UNIVERSAL CONTROLS FOR SEQUENCING ASSAYS
20170016059 ยท 2017-01-19
Assignee
Inventors
Cpc classification
C12Q2545/113
CHEMISTRY; METALLURGY
C12Q2545/107
CHEMISTRY; METALLURGY
C12Q2600/166
CHEMISTRY; METALLURGY
C12Q1/6806
CHEMISTRY; METALLURGY
C12Q1/707
CHEMISTRY; METALLURGY
C12Q2545/107
CHEMISTRY; METALLURGY
C12Q2545/113
CHEMISTRY; METALLURGY
International classification
Abstract
The present invention relates to a positive and negative control and an extraction control, respectively, for sequencing assays. The present application discloses plasmids, kits, their uses and a method of detecting a specific nucleic acid, wherein the controls according to the present invention are used.
Claims
1. An in vitro method of detecting the presence of a nucleic acid comprising a target sequence (T) in a sample comprising the following steps: a) Providing a sample potentially comprising a nucleic acid comprising T, wherein T is flanked by a sequence hybridizing to a forward primer (FOR) and a sequence hybridizing to a reverse primer (REV); b) Transferring said sample into a vial V1; c) Providing a plasmid comprising a control sequence 1 (S1), wherein S1 is flanked by a sequence hybridizing to FOR and a sequence hybridizing to REV, wherein T and S1 are not identical; d) Transferring said plasmid of step c) into a vial V2; e) Providing a plasmid comprising a control sequence 2 (S2), wherein S2 is flanked by a sequence hybridizing to FOR and a sequence hybridizing to REV, wherein T, S1 and S2 are not identical; f) Transferring said plasmid of step e) into said vials; g) Extracting nucleic acids in said vials; h) Conducting PCR reactions in said vials using the primers FOR and REV; i) Sequencing the nucleic acids amplified in said vials; wherein the presence of T in vial V1 indicates the presence of said nucleic acid comprising T in said sample if the sequencing in vial V2 resulted in the presence of S1 and S2, and if the sequencing in vial V1 resulted in the presence of T and S2.
2. The in vitro method according to claim 1, wherein said sample is a clinical sample.
3. The in vitro method according to claim 2, wherein said clinical sample is a tissue sample or a body fluid sample.
4. The in vitro method according to claim 1, wherein said nucleic acid comprising T is a nucleic acid from a microorganism.
5. The in vitro method according to claim 3, wherein said microorganism is selected from the group consisting of bacteria, archaea, protozoa, fungi and viruses.
6. The in vitro method according to claim 1, wherein said nucleic acid comprising T is an oncogene.
7. A plasmid comprising a control sequence (S), wherein S is flanked by a sequence hybridizing to a forward primer (FOR) and a sequence hybridizing to a reverse primer (REV), wherein said sequences hybridizing to FOR and REV are sequences derived from a nucleic acid comprising said sequence hybridizing to FOR, followed by a target sequence (T), followed by said sequence hybridizing to REV, and wherein S and T are not identical.
8. The plasmid according to claim 7, wherein said nucleic acid comprising said sequence hybridizing to FOR, followed by T, followed by said sequence hybridizing to REV is a nucleic acid from a microorganism.
9. The plasmid according to claim 8, wherein said microorganism is selected from the group consisting of bacteria, archaea, protozoa, fungi and viruses.
10. The plasmid according to claim 7, wherein said nucleic acid comprising said sequence hybridizing to FOR, followed by T, followed by said sequence hybridizing to REV is an oncogene.
11. The plasmid according to claim 7, wherein said plasmid is used in step c) of the method according to claim 1 and serves as positive and negative control.
12. The plasmid according to claim 7, wherein said plasmid is used in step e) of the method according to claim 1 and serves as extraction control.
13. Use of a plasmid according to claim 7 in a sequencing assay designed to detect the presence of T in a sample in a sample reaction (SR), wherein said plasmid is used in a control reaction (CR) and wherein CR and SR are separate reactions.
14. Use of a plasmid according to claim 7 in a sequencing assay designed to detect the presence of T in a sample in a sample reaction (SR), wherein said plasmid is added to said SR prior to the extraction of nucleic acids therefrom.
