VITAMIN PROTOTROPHY AS A SELECTABLE MARKER
20170016007 ยท 2017-01-19
Inventors
Cpc classification
C12N15/74
CHEMISTRY; METALLURGY
C12Y401/99017
CHEMISTRY; METALLURGY
C12Y202/01011
CHEMISTRY; METALLURGY
C12N9/1014
CHEMISTRY; METALLURGY
C12Y201/02011
CHEMISTRY; METALLURGY
International classification
C12N15/74
CHEMISTRY; METALLURGY
Abstract
One or more genes in a biosynthesis pathway for a vitamin or other essential nutrient which is needed for the survival of a microorganism can be used as an effective selective marker to identify cells transformed with an exogenous nucleic acid. The microorganism does not naturally contain or express the one or more gene. This permits genetic manipulations to be performed. It permits lower cost fermentations to be performed. It permits production of the essential nutrient for subsequent commodity use.
Claims
1. A method of using vitamin prototrophy as a selectable marker comprising: (a) transforming a microorganism auxotrophic for a vitamin with both a vitamin biosynthesis gene and a gene conferring a desired property, wherein the microorganism is not transformed with an antibiotic resistance gene and (b) culturing the microorganism in the absence of the vitamin, wherein growth of the microorganism in the absence of the vitamin indicates successful transformation of the microorganism with both the vitamin biosynthesis gene and the gene conferring a desired property.
2. The method of claim 1, wherein the culturing is performed in the absence of an antibiotic.
3. The method of claim 1, wherein antibiotic resistance is not used as a selectable marker.
4. The method of claim 1, wherein transformation with the vitamin biosynthesis gene renders the microorganism prototrophic for the vitamin.
5. The method of claim 1, wherein the desired property is not selectable.
6. The method of claim 1, wherein the vitamin is thiamine.
7. The method of claim 1, wherein the vitamin biosynthesis gene encodes thiamine biosynthesis protein (ThiC) (EC 4.1.99.17).
8. The method of claim 1, wherein the vitamin biosynthesis gene is thiC derived from Clostridium ragsdalei.
9. The method of claim 1, wherein the vitamin is pantothenate.
10. The method of claim 1, wherein the vitamin biosynthesis gene encodes methyl-2-oxobutanoate hydroxymethyltransferase (PanB) (EC 2.1.2.11), pantoate-beta-alanine ligase (PanC) (EC 6.3.2.1), and aspartate 1-decarboxylase (PanD) (EC 4.1.1.11).
11. The method of claim 1, wherein the vitamin biosynthesis gene is panBCD derived from Clostridium beijerinckii.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0082] These and other aspects of the present invention, which should be considered in all its novel aspects, will become apparent from the following description, which is given by way of example only, with reference to the accompanying figures, in which:
[0083]
[0084]
[0085]
[0086]
[0087]
[0088] A sequence listing is part of this application.
DETAILED DESCRIPTION OF THE INVENTION
[0089] The following is a description of the present invention, including preferred embodiments thereof, given in general terms. The invention is further elucidated from the disclosure given under the heading Examples herein below, which provides experimental data supporting the invention, specific examples of various aspects of the invention, and means of performing the invention.
[0090] The inventors have surprisingly identified that one or more gene(s) in a biosynthesis pathway for a vitamin which is needed for the survival of a microorganism can be used as an effective selective marker to screen for cells transformed with exogenous nucleic acid(s) where the microorganism does not naturally contain or express the one or more gene(s).
[0091] This has a number of advantages, including obviating the need for the use of standard selective markers and agents, such as antibiotics, which are expensive, have limitations, and can be toxic to some desirable cells. It also has the benefit of further reducing the cost of the growth and fermentation of recombinant microorganisms as vitamins that would typically need to be added to growth and fermentation media can be omitted. Further, vitamins are themselves a valuable product, so in addition to acting as a selection marker, the vitamins produced may be recovered and sold or used for other purposes.
[0092] As referred to herein, a fermentation broth is a culture medium comprising at least a nutrient media and bacterial cells.
[0093] As referred to herein, a shuttle microorganism is a microorganism in which a methyltransferase enzyme is expressed and is distinct from the destination microorganism.
[0094] As referred to herein, a destination microorganism is a microorganism in which the genes included on an expression construct/vector are expressed and is distinct from the shuttle microorganism.
[0095] The term main fermentation product is intended to mean the one fermentation product which is produced in the highest concentration and/or yield.
[0096] The terms increasing the efficiency, increased efficiency and the like, when used in relation to a fermentation process, include, but are not limited to, increasing one or more of the rate of growth of microorganisms catalysing the fermentation, the growth and/or product production rate at elevated product concentrations, the volume of desired product produced per volume of substrate consumed, the rate of production or level of production of the desired product, and the relative proportion of the desired product produced compared with other by-products of the fermentation.
[0097] The phrase substrate comprising carbon monoxide and like terms should be understood to include any substrate in which carbon monoxide is available to one or more strains of bacteria for growth and/or fermentation, for example.
[0098] The phrase gaseous substrate comprising carbon monoxide and like phrases and terms includes any gas which contains a level of carbon monoxide. In certain embodiments the substrate contains at least about 20% to about 100% CO by volume, from 20% to 70% CO by volume, from 30% to 60% CO by volume, and from 40% to 55% CO by volume. In particular embodiments, the substrate comprises about 25%, or about 30%, or about 35%, or about 40%, or about 45%, or about 50% CO, or about 55% CO, or about 60% CO by volume.
[0099] While it is not necessary for the substrate to contain any hydrogen, the presence of H.sub.2 should not be detrimental to product formation in accordance with methods of the invention. In particular embodiments, the presence of hydrogen results in an improved overall efficiency of alcohol production. For example, in particular embodiments, the substrate may comprise an approx 2:1, or 1:1, or 1:2 ratio of H.sub.2:CO. In one embodiment the substrate comprises about 30% or less H.sub.2 by volume, 20% or less H.sub.2 by volume, about 15% or less H.sub.2 by volume or about 10% or less H.sub.2 by volume. In other embodiments, the substrate stream comprises low concentrations of H.sub.2, for example, less than 5%, or less than 4%, or less than 3%, or less than 2%, or less than 1%, or is substantially hydrogen free. The substrate may also contain some CO.sub.2 for example, such as about 1% to about 80% CO.sub.2 by volume, or 1% to about 30% CO.sub.2 by volume. In one embodiment the substrate comprises less than or equal to about 20% CO.sub.2 by volume. In particular embodiments the substrate comprises less than or equal to about 15% CO.sub.2 by volume, less than or equal to about 10% CO.sub.2 by volume, less than or equal to about 5% CO.sub.2 by volume or substantially no CO.sub.2.
[0100] In the description which follows, embodiments of the invention are described in terms of delivering and fermenting a gaseous substrate containing CO. However, it should be appreciated that the gaseous substrate may be provided in alternative forms. For example, the gaseous substrate containing CO may be provided dissolved in a liquid. Essentially, a liquid is saturated with a carbon monoxide containing gas and then that liquid is added to the bioreactor. This may be achieved using standard methodology. By way of example, a microbubble dispersion generator (Hensirisak et. al. Scale-up of microbubble dispersion generator for aerobic fermentation; Applied Biochemistry and Biotechnology Volume 101, Number 3/October, 2002) could be used. By way of further example, the gaseous substrate containing CO may be adsorbed onto a solid support. Such alternative methods are encompassed by use of the term substrate containing CO and the like.
[0101] In particular embodiments of the invention, the CO-containing gaseous substrate is an industrial off or waste gas. Industrial waste or off gases should be taken broadly to include any gases comprising CO produced by an industrial process and include gases produced as a result of ferrous metal products manufacturing, non-ferrous products manufacturing, petroleum refining processes, gasification of coal, gasification of biomass, electric power production, carbon black production, and coke manufacturing. Further examples may be provided elsewhere herein.
[0102] Unless the context requires otherwise, the phrases fermenting, fermentation process or fermentation reaction and the like, as used herein, are intended to encompass both the growth phase and product biosynthesis phase of the process. As will be described further herein, in some embodiments the bioreactor may comprise a first growth reactor and a second fermentation reactor. As such, the addition of metals or compositions to a fermentation reaction should be understood to include addition to either or both of these reactors.
[0103] The term bioreactor includes a fermentation device consisting of one or more vessels and/or towers or piping arrangement, which includes the Continuous Stirred Tank Reactor (CSTR), Immobilized Cell Reactor (ICR), Trickle Bed Reactor (TBR), Bubble Column, Gas Lift Fermenter, Static Mixer, or other vessel or other device suitable for gas-liquid contact. In some embodiments the bioreactor may comprise a first growth reactor and a second fermentation reactor. As such, when referring to the addition of substrate to the bioreactor or fermentation reaction it should be understood to include addition to either or both of these reactors where appropriate.
[0104] Exogenous nucleic acids are nucleic acids which originate outside of the microorganism to which they are introduced. Exogenous nucleic acids may be derived from any appropriate source, including, but not limited to, strains or species of microorganisms which differ from the organism to which they are to be introduced, or they may be artificially or recombinantly created. The exogenous nucleic acids represent nucleic acid sequences not naturally present within the microorganism to which they are to be introduced and allow for the expression of a product not naturally present within the microorganism. The exogenous nucleic acid may be adapted to integrate into the genome of the microorganism to which it is to be introduced or to remain in an extra-chromosomal state. Typically the exogenous nucleic acid is heterologous, coming from a different species, a different genus, or a different phylum or kingdom than the recipient.
[0105] It should be appreciated that the invention may be practised using nucleic acids whose sequence varies from the sequences specifically exemplified herein provided they perform substantially the same function. For nucleic acid sequences that encode a protein or peptide this means that the encoded protein or peptide has substantially the same function. For nucleic acid sequences that represent promoter sequences, the variant sequence will have the ability to promote expression of one or more genes. Such nucleic acids may be referred to herein as functionally equivalent variants. By way of example, functionally equivalent variants of a nucleic acid include allelic variants, fragments of a gene, genes which include mutations (deletion, insertion, nucleotide substitutions and the like) and/or polymorphisms and the like. Homologous genes from other microorganisms may also be considered as examples of functionally equivalent variants of the sequences specifically exemplified herein. These include homologous genes in species such as E. coli, Bacillus subtilis, Clostridium beijerinckii, details of which are publicly available on websites such as Genbank or NCBI. The phrase functionally equivalent variants should also be taken to include nucleic acids whose sequence varies as a result of codon optimisation for a particular organism. Functionally equivalent variants of a nucleic acid herein will preferably have at least approximately 70%, preferably approximately 80%, more preferably approximately 85%, preferably approximately 90%, preferably approximately 95% or greater nucleic acid sequence identity with the nucleic acid identified.
