (FIG. 24B). The mice were sacrificed on day 10 and total RNA from 5-10 mg of the liver was analyzed by RT-PCR (FIG. 24A) using the forward primer TR045 (SEQ ID No: 228) and the reverse primer TR046 (SEQ ID No: 229).

    [0495] Of the 10 nucleotide SSOs subsequences of SSO 3274 tested in vitro, all of them generated at least some muTNFR2 7 mRNA (FIG. 23). In particular, SSO 3839, 3840 and 3841 displayed greater splice-switching activity than the longer 16 nucleotide SSO 3274 from which they are derived. The three 10 nucleotide SSOs, 3839, 3840, 3841, that demonstrated the greatest activity in vitro also were able to generate significant amounts of muTNFR2 7 mRNA (FIG. 24A) and soluble muTNFR2 7 protein (FIG. 24B) in mice in vivo.

    [0496] To assess the effect of SSO length on splice switching activity in human TNFR2, cells were treated with SSOs of different lengths. Primary human hepatocytes were transfected with the indicated SSOs selected from Table 4. These SSOs were synthesized by Santaris Pharma, Denmark with alternating 2deoxy- and 2O-4-(methylene)-bicyclic-ribonucleoside phosphorothioates. For each SSO, the 5-terminal nucleoside was a 2O-4-methylene-ribonucleoside and the 3-terminal nucleoside was a 2deoxy-ribonucleoside. These SSOs were either 10-, 12-, 14- or 16-mers. The concentration of soluble TNFR2 7 was measured by ELISA (FIG. 25, top panel). Total RNA was analyzed by RT-PCR for splice switching activity (FIG. 25, bottom panel).

    Example 14

    Analysis of the Splice Junction of SSO-Induced TNFR2 Splice Variants

    [0497] To confirm that the SSO splice switching, both in mice and in human cells, leads to the expected TNFR2 7 mRNA, SSO-induced TNFR2 7 mRNA was analyzed by RT-PCR and was sequenced.

    Mice.

    [0498] Mice were injected with SSO 3274 intraperitoneal (i.p.) at 25 mg/kg/day for 10 days. The mice were then sacrificed and total RNA from the liver was analyzed by RT-PCR using the forward primer TR045 (SEQ ID No: 228) and the reverse primer TR046 (SEQ ID No: 229). The products were analyzed on a 1.5% agarose gel (FIG. 26A) and the product for the TNFR2 7 was isolated using standard molecular biology techniques. The isolated TNFR2 7 product was amplified by PCR using the same primers and then sequenced (FIG. 26B). The sequence data contained the sequence CTCTCTTCCAATTGAGAAGCCCTCCTGC (nucleotides 777-804 of SEQ ID No: 127), which confirms that the SSO-induced TNFR2 7 mRNA lacks exon 7 and that exon 6 is joined directly to exon 8.

    Human Hepatocytes.

    [0499] Primary human hepatocytes were transfected with SSO 3379 as described in Example 12. Total RNA was isolated 48 hrs after transfection. The RNA was converted to cDNA with the Superscript II Reverse Transcriptase (Invitrogen) using random hexamer primers according to the manufacturer's directions. PCR was performed on the cDNA using the forward primer TR049 (SEQ ID No: 202) and the reverse primer TR050 (SEQ ID No: 203). The products were analyzed on a 1.5% agarose gel (FIG. 27A). The band corresponding to TNFR2 7 was isolated using standard molecular biology techniques and then sequenced (FIG. 27B). The sequence data contained the sequence CGCTCTTCCAGTTGAGAAGCCCTTGTGC (nucleotides 774-801 of SEQ ID No: 125), which confirms that the SSO-induced TNFR2 7 mRNA lacks exon 7 and that exon 6 is joined directly to exon 8.

    Example 15

    SSO Dose-Dependent Production of TNFR2 7 Protein in Primary Human Hepatocytes

    [0500] The dose response of splice-switching activity of SSOs in primary human hepatocytes was tested. Human hepatocytes were obtained in suspension from ADMET technologies. Cells were washed three times and suspended in seeding media (RPMI 1640 supplemented with L-Glut, with 10% FBS, penicillin, streptomycin, and 12 nM DexamethASONe). Hepatocytes were evaluated for viability and plated in 24-well, collagen-coated plates at 1.010.sup.5 cells per well. Typically, cell viability was 85-93%. After approximately 24 hrs, the media was replaced with maintenance media (seeding media without FBS).

    [0501] For delivery of each of the SSOs to the hepatocytes, SSOs were diluted into 50 mL of OPTI-MEM, and then 50 mL Lipofectamine 2000 mix (1 part Lipofectamine 2000 to 25 parts OPTI-MEM) was added and incubated for 20 minutes. The SSOs were then applied to the cells in the 24-well plates. The final SSO concentration ranged from 1 to 150 nM. After 48 hrs, cells were harvested in 800 mL TRI-Reagent.

    [0502] Total RNA from the cells was analyzed by RT-PCR using the forward primer TR047 (SEQ ID No: 200) and the reverse primer TR048 (SEQ ID No: 201) (FIG. 28A). The concentration of soluble TNFR2 7 in the serum was measured by ELISA (FIG. 28B). Both huTNFR2 7 mRNA (FIG. 8A) and secreted huTNFR2 7 protein (FIG. 28B) displayed dose dependent increases.