15. A kit for the detection of a nucleic acid comprising a target sequence (T) in a sample, wherein said kit comprises (a) primers FOR and REV, wherein FOR and REV hybridize to sequences flanking T; (b) a plasmid comprising a sequence hybridizing to FOR, followed by a control sequence 1 (S1), followed by a sequence hybridizing to REV; (c) a plasmid comprising a sequence hybridizing to FOR, followed by a control sequence 2 (S2), followed by a sequence hybridizing to REV; wherein T, S1 and S2 are not identical.
16. The method according to claim 3, wherein said clinical sample is from a human subject.
17. The method according to claim 6, wherein said wherein said oncogene, is a human oncogene.
18. The plasmid according to claim 10, wherein said wherein said oncogene, is a human oncogene.
Description
DESCRIPTION OF THE FIGURES
[0093]
[0094]
[0095]
DETAILED DESCRIPTION OF THE INVENTION
[0096] The inventors of the present invention inter alia succeeded in providing universal sequencing controls, which may be used as positive and negative as well as extraction control in a sequencing assay.
[0097] Before some of the embodiments of the present invention are described in more detail, the following definitions are introduced.
DEFINITIONS
[0098] As used in the specification and the claims, the singular forms of a and an also include the corresponding plurals unless the context clearly dictates otherwise.
[0099] The term about in the context of the present invention denotes an interval of accuracy that a person skilled in the art will understand to still ensure the technical effect of the feature in question. The term typically indicates a deviation from the indicated numerical value of 10% and preferably 5%.
[0100] It needs to be understood that the term comprising is not limiting. For the purposes of the present invention, the term consisting of is considered to be a preferred embodiment of the term comprising. If hereinafter a group is defined to comprise at least a certain number of embodiments, this is also meant to encompass a group which preferably consists of these embodiments only.
[0101] The term detecting the presence as used herein is to be understood in the meaning of detecting the presence or absence. As mentioned in the method as claimed in the present application, the sample to be analyzed potentially comprises a nucleic acid comprising a target sequence. Thus, there may e.g. be indications that a patient is infected with a hepatitis C virus and a corresponding blood sample potentially comprising an HCV nucleic acid is analyzed by a method according to the present invention. Assuming that all controls indicate that the assay has been carried out properly, the result is that the target sequence(s) (and thus the virus) is(are) either present or absentaccordingly, the presence or absence of the target sequence in said sample is detected.
[0102] In the context of the present invention the term nucleic acid refers to a naturally occurring deoxyribonucleotide or ribonucleotide polymer in either single- or double-stranded form. The nucleic acid may particularly be double-stranded DNA and single-stranded RNA.
[0103] The term sequence as used herein refers to the sequential occurrence of the bases in a deoxyribonucleotide or ribonucleotide polymer, wherein a base found in a deoxyribonucleotide polymer is selected from the group consisting of A, T, G and C and a base found in a ribonucleotide polymer is selected from the group consisting of A, U, G and C. A sequence of bases in a deoxyribonucleotide polymer may thus e.g. be GGAAGCAAGCCT (SEQ ID No.:14), whereas a sequence of bases in a ribonucleotide polymer may e.g. be GGAAUCGAUAU (SEQ ID No:15).
[0104] A target sequence as referred to herein is a sequence in the nucleic acid, the presence of which is detected in the method according to the present invention; a target sequence is characteristic for the specific nucleic acid, the presence of which is detected. If e.g. an HCV nucleic acid is detected, the target sequence may e.g. comprise the NS3 and/or the NS5A and/or the NS5B genes of HCV (see also examples 1 and 2).
[0105] As used herein, the term sample refers to any biological sample from any human or veterinary subject that may be tested for the presence of a nucleic acid comprising a target sequence. The samples may include tissues obtained from any organ, such as for example, lung tissue; and fluids obtained from any organ such as for example, blood, plasma, serum, lymphatic fluid, synovial fluid, cerebrospinal fluid, amniotic fluid, amniotic cord blood, tears, saliva, and nasopharyngeal washes. As listed above, samples may also be derived from a specific region in the body, e.g. the respiratory tract; samples from the respiratory tract include throat swabs, throat washings, nasal swabs, and specimens from the lower respiratory tract.