[0106] It should also be appreciated that the invention may be practised using polypeptides whose sequence varies from the amino acid sequences specifically exemplified herein. These variants may be referred to herein as functionally equivalent variants. A functionally equivalent variant of a protein or a peptide includes those proteins or peptides that share at least 40%, preferably 50%, preferably 60%, preferably 70%, preferably 75%, preferably 80%, preferably 85%, preferably 90%, preferably 95% or greater amino acid identity with the protein or peptide identified and has substantially the same function as the peptide or protein of interest. Such variants include within their scope fragments of a protein or peptide wherein the fragment comprises a truncated form of the polypeptide wherein deletions may be from 1 to 5, to 10, to 15, to 20, to 25 amino acids, and may extend from residue 1 through 25 at either terminus of the polypeptide, and wherein deletions may be of any length within the region; or may be at an internal location. Functionally equivalent variants of the specific polypeptides herein should also be taken to include polypeptides expressed by homologous genes in other species of bacteria, for example as exemplified in the previous paragraph.
[0107] Substantially the same function as used herein is intended to mean that the nucleic acid or polypeptide is able to perform the function of the nucleic acid or polypeptide of which it is a variant. For example, a variant of an enzyme of the invention will be able to catalyse the same reaction as that enzyme. However, it should not be taken to mean that the variant has the same level of activity as the polypeptide or nucleic acid of which it is a variant.
[0108] One may assess whether a functionally equivalent variant has substantially the same function as the nucleic acid or polypeptide of which it is a variant using any number of known methods. However, by way of example, the methods outlined in Zhang et al (1997, J. Bacteriol., 179:3030-5), Lawhorn et al. (2004, Organic & Biomolecular Chemistry, 2: 2538-46) may be used to assess functionality in respect of ThiC, Powers & Snell (1976, Biol. Chem. 251, 3786-3793) may be used to assess functionality in respect of PanB, Cronan et al. (1982, J. Bacteriol. 149: 916-922) may be used to assess functionality in respect of PanC, or Williamson (1985, Methods Enzymol. 113: 589-595) may be used to assess functionality in respect of PanD, or a genetic screen as outlined by Lawhorn et al. (2004, J. Soc. Biol. Chem., 279: 43555-9) in respect of thiamine genes may be used.
[0109] A parental microorganism is a microorganism used to generate a recombinant microorganism of the invention. The parental microorganism may be one that occurs in nature (ie a wild type microorganism) or one that has been previously modified but which does not express one or more of the enzymes in the one or more vitamin biosynthesis pathway which is needed for the growth of the microorganism. Accordingly, the recombinant microorganisms of the invention have been modified to express the one or more enzymes that were not expressed in the parental microorganism.
[0110] The terms nucleic acid constructs or vectors and like terms should be taken broadly to include any nucleic acid (including DNA and RNA) suitable for use as a vehicle to transfer genetic material into a cell. The terms should be taken to include plasmids, viruses (including bacteriophage), cosmids and artificial chromosomes. Constructs or vectors may include one or more regulatory elements, an origin of replication, a multicloning site and/or a selectable marker. In one particular embodiment, the constructs or vectors are adapted to allow expression of one or more genes encoded by the construct or vector. Nucleic acid constructs or vectors include naked nucleic acids as well as nucleic acids formulated with one or more agents to facilitate delivery to a cell (for example, liposome-conjugated nucleic acid, an organism in which the nucleic acid is contained).
[0111] The invention is applicable to the production of one or more products by microbial fermentation. Reference to one or more products should be taken broadly to include any product which may be produced by microbial fermentation. However, by way of example, it includes, ethanol, acetate, butanol, isopropanol, one or more vitamins, acetone, 2,3-butane diol.
[0112] Contaminating microorganisms or undesirable microorganisms should be taken broadly to mean any microorganism that is not desired, for what ever reason.
[0113] When used in the context of the methods of the invention preventing growth and like terms should be taken broadly to include any level of prevention or reduction in the level of growth of one or more microorganism. It should not be construed to mean that growth of a microorganism is completed prevented, inhibited or stopped. However, in a preferred embodiment the growth of the microorganism is substantially prevented.
[0114] Needed for growth is to be taken to mean that the vitamin is required for a desired level of growth, such that the absence of the vitamin in a media in or on which a microorganism will grow is sufficient to select for a recombinant microorganism (able to make the vitamin) or select against an undesirable or contaminating microorganism. In one embodiment, a vitamin is essential for growth of the microorganism. In this case, without the vitamin, a microorganism will not substantially grow, or may die.
[0115] Anaerobe or anaerobic microorganism or like terms should be taken broadly and to include both obligate and facultative anaerobes.
Recombinant Microorganisms
[0116] As discussed herein before, the invention provides a recombinant microorganism. The recombinant microorganism comprises at least one exogenous nucleic acid which encodes one or more gene(s) in one or more vitamin biosynthesis pathway which produces a vitamin(s) which is needed for growth of the microorganism. The recombinant microorganism is accordingly able to produce the one or more vitamin(s). The recombinant microorganism is an anaerobe.
[0117] The recombinant microorganism is produced from a parental microorganism.
[0118] The parental microorganism may be chosen from any microorganism that is lacking the one or more genes in the one or more vitamin biosynthesis pathway.
[0119] In one embodiment, the vitamin is chosen from thiamine, pathothenate, riboflavin, nicotinic acid, pyridoxine, biotin, folic acid, and cyanocobalamine. In one particular embodiment, the vitamin is thiamine (B1) or panthothenate (B5).
[0120] The one or more enzymes may be any one which is involved in a vitamin biosynthesis pathway. However, by way of example, the one or more enzymes may be chosen from those listed in Tables 1 to 8 below.
TABLE-US-00001 TABLE 1 Thiamine (B1) biosynthesis: cysteine desulfurase [EC: 2.8.1.7] glycine oxidase [EC: 1.4.3.19] hydroxyethylthiazole kinase [EC: 2.7.1.50] hydroxymethylpyrimidine [EC: 2.7.4.7] nucleoside-triphosphatase [EC: 3.6.1.15] phosphomethylpyrimidine kinase [EC: 2.7.1.49] selenocysteine lyase [EC: 4.4.1.16] sulfur carrier protein ThiS adenylyltransferase [EC: 2.7.7.73] thiaminase [EC: 3.5.99.2] thiamine biosynthesis protein ThiC [EC 4.1.99.17] thiamine biosynthesis protein ThiG thiamine biosynthesis protein ThiH thiamine biosynthesis protein ThiI thiamine kinase [EC: 2.7.1.89] thiamine pyridinylase [EC: 2.5.1.2] thiamine pyrophosphokinase [EC: 2.7.6.2] thiamine-monophosphate kinase [EC: 2.7.4.16] thiamine-phosphate pyrophosphorylase [EC: 2.5.1.3] thiamine-triphosphatase [EC: 3.6.1.28]
TABLE-US-00002 TABLE 2 Riboflavin (B2) biosynthesis: GTP cyclohydrolase II [EC: 3.5.4.25] 2,5-diamino-6-(ribosylamino)-4(3H)-pyrimidinone 5-phosphate reductase [EC: 1.1.1.302] 2-amino-5-formylamino-6-ribosylaminopyrimidin-4(3H)-one 5-monophosphate deformylase [EC: 3.5.1.102] 3,4-dihydroxy 2-butanone 4-phosphate synthase [EC: 4.1.99.12] 4-phytase/acid phosphatase [EC: 3.1.3.2/3.1.3.26] 5,6-dimethylbenzimidazole synthase [EC: 1.14.99.40] 5-amino-6-(5-phosphoribosylamino)uracil reductase [EC: 1.1.1.193] 6,7-dimethyl-8-ribityllumazine synthase [EC: 2.5.1.78] acid phosphatase (class A) [EC: 3.1.3.2] acid phosphatase (class B) [EC: 3.1.3.2] acid phosphatase [EC: 3.1.3.2] aquacobalamin reductase/NAD(P)H-flavin reductase [EC: 1.5.1.41/1.16.1.3] biliverdin reductase/flavin reductase [EC: 1.5.1.30/1.3.1.24] diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5- phosphoribosylamino)uracil reductase [EC: 1.1.1.193/3.5.4.26] diaminohydroxyphosphoribosylaminopyrimidine deaminase [EC: 3.5.4.26] ectonucleotide pyrophosphatase/phosphodiesterase family member 1/3 [EC: 3.6.1.9/3.1.4.1] FAD synthetase [EC: 2.7.7.2] FMN reductase [EC: 1.5.1.38] GTP cyclohydrolase II [EC: 3.5.4.25] GTP cyclohydrolase IIa [EC: 3.5.4.29] low molecular weight phosphotyrosine protein phosphatase [EC: 3.1.3.48/3.1.3.2] lysophosphatidic acid phosphatase type 6 [EC: 3.1.3.2] FMN adenylyltransferase [EC: 2.7.7.2] riboflavin kinase [EC: 2.7.1.26/EC: 2.7.1.161] riboflavin synthase [EC: 2.5.1.9] tartrate-resistant acid phosphatase type 5 [EC: 3.1.3.2] tRNA pseudouridine synthase 8/2,5-diamino-6-(5-phospho-D- ribitylamino)-pyrimidin-4(3H)-one deaminase [EC: 5.4.99.] tyrosinase [EC: 1.14.18.1]