    Example 16

    Secretion of TNFR2 Splice Variants from Murine Cells

    [0503] The ability of SSOs to induce soluble TNFR2 protein production and secretion into the extracellular media was tested. L929 cells were treated with SSOs as described in Example 12, and extracellular media samples were collected 48 hrs after transfection. The concentration of soluble TNFR2 in the samples was measured by ELISA (FIG. 29). SSOs that best induced shifts in RNA splicing, also secreted the most protein into the extracellular media. In particular, SSOs 3305, 3312, and 3274 increased soluble TNFR2 at least 3.5-fold over background. Consequently, induction of the splice variant mRNA correlated with production and secretion of the soluble TNFR2.

    Example 17

    In Vivo Injection of SSOs Generated muTNFR2 7 mRNA in Mice

    [0504] SSO 3305 in saline was injected intraperitoneal (i.p.) daily for 4 days into mice at doses from 3 mg/kg to 25 mg/kg. The mice were sacrificed on day 5 and total RNA from the liver was analyzed by RT-PCR. The data show splice switching efficacy similar to that found in cell culture. At the maximum dose of 25 mg/kg, SSO 3305 treatment induced almost full conversion to 7 mRNA (FIG. 30, bottom panel).

    [0505] A similar experiment with SSO 3274 induced about 20% conversion to 7 mRNA. To optimize SSO 3274 induction of 7 mRNA, both the dose regimen and the time from the last injection to the sacrifice of the animal were varied. SSO 3274 was injected (i.p.) into mice daily for 4 days. SSO treatment induced about 30% conversion to 7 mRNA in mice analyzed on day 15, whereas a 20% shift was observed in mice analyzed on day five (FIG. 30, top panel). Furthermore, mice given 7 injections for 10 days, and sacrificed on day 11 showed a 50% induction of mRNA (FIG. 30, top). These in vivo data suggest that TNFR2 SSOs can produce muTNFR2 7 mRNA for at least 10 days after administration.

    Example 18

    Circulatory TNFR2 7

    [0506] Mice were injected with SSO 3274, 3305, or the control 3083 intraperitoneal (i.p.) at 25 mg/kg/day for 10 days. Mice were bled before injection and again 1, 5 and 10 days after the last injection. The concentration of soluble TNFR2 7 in the serum was measured. SSO treatment induced soluble TNFR2 7 protein levels over background for at least 10 days (FIG. 31).

    [0507] To test the effects at longer time points, the experiment was repeated, except that serum samples were collected until day 27 after the last injection. The results show only a slight decrease in soluble TNFR2 7 levels 27 days after the last SSO injection (FIG. 32).

    Example 19

    Anti-TNF- Activity in Mice Serum

    [0508] The anti-TNF- activity of serum from SSO 3274 treated mice was tested in an L929 cytotoxicity assay. In this assay, serum is assessed for its ability to protect cultured L929 cells from the cytotoxic effects of a fixed concentration of TNF- as described in Example 12. Serum from mice treated with SSO 3274 but not control SSOs (3083 or 3272) increased viability of the L929 cells exposed to 0.1 ng/mL TNF- (FIG. 23). Hence, the SSO 3274 serum contained TNF- antagonist sufficient to bind and to inactivate TNF-, and thereby protect the cells from the cytotoxic effects of TNF-. This anti-TNF- activity was present in the serum of animals 5 and 27 days after the last injection of SSO 3274.

    Example 20

    Comparison of SSO Generated TNFR2 7 to Other Anti-TNF- Antagonists

    [0509] L929 cells were seeded as described above. Samples were prepared containing 90 L of serum-free MEM, 0.1 ng/ml TNF- and 1 g/ml of actinomycin D, with either (i) recombinant soluble protein (0.01-3 mg/mL)) from Sigma having the 236 amino acid residue extracellular domain of mouse TNFR2, (ii) serum from SSO 3274 or SSO 3305 treated mice (1.25-10%, diluted in serum from untreated mice; the concentration of TNFR2 7 was determined by ELISA) or (iii) Enbrel (0.45-150 pg/ml) to a final volume of 100 ti with a final mouse serum concentration of 10%. The samples were incubated at room temperature for 30 minutes. Subsequently, the samples were applied to the plated cells and incubated for 24 hrs at 37 C. in a 5% CO.sub.2 humidified atmosphere. Cell viability was measured by adding 20 L CellTiter 96 AQ.sub.ueous One Solution Reagent (Promega) and measuring absorbance at 490 nm with a microplate reader. Cell viability was normalized to untreated cells and plotted as a function of TNF antagonist concentration (FIG. 24).

    Example 21

    Stability of TNFR2 7 mRNA and Protein

    [0510] Mice were treated with either SSO 3274 or 3272 (control) (n=5) by i.p. injection at a dose of 25 mg/kg/day daily for five days. Mice were bled before injection and again 5, 15, 22, 27, and 35 days after the last injection. The concentration of soluble TNFR2 7 in the serum was measured (FIG. 25A). Splice shifting of TNFR2 in the liver was also determined at the time of sacrifice by RT-PCR of total RNA from the liver (FIG. 25B). Combined with data from Example 18, a time course of TNFR2 mRNA levels after SSO treatment was constructed, and compared with the time course of TNFR2 7 protein in serum (FIG. 26). The data show that TNFR2 7 mRNA in vivo decays at a rate approximately 4 times faster than that of TNFR2 7 protein in serum. On day 35, TNFR2 7 mRNA was only detectable in trace amounts, whereas TNFR2 7 protein had only decreased by 20% from its peak concentration.

    Example 22

    Generation of Human TNFR2 7 cDNA

    [0511] A plasmid containing the full length human TNFR2 cDNA was obtained commercially from OriGene (Cat. No: TC119459, NM_001066.2). The cDNA was obtained by performing PCR on the plasmid using reverse primer TR001 (SEQ ID No: 116) and forward primer TR002 (SEQ ID No: 117). The PCR product was isolated and was purified using standard molecular biology techniques, and contains the 1383 bp TNFR2 open reading frame without a stop codon.