[0106] The sample may in particular be derived from a human or a veterinary subject. Accordingly, a patient may be a human or veterinary subject. If reference is made to a clinical sample, this indicates that the sample is from a patient suspicious of carrying a nucleic acid comprising a target sequence.
[0107] The term flanked as used herein in connection with sequences means that the two sequences described as flanking a specific sequence (e.g. a sequence hybridizing to a forward primer and a sequence hybridizing to a reverse primer) are comprised upstream and downstream of said specific sequence. If reference is made in this context to a sequence hybridizing to a forward primer, this region lies upstream, i.e. at the 5-end of said sequence. Following the target sequence, a sequence hybridizing to a reverse primer is then present, i.e. downstream of said sequence or at the 3-end. This setup can also be derived from
[0108] The term primer refers to an oligonucleotide that is capable of acting as a point of initiation for the 5 to 3 synthesis of a primer extension product that is complementary to a nucleic acid strand. The primer extension product is synthesized in the presence of appropriate nucleotides and an agent for polymerization such as a DNA polymerase in an appropriate buffer and at a suitable temperature. Primers can be designed using, for example, a computer program such as OLIGO (Molecular Biology Insights, Inc., Cascade, Colo.). Important features when designing primers include an appropriate size of the amplification product, preferably in the ranges set out above, to facilitate detection, similar melting temperatures for the members of a pair of primers, and the length of each primer (i.e., the primers need to be long enough to anneal with sequence-specificity and to initiate synthesis but not so long that fidelity is reduced during oligonucleotide synthesis). Typically, primers are 15 to 30 nucleotides in length.
[0109] A forward primer hybridizing to a region upstream of a specific sequence and a reverse primer hybridizing to a region downstream of a specific sequence will hybridize such that said specific sequence will be amplified during a PCR amplification reaction. If double stranded DNA or cDNA is present in the sample, the forward primer will hybridize to the upstream region such that its 3-end points towards the sequence to be amplified; the 3-end of the reverse primer also points to the sequence to be amplified. As in every PCR setup, the primers will thus hybridize to different strands: the forward primer hybridizes to the noncoding strand, whereas the reverse primer hybridizes to the coding strand.
[0110] As used herein, the term amplification refers to enzyme-mediated procedures that are capable of producing billions of copies of nucleic acid target. Examples of enzyme-mediated target amplification procedures known in the art include PCR.
[0111] As used herein the term hybridizing refers to the process of establishing a non-covalent, sequence-specific interaction between two or more complementary strands of single-stranded nucleic acids into a complex, preferably a duplex in the present invention.
[0112] The term vial refers to a reaction vial as typically used in diagnostic assays. The vial may be comprised on a multiplate, e.g. a 96-well plate and may thus also be referred to as well, or it may be comprised on a sample ring, e.g. a 36-vial sample ring. If an object is transferred into a vial, as sterile conditions as possible are preferably used in this step; in some setups, the transfer step may be carried out by pipetting the object into a vial; this may be done in an automated manner. A typical object in the present context is a clinical sample, a plasmid comprised in buffer, or cells comprising a plasmid. If cells comprising a plasmid are transferred into a vial, this may also be done by adding said cells to a specific buffer used during an extraction process, e.g. a lysis buffer.
[0113] The term plasmid is used as herein according to its standard meaning in molecular biology. Any type of prokaryotic or eukaryotic vector may be used for the purposes of the present invention, i.e. for the plasmid used as positive and negative control as well as the extraction control. Examples of such plasmids are TMV plasmids.
[0114] The term identical as used herein in connection with not identical sequences means that the sequences differ in at least one base from each other. As noted above, it is, however, preferred that the sequences show no homology at all, at least as regards the target sequence(s) and the control sequence(s). Different control sequences may show some degree of homology but clearly must be distinguishable from each other. This is achieved in that the control sequences also differ from each other by at least one base. In a preferred embodiment, T thus shows no homology to S1 and S2, wherein S1 and S2 may share some homology but differ in at least one base, preferably more than one base from each other.