TABLE-US-00003 TABLE 3 Nicotinic acid (B3) biosynthesis: 5-nucleotidase [EC: 3.1.3.5] 6-hydroxy-3-succinoylpyridine hydroxylase [EC: 3.7.1.] 6-hydroxynicotinate 3-monooxygenase [EC: 1.14.13.114] aldehyde oxidase [EC: 1.2.3.1] aspartate dehydrogenase [EC: 1.4.1.21] bifunctional NMN adenylyltransferase/nudix hydrolase [EC: 3.6.1. 2.7.7.1] ectonucleotide pyrophosphatase/phosphodiesterase family member 1/3 [EC: 3.6.1.9 3.1.4.1] enamidase [EC: 3.5.2.18] L-aspartate oxidase [EC: 1.4.3.16] maleamate amidohydrolase [EC: 3.5.1.107] maleate isomerase [EC: 5.2.1.1] NAD(P) transhydrogenase [EC: 1.6.1.1] NAD(P) transhydrogenase subunit alpha [EC: 1.6.1.2] NAD(P) transhydrogenase subunit beta [EC: 1.6.1.2] NAD+ diphosphatase [EC: 3.6.1.22] NAD+ kinase [EC: 2.7.1.23] NAD+ nucleosidase [EC: 3.2.2.5] NAD+ synthase (glutamine-hydrolysing) [EC: 6.3.5.1] NAD+ synthase [EC: 6.3.1.5] N-formylmaleamate deformylase [EC: 3.5.1.106] nicotinamidase [EC: 3.5.1.19] nicotinamide mononucleotide adenylyltransferase [EC: 2.7.7.18 2.7.7.1] nicotinamide N-methyltransferase [EC: 2.1.1.1] nicotinamide phosphoribosyltransferase [EC: 2.4.2.12] nicotinamide riboside kinase [EC: 2.7.1.22] nicotinamide-nucleotide adenylyltransferase [EC: 2.7.7.1] nicotinate phosphoribosyltransferase [EC: 2.4.2.11] nicotinate-nucleotide adenylyltransferase [EC: 2.7.7.18] nicotinate-nucleotide pyrophosphorylase (carboxylating) [EC: 2.4.2.19] purine nucleosidase [EC: 3.2.2.1] purine-nucleoside phosphorylase [EC: 2.4.2.1] pyrazinamidase [EC: 3.5.1.] quinolinate synthase [EC: 2.5.1.72] UDP-sugar diphosphatase [EC: 3.6.1.45]
TABLE-US-00004 TABLE 4 Panthothenate (B5) biosynthesis: 2-dehydropantoate 2-reductase [EC: 1.1.1.169] 3-methyl-2-oxobutanoate hydroxymethyltransferase PanB [EC: 2.1.2.11] 4-phosphopantetheinyl transferase [EC: 2.7.8.] 4-phosphopantoate---beta-alanine ligase [EC: 6.3.2.36] acetolactate synthase I/II/III large subunit [EC: 2.2.1.6] acetolactate synthase I/III small subunit [EC: 2.2.1.6] acetolactate synthase II small subunit [EC: 2.2.1.6] acyl carrier protein phosphodiesterase [EC: 3.1.4.14] aspartate 1-decarboxylase PanD [EC: 4.1.1.11] beta-ureidopropionase [EC: 3.5.1.6] biotin-[acetyl-CoA-carboxylase] ligase [EC: 6.3.4.15] branched-chain amino acid aminotransferase [EC: 2.6.1.42] dephospho-CoA kinase [EC: 2.7.1.24] dihydropyrimidinase [EC: 3.5.2.2] dihydropyrimidine dehydrogenase (NADP+) [EC: 1.3.1.2] dihydroxy-acid dehydratase [EC: 4.2.1.9] ectonucleotide pyrophosphatase/phosphodiesterase family member 1/3 [EC: 3.6.1.9 3.1.4.1] holo-[acyl-carrier protein] synthase [EC: 2.7.8.7] ketol-acid reductoisomerase [EC: 1.1.1.86] pantetheine hydrolase [EC: 3.5.1.92] pantetheine-phosphate adenylyltransferase [EC: 2.7.7.3] pantoate kinase [EC: 2.7.1.169] pantoate ligase/cytidylate kinase [EC: 2.7.4.14/6.3.2.1] pantoate--beta-alanine ligase PanC [EC: 6.3.2.1] phosphopantetheine adenylyltransferase/dephospho-CoA kinase [EC: 2.7.1.24 2.7.7.3] phosphopantothenate-cysteine ligase [EC: 6.3.2.5] phosphopantothenate-cysteine ligase [EC: 6.3.2.5] phosphopantothenoylcysteine decarboxylase [EC: 4.1.1.36] type I pantothenate kinase [EC: 2.7.1.33] type II pantothenate kinase [EC: 2.7.1.33] type III pantothenate kinase [EC: 2.7.1.33]
TABLE-US-00005 TABLE 5 Pyridoxin (B6) biosynthesis: 4-hydroxythreonine-4-phosphate dehydrogenase [EC: 1.1.1.262] aldehyde oxidase [EC: 1.2.3.1] D-erythrose 4-phosphate dehydrogenase [EC: 1.2.1.72] erythronate-4-phosphate dehydrogenase [EC: 1.1.1.290] glutamine amidotransferase [EC: 2.6..] phosphoserine aminotransferase [EC: 2.6.1.52] pyridoxal phosphatase [EC: 3.1.3.74] pyridoxal phosphate phosphatase [EC: 3.1.3.74] pyridoxamine 5-phosphate oxidase [EC: 1.4.3.5] pyridoxine 4-dehydrogenase [EC: 1.1.1.65] pyridoxine 5-phosphate synthase [EC: 2.6.99.2] pyridoxine biosynthesis protein [EC: 4...] pyridoxine kinase [EC: 2.7.1.35] threonine synthase [EC: 4.2.3.1]
TABLE-US-00006 TABLE 6 Biotin (B7) biosynthesis: 6-carboxyhexanoate--CoA ligase [EC: 6.2.1.14] 8-amino-7-oxononanoate synthase [EC: 2.3.1.47] adenosylmethionine-8-amino-7-oxononanoate aminotransferase [EC: 2.6.1.62] biotin synthetase [EC: 2.8.1.6] biotin-[acetyl-CoA-carboxylase] ligase [EC: 6.3.4.15] biotinidase [EC: 3.5.1.12] biotin-protein ligase [EC: 6.3.4.15 6.3.4.11 6.3.4.10 6.3.4.9] dethiobiotin synthetase [EC: 6.3.3.3] type III pantothenate kinase [EC: 2.7.1.33]
TABLE-US-00007 TABLE 7 Folate (B9)/p-Aminobenzoate (B10) biosynthesis: 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase [EC: 2.7.6.3] 4-amino-4-deoxychorismate lyase [EC: 2.6.1.85/EC: 4.1.3.38] 6-pyruvoyl tetrahydrobiopterin synthase [EC: 4.2.3.12] 6-pyruvoyltetrahydropterin 2-reductase [EC: 1.1.1.220] alkaline phosphatase [EC: 3.1.3.1] dihydrofolate reductase [EC: 1.5.1.3] dihydrofolate synthase/folylpolyglutamate synthase [EC: 6.3.2.17/6.3.2.12] dihydromonapterin reductase [EC: 1.5.1.] dihydroneopterin aldolase/2-amino-4-hydroxy-6-hydroxymethyl- dihydropteridine diphosphokinase [EC: 2.7.6.3/4.1.2.25] dihydroneopterin aldolase [EC: 4.1.2.25] dihydropteridine reductase [EC: 1.5.1.34] dihydropteroate synthase [EC: 2.5.1.15] folylpolyglutamate synthase [EC: 6.3.2.17] gamma-glutamyl hydrolase [EC: 3.4.19.9] GTP cyclohydrolase I [EC: 3.5.4.16] molybdenum cofactor biosynthesis protein molybdopterin synthase catalytic subunit [EC: 2...] molybdopterin synthase sulfur carrier subunit para-aminobenzoate synthetase [EC: 2.6.1.85] para-aminobenzoate synthetase component I [EC: 2.6.1.85] para-aminobenzoate synthetase component II [EC: 2.6.1.85] sepiapterin reductase [EC: 1.1.1.153] thymidylate synthase [EC: 2.1.1.45]
TABLE-US-00008 TABLE 8 Cobalamin (B12) biosynthesis 5-aminolevulinate synthase [EC: 2.3.1.37] 5-aminolevulinate:pyruvate aminotransferase [EC 2.6.1.43] adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase [EC: 2.7.1.156/2.7.7.62] adenosylcobinamide-GDP ribazoletransferase [EC: 2.7.8.26] adenosylcobinamide-phosphate synthase [EC: 6.3.1.10] adenosylcobyric acid synthase [EC: 6.3.5.10] alpha-ribazole phosphatase [EC: 3.1.3.73] cob(I)alamin adenosyltransferase [EC: 2.5.1.17] cob(II)yrinic acid a,c-diamide reductase [EC: 1.16.8.1] cobalt-precorrin 5A hydrolase [EC: 3.7.1.12] cobalt-precorrin-5B (C1)-methyltransferase [EC: 2.1.1.195] cobalt-precorrin-7 (C15)-methyltransferase [EC: 2.1.1.196] cobaltochelatase CobN [EC: 6.6.1.2] cobyrinic acid a,c-diamide synthase [EC: 6.3.5.9/6.3.5.11] ferritin [EC: 1.16.3.1] glutamate-1-semialdehyde 2,1-aminomutase [EC: 5.4.3.8] glutamyl-tRNA reductase [EC: 1.2.1.70] glutamyl-tRNA synthetase [EC: 6.1.1.17] hydroxymethylbilane synthase [EC: 2.5.1.61] nicotinate-nucleotide-dimethylbenzimidazole phosphoribosyltransferase [EC: 2.4.2.21] oxygen-independent coproporphyrinogen III oxidase [EC: 1.3.99.22] porphobilinogen synthase [EC: 4.2.1.24] precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase [EC: 1.3.1.76/4.99.1.4] precorrin-2/cobalt-factor-2 C20-methyltransferase [EC: 2.1.1.130/2.1.1.151] precorrin-3B synthase [EC: 1.14.13.83] precorrin-3B C17-methyltransferase [EC: 2.1.1.131] precorrin-4 C11-methyltransferase [EC: 2.1.1.133] precorrin-6X reductase [EC: 1.3.1.54] precorrin-6Y C5,15-methyltransferase [EC: 2.1.1.132] precorrin-8W decarboxylase [EC: 1...] precorrin-8X methylmutase [EC: 5.4.1.2] sirohydrochlorin cobaltochelatase [EC: 4.99.1.3] threonine-phosphate decarboxylase [EC: 4.1.1.81] uroporphyrinogen decarboxylase [EC: 4.1.1.37] uroporphyrinogen III methyltransferase/synthase [EC: 2.1.1.107 4.2.1.75]
[0121] In one particular embodiment, the parental microorganism lacks one or more of the genes encoding the enzymes thiamine biosynthesis protein ThiC (EC 4.1.99.17), 3-methyl-2-oxobutanoate hydroxymethyltransferase PanB (EC 2.1.2.11), pantoate-beta-alanine ligase PanC (EC 6.3.2.1), and aspartate 1-decarboxylase Pan D (EC 4.1.1.11). In one embodiment, the parental microorganism lacks the gene encoding enzyme ThiC. In another embodiment, the parental microorganism lacks one or more enzymes encoding one or more or all of PanB, PanC and PanD.
[0122] While the invention is exemplified herein in respect of certain vitamin biosynthesis pathways, it will be appreciated that other biosynthesis pathways may be used. With knowledge of the present invention, analysis of any sequenced organism can be done using databases like the Kyoto Encyclopedia of Genes and Genomes KEGG (http://www.genome.jp/kegg/; Kanehisa et al., 2012, Nucleic Acids Res. 40, D109-D114; Kanehisa and Goto, 2000, Nucleic Acids Res. 28, 27-30) or BioCyc (http://biocyc.org/; Caspi et al., 2010, Nucleic Acids Res. 38: D473-479) to identify genes which are present or missing from a particular biosynthesis pathway.
[0123] The parental microorganism may be chosen from any of the group of anaerobic microorganism, in one embodiment anaerobic bacteria.
[0124] In one embodiment, the microorganism is selected from the group comprising the genera Clostridium, Eubacterium, Peptostreptococcus, Peptococcus, Actinomyces, Lactobacillus, Bifidobacterium, Propionibacterium, Bacteroides, Fusobacterium, Campylobacter, or Veillonella.
[0125] In one particular embodiment, the parental microorganism is selected from the group of carboxydotrophic acetogenic bacteria. In certain embodiments the microorganism is selected from the group comprising Clostridium autoethanogenum, Clostridium ljungdahlii, Clostridium ragsdalei, Clostridium carboxidivorans, Clostridium drakei, Clostridium scatologenes, Clostridium aceticum, Clostridium formicoaceticum, Clostridium magnum, Butyribacterium methylotrophicum, Acetobacterium woodii, Alkalibaculum bacchii, Blautia producta, Eubacterium limosum, Moorella thermoacetica, Moorella thermautotrophica, Sporomusa ovata, Sporomusa silvacetica, Sporomusa sphaeroides, Oxobacter pfennigii, and Thermoanaerobacter kiuvi.