    [0512] Alternatively, full length human TNFR2 cDNA is obtained by performing RT-PCR on total RNA from human mononuclear cells using the TR001 reverse primer and the TR002 forward primer. The PCR product is isolated and is purified using standard molecular biology techniques.

    [0513] To generate human TNFR2 7 cDNA, two separate PCR reactions were performed on the full length human TNFR2 cDNA, thereby creating overlapping segments of the TNFR2 7 cDNA. In one reaction, PCR was performed on full length TNFR2 cDNA using the forward primer TR003 (SEQ ID No: 190) and the reverse primer TR004 (SEQ ID No: 191). In the other reaction, PCR was performed on full length TNFR2 cDNA using the reverse primer TR005 (SEQ ID No: 192) and the TR002 forward primer. Finally, the 2 overlapping segments were combined, and PCR was performed using the TR002 forward primer and the TR004 reverse primer. The PCR product was isolated and was purified using standard molecular biology techniques, and was expected to contain the 1308 bp TNFR2 7 open reading frame with a stop codon (SEQ ID No: 125).

    [0514] Similarly, by using the TR001 reverse primer instead of the TR004 reverse primer in these PCR reactions the 1305 bp human TNFR2 7 open reading frame without a stop codon was generated. This allows for the addition of in-frame C-terminal affinity purification tags, such as His-tag, when the final PCR product is inserted into an appropriate vector.

    Example 23

    Generation of Human TNFR1 7 cDNA

    [0515] A plasmid containing the full length human TNFR2 cDNA is obtained commercially from OriGene (Cat. No: TC127913, NM_001065.2). The cDNA is obtained by performing PCR on the plasmid using the TR006 reverse primer (SEQ ID No: 204) and the TR007 forward primer (SEQ ID No: 205). The full length human TNFR1 cDNA PCR product is isolated and is purified using standard molecular biology techniques.

    [0516] Alternatively, full length human TNFR1 cDNA is obtained by performing RT-PCR on total RNA from human mononuclear cells using the TR006 reverse primer and the TR007 forward primer. The full length human TNFR1 cDNA PCR product is isolated and is purified using standard molecular biology techniques.

    [0517] To generate human TNFR1 7 cDNA, two separate PCR reactions are performed on the full length human TNFR1 cDNA, thereby creating overlapping segments of the TNFR1 7 cDNA. In one reaction, PCR is performed on full length TNFR1 cDNA using the TR008 forward primer (SEQ ID No: 206) and the TR006 reverse primer. In the other reaction, PCR is performed on full length TNFR1 cDNA using the TR009 reverse primer (SEQ ID No: 207) and the TR010 forward primer (SEQ ID No: 208). Finally, the 2 overlapping segments are combined, and PCR is performed using the TR010 forward primer and the TR006 reverse primer. The PCR product is isolated and is purified using standard molecular biology techniques, and contains the 1254 bp human TNFR1 7 open reading frame with a stop codon (SEQ ID No: 121).

    [0518] Alternatively, by using the TR011 reverse primer (SEQ ID No: 209) instead of the TR006 reverse primer in these PCR reactions the 1251 bp human TNFR1 7 open reading frame without a stop codon is generated. This allows for the addition of in-frame C-terminal affinity purification tags, such as His-tag, when the final PCR product is inserted into an appropriate vector.

    Example 24

    Generation of Murine TNFR2 7 cDNA

    [0519] To generate full length murine TNFR2 cDNA, PCR was performed on the commercially available FirstChoice PCR-Ready Mouse Liver cDNA (Ambion, Cat. No: AM3300) using the TR012 reverse primer (SEQ ID No: 214) and the TR013 forward primer (SEQ ID No: 215). The full length murine TNFR2 cDNA PCR product is isolated and is purified using standard molecular biology techniques. Then by performing PCR on the resulting product using the TR014 forward primer (SEQ ID No: 216) and the TR012 reverse primer the proper Kozak sequence was introduced.

    [0520] Alternatively, full length murine TNFR2 cDNA is obtained by performing RT-PCR on total RNA from mouse mononuclear cells or mouse hepatocytes using the TR015 reverse primer (SEQ ID No: 217) and the TR016 forward primer (SEQ ID No: 218). The full length murine TNFR2 cDNA PCR product is isolated and is purified using standard molecular biology techniques.

    [0521] To generate murine TNFR2 7 cDNA, two separate PCR reactions were performed on the full length murine TNFR2 cDNA, thereby creating overlapping segments of the TNFR2 7 cDNA. In one reaction, PCR was performed on full length TNFR2 cDNA using the TR017 forward primer (SEQ ID No: 219) and the TR015 reverse primer. In the other reaction, PCR was performed on full length TNFR2 cDNA using the TR018 reverse primer (SEQ ID No: 220) and the TR016 forward primer. Finally, the 2 overlapping segments were combined, and PCR was performed using the TR016 forward primer and the TR015 reverse primer. The PCR product was isolated and was purified using standard molecular biology techniques, and was expected to contain the 1348 bp murine TNFR2 7 open reading frame with a stop codon (SEQ ID No: 127).

    [0522] Alternatively, by using the TR019 reverse primer (SEQ ID No: 221) instead of the TR015 reverse primer in these PCR reactions the 1345 bp murine TNFR2 7 open reading frame without a stop codon was generated. This allows for the addition of in-frame C-terminal affinity purification tags, such as His-tag, when the final PCR product is inserted into an appropriate vector.