[0115] Extracting nucleic acids means that any nucleic acids present in a vial are substantially isolated from any cellular background, particularly isolated from intact cells. Preferably, the nucleic acids are also washed during the process and optionally concentrated. Following an extraction, substantially all intact cells present in a vial have been lysed and substantially all cellular debris not related to nucleic acids has been removed. Typical extraction methods may include the use of hypotonic lysis buffer, heat and/or detergents, and are known to the skilled person. A particularly preferred extraction process according to the present invention comprises the following steps: [0116] proteinase K is added to a commonly used lysis buffer; if the subsequent steps comprise the step of carrying out a reverse transcription (via RT-PCR), carrier RNA may also be added to the lysis buffer; further, as outlined above, the extraction control plasmid may also be added to the lysis buffer (spiked into the lysis buffer); [0117] the lysis buffer described above is added to the samples and the samples are incubated for 10 minutes at 60 C., preferably while the samples are mixed; [0118] magnetic beads commonly used for capturing nucleic acids are preferably used in order to isolate nucleic acids from the samples (according to standard protocols); the next steps may thus comprise: [0119] binding buffer is added to the samples after lysis of the cells; [0120] the magnetic beads for capturing nucleic acids are added; [0121] the magnetic beads are collected via a magnet and the supernatant is removed (preferably after a short incubation); [0122] optionally several different (preferably two) wash buffers are added to the beads and several (preferably two) wash steps are carried out sequentially by washing the beads (mixing, collecting the beads via a magnet and removing the supernatant; adding the next wash buffer); [0123] the beads are then typically dried; [0124] elution buffer is added to the beads and the samples are typically mixed, preferably after a short incubation; [0125] the magnetic beads are collected via a magnet and the supernatant comprising the eluted nucleic acids is collected; [0126] the supernatant comprising the eluted nucleic acids (corresponding to the extracted nucleic acids) is used in the subsequent steps.
[0127] A PCR reaction has first been described for the amplification of DNA by Mullis et al. in U.S. Pat. No. 4,683,195 and Mullis in U.S. Pat. No. 4,683,202 and is well known to those of ordinary skill in the art. In the PCR technique, a sample of DNA is mixed in a solution with a molar excess of at least two oligonucleotide primers of that are prepared to be complementary to the 3 end of each strand of the DNA duplex (see above, a forward and a reverse primer); a molar excess of nucleotide bases (i.e., dNTPs); and a heat stable DNA polymerase, (preferably Taq polymerase), which catalyzes the formation of DNA from the oligonucleotide primers and dNTPs. Of the primers, at least one is a forward primer that will bind in the 5 to 3 direction to the 3 end of one strand (in the above definition the non-sense strand) of the denatured DNA analyte and another is a reverse primer that will bind in the 3 to 5 direction to the 5 end of the other strand (in the above definition the sense strand) of the denatured DNA analyte. The solution is heated to about 94-96 C. to denature the double-stranded DNA to single-stranded DNA. When the solution cools down and reaches the so-called annealing temperature, the primers bind to separated strands and the DNA polymerase catalyzes a new strand of analyte by joining the dNTPs to the primers. When the process is repeated and the extension products synthesized from the primers are separated from their complements, each extension product serves as a template for a complementary extension product synthesized from the other primer. As the sequence being amplified doubles after each cycle, a theoretical amplification of a huge number of copies may be attained after repeating the process for a few hours; accordingly, extremely small quantities of DNA may be amplified using PCR in a relatively short period of time.
[0128] Where the starting material for the PCR reaction is RNA, complementary DNA (eDNA) is synthesized from RNA via reverse transcription. The resultant cDNA is then amplified using the PCR protocol described above. Reverse transcriptases are known to those of ordinary skill in the art as enzymes found in retroviruses that can synthesize complementary single strands of DNA from an mRNA sequence as a template. A PCR used to amplify RNA products is referred to as reverse transcriptase PCR or RT-PCR.
[0129] The terms complementary and substantially complementary as used in the above definitions refer to base pairing between nucleotides or nucleic acids, such as, for instance, between the two strands of a double-stranded DNA molecule or between an oligonucleotide primer and a primer binding site on a single-stranded nucleic acid to be sequenced or amplified. Complementary nucleotides are, generally, A and T (or A and U), and G and C.