[0126] In one particular embodiment, the parental microorganism is selected from the cluster of ethanologenic, acetogenic Clostridia comprising the species C. autoethanogenum, C. ljungdahlii, and C. ragsdalei and related isolates. These include but are not limited to strains C. autoethanogenum JAI-1.sup.T (DSM10061) [Abrini J, Naveau H, Nyns E-J: Clostridium autoethanogenum, sp. nov., an anaerobic bacterium that produces ethanol from carbon monoxide. Arch Microbiol 1994, 4: 345-351], C. autoethanogenum LBS1560 (DSM19630) [Simpson S D, Forster R L, Tran P T, Rowe M J, Warner I L: Novel bacteria and methods thereof. International patent 2009, WO/2009/064200], C. autoethanogenum LBS1561 (DSM23693), C. ljungdahlii PETC.sup.T (DSM13528=ATCC 55383) [Tanner R S, Miller L M, Yang D: Clostridium ljungdahlii sp. nov., an Acetogenic Species in Clostridial rRNA Homology Group I. Int J Syst Bacteriol 1993, 43: 232-236], C. ljungdahlii ERI-2 (ATCC 55380) [Gaddy J L: Clostridium stain which produces acetic acid from waste gases. US patent 1997, U.S. Pat. No. 5,593,886], C. ljungdahlii C-01 (ATCC 55988) [Gaddy J L, Clausen E C, Ko C-W: Microbial process for the preparation of acetic acid as well as solvent for its extraction from the fermentation broth. US patent, 2002, U.S. Pat. No. 6,368,819], C. ljungdahlii 0-52 (ATCC 55989) [Gaddy J L, Clausen E C, Ko C-W: Microbial process for the preparation of acetic acid as well as solvent for its extraction from the fermentation broth. US patent, 2002, U.S. Pat. No. 6,368,819], C. ragsdalei P11.sup.T (ATCC BAA-622) [Huhnke R L, Lewis R S, Tanner R S: Isolation and Characterization of novel Clostridial Species. International patent 2008, WO 2008/028055], related isolates such as C. coskatii [Zahn et alNovel ethanologenic species Clostridium coskatii (US Patent Application number US20110229947)] and Clostridium sp. (Tyurin et al., 2012, 1 Biotech Res. 4: 1-12), or mutated strains such as C. ljungdahlii OTA-1 (Tirado-Acevedo O. Production of Bioethanol from Synthesis Gas Using Clostridium ljungdahlii. PhD thesis, North Carolina State University, 2010). These strains form a subcluster within the Clostridial rRNA cluster I, and their 16S rRNA gene is more than 99% identical with a similar low GC content of around 30%. However, DNA-DNA reassociation and DNA fingerprinting experiments showed that these strains belong to distinct species [Huhnke R L, Lewis R S, Tanner R S: Isolation and Characterization of novel Clostridial Species. International patent 2008, WO 2008/028055].
[0127] All species of this cluster have a similar morphology and size (logarithmic growing cells are between 0.5-0.73-5 m), are mesophilic (optimal growth temperature between 30-37 C.) and strictly anaerobe [Tanner R S, Miller L M, Yang D: Clostridium ljungdahlii sp. nov., an Acetogenic Species in Clostridial rRNA Homology Group I. Int J Syst Bacteriol 1993, 43: 232-236; Abrini J, Naveau H, Nyns E-J: Clostridium autoethanogenum, sp. nov., an anaerobic bacterium that produces ethanol from carbon monoxide. Arch Microbiol 1994, 4: 345-351; Huhnke R L, Lewis R S, Tanner R S: Isolation and Characterization of novel Clostridial Species. International patent 2008, WO 2008/028055]. Moreover, they all share the same major phylogenetic traits, such as same pH range (pH 4-7.5, with an optimal initial pH of 5.5-6), strong autotrophic growth on CO containing gases with similar growth rates, and a similar metabolic profile with ethanol and acetic acid as main fermentation end product, and small amounts of 2,3-butanediol and lactic acid formed under certain conditions. [Tanner R S, Miller L M, Yang D: Clostridium ljungdahlii sp. nov., an Acetogenic Species in Clostridial rRNA Homology Group I. Int J Syst Bacteriol 1993, 43: 232-236; Abrini J, Naveau H, Nyns E-J: Clostridium autoethanogenum, sp. nov., an anaerobic bacterium that produces ethanol from carbon monoxide. Arch Microbiol 1994, 4: 345-351; Huhnke R L, Lewis R S, Tanner R S: Isolation and Characterization of novel Clostridial Species. International patent 2008, WO 2008/028055]. Indole production was observed with all three species as well. However, the species differentiate in substrate utilization of various sugars (e.g. rhamnose, arabinose), acids (e.g. gluconate, citrate), amino acids (e.g. arginine, histidine), or other substrates (e.g. betaine, butanol). Moreover some of the species were found to be auxotroph to certain vitamins (e.g. thiamine, biotin) while others were not.
[0128] The strains of this cluster are defined by common characteristics, having both a similar genotype and phenotype, and they all share the same mode of energy conservation and fermentative metabolism. The strains of this cluster lack cytochromes and conserve energy via an Rnf complex.
[0129] All strains of this cluster have a genome size of around 4.2 MBp (Kpke et al., 2010) and a GC composition of around 32% mol (Abrini et al., 1994; Kpke et al., 2010; Tanner et al., 1993) (WO 2008/028055; US patent 2011/0229947), and conserved essential key gene operons encoding for enzymes of Wood-Ljungdahl pathway (Carbon monoxide dehydrogenase, Formyl-tetrahydrofolate synthetase, Methylene-tetrahydrofolate dehydrogenase, Formyl-tetrahydrofolate cyclohydrolase, Methylene-tetrahydrofolate reductase, and Carbon monoxide dehydrogenase/Acetyl-CoA synthase), hydrogenase, formate dehydrogenase, Rnf complex (rnfCDGEAB), pyruvate:ferredoxin oxidoreductase, aldehyde:ferredoxin oxidoreductase (Kpke et al., 2010, 2011). The organization and number of Wood-Ljungdahl pathway genes, responsible for gas uptake, has been found to be the same in all species, despite differences in nucleic and amino acid sequences (Kpke et al., 2011).
[0130] Reduction of carboxylic acids into their corresponding alcohols has been shown in a range of these organisms (Perez, Richter, Loftus, & Angenent, 2012).
[0131] The traits described are therefore not specific to one organism like C. autoethanogenum or C. ljungdahlii, but rather general traits for carboxydotrophic, ethanol-synthesizing Clostridia. Thus, the invention can be anticipated to work across these strains, although there may be differences in performance.
[0132] The recombinant carboxydotrophic acetogenic microorganisms of the invention may be prepared from a parental carboxydotrophic acetogenic microorganism and one or more exogenous nucleic acids using any number of techniques known in the art for producing recombinant microorganisms. By way of example only, transformation (including transduction or transfection) may be achieved by electroporation, electrofusion, ultrasonication, polyethylene glycol-mediated transformation, conjugation, or chemical and natural competence. Suitable transformation techniques are described for example in Sambrook J, Fritsch E F, Maniatis T: Molecular Cloning: A laboratory Manual, Cold Spring Harbour Laboratory Press, Cold Spring Harbour, 1989.
[0133] Electroporation has been described for several carboxydotrophic acetogens as C. ljungdahlii (Kpke et al., 2010; Leang, Ueki, Nevin, & Lovley, 2012) (PCT/NZ2011/000203; WO2012/053905), C. autoethanogenum (PCT/NZ2011/000203; WO2012/053905), Acetobacterium woodii (Strtz, Sauer, Kuhn, & Dune, 1994) or Moorella thermoacetica (Kita et al., 2012) and is a standard method used in many Clostridia such as C. acetobutylicum (Mermelstein, Welker, Bennett, & Papoutsakis, 1992), C. cellulolyticum (Jennert, Tardif, Young, & Young, 2000) or C. thermocellum (MV Tyurin, Desai, & Lynd, 2004).
[0134] Electrofusion has been described for acetogenic Clostridium sp. MT351 (Tyurin and Kiriukhin, 2012).
[0135] Prophage induction has been described for carboxydotrophic acetogen as well in case of C. scatologenes (Prasanna Tamarapu Parthasarathy, 2010, Development of a Genetic Modification System in Clostridium scatologenes ATCC 25775 for Generation of Mutants, Masters Project Western Kentucky University).
[0136] Conjugation has been described as method of choice for acetogen Clostridium difficile (Herbert, O'Keeffe, Purdy, Elmore, & Minton, 2003) and many other Clostridia including C. acetobuylicum (Williams, Young, & Young, 1990). In one embodiment, the parental strain uses CO as its sole carbon and energy source.
[0137] In one embodiment the parental microorganism is Clostridium autoethanogenum or Clostridium ljungdahlii. In one particular embodiment, the microorganism is Clostridium autoethanogenum DSM23693. In another particular embodiment, the microorganism is Clostridium ljungdahlii DSM13528 (or ATCC55383).
[0138] In one particular embodiment, the parental microorganism is Clostridium autoethanogenum, the biosynthesis pathway is for thiamine or panthothenate and the parental microorganism lacks the genes thiC or one or more of panB, panC and panD.
[0139] In one particular embodiment, the recombinant microorganism is adapted to express one or more enzymes in a vitamin biosynthesis pathway which produces a vitamin(s) which is needed for the growth of the microorganism and which are not naturally present in the parental microorganism.
[0140] The microorganism may be adapted to express the one or more enzymes by any number of recombinant methods including, for example, introducing an exogenous nucleic acid encoding and adapted to express an enzyme not naturally present within the parental microorganism.
[0141] The vitamins and enzymes of use in the recombinant microorganisms of the invention are defined elsewhere herein.
[0142] In one embodiment, the microorganism comprises one or more exogenous nucleic acids encoding and adapted to express one or more of the enzymes referred to elsewhere herein. In one embodiment, the microorganisms comprise one or more exogenous nucleic acid encoding and adapted to express at least two of the enzymes. In other embodiments, the microorganism comprises one or more exogenous nucleic acid encoding and adapted to express 3, 4, 5, or 6 of the enzymes.
[0143] The microorganism may comprise one or more exogenous nucleic acids. Where it is desirable to transform the parental microorganism with two or more genetic elements (such as) they may be contained on one or more exogenous nucleic acids.
[0144] In one embodiment, the one or more exogenous nucleic acid is a nucleic acid construct or vector, in one particular embodiment a plasmid, encoding one or more of the enzymes referred to herein in any combination.
[0145] The exogenous nucleic acids may remain extra-chromosomal upon transformation of the parental microorganism or preferably intergrate into the genome of the parental microorganism. Accordingly, they may include additional nucleotide sequences adapted to assist integration (for example, a region which allows for homologous recombination and targeted integration into the host genome) or expression and replication of an extrachromosomal construct (for example, origin of replication, promoter and other regulatory elements or sequences).