    Example 25

    Generation of Murine TNFR1 7 cDNA

    [0523] To generate full length murine TNFR1 cDNA, PCR is performed on the commercially available FirstChoice PCR-Ready Mouse Liver cDNA (Ambion, Cat. No: AM3300) using the TR020 reverse primer (SEQ ID No: 230) and the TR021 forward primer (SEQ ID No: 231). The full length murine TNFR1 cDNA PCR product is isolated and is purified using standard molecular biology techniques.

    [0524] Alternatively, full length murine TNFR1 cDNA is obtained by performing RT-PCR on total RNA from mouse mononuclear cells using the TR020 reverse primer and the TR021 forward primer. The full length murine TNFR1 cDNA PCR product is isolated and is purified using standard molecular biology techniques.

    [0525] To generate murine TNFR1 7 cDNA, two separate PCR reactions are performed on the full length human TNFR1 cDNA, thereby creating overlapping segments of the TNFR1 7 cDNA. In one reaction, PCR is performed on full length TNFR1 cDNA using the TR022 forward primer (SEQ ID No: 232) and the TR020 reverse primer. In the other reaction, PCR is performed on full length TNFR1 cDNA using the TR023 reverse primer (SEQ ID No: 233) and the TR024 forward primer (SEQ ID No: 234). Finally, the 2 overlapping segments are combined, and PCR is performed using TR024 forward primer and the TR020 reverse primer. The 1259 bp PCR product is isolated and is purified using standard molecular biology techniques, and contains the 1251 bp murine TNFR1 7 open reading frame with a stop codon (SEQ ID No: 123).

    [0526] Alternatively, by using the TR025 reverse primer (SEQ ID No: 235) instead of the TR020 reverse primer in these PCR reactions the 1248 bp murine TNFR1 7 open reading frame without a stop codon is generated. This allows for the addition of in-frame C-terminal affinity purification tags, such as His-tag, when the final PCR product is inserted into an appropriate vector.

    Example 26

    Construction of Vectors for the Expression of Human TNFR2 7 in Mammalian Cells

    [0527] For expression of the human TNFR2 7 protein in mammalian cells, a human TNFR2 7 cDNA PCR product from Example 23 was incorporated into an appropriate mammalian expression vector. The TNFR2 7 cDNA PCR product from Example 23, both with and without a stop codon, and the pcDNA3.1D/V5-His TOPO expression vector (Invitrogen) were blunt-end ligated and isolated according to the manufacturer's directions. Plasmids containing inserts encoding human TNFR2 7 were transformed into OneShot Top10 competent cells (Invitrogen), according to the supplier's directions. Fifty mL of the transformation mix were plated on LB media with 100 mg/mL of ampicillin and incubated overnight at 37 C. Single colonies were used to inoculate 5 mL cultures of LB media with 100 mg/mL ampicillin and incubated overnight at 37 C. The cultures were then used to inoculate 200 mL of LB media with 100 mg/mL of ampicillin and grown overnight at 37 C. The plasmids were isolated using GenElute Plasmid Maxiprep kit (Sigma) according to manufacturer's directions. Purification efficiency ranged from 0.5 to 1.5 mg of plasmid per preparation.

    [0528] Three human TNFR2 7 clones (1319-1, 1138-5 and 1230-1) were generated and sequenced. Clone 1319-1 contains the human TNFR2 7 open reading frame without a stop codon followed directly by an in-frame His-tag from the plasmid; while clones 1138-5 and 1230-1 contain the TNFR2 7 open reading frame followed immediately by a stop codon. The sequence of the His-tag from the plasmid is given in SEQ ID No: 242. The sequences of the TNFR2 7 open reading frames of clones 1230-1 and 1319-1 were identical to SEQ ID No: 125 with and without the stop codon, respectively. However relative to SEQ ID No: 125, the sequence (SEQ ID No: 231) of the TNFR2 7 open reading frames of clone 1138-5 differed by a single nucleotide at position 1055 in exon 10, with an A in the former and a G in the later. This single nucleotide change causes the amino acid 352 to change from a glutamine to an arginine.

    Example 27

    Expression of Human TNFR2 7 in E. coli

    [0529] For expression of the human TNFR2 7 protein in bacteria, a human TNFR2 7 cDNA from Example 23 is incorporated into an appropriate expression vector, such as a pET Directional TOPO expression vector (Invitrogen). PCR is performed on the PCR fragment from Example 23 using forward (TR002) (SEQ ID No: 191) and reverse (TR026) (SEQ ID No: 195) primers to incorporate a homologous recombination site for the vector. The resulting PCR fragment is incubated with the pET101/D-TOPO vector (Invitrogen) according to the manufacturer's directions, to create the human TNFR2 7 bacterial expression vector. The resulting vector is transformed into the E. coli strain BL21(DE3). The human TNFR2 7 is then expressed from the bacterial cells according to the manufacturer's instructions.

    Example 28

    Expression of Human TNFR2 7 in Insect Cells

    [0530] For expression of the human TNFR2 7 protein in insect cells, a human TNFR2 7 cDNA from Example 23 is incorporated into a baculoviral vector. PCR is performed on a human TNFR2 7 cDNA from Example 23 using forward (TR027) (SEQ ID No: 196) and reverse (TR028) (SEQ ID No: 197) primers. The resulting PCR product is digested with the restriction enzymes EcoRI and XhoI. The digested PCR product is ligated with a EcoRI and XhoI digested pENTR Vector (Invitrogen), such as any one of the pENTR1A, pENTR2B, pENTR3C, pENTR4, or pENTR11 Vectors, to yield an entry vector. The product is then isolated, amplified, and purified using standard molecular biology techniques.