[0130] The term sequencing is used herein in its common meaning in molecular biology. Thus, the exact sequential occurrence of bases in a nucleic acid sequence is determined.
[0131] The term microorganism as used herein is used in its broadest meaning. Thus, a microorganism may be any type of bacteria, archaeum, protozoum, fungus and virus. It is explicitly mentioned that viruses fall under the definition of a microorganism as used herein.
[0132] The term oncogene is used herein in its common meaning in molecular biology and oncology, respectively. Thus, there are e.g. mutations known in genes, which render a normal or wild-type gene oncogenic, i.e. cancer-inducing; examples in this respect are mutations rendering kinases constitutionally active such that specific signals (e.g. growth inducing signals) are constantly signaled and corresponding processes initiated. Oncogenes as used herein may also relate to intra- or inter-chromosomal translocations resulting also in cancer-inducing situations.
[0133] The term multiplex refers to the detection of the presence of a specific nucleic acid in several samples, wherein the corresponding assays are carried out simultaneously, i.e. the steps of the present method are generally performed in parallel.
[0134] It is to be understood that while the invention has been described in conjunction with the embodiments described herein, that the foregoing description as well as the examples that follow are intended to illustrate and not limit the scope of the invention. Other aspects, advantages and modifications within the scope of the invention will be apparent to those skilled in the art to which the invention pertains.
[0135] All patents and publications mentioned herein are incorporated by reference in their entireties.
[0136] The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how to make and use the compositions of the invention. The examples are intended as non-limiting examples of the invention. While efforts have been made to ensure accuracy with respect to variables such as amounts, temperature, etc., experimental error and deviations should be taken into account. Unless indicated otherwise, parts are parts by weight, temperature is degrees centigrade, and pressure is at or near atmospheric. All components were obtained commercially unless otherwise indicated.
EXAMPLES
Example 1
A Plasmid to be Used as Positive and Negative Control
[0137] The goal of the present assay (as described in Example 3 in more detail) is the detection of the presence or absence of a nucleic acid of the hepatitis C virus (HCV) in a clinical sample. There are two target sequences to be detected in the HCV nucleic acid; these sequences are comprised in the genes NS3 and NS5B of HCV.
[0138] A plasmid to be used as positive and negative control comprises the following sequences (in 5 to 3 direction, see also
[0145] An exemplary sequence comprising the above elements is the following (SEQ ID No.:7):
TABLE-US-00001 GCACAACGGCCTGCGAGATCTGGCCGTGGCTGTGGAACCAGTCGTCTTCT CCCGAATGGAGACCAAGCTCATCACGTGGGGGGCAGATACCGCCGCGTGC GGTGACATCATCAACGGCTTGCCCGTCTCTGCCCGTAggaagcaagccgc ggaaatgatcagaagacgtgcgaattcctcagggattattgtggccacga aggataacgttaaaaccgttgattctttcatgatgaattttgggaaaagc acacgctgtcagttcaagaggttattcattgatgaagggttgatgttgca tactggttgtgttaattttcttgtggcgatgtcattgtgcgaaattgcat atgtttacggagacacacagcagattccatacatcaatagagtttcagga ttcccgtaccccgcccattttgccaaattggaggttgacgaggtggagac acgcagaactactctccgttgtccagccgatgtcacacattatctgaaca ggagatatgagggctttgtcatgagcacttcttcggttaaaaagtctgtt tcgcaggagatggtcggcggagocgccgtgatcaatccgatctcaaaacc cttgcatggcaagatcctgacttttarccaatcggataaagaagctctga ttcaagagggtattcagatgttcacactgtgcatgaagtgcaaggcgaga catactctgatgtttcactagttaggttaacccctaCAGGACCGGGGTGA GAACAATTACCACTGGCAGCCCCATCACGTACTCCACCTACGGCAAGTTC CTTGCCGACGGCGGGTGCTCAGGAGGTGCTTATGACATAATAATTTGTGA CGAGTGCCACTCCACGGATGCCACATTGCACCATGCTCGTGTGTGGCGAC GACTTAGTCGTTATCTGTGAAAGTGCGGGGGTCCAGGAGGACGCGGCGAG CCTGAGAGCCTTCACGGAGGCTATGACCAGGTACTCCGCCCCCCCCGGGG ACCCCCCACAACCgcatattggatatgtctaagtctgttgctgcgcctaa ggatcaaatcaaaccactaatacctatggtacgaacggcggcagaaatgc cacgccagactggactattggaaaatttagtggcgatgattaaaaggaac tttaacgcacccgagttgtctggcatcattgatattgaaaatactgcata tttggttgtagataagttttttgatagttatttgcttaaagaaaaaagaa aaccaaataaaaatgatctttgttcagtagagagtctctcaatagatggt tagaaaagcaggaacaggtaacaattggccaptcgcagattttgattttg tggatttgccagcagttgatcagtacagacacatgattaaagcacaaccc aagaaaagttggacacttcaatccaaacggagtacccggctttgcagacg attgtgtaccattcaaaaaagatcaatgcaatattcggcccgttgtttag cgagcttactaggcaattactggacagtgttgattcgagcagatttttgt ttttcacaagaaagacaccagcgcagattgaggatttcttcggagatctc gacagtcatgGGCTGGACTTGTCCGGTTGGTTCACGGCTGGCTACAGCGG GGGAGACATTTATCACAGCGTGTCTCATGCCCGGCCCCGCTGGTTCTGGT TTTGCCTACTCCTGCTCGCTGCAGGGGTAGGCATCTACCTCCTCCCCAAC CGATGA
[0146] The assay is carried out as described in example 3. Successful detection of the sequences S1 and S2 in the control vial (comprising the plasmid comprising the sequences shown above) will indicate that the PCR reactions using primer pairs NS3-for and NS3-rev and NS5B-for and NS5B-rev, respectively, worked properly (positive control). If S1 and S2 were detected, it can be excluded that the samples were contaminated (e.g. with a sample comprising the virus or the virus itself) since otherwise the sequences of the HCV genes NS3 and NS5B would also have been detected in this control (negative control). No additional negative control is required. As discussed in example 2, an extraction control plasmid is usually also added to the vial.
Example 2
A Plasmid to be Used as Extraction Control
[0147] The general setup is identical to the setup outlined above. Thus, the goal of the assay is the detection of the presence or absence of a nucleic acid from the hepatitis C virus (HCV) in a clinical sample, wherein HCV-sequences comprised in the genes NS3 and NS5B of HCV are detected.
[0148] A plasmid to be used as extraction control comprises the following sequences (in 5 to 3-direction, see also
[0152] An exemplary sequence is the following (SEQ ID No.:9):
TABLE-US-00002 GCACAACGGCCTGCGAGATCTGGCCGTGGCTGTGGAACCAGTCGTCTTCT CCCGAATGGAGACCAAGCTCATCACGTGGGGGGCAGATACCGCCGCGTGC GGTGACATCATCAACGGCTTGCCCGTCTCTGCCCGTAgcatctggtatca aagaaagagcggggacgtcacgacgttcattggaaacactgtgacattgc tgcatgtttggcctcgatgcttccgatggagaaaataatcaaaggagcct tttgtggtgacgatagtctgctgtactttccaaagggttgtgagtttccg gatgtgcaacactccgcgaatcttatgtggaattttgaagcaaaactgtt taaaaaacagtatggatacttttgcggaagatatgtaatacatcacgaca gaggatgcattgtgattacgatcccctaaagagatctcgaaacttggtgc taaacacatcaaggattgggaacacttggaggagttcagaaggtctcttt gtgatgttgctgtttcgttgaacaattgtgcgtattacacacagttggac gacgctgtatgggaggttcataaaaccgcccctccaggttcgatgtttat aaaagtctggtgaagtatttgtctgataaagttCAGGACCGGGGTGAGAA CAATTACCACTGGCAGCCCCATCACGTACTCCACCTACGGCAAGTTCCTT GCCGACGGCGGGTGCTCAGGAGGTGCTTATGACATAATAATTTGTGACGA GTGCCACTCCACGGATGCCACAT
[0153] The assay is carried out as described in Example 3, wherein a standardized amount of the extraction control plasmid is spiked into the lysis buffer used in the extraction step of all samples including the control of example 2.
[0154] Successful detection of the HCV target sequences and the sequence S3 in a vial comprising a sample (and the above plasmid) will at least indicate that the extraction step worked properly (extraction control). If only the HCV target sequences are detected, the extraction step was not carried out properlyto the contrary, such a result is indicative of a contamination of the samples with viral DNA. No additional primer pair is required for the amplification reaction of the sequence comprised in the cells of the extraction control.
Example 3
Assay Using the Plasmids of Example 1 and 2
[0155] The assay described in the following is carried out in order to determine the presence or absence of a nucleic acid of the hepatitis C virus (HCV) in a clinical sample such as blood from a human subject.
[0156] The assay is carried out using the Sentosa SX101 device by Vela Diagnostics, the Rotor-Gene Q device by Qiagen and an Ion Torrent Semiconductor Sequencing device by life technologies.
[0157] The clinical sample to be analyzed is provided in a suitable vial or well; further samples may be provided as well (of course in different vials), wherein all samples can be analyzed in parallel. The plasmid of Example 1 is placed into another vial in an appropriate concentration and volume. The samples in all vials/wells (including the vial comprising the plasmid of Example 1) are in a first step subject to the automated extraction procedure of the Sentosa SX101 device. This procedure uses the plasmid of Example 2 in the lysis buffer; thus, the nucleic acids in all vials are then extracted.
[0158] In the next step, the samples are automatically transferred to a sample ring. Such a sample ring may comprise up to 72 vials, wherein the positive control (i.e. the plasmid of Example 1) may be transferred into vial 1 and the samples may be transferred into vials 2 to 72.
[0159] The Sentosa SX101 device is also capable of automatically loading the samples with the components used in the next stepin the present example, the next step is an RT-PCR since HCV is an RNA virus. Therefore, an initial RT-PCR needs to be carried out in the regions of the NS3- and NS5B-genes to be detected. The corresponding components are added to the extracted nucleic acids in all vials, i.e. vials 1 to 72. The components comprise the enzymes reverse transcriptase and Taq polymerase as well as the following primers:
TABLE-US-00003 NS3_fw: (SEQIDNo.:10) TGGGGGGCAGATACCGC NS3_rev: (SEQIDNo.:11) AGGAACTTGCCGTAGGTGGAGTA NS5B_fw: (SEQIDNo.:12) CCTTCACGGAGGCTATGACCAGGTA NS5B_rev: (SEQIDNo.:13) TGAGACACGCTGTGATAAATGTC
[0160] The sample ring comprising the extracted nucleic acids together with all components required for an RT-PCR is then transferred to a Rotor-Gene Q device, where the RT-PCR reactions are carried out according to a standard protocol.
[0161] The samples are then transferred from the individual vials to a microwell used in an Ion Torrent Semiconductor Sequencing device. The sequencing (including an optionally necessary step of fragmenting the amplified nucleic acids) is carried out according to a standard protocol.
[0162] The plasmid according to example 1 was comprised in vial 1; as noted above, an extraction step was also carried out for this vialthus, lysis buffer comprising the plasmid of example 2 was added to this vial. A successful detection of sequences S1 and S2 indicates that the PCR reactions were carried out properly. The plasmid according to Example 1 thus serves as positive control for the PCR-reaction. Since the plasmid of example 2 was also added, sequence S2 should also be detectedif no further sequences apart from S1, S2 and S3 are detected in vial 1, a contamination of the samples can be excluded. The reaction thus also serves as negative control. As noted above, the plasmid according to example 2 was added to the lysis buffer used for the extraction of the nucleic acids in all samples. Successful extraction of the nucleic acids is indicated by the presence of sequence S3 in all vials.
[0163] If the sequences to be detected in HCV, i.e. the regions in genes NS3 and NS5B, are also (in addition to sequence S3) present in vial 2 (and, if applicable, in all further sample vials), nucleic acids derived from HCV were indeed present. This is indicative of the presence of HCV in the clinical sample(s).
[0164] If only sequence S3 was detected in vial 2, no nucleic acids from HCV were present in the sample; accordingly, an HCV infection can be excluded.