[0146] In one embodiment, the exogenous nucleic acids encoding one or enzymes as mentioned herein before will further comprise a promoter adapted to promote expression of the one or more enzymes encoded by the exogenous nucleic acids. In one embodiment, the promoter is a constitutive promoter that is preferably highly active under appropriate fermentation conditions. Inducible promoters could also be used. In preferred embodiments, the promoter is selected from the group comprising Wood-Ljungdahl gene cluster and Phosphotransacetylase/Acetate kinase promoters. It will be appreciated by those of skill in the art that other promoters which can direct expression, preferably a high level of expression under appropriate fermentation conditions, would be effective as alternatives to the exemplified embodiments.
[0147] In one embodiment, the exogenous nucleic acid is an expression plasmid.
Nucleic Acids
[0148] The invention also provides nucleic acids and nucleic acid constructs of use in generating a recombinant microorganism of the invention.
[0149] The nucleic acids comprise sequences encoding one or more enzymes of one or more vitamin biosynthesis pathway which when expressed in a microorganism allows the microorganism to produce a vitamin which is needed for the growth of the microorganism. In one particular embodiment, the invention provides a nucleic acid encoding two or more enzymes. In one embodiment, the nucleic acids of the invention encode 3, 4, 5 or 6 such enzymes.
[0150] A nucleic acid of the invention encodes one or more enzyme in a vitamin biosynthesis pathway. In one particular embodiment, a nucleic acid of the invention encodes one or more enzyme in the biosynthesis pathway of one or more of Thiamine, pathothenate, riboflavin, nicotinic acid, pyridoxine, biotin, folic acid, and cyanocobalamine. In one embodiment, a nucleic acid of the invention encodes one or more of the enzymes listed in tables 3 to 10 herein before.
[0151] In one particular embodiment, a nucleic acid of the invention encodes one or more enzymes in the thiamine biosynthesis pathway. In one embodiment, the nucleic acid encodes ThiC.
[0152] In another embodiment, a nucleic acid of the invention encodes one or more enzymes in the panthothenate pathway. In one particular embodiment, a nucleic acid encodes one or more or all of panB, panC or panD.
[0153] Skilled persons will readily appreciate nucleic acids sequences encoding the enzymes or functionally equivalent variants thereof which are of use in the invention, having regard to the information contained herein, in GenBank and other databases, and the genetic code. However, by way of example only, exemplary amino acid sequences and nucleic acid sequences encoding enzymes of relevance to the invention may be obtained from databases such as the NCBI, KEGG and BRENDA databases, for example.
[0154] By way of example only, in one embodiment, ThiC has the sequence of SEQ ID No. 3, or is a functionally equivalent variant thereof. By way of further example, in one embodiment, panB has the sequence of YP_001309722.1 (GenBank) or is a functionally equivalent variant thereof, panC has the sequence of YP_001309721.1 (GenBank) or is a functionally equivalent variant thereof, and panD has the sequence of YP_001309720.1 (GenBank) or is a functionally equivalent variant thereof.
[0155] Again, by way of example only, in one embodiment, a nucleic acid encoding ThiC has the sequence of SEQ ID No. 2, or is a functionally equivalent variant thereof. By way of further example, in one embodiment, a nucleic acid encoding panB has the sequence of Cbei_2610; Gene ID: 5293811 or is a functionally equivalent variant thereof, a nucleic acid encoding panC has the sequence of Cbei_2609; Gene ID: 5293810 or is a functionally equivalent variant thereof, and a nucleic acid encoding panD has the sequence of Cbei_2608; Gene ID: 5293809 or is a functionally equivalent variant thereof.
[0156] In one embodiment, the nucleic acids of the invention will further comprise a promoter. In one embodiment, the promoter allows for constitutive expression of the genes under its control. However, inducible promoters may also be employed. Persons of skill in the art will readily appreciate promoters of use in the invention. Preferably, the promoter can direct a high level of expression under appropriate fermentation conditions. In a particular embodiment a Wood-Ljungdahl cluster promoter is used. In another embodiment, a Phosphotransacetylase/Acetate kindase promoter is used. In another embodiment a pyruvate:ferredoxin oxidoreductase promoter, an Rnf complex operon promoter or an ATP synthase operon promoter. In one particular embodiment, the promoter is from C. autoethanogenum.
[0157] The nucleic acids of the invention may remain extra-chromosomal upon transformation of a parental microorganism or may preferably be adapted for intergration into the genome of the microorganism. Accordingly, nucleic acids of the invention may include additional nucleotide sequences adapted to assist integration (for example, a region which allows for homologous recombination and targeted integration into the host genome) or stable expression and replication of an extrachromosomal construct (for example, origin of replication, promoter and other regulatory sequences).
[0158] In one embodiment, the nucleic acid is nucleic acid construct or vector. In one particular embodiment, the nucleic acid construct or vector is an expression construct or vector, however other constructs and vectors, such as those used for cloning are encompassed by the invention. In one particular embodiment, the expression construct or vector is a plasmid.
[0159] It will be appreciated that an expression construct/vector of the present invention may contain any number of regulatory elements in addition to the promoter as well as additional genes suitable for expression of further proteins if desired. In one embodiment the expression construct/vector includes one promoter. In another embodiment, the expression construct/vector includes two or more promoters. In one particular embodiment, the expression construct/vector includes one promoter for each gene to be expressed. In one embodiment, the expression construct/vector includes one or more ribosomal binding sites, preferably a ribosomal binding site for each gene to be expressed.
[0160] It will be appreciated by those of skill in the art that the nucleic acid sequences and construct/vector sequences described herein may contain standard linker nucleotides such as those required for ribosome binding sites and/or restriction sites. Such linker sequences should not be interpreted as being required and do not provide a limitation on the sequences defined.
[0161] Nucleic acids and nucleic acid constructs, including expression constructs/vectors of the invention may be constructed using any number of techniques standard in the art. For example, chemical synthesis or recombinant techniques may be used. Such techniques are described, for example, in Sambrook et al (Molecular Cloning: A laboratory manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989). Further exemplary techniques are described in the Examples section herein after. Essentially, the individual genes and regulatory elements will be operably linked to one another such that the genes can be expressed to form the desired proteins. Suitable vectors for use in the invention will be appreciated by those of ordinary skill in the art. However, by way of example, the following vectors may be suitable: pMTL80000 vectors, pIMP1, pJIR750, and the plasmids exemplified in the Examples section herein after.
[0162] It should be appreciated that nucleic acids of the invention may be in any appropriate form, including RNA, DNA, or cDNA.
[0163] The invention also provides host organisms, particularly microorganisms, and including viruses, bacteria, and yeast, comprising any one or more of the nucleic acids described herein.
[0164] The one or more exogenous nucleic acids may be delivered to a parental microorganism as naked nucleic acids or may be formulated with one or more agents to facilitate the transformation process (for example, liposome-conjugated nucleic acid, an organism in which the nucleic acid is contained). The one or more nucleic acids may be DNA, RNA, or combinations thereof, as is appropriate. Restriction inhibitors may be used in certain embodiments; see, for example Murray, N. E. et al. (2000) Microbial. Molec. Biol. Rev. 64, 412.)
[0165] The microorganisms of the invention may be prepared from a parental microorganism and one or more exogenous nucleic acids using any number of techniques known in the art for producing recombinant microorganisms. By way of example only, transformation (including transduction or transfection) may be achieved by electroporation, ultrasonication, polyethylene glycol-mediated transformation, chemical or natural competence, or conjugation. Suitable transformation techniques are described for example in, Sambrook J, Fritsch E F, Maniatis T: Molecular Cloning: A laboratory Manual, Cold Spring Harbour Labrotary Press, Cold Spring Harbour, 1989.
[0166] In certain embodiments, due to the restriction systems which are active in the microorganism to be transformed, it is necessary to methylate the nucleic acid to be introduced into the microorganism. This can be done using a variety of techniques, including those described below, and further exemplified in the Examples section herein after.
[0167] By way of example, in one embodiment, a recombinant microorganism of the invention is produced by a method comprises the following steps:
a. introduction into a shuttle microorganism of (i) of an expression construct/vector as described herein and (ii) a methylation construct/vector comprising a methyltransferase gene; expression of the methyltransferase gene;
b. isolation of one or more constructs/vectors from the shuttle microorganism; and,
c. introduction of the one or more construct/vector into a destination microorganism.
[0168] In one embodiment, the methyltransferase gene of step B is expressed constitutively. In another embodiment, expression of the methyltransferase gene of step B is induced.
[0169] The shuttle microorganism is a microorganism, preferably a restriction negative microorganism, that facilitates the methylation of the nucleic acid sequences that make up the expression construct/vector. In a particular embodiment, the shuttle microorganism is a restriction negative E. coli, Bacillus subtillis, or Lactococcus lactis.
[0170] The methylation construct/vector comprises a nucleic acid sequence encoding a methyltransferase.
[0171] Once the expression construct/vector and the methylation construct/vector are introduced into the shuttle microorganism, the methyltransferase gene present on the methylation construct/vector is induced. Induction may be by any suitable promoter system although in one particular embodiment of the invention, the methylation construct/vector comprises an inducible lac promoter and is induced by addition of lactose or an analogue thereof, more preferably isopropyl--D-thio-galactoside (IPTG). Other suitable promoters include the ara, tet, or T7 system. In a further embodiment of the invention, the methylation construct/vector promoter is a constitutive promoter.
[0172] In a particular embodiment, the methylation construct/vector has an origin of replication specific to the identity of the shuttle microorganism so that any genes present on the methylation construct/vector are expressed in the shuttle microorganism. Preferably, the expression construct/vector has an origin of replication specific to the identity of the destination microorganism so that any genes present on the expression construct/vector are expressed in the destination microorganism.
[0173] Expression of the methyltransferase enzyme results in methylation of the genes present on the expression construct/vector. The expression construct/vector may then be isolated from the shuttle microorganism according to any one of a number of known methods. By way of example only, the methodology described in the Examples section described hereinafter may be used to isolate the expression construct/vector.
[0174] In one particular embodiment, both construct/vector are concurrently isolated.
[0175] The expression construct/vector may be introduced into the destination microorganism using any number of known methods. However, by way of example, the methodology described in the Examples section hereinafter may be used. Since the expression construct/vector is methylated, the nucleic acid sequences present on the expression construct/vector are able to be incorporated into the destination microorganism and successfully expressed.
[0176] It is envisaged that a methyltransferase gene may be introduced into a shuttle microorganism and over-expressed. Thus, in one embodiment, the resulting methyltransferase enzyme may be collected using known methods and used in vitro to methylate an expression plasmid. The expression construct/vector may then be introduced into the destination microorganism for expression. In another embodiment, the methyltransferase gene is introduced into the genome of the shuttle microorganism followed by introduction of the expression construct/vector into the shuttle microorganism, isolation of one or more constructs/vectors from the shuttle microorganism and then introduction of the expression construct/vector into the destination microorganism.
[0177] It is envisaged that the expression construct/vector and the methylation construct/vector as defined above may be combined to provide a composition of matter. Such a composition has particular utility in circumventing restriction barrier mechanisms to produce the recombinant microorganisms of the invention.
[0178] In one particular embodiment, the expression construct/vector and/or the methylation construct/vector are plasmids.
[0179] Persons of ordinary skill in the art will appreciate a number of suitable methyltransferases of use in producing the microorganisms of the invention. However, by way of example the Bacillus subtilis phage T1 methyltransferase and a methyltransferase having the sequence of SEQ ID 14 or a functionally equivalent variant thereof may be used. Nucleic acids encoding suitable methyltransferases will be readily appreciated having regard to the sequence of the desired methyltransferase and the genetic code. In one embodiment, the nucleic acid encoding a methyltransferase is as for SEQ ID 15 or it is a functionally equivalent variant thereof.
[0180] Any number of constructs/vectors adapted to allow expression of a methyltransferase gene may be used to generate the methylation construct/vector. However, by way of example, the plasmid described in the Examples section hereinafter may be used.
Methods of Production
[0181] The invention provides a method for the production of one or more desirable products by microbial fermentation of a substrate using a recombinant microorganism of the invention.
[0182] Any substrate which is appropriate for anaerobic fermentation may be used for the fermentation, including, for example, carbohydrates, sugars, substrates comprising CO, substrates comprising carbon dioxide and hydrogen, glycerol, fatty acids, starch, molasses, pentoses and hexoses sugars, biomass. In one embodiment, the substrate is a substrate comprising CO. In this embodiment, the methods of the invention may be used to reduce the total atmospheric carbon emissions from an industrial process.
[0183] Preferably, the fermentation comprises the steps of fermenting a substrate in a bioreactor to produce the one or more products using a recombinant microorganism of the invention.
[0184] In one embodiment the method comprises the steps of: [0185] (a) providing a substrate to a bioreactor containing a culture of one or more microorganism of the invention; and [0186] (b) anaerobic fermentation of the culture in the bioreactor to produce the one or more products.
[0187] In one embodiment the method comprises the steps of: [0188] (a) capturing CO-containing gas produced as a result of the industrial process, before the gas is released into the atmosphere; [0189] (b) the anaerobic fermentation of the CO-containing gas to produce the one or more products by a culture containing one or more microorganism of the invention.
[0190] In an embodiment of the invention, the gaseous substrate fermented by the microorganism is a gaseous substrate containing CO. The gaseous substrate may be a CO-containing waste gas obtained as a by-product of an industrial process, or from some other source such as from automobile exhaust fumes. In certain embodiments, the industrial process is selected from the group consisting of ferrous metal products manufacturing, such as a steel mill, non-ferrous products manufacturing, petroleum refining processes, gasification of coal, electric power production, carbon black production, ammonia production, methanol production and coke manufacturing. In these embodiments, the CO-containing gas may be captured from the industrial process before it is emitted into the atmosphere, using any convenient method. The CO may be a component of syngas (gas comprising carbon monoxide and hydrogen). The CO produced from industrial processes is normally flared off to produce CO.sub.2 and therefore the invention has particular utility in reducing CO.sub.2 greenhouse gas emissions and producing butanol for use as a biofuel. Depending on the composition of the gaseous COcontaining substrate, it may also be desirable to treat it to remove any undesired impurities, such as dust particles before introducing it to the fermentation. For example, the gaseous substrate may be filtered or scrubbed using known methods.
[0191] It will be appreciated that for growth of the bacteria and substrate to the one or more product(s) to occur, in addition to the substrate, a suitable liquid nutrient medium will need to be fed to the bioreactor. The substrate and media may be fed to the bioreactor in a continuous, batch or batch fed fashion. A nutrient medium will contain a number of compounds sufficient to permit survival and/or growth of the micro-organism used, as known in the art. Suitable anaerobic and aerobic fermentation media are known in the art. For example, suitable media are described Biebel (2001). However, the present invention offers the advantage of not having to include in the media one or more vitamin, as the recombinant microorganism is able to produce it. Accordingly, minimal media may be used, reducing costs. In addition, growth and fermentation of recombinant microorganisms typically involves the addition to the media of a selection compound, typically one or more antibiotic, so that the recombinant microorganism is selected for and any contaminating microorganisms do not survive. The use of antibiotics increases the cost of fermentation, and there may be other downsides such as toxicity. The present invention obviates the need for antibiotics. In one embodiment of the invention the media is as described in the Examples section herein after.
[0192] The fermentation should desirably be carried out under appropriate conditions for the substrate-to-the one or more product(s) fermentation to occur. Reaction conditions that should be considered include pressure, temperature, gas flow rate, liquid flow rate, media pH, media redox potential, agitation rate (if using a continuous stirred tank reactor), inoculum level, maximum substrate concentrations to ensure that it does not become limiting, and maximum product concentrations to avoid product inhibition.
[0193] Where a substrate comprising CO is used, it is often desirable to increase the CO concentration of the substrate stream (or CO partial pressure in a gaseous substrate) and thus increase the efficiency of fermentation reactions where CO is a substrate. Operating at increased pressures allows a significant increase in the rate of CO transfer from the gas phase to the liquid phase where it can be taken up by the micro-organism as a carbon source for the production of the one or more products. This in turn means that the retention time (defined as the liquid volume in the bioreactor divided by the input gas flow rate) can be reduced when bioreactors are maintained at elevated pressure rather than atmospheric pressure. The optimum reaction conditions will depend partly on the particular micro-organism of the invention used. However, in general, it is preferred that the fermentation be performed at pressure higher than ambient pressure. Also, since a given CO-to-the one or more product(s) conversion rate is in part a function of the substrate retention time, and achieving a desired retention time in turn dictates the required volume of a bioreactor, the use of pressurized systems can greatly reduce the volume of the bioreactor required, and consequently the capital cost of the fermentation equipment. According to examples given in U.S. Pat. No. 5,593,886, reactor volume can be reduced in linear proportion to increases in reactor operating pressure, i.e. bioreactors operated at 10 atmospheres of pressure need only be one tenth the volume of those operated at 1 atmosphere of pressure.
[0194] By way of example, the benefits of conducting a gas-to-ethanol fermentation at elevated pressures has been described. For example, WO 02/08438 describes gas-to-ethanol fermentations performed under pressures of 30 psig and 75 psig, giving ethanol productivities of 150 g/l/day and 369 g/l/day respectively. However, example fermentations performed using similar media and input gas compositions at atmospheric pressure were found to produce between 10 and 20 times less ethanol per litre per day.
[0195] It is also desirable that the rate of introduction of the CO-containing gaseous substrate is such as to ensure that the concentration of CO in the liquid phase does not become limiting. This is because a consequence of CO-limited conditions may be that the product is consumed by the culture.
[0196] The composition of gas streams used to feed a fermentation reaction can have a significant impact on the efficiency and/or costs of that reaction. For example, 02 may reduce the efficiency of an anaerobic fermentation process. Processing of unwanted or unnecessary gases in stages of a fermentation process before or after fermentation can increase the burden on such stages (e.g. where the gas stream is compressed before entering a bioreactor, unnecessary energy may be used to compress gases that are not needed in the fermentation). Accordingly, it may be desirable to treat substrate streams, particularly substrate streams derived from industrial sources, to remove unwanted components and increase the concentration of desirable components.
[0197] In certain embodiments a culture of a bacterium of the invention is maintained in an aqueous culture medium (which does not include one or more vitamins in accordance with the invention). Preferably the aqueous culture medium is a minimal microbial growth medium. Suitable media are known in the art and described for example in U.S. Pat. Nos. 5,173,429 and 5,593,886 and WO 02/08438, and as described in the Examples section herein after.
[0198] The one or more products may be recovered from the fermentation broth by methods known in the art, such as fractional distillation or evaporation, pervaporation, gas stripping and extractive fermentation, including for example, liquid-liquid extraction.
[0199] In certain preferred embodiments of the invention, the one or more products are recovered from the fermentation broth by continuously removing a portion of the broth from the bioreactor, separating microbial cells from the broth (conveniently by filtration), and recovering one or more products from the broth. Alcohols may conveniently be recovered for example by distillation. Acetone may be recovered for example by distillation. Any acids produced may be recovered for example by adsorption on activated charcoal. The separated microbial cells are preferably returned to the fermentation bioreactor. The cell free permeate remaining after any alcohol(s) and acid(s) have been removed is also preferably returned to the fermentation bioreactor.
[0200] Vitamins may be recovered using any appropriate means. However, by way of example they may be recovered by concentration and drying of the cells (e.g. centrifugation or spray drying) with subsequent extraction (e.g. in alcohol with purification and filtration using chromatography or simply by differential centrifugation) and crystallization (Survase et al., 2006, Food Technol. Biotechnol. 44: 381-96).
[0201] In one embodiment, the one or more product (in one particular embodiment one or more vitamin) is recovered from the fermentation and passed to one or more further bioreactor to support the growth of, or support the fermentation of a substrate by, one or more second microorganism.
[0202] In one embodiment, the one or more second microorganism is a microorganism which is unable to produce, or unable to produce at sufficient levels, of the one or more vitamin(s) and requires its growth or fermentation media to be supplemented with the one or more vitamin(s) to ensure or maintain growth or fermentation, or to increase the efficiency of growth or fermentation.
[0203] The one or more product recovered from the first fermentation may be passed to one or more further bioreactor using any suitable conduit.
[0204] In one embodiment, the methods of the invention may further comprise fermentation of a substrate by the one or more second microorganism to produce one or more products. In one embodiment, the one or more products may then be recovered from the fermentation broth.
Methods of Selection
[0205] The invention also provides a method for the selection of a microorganism A in a mixed population of microorganisms, wherein microorganism A is a recombinant microorganism comprising at least one exogenous nucleic acid which is adapted to express one or more enzymes in one or more vitamin biosynthesis pathway which produces one or more vitamin(s) which is needed for the growth of the mixed population of microorganisms.
[0206] The method comprises subjecting the mixed population of microorganisms to culture conditions including a media which lacks the one or more vitamin(s) which is needed for the growth of the microorganisms. Those microorganisms not able to produce the one or more vitamin(s), will not grow or will be selected against.
[0207] In other embodiments, the one or more of the enzyme is as herein before described. The one or more vitamin is as herein before described. In one particular embodiment, the one or more vitamin is chosen from thiamine, pathothenate, riboflavin, nicotinic acid, pyridoxine, biotin, folic acid, and/or cyanocobalamine.
[0208] The culture conditions may be any suitable conditions which allow for at least the maintenance of a culture of microorganism A and include conditions suitable for growth and/or fermentation. Skilled persons will appreciate suitable conditions, having regard to the nature of the microorganism, and the information contained herein. However, by way of example, growth conditions include suitable environmental conditions including pH, presence or absence of oxygen and other gases, salinity, temperature and the like.
[0209] Any suitable media may be used, provided it lacks the one or more vitamin needed for the growth of the microorganisms (which can be produced by microorganism A) as described herein before. Skilled persons will readily appreciate a variety of appropriate media. However, in one embodiment, the media is a minimal media.
[0210] While the invention overcomes the need to use alternative selection means or supplement media with ingredients such as antibiotics, these methods could be combined with the current invention if desired.
[0211] The method of this aspect of the invention may be useful to distinguish between recombinant and non-recombinant microorganisms during the process of producing recombinant microorganismsfor example, distinguishing successfully transformed bacteria during a transformation process.
[0212] The method may also be useful for the purpose of selecting against contaminating microorganisms during laboratory or commercial scale culturing of microorganisms and/or fermentation reactions. Without selection measures, undesirable microrgansisms may grow to the detriment of a desired microorganism, or otherwise affect the efficiency of the culture or fermentation reaction.
[0213] Accordingly, the invention also provides a means of preventing the growth of one or more undesirable microorganism in a microbial culture or a fermentation broth, wherein the microbial culture or fermentation broth comprises microorganism A and a nutrient media, wherein microorganism A is a recombinant microorganism comprising at least one exogenous nucleic acid which is adapted to express one or more enzymes in one or more vitamin biosynthesis pathway which produces one or more vitamin(s) which is needed for the growth of microorganism A and the undesirable microorganism(s) such that the microorganism A can produce the one or more vitamin(s), wherein the media lacks the one or more vitamin(s).
[0214] The invention further provides a method for the selective growth or culture of a microorganism A, and wherein microorganism A is a recombinant microorganism comprising at least one exogenous nucleic acid which is adapted to express one or more enzymes in one or more vitamin biosynthesis pathway which produces one or more vitamin(s) which are needed for the growth of the microorganism, such that the microorganism A can produce the one or more vitamin(s), and wherein the growth or culture media lacks the one or more vitamin(s).
[0215] In one embodiment, the conditions select against the growth of one or more undesirable microorganism(s).
[0216] In another aspect, the invention provides a method for the production of one or more products by microbial fermentation of a substrate by a microorganism A, wherein microorganism A is a recombinant microorganism comprising at least one exogenous nucleic acid which is adapted to express one or more enzymes in one or more vitamin biosynthesis pathway which produces one or more vitamin(s) which are needed for the growth of the microorganism, such that the microorganism A can produce the one or more vitamin(s), and wherein fermentation occurs in or on a growth media which lacks the one or more vitamin(s).
[0217] In one embodiment, the conditions select for growth of microorganism A and against the growth of one or more undesirable microorganism(s).
[0218] It should be appreciated that the microorganisms, including recombinant microorganism A, of this aspect of the invention may be chosen from any microorganism of interest, and are not limited to anaerobes. However, in one embodiment they are chosen from the group of anaerobic microorganisms. In one embodiment, they are chosen from the group of carboxydotrophic acetogens.
[0219] The methods described herein before to produce the anaerobic recombinant microorganisms of other aspects of the invention, as well as methods known in the art, may be readily employed to generate the recombinant microorganisms to be selected in this aspect of the invention, adjusted to suit a particular microorganism where necessary. For example, where the microorganism is not an anaerobe, aerobic conditions can be used. The parental microorganism may be chose from any class of microorganisms, and are not limited to anaerobes. However, in one embodiment they may be chosen from the group of anaerobic microorganisms and in one particular embodiment carboxydotrophic acetogens.
[0220] Similarly, the methods for growth and fermention described for other aspects of the invention may be employed in this aspect of the invention, with conditions adjusted, as necessary for the type of microorganism of interest; for example, substituting anaerobic and aerobic conditions.
[0221] The invention also provides microorganisms cultured or grown in accordance with a method herein before described, and products produced by a method as herein before described.
Examples
[0222] The invention will now be described in more detail with reference to the following non-limiting examples.
Methods
[0223] Analysis of Vitamin Biosynthesis Pathways of Clostridium ljungdahlii, C. Autoethanogenum and C. ragsdalei
[0224] The inventors analysed the genomes of the carboxydotrophic acetogens Clostridium ljungdahlii (NC 014328.1; Kpke et al., 2010, Proc. Nat. Acad. Sci. U.S.A., 107: 13087-13092), C. autoethanogenum and C. ragsdalei. It was found that both C. ljungdahlii, as well as C. autoethanogenum are unable to synthesize thiamine due to the lack of the thiamine biosynthesis protein ThiC that participates in the formation of 4-Amino-5-hydroxymethyl-2-methylpyrimidine from 1-(5-Phosphoribosyl)-5-aminoimidazole ribonucleotide (AIR). ThiC is the only required gene product that has been identified for the pyrimidine biosynthesis in E. coli, S. typhimurium, and B. subtilis (Begeley et al, 1999, Arch Microbiol, 171: 293-300). On the other hand, ThiC and the full thiamine biosynthetsis pathway is present in C. ragsdalei and other organisms. Thiamine auxotrophy of C. ljungdahlii and C. autoethanogenum was demonstrated in serum bottle and fermentation experiments, confirming that thiamine needs to be added in fermentation medium (see below).
[0225] The panthothenate/CoA biosynthesis pathway was found to be incomplete in all three organisms, Clostridium ljungdahlii, C. autoethanogenum and C. ragsdalei due to the lack of biosynthetic genes panBCD, encoding a 3-methyl-2-oxobutanoate hydroxymethyltransferase (EC:2.1.2.11; catalyzing conversion of 5,10-Methylenetetrahydrofolate and 3-Methyl-2-oxobutanoic acid to Tetrahydrofolate and 2-Dehydropantoate), pantoate-beta-alanine ligase (EC:6.3.2.1; catalyzing the reaction of (R)-Pantoate+beta-Alanine to Diphosphate+Pantothenate), and aspartate 1-decarboxylase (EC:4.1.1.11; catalyzing the conversion of L-Aspartate to beta-Alanine).
[0226] This concept can be extended to other species of Clostridium, including non acetogenic Clostridial species or to other acetogenic species. Genomes can be obtained from public resources as NCBI (/genome/browse/) or KEGG (genome.jp/kegg-bin/get_htext) and then analysed for presence of genes encoding vitamin biosynthesis proteins listed in tables 1-8. For example, it was found that the genes panCD are also missing in another carboxydotrophic acetogen Acetobacterium woodii that has been recently sequenced (Poehlein et al., 2012) or that panBCD genes are missing in another Clostridia species as C. phytofermentans while all other genes of the panthothenate pathway are present.
Growth Experiments with Clostridium ljungdahlii, C. Autoethanogenum and C. ragsdalei in Media without Thiamine
[0227] Experiments were performed using C. autoethanogenum DSM10061 and DSM23693 (a derivate of DSM10061) and C. ljungdahlii obtained from DSMZ (The German Collection of Microorganisms and Cell Cultures, Inhoffenstrae 7 B, 38124 Braunschweig, Germany). C. ragsdalei ATCC BAA-622 was sourced from ATCC (American Type Culture Collection, Manassas, Va. 20108, USA).
[0228] All strains were cultivated at 37 C in chemically defined PETC media without yeast extract (Table 9) using strictly anaerobic conditions and techniques (Hungate, 1969, Methods in Microbiology, vol. 3B. Academic Press, New York: 117-132; Wolfe, 1971, Adv. Microb. Physiol., 6: 107-146). 30 psi carbon monioxide containing steel mill waste gas (collected from New Zealand Steel site in Glenbrook, NZ; composition: 44% CO, 32% N2, 22% CO.sub.2, 2% H.sub.2) served as sole carbon and energy source.
TABLE-US-00009 TABLE 9 PETC medium Concentration per Media component 1.0 L of media NH.sub.4Cl 1 g KCl 0.1 g MgSO.sub.47H.sub.2O 0.2 g NaCl 0.8 g KH.sub.2PO.sub.4 0.1 g CaCl.sub.2 0.02 g Trace metal solution 10 ml Wolfe's vitamin solution minus 10 ml Thiamine Resazurin (2 g/L stock) 0.5 ml NaHCO.sub.3 2 g Reducing agent 0.006-0.008% (v/v) Distilled water Up to 1 L, pH 5.5 (adjusted with HCl) Wolfe's vitamin solution minus Thiamine per L of Stock Biotin 2 mg Folic acid 2 mg Pyridoxine hydrochloride 10 mg Riboflavin 5 mg Nicotinic acid 5 mg Calcium D-(+)-pantothenate 5 mg Vitamin B.sub.12 0.1 mg p-Aminobenzoic acid 5 mg Lipoic acid 5 mg Thiamine 5 mg Distilled water To 1 L Trace metal solution per L of stock Nitrilotriacetic Acid 2 g MnSO.sub.4H.sub.2O 1 g Fe(SO.sub.4).sub.2(NH.sub.4).sub.26H.sub.2O 0.8 g CoCl.sub.26H.sub.2O 0.2 g ZnSO.sub.47H.sub.2O 0.2 mg CuCl.sub.22H.sub.2O 0.02 g NaMoO.sub.42H.sub.2O 0.02 g Na.sub.2SeO.sub.3 0.02 g NiCl.sub.26H.sub.2O 0.02 g Na.sub.2WO.sub.42H.sub.2O 0.02 g Distilled water To 1 L Reducing agent stock per 100 mL of stock NaOH 0.9 g CysteinHCl 4 g Na.sub.2S 4 g Distilled water To 100 mL
[0229] Growth experiments were then carried out in PETC media omitting thiamine (or panthothenate) from Wolf's vitamin solution. While C. ragsdalei was able to grow over multiple subcultures in absence of thiamine, C. autoethanogenum and C. ljungdahlii weren't able to grow for more than 2 subculture step in absence of thiamine (or no subculture step, if the cell were washed before inoculation to remove residual thiamine), confirming the results from the genome analysis that those strains are auxotroph to thiamine.
[0230] For C. autoethanogenum DSM23693, also a bioreactor experiment was carried out, using a defined medium containing per litre: MgCl, CaCl.sub.2 (0.5 mM), KCl (2 mM), H.sub.3PO.sub.4 (5 mM), Fe (100 M), Ni, Zn (5 M), Mn, B, W, Mo, Se (2 M) was prepared for culture growth. The media was transferred into the bioreactor and autoclaved at 121 C. for 45 minutes. After autoclaving, the medium was supplemented with Wolfe's B-Vitamin solution (see above), and reduced with 3 mM Cysteine-HCl. To achieve anaerobic state, the reactor vessel was sparged with nitrogen through a 0.2 m filter. Gas flow of carbon monioxide containing steel mill waste gas was initially set at 80 ml/min, increasing to 120 ml/min during mid exponential phase, while the agitation was increased from 250 rpm to 350. Na.sub.2S was dosed into the bioreactor at 0.25 ml/hr. Once the OD600 reached 0.4, the bioreactor was switched to a continuous mode at a rate of 1.0 ml/min (Dilution rate 0.96 d.sup.1). Thiamine was dosed into the reactor separately using a syringe pump. The thiamine pump was turned off for six days between day twenty and twenty six. During the period, thiamine feeding was stopped, the culture died and the biomass and gas-uptake dropped considerably. Re-starting the thiamine feeding, regenerated growth and biomass and gas uptake went back to the same level as before (
Cloning of Thiamine Biosynthesis Gene thiC
[0231] The thiC gene of Clostridium ragsdalei was cloned into an appropriate vector for expression. Standard Recombinant DNA and molecular cloning techniques were used in this invention (Sambrook et al, Molecular Cloning: A laboratory Manual, Cold Spring Harbour Labrotary Press, Cold Spring Harbour, 1989; Ausubel et al, Current protocols in molecular biology, John Wiley & Sons, Ltd., Hoboken, 1987).
[0232] For genomic DNA extraction of C. ragsdalei and C. autoethanogenum, a 100 ml of an exponentially growing culture was harvested (4000g, 15 min, 4 C.), washed with potassium phosphate buffer (10 mM, pH 7.5) and re-suspended in 1.9 ml STE buffer (50 mM Tris-HCl, pH 8.0, 1 mM EDTA, 200 mM sucrose). The cells were incubated for 30 minutes with 300 L of lysozyme (100 000 U) at 37 C. The lysis step was followed by a 10 minute incubation with 10% (w/v) SDS. The RNA was digested at room temperature by adding 240 L of 0.5 M EDTA (pH 8.0), 20 L of 1 M Tris-HCl (pH 7.5), and 100 L of RNase A. Then, 100 l Proteinase K (0.5 U) were added and proteolysis took place for 3 h at 37 C. Finally, 600 l of sodium perchlorate (5 M) were added, followed by a phenol-chloroform extraction and an isopropanol precipitation.
[0233] A region (SEQ ID NO: 1) of the C. ragsdalei genome containing the thiC gene (SEQ ID NO: 2), as well as adjacent purF genes (SEQ ID NO: 4 and 6) encoding a amidophosphoribosyl transferase (SEQ ID NO: 5 and 7) and promoter region including regulatory thi box element (
[0234] The amplification was performed on an Applied Biosystems GeneAmp PCR system 9700, using iProof HF DNA polymerase (Bio-Rad) and FailSafe 2PCR premix E buffer (Epicentre). The genes were amplified using the following program: Initial denaturation at 98 for two minutes, followed by thirty two cycles of denaturation (95 C. for 30 s), annealing (53 C. for 30 s), and extension (68 C. for 3 minutes). A final five minute extension step at 72 C. completed the amplification of the 3063 bp fragment.
[0235] Obtained PCR fragment was cloned into shuttle vector pMTL85246 (SEQ ID NO: 10) using ApaI and SbfI (New England Biolabs) to create plasmid pMTL85246-thiC-purF (SEQ ID NO: 11;
[0236] The DNA fragments were incubated with ApaI and BSA at 25 C. for three hours, followed by SbfI addition and Incuabtion at 37 C. for a further three hours. A double digest at 37 C was carried out for NotI and NdeI. All Enzymes were inactivated by twenty minute incubation at 65 C. Vector pMTL85240 and pMTL85246 was dephosphorylated using Shrimp Alkaline Phosphotase (Fermentas) at 37 C. for one hour. The purified DNA fragments were ligated with T4 DNA ligase (New England Biolabs). The reaction was left to incubate at 16 C. overnight and the enzyme was inactivated with ten minute incubation at 65 C.
[0237] 5 L of the ligation mixture was transformed into electro-competent cells of a thiC negative strain of E. coli JW3958-1 [thiC765(del)::kan (Baba et al, 2006, Mol. Syst. Biol., 2: 1-11)] obtained from the Coli Genetic Stock Centre (CGSC). After regeneration in LB media for 30 mins, cells were washed twice and selection was carried out using the thiC gene as selectable marker in M9 medium (Table 10) without thiamine. Colony formation took 2-3 days, and all screened colonies were positive, without any background growth. This is important when using as selectable marker and was surprisingly enabled by special treatment of cells such as washing the cells after regeneration. When expressing plant thiC gene using an antibiotic selectable marker in E. coli, significant background growth was observed (Kong et al., 2008, Cell Research 18: 566-576).
[0238] Presence of the plasmid was confirmed using colony PCR (Intron iTaq PCR premix). The PCR conditions were: 94 for three minutes, followed by thirty two cycles of denaturation (94 C. for 30 s), annealing (53 C. for 30 s), and extension (72 C. for 3 minutes). A final seven minute extension step at 72 C. completed the amplification of the 3063 bp fragment. The presence of the insert and plasmid was also confirmed using restriction digestion with NdeI (NEB) giving two bands (4269 bp and 2325 bp). The insert of the plasmid was fully sequenced to confirm sequence identity.
TABLE-US-00010 TABLE 10 M9 minimal media Concentration per Media component 1.0 L of media M9 Salts (see below) 200 ml 1M MgSO.sub.4 2 ml 20% glucose 20 ml 1M CaCl.sub.2 100 l Distilled water To 1 L M9 Salts per L of Stock Na.sub.2HPO.sub.4 64 g KH.sub.2PO.sub.4 15 g NaCl 2.5 g NH.sub.4Cl 5 g Distilled water To 1 L
Use of thiC as Selectable Marker in C. autoethanogenum
[0239] Prior to transformation in C. autoethangenum, plasmid DNA was in vivo methylated using E. coli strain XL1Blue MRF and methylation plasmid pGS20 (SEQ ID NO: 13) carrying a designed methyltransferase (SEQ ID NO: 14) under control of an inducible lac promoter (SEQ ID NO: 15) as described in WO 2012/053905. Methylated plasmid DNA was purified using the PureLink HiPure Plasmid Purification Kit (Life Technologies). Cells were growing up in PET media (Table 9) with thiamine plus 1 g/L yeast extract and 5 g/L fructose plus steel-mill gas as carbon and energy source. A 50 mL culture of C. autoethanogenum DSM23693 was subcultured to fresh media for 3 consecutive days. These cells were used to inoculate 50 ml PETC media containing 40 mM DL-threonine at an OD.sub.600nm of 0.05. When the culture reached an OD.sub.600nm of 0.4, the cells were transferred into an anaerobic chamber and harvested at 4,700g and 4 C. The culture was twice washed with ice-cold electroporation buffer (270 mM sucrose, 1 mM MgCl2, 7 mM sodium phosphate, pH 7.4) and finally suspended in a volume of 600 l fresh electroporation buffer. This mixture was transferred into a pre-cooled electroporation cuvette with a 0.4 cm electrode gap containing 1 g of the methylated plasmid mix and immediately pulsed using the Gene pulser Xcell electroporation system (Bio-Rad) with the following settings: 2.5 kV, 600, and 25 F. Time constants of 3.7-4.0 ms were achieved. Regeneration was carried out in 5 mL PETC media that has 10 g/L MES (2-(N-morpholino) ethanesulfonic acid) as buffer.
[0240] Cells were then either plated out on PETC-MES solid media (1.2% Bacto Agar) with thiamine and yeast extract and also 5 g/mL clarithromycin as selectable agent, or washed twice and plated on PETC-MES solid media without yeast extract and without thiamine. In both cases, over 50 positive colonies carrying the plasmid were obtained per plate, after 3 days using clarithromycin as selectable agent and ermC as selectable marker and after 6 days on plates without yeast extract and thiamine using thiC as selectable marker.
Growth of C. autoethanogenum Engineered with thiC in Absence of Thiamine
[0241] Single colonies were picked and growth experiments were performed to compare growth in PETC media without thiamine and yeast extract and steel mill gas as sole energy and carbon source using C. autoethanogenum DSM23693 wild-type and strain carrying plasmid pMTL85246-thiC-purF. While growth of the wild-type ceased after two subculture steps (or within one subculture step if the cells were washed before inoculation), the strain carrying plasmid pMTL85246-thiC-purF was able to grow sustainable for multiple subculturing steps (regardless if the cells have been washed or not) (
[0242] This demonstrates that the organism is able to synthesize thiamine by itself and thiC can be used as selectable marker in carboxydotrophic acetogen C. autoethanogenum.
Use of panBCD as Selectable Marker
[0243] The inventors have identified that C. autoethanogenus, C. ljungdahlii and C. ragsdalei have an incomplete panthothenate pathway lacking biosynthetic genes panBCD, encoding a 3-methyl-2-oxobutanoate hydroxymethyltransferase (EC:2.1.2.11; catalyzing conversion of 5,10-Methylenetetrahydrofolate and 3-Methyl-2-oxobutanoic acid to Tetrahydrofolate and 2-Dehydropantoate), pantoate-beta-alanine ligase (EC:6.3.2.1; catalyzing the reaction of (R)-Pantoate+beta-Alanine to Diphosphate+Pantothenate), and aspartate 1-decarboxylase (EC:4.1.1.11; catalyzing the conversion of L-Aspartate to beta-Alanine). In other acetogens such as Acetobacterium woodii, whose genome (Poehlein et al, 2012, PLoS One 7: e33439), genes panB and panC were also found to be absent, while the rest of the panthothenate biosynthesis pathway is present.
[0244] The same principle as for thiC and thiamine as selectable marker and agent may be applied for panBCD and panthothenate in these organisms. While in case of thiC only one gene is required, here three genes are missing. However, all three genes have been found to be organized in one cluster in for example C. beijerinckii (
Cloning of panBCD
[0245] panBCD genes were cloned into an expression vector using GeneArt Seamless Cloning and Assembly kit (Life Technologies). Large PCR primers containing a 20 bp overhang homology to the desired vector were designed.
TABLE-US-00011 Primer sequence panBCD- AGGAAATGAACATGAAACATGTGAAAAATACAGTATTAACTT 83155- TTAAACAAG(SEQIDNO:16) F1 panBCD- GACGTCGACTCTAGAGGATCTTATTCATTTGATTCATAATTA GeneD- GTTATTTCTTTTATTG(SEQIDNO:17) R1
[0246] The panBCD sequence was PCR amplified using iProof high fidelity DNA polymerase from C. beijerinckii. The protocol to amplify the 2813 bp fragment was: Initialisation 30 s, Danturation 10 s, annealing 30 s, Extension 2 minutes, and a final extension step of 7 minutes.
[0247] The DNA was purified using DNA Clean and Concentrator-5 (Zymo Research). pMTL vector 83155 carrying the catP antibiotic resistance marker along with the Ppta promoter was digested using NdeI and BamHI (Fermentas) and purified using DNA Clean and Concentrator-5 (Zymo Research). 100 ng of the digested vector was mixed with a 2:1 molar ratio of insert, along with 5 reaction buffer and 10 Enzyme mix. The mixture was incubated at room temperature for 30 minutes and immediately transformed into One Shot TOP10 E. coli competent cells. 50 L of transformed E. coli was spread on LB agar plates containing 5 g/ml chloramphenicol. Four colonies were screened using iNtron Maxime PCR PreMix i-MAX II (Tech Dragon Limited) from an overnight incubation
TABLE-US-00012 Primer sequence M13F TGTAAAACGACGGCCAGT(SEQIDNO:18) M13R CAGGAAACAGCTATGACC(SEQIDNO:19)
[0248] The protocol to amplify the 3404 bp fragment was: Initialisation 30 s, Danturation 10 s, annealing 30 s, Extension