    [0531] A baculoviral vector containing the human TNFR2 7 cDNA is generated by homologous recombination of the entry vector with BaculoDirect Linear DNA (Invitrogen) using LR Clonase (Invitrogen) according to the manufacturer's directions. The reaction mixture is then used to infect Sf9 cells to generate recombinant baculovirus. After harvesting the recombinant baculovirus, expression of human TNFR2 7 is confirmed. Amplification of the recombinant baculovirus yields a high-titer viral stock. The high-titer viral stock is used to infect Sf9 cells, thereby expressing human TNFR2 7 protein.

    Example 29

    Generation of Adeno-Associated Viral Vectors for the Expression of Human TNFR2 7

    [0532] For in vitro or in vivo delivery to mammalian cells of the human TNFR2 7 gene for expression in those mammalian cells, a recombinant adeno-associated virus (rAAV) vector is generated using a three plasmid transfection system as described in Grieger, J., et al., 2006, Nature Protocols 1:1412. PCR is performed on a purified human TNFR2 D7 PCR product of Example 23 using forward (TR029) (SEQ ID No: 198) and reverse (TR030) (SEQ ID No: 199) primers to introduce unique flanking NotI restriction sites. The resulting PCR product is digested with the NotI restriction enzyme, and isolated by standard molecular biology techniques. The NotI-digested fragment is then ligated to NotI-digested pTR-UF2 (University of North Carolina (UNC) Vector Core Facility), to create a plasmid that contains the human TNFR2 D7 open reading frame, operably linked to the CMVie promoter, flanked by inverted terminal repeats. The resulting plasmid is then transfected with the plasmids pXX680 and pHelper (UNC Vector Core Facility) into HEK-293 cells, as described in Grieger, J., et al., to produce rAAV particles containing the human TNFR2 7 gene where expression is driven by the strong constitutive CMVie promoter. The virus particles are harvested and purified, as described in Grieger, J., et al., to provide an rAAV stock suitable for transducing mammalian cells.

    Example 30

    Expression of Human TNFR1 7 in E. coli

    [0533] For expression of the human TNFR1 7 protein in bacteria, the cDNA is incorporated into an appropriate expression vector, such as a pET Directional TOPO expression vector (Invitrogen). PCR is performed on the cDNA using forward (TR010) (SEQ ID No: 208) and reverse (TR006) (SEQ ID No: 204) primers to incorporate a homologous recombination site for the vector. The resulting PCR fragment is incubated with the pET101/D-TOPO vector (Invitrogen) according to the manufacturer's directions, to create the human TNFR1 7 bacterial expression vector. The resulting vector is transformed into the E. coli strain BL21(DE3). The human TNFR1 7 is then expressed from the bacterial cells according to the manufacturer's instructions.

    Example 31

    Expression of Human TNFR1 7 in Mammalian Cells

    [0534] For expression of the human TNFR1 7 protein in mammalian cells, a human TNFR1 7 cDNA PCR product is incorporated into an appropriate mammalian expression vector. human TNFR1 7 cDNA PCR product and the pcDNA3.1D/V5-His TOPO expression vector (Invitrogen) are blunt-end ligated according to the manufacturer's directions. The product is then isolated, amplified, and purified using standard molecular biology techniques to yield the mammalian expression vector. The vector is then transfected into a mammalian cell, where expression of the human TNFR1 7 protein is driven by the strong constitutive CMVie promoter.

    Example 32

    Expression of Human TNFR1 7 in Insect Cells

    [0535] For expression of the human TNFR1 7 protein in insect cells, the cDNA from Example 33 is incorporated into a baculoviral vector. PCR is performed on the cDNA from Example 33 using forward (TR031) (SEQ ID No: 210) and reverse (TR032) (SEQ ID No: 211) primers. The resulting PCR product is digested with the restriction enzymes EcoRI and XhoI. The digested PCR product is ligated with a EcoRI and XhoI digested pENTR Vector (Invitrogen), such as any one of the pENTR1A, pENTR2B, pENTR3C, pENTR4, or pENTR11 Vectors, to yield an entry vector. The product is then isolated, amplified, and purified using standard molecular biology techniques.

    [0536] A baculoviral vector containing the human TNFR1 7 cDNA is generated by homologous recombination of the entry vector with BaculoDirect Linear DNA (Invitrogen) using LR Clonase (Invitrogen) according to the manufacturer's directions. The reaction mixture is then used to infect Sf9 cells to generate recombinant baculovirus. After harvesting the recombinant baculovirus, expression of human TNFR1 7 is confirmed. Amplification of the recombinant baculovirus yields a high-titer viral stock. The high-titer viral stock is used to infect Sf9 cells, thereby expressing human TNFR1 7 protein.

    Example 33

    Generation of Adeno-Associated Viral Vectors for the Expression of Human TNFR1 7

    [0537] For in vitro or in vivo delivery to mammalian cells of the human TNFR1 7 gene for expression in those mammalian cells, a recombinant adeno-associated virus (rAAV) vector is generated using a three plasmid transfection system as described in Grieger, J., et al., 2006, Nature Protocols 1:1412. PCR is performed on the purified human TNFR1 D7 PCR product using forward (TR033) (SEQ ID No: 212) and reverse (TR034) (SEQ ID No: 213) primers to introduce unique flanking NotI restriction sites. The resulting PCR product is digested with the NotI restriction enzyme, and isolated by standard molecular biology techniques. The NotI-digested fragment is then ligated to NotI-digested pTR-UF2 (University of North Carolina (UNC) Vector Core Facility), to create a plasmid that contains the human TNFR1 D7 open reading frame, operably linked to the CMVie promoter, flanked by inverted terminal repeats. The resulting plasmid is then transfected with the plasmids pXX680 and pHelper (UNC Vector Core Facility) into HEK-293 cells, as described in Grieger, J., et al., to produce rAAV particles containing the human TNFR1 7 gene where expression is driven by the strong constitutive CMVie promoter. The virus particles are harvested and purified, as described in Grieger, J., et al., to provide an rAAV stock suitable for transducing mammalian cells.

    Example 34

    Construction of Vectors for the Expression of Mouse TNFR2 7 in Mammalian Cells

    [0538] For expression of the murine TNFR2 7 protein in mammalian cells, a murine TNFR2 7 cDNA PCR product from Example 25 was incorporated into an appropriate mammalian expression vector. The TNFR2 7 cDNA PCR product from Example 25 both with and without a stop codon, and the pcDNA3.1D/V5-His TOPO expression vector (Invitrogen) was blunt-end ligated and isolated according to the manufacturer's directions. Plasmids containing inserts encoding murine 7 TNFR2 were transformed into OneShot Top10 competent cells (Invitrogen), according to the supplier's directions. Fifty mL of the transformation mix were plated on LB media with 100 mg/mL of ampicillin and incubated overnight at 37 C. Single colonies were used to inoculate 5 mL cultures of LB media with 100 mg/mL ampicillin and incubated overnight at 37 C. The cultures were then used to inoculate 200 mL of LB media with 100 mg/mL of ampicillin and grown overnight at 37 C. The plasmids were isolated using GenElute Plasmid Maxiprep kit (Sigma) according to manufacturer's directions. Purification efficiency ranged from 0.5 to 1.5 mg of plasmid per preparation.

    [0539] Two murine TNFR2 7 clones (1144-4 and 1145-3) were generated and sequenced. Clone 1144-4 contains the murine TNFR2 7 open reading frame without a stop codon followed directly by an in-frame His-tag from the plasmid; while clone 1145-3 contains the TNFR2 7 open reading frame followed immediately by a stop codon. The sequence of the His-tag from the plasmid is given in SEQ ID No: 242. Relative to SEQ ID No: 127, the sequence (SEQ ID No: 240) of the TNFR2 7 open reading frames of the two clones, 1144-4 and 1145-3, differed by a single nucleotide at eleven positions. As a result of these single nucleotide changes there are four amino acid differences relative to SEQ ID No: 128.

    Example 35

    Expression of Murine TNFR2 7 in E. coli

    [0540] For expression of the mouse TNFR2 7 protein in bacteria, a murine TNFR2 7 cDNA from Example 25 is incorporated into an appropriate expression vector, such as a pET Directional TOPO expression vector (Invitrogen). PCR is performed on the PCR fragment from Example 25 using forward (TR035) (SEQ ID No: 222) and reverse (TR036) (SEQ ID No: 223) primers to incorporate a homologous recombination site for the vector. The resulting PCR fragment is incubated with the pET101/D-TOPO vector (Invitrogen) according to the manufacturer's directions, to create the murine TNFR2 7 bacterial expression vector. The resulting vector is transformed into the E. coli strain BL21(DE3). The murine TNFR2 7 is then expressed from the bacterial cells according to the manufacturer's instructions.

    Example 36

    Expression of Mouse TNFR2 7 in Insect Cells

    [0541] For expression of the murine TNFR2 7 protein in insect cells, the cDNA from Example 25 is incorporated into a baculoviral vector. PCR is performed on the cDNA from Example 25 using forward (TR037) (SEQ ID No: 224) and reverse (TR038) (SEQ ID No: 225) primers. The resulting PCR product is digested with the restriction enzymes EcoRI and XhoI. The digested PCR product is ligated with a EcoRI and XhoI digested pENTR Vector (Invitrogen), such as any one of the pENTR1A, pENTR2B, pENTR3C, pENTR4, or pENTR11 Vectors, to yield an entry vector. The product is then isolated, amplified, and purified using standard molecular biology techniques.

    [0542] A baculoviral vector containing the murine TNFR2 7 cDNA is generated by homologous recombination of the entry vector with BaculoDirect Linear DNA (Invitrogen) using LR Clonase (Invitrogen) according to the manufacturer's directions. The reaction mixture is then used to infect Sf9 cells to generate recombinant baculovirus. After harvesting the recombinant baculovirus, expression of murine TNFR2 7 is confirmed. Amplification of the recombinant baculovirus yields a high-titer viral stock. The high-titer viral stock is used to infect Sf9 cells, thereby expressing murine TNFR2 7 protein.

    Example 37

    Generation of Adeno-Associated Viral Vectors for the Expression of Murine TNFR2 7

    [0543] For in vitro or in vivo delivery to mammalian cells of the murine TNFR2 7 gene for expression in those mammalian cells, a recombinant adeno-associated virus (rAAV) vector is generated using a three plasmid transfection system as described in Grieger, J., et al., 2006, Nature Protocols 1:1412. PCR is performed on the purified murine TNFR2 D7 PCR product of Example 25 using forward (TR039)(SEQ ID No: 226) and reverse (TR040)(SEQ ID No: 227) primers to introduce unique flanking NotI restriction sites. The resulting PCR product is digested with the NotI restriction enzyme, and isolated by standard molecular biology techniques. The NotI-digested fragment is then ligated to NotI-digested pTR-UF2 (University of North Carolina (UNC) Vector Core Facility), to create a plasmid that contains the murine TNFR2 D7 open reading frame, operably linked to the CMVie promoter, flanked by inverted terminal repeats. The resulting plasmid is then transfected with the plasmids pXX680 and pHelper (UNC Vector Core Facility) into HEK-293 cells, as described in Grieger, J., et al., to produce rAAV particles containing the murine TNFR2 7 gene where expression is driven by the strong constitutive CMVie promoter. The virus particles are harvested and purified, as described in Grieger, J., et al., to provide a rAAV stock suitable for transducing mammalian cells.

    Example 38

    Expression of Murine TNFR1 7 in E. coli

    [0544] For expression of the mouse TNFR1 7 protein in bacteria, the cDNA from Example 26 is incorporated into an appropriate expression vector, such as a pET Directional TOPO expression vector (Invitrogen). PCR is performed on the cDNA from Example 26 using forward (TR024)(SEQ ID No: 234) and reverse (TR020)(SEQ ID No: 235) primers to incorporate a homologous recombination site for the vector. The resulting PCR fragment is incubated with the pET101/D-TOPO vector (Invitrogen) according to the manufacturer's directions, to create the murine TNFR1 7 bacterial expression vector. The resulting vector is transformed into the E. coli strain BL21(DE3). The murine TNFR1 7 is then expressed from the bacterial cells according to the manufacturer's instructions.

    Example 39

    Expression of Mouse TNFR1 7 in Mammalian Cells

    [0545] For expression of the murine TNFR1 7 protein in mammalian cells, a murine TNFR1 7 cDNA PCR product from Example 26 is incorporated into an appropriate mammalian expression vector. The murine TNFR1 7 cDNA PCR product from Example 26 and the pcDNA3.1D/V5-His TOPO expression vector (Invitrogen) are blunt-end ligated according to the manufacturer's directions. The product is then isolated, amplified, and purified using standard molecular biology techniques to yield the mammalian expression vector. The vector is then transfected into a mammalian cell, where expression of the murine TNFR1 7 protein is driven by the strong constitutive CMVie promoter.

    Example 40

    Expression of Mouse TNFR1 7 in Insect Cells

    [0546] For expression of the murine TNFR1 7 protein in insect cells, the cDNA from Example 26 is incorporated into a baculoviral vector. PCR is performed on the cDNA from Example 26 using forward (TR041)(SEQ ID No: 236) and reverse (TR042) (SEQ ID No: 237) primers. The resulting PCR product is digested with the restriction enzymes EcoRI and XhoI. The digested PCR product is ligated with a EcoRI and XhoI digested pENTR Vector (Invitrogen), such as any one of the pENTR1A, pENTR2B, pENTR3C, pENTR4, or pENTR11 Vectors, to yield an entry vector. The product is then isolated, amplified, and purified using standard molecular biology techniques.

    [0547] A baculoviral vector containing the murine TNFR1 7 cDNA is generated by homologous recombination of the entry vector with BaculoDirect Linear DNA (Invitrogen) using LR Clonase (Invitrogen) according to the manufacturer's directions. The reaction mixture is then used to infect Sf9 cells to generate recombinant baculovirus. After harvesting the recombinant baculovirus, expression of murine TNFR1 7 is confirmed. Amplification of the recombinant baculovirus yields a high-titer viral stock. The high-titer viral stock is used to infect Sf9 cells, thereby expressing murine TNFR1 7 protein.

    Example 41

    Generation of Adeno-Associated Viral Vectors for the Expression of Murine TNFR1 7

    [0548] For in vitro or in vivo delivery to mammalian cells of the murine TNFR1 7 gene for expression in those mammalian cells, a recombinant adeno-associated virus (rAAV) vector is generated using a three plasmid transfection system as described in Grieger, J., et al., 2006, Nature Protocols 1:1412. PCR is performed on the purified murine TNFR1 D7 PCR product of Example 25, using forward (TR043)(SEQ ID No: 238) and reverse (TR044)(SEQ ID No: 239) primers to introduce unique flanking NotI restriction sites. The resulting PCR product is digested with the NotI restriction enzyme, and isolated by standard molecular biology techniques. The NotI-digested fragment is then ligated to NotI-digested pTR-UF2 (University of North Carolina (UNC) Vector Core Facility), to create a plasmid that contains the murine TNFR1 D7 open reading frame, operably linked to the CMVie promoter, flanked by inverted terminal repeats. The resulting plasmid is then transfected with the plasmids pXX680 and pHelper (UNC Vector Core Facility) into HEK-293 cells, as described in Grieger, J., et al., to produce rAAV particles containing the murine TNFR1 7 gene where expression is driven by the strong constitutive CMVie promoter. The virus particles are harvested and purified, as described in Grieger, J., et al., to provide an rAAV stock suitable for transducing mammalian cells.

    Example 42

    Generation of Lentiviral Vectors for the Expression of TNFR 7

    [0549] For in vitro or in vivo delivery to mammalian cells of a TNFR 7 gene for expression in those mammalian cells, a replication-incompetent lentivirus vector is generated. A PCR product from Examples 27, 30, 35 and 38 and the pLenti6/V5-D-TOPO vector (Invitrogen) are blunt-end ligated according to the manufacturer's directions. The resulting plasmid is transformed into E. coli, amplified, and purified using standard molecular biology techniques. This plasmid is transfected into 293FT cells (Invitrogen) according to the manufacturer's directions to produce lentivirus particles containing the TNFR 7 gene where expression is driven by the strong constitutive CMVie promoter. The virus particles are harvested and purified, as described in Tiscornia, G., et al., 2006, Nature Protocols 1:241, to provide a lentiviral stock suitable for transducing mammalian cells.

    Example 43

    Expression of TNFR2 7 in Mammalian Cells

    [0550] The plasmids generated in Examples 26 and 34 were used to express active protein in mammalian HeLa cells, and the resulting proteins were tested for anti-TNF- activity. HeLa cells were seeded in at 1.010.sup.5 cells per well in 24-well plates in SMEM media containing L-glutamine, gentamicin, kanamycin, 5% FBS and 5% HS. Cells were grown overnight at 37 C. in a 5% CO.sub.2 humidified atmosphere. Approximately 250 ng of plasmid DNA was added to 50 mL of OPTI-MEM, and then 50 mL Lipofectamine 2000 mix (1 part Lipofectamine 2000 to 25 parts OPTI-MEM) was added and incubated for 20 minutes. Then 400 mL of serum free media was added and then applied to the cells in the 24-well plates. After incubation for 48 hrs at 37 C. in a 5% CO.sub.2 humidified atmosphere, the media was collected and the cells were harvested in 800 mL TRI-Reagent. Total RNA was isolated from the cells per the manufacturer's directions and analyzed by RT-PCR using the forward primer TR047 (SEQ ID No: 200) and the reverse primer TR048 (SEQ ID No: 201) for human TNFR2 7, or the forward primer TR045 (SEQ ID No: 228) and the reverse primer TR046 (SEQ ID No: 229) for mouse TNFR2 7. The concentration of soluble TNFR2 in the media was measured by ELISA.

    [0551] The anti-TNF- activity of the above media was tested in an L929 cytotoxicity assay. L929 cells were plated in 96-well plates at 210.sup.4 cells per well in MEM media containing 10% regular FBS, penicillin and streptomycin and grown overnight at 37 C. in a 5% CO.sub.2 humidified atmosphere. The media samples were diluted 1, 2, 4, 8 and 16 fold with media from non-transfected HeLa cells. Ninety L of each of these samples was added to 10 L of serum-free media, containing 1.0 ng/ml TNF- and 1 g/ml of actinomycin D. The media from the cells were removed and replaced with these 100 L samples. The cells were then grown overnight at 37 C. in a 5% CO.sub.2 humidified atmosphere. Twenty mL CellTiter 96 AQ.sub.ueous One Solution Reagent (Promega) was then added to each well. Cell viability was measured 4 hrs later by measuring absorbance at 490 nm with a microplate reader. Cell viability was normalized to untreated cells and plotted as a function of TNF antagonist concentration (FIG. 37).

    [0552] The data from this example and from Example 20 were analyzed using the GraphPad Prism software to determine the EC.sub.50 value for each antagonist. For each antagonist from these examples a sigmoidal dose-response curve was fit by non-linear regression with the maximum and minimum responses held fixed to 100% and 0%, respectively. The EC.sub.50 values shown in Table 8 correspond to a 95% confidence level, and each curve had an r.sup.2 value ranging from 0.7 to 0.9.

    TABLE-US-00008 TABLE 8 Activity of TNF- antagonists EC.sub.50 TNF- Antagonist (ng/mL) Etanercept 1.1 0.5 Recombinant soluble TNFR2 (rsTNFR2) 698 180 SSO 3305 treated mice serum (mouse TNFR2 7) 0.6 0.2 SSO 3274 treated mice serum (mouse TNFR2 7) 0.8 0.3 Extracellular media from 1144-4 transfected HeLa cells 2.4 1.4 (mouse TNFR2 7) Extracellular media from 1145-3 transfected HeLa cells 2.4 0.8 (mouse TNFR2 7) Extracellular media from 1230-1 transfected HeLa cells 1.4 1.1 (human TNFR2 7) Extracellular media from 1319-1 transfected HeLa cells 1.7 1.0 (human TNFR2 7) Extracellular media from 1138-5 transfected HeLa cells 1.8 1.1 (human TNFR2 7)

    Example 44

    Expression and Purification of TNFR2 7 in Mammalian Cells

    [0553] The plasmids generated in Example 26 and Example were used to express and purify TNFR2 7 from mammalian HeLa cells. HeLa cells were plated in 6-well plates at 510.sup.5 cells per well, and grown overnight at 37 C., 5% CO.sub.2, in humidified atmosphere. Each well was then transfected with 1.5 mg of plasmid DNA using either 1144-4 (mouse TNFR2 7 with His-tag), 1145-1 (mouse TNFR2 7, no His-tag), 1230-1 (human TNFR2 7, no His-tag) or 1319-1 (human TNFR2 7 with His-tag) plasmids. Media was collected 48 hrs after transfection and concentrated approximately 40-fold using Amicon MWCO 30,000 filters. The cells were lysed in 120 mL of RIPA lysis buffer (Invitrogen) with protease inhibitors (Sigma-aldrich) for 5 minutes on ice. Protein concentration was determined by the Bradford assay. Proteins were isolated from aliquots of the cell lysates and the extracellular media and analyzed by western blot for TNFR2 as described in Example 12 (FIG. 38).

    [0554] Human and mouse TNFR2 D7 with a His-tag (clones 1319-1 and 1144-4, respectively) were purified from the above media by affinity chromatography. HisPur cobalt spin columns (Pierce) were used to purify mouse and human TNFR2 7 containing a His-tag from the above media. Approximately 32 mL of media were applied to a 1 mL HisPur column equilibrated with 50 mM sodium phosphate, 300 mM sodium chloride, 10 mM imidazole buffer (pH 7.4) as recommended by the manufacturer. The column was then washed with two column volumes of the same buffer and protein was eluted with 1 mL of 50 mM sodium phosphate, 300 mM sodium chloride, 150 mM imidazole buffer (pH 7.4). Five mL of each eluate were analyzed by Western blot as described above (FIG. 39). TNFR2 7 appears in the eluate and the multiple bands represent variably glycosylated forms of TNFR2 D7. As negative controls, the TNFR2 D7 proteins expressed from plasmids 1230-1 or 1145-1 which do not contain a His-tag where subjected to the above purification procedure. These proteins do not bind the affinity column and do not appear in the eluate (FIG. 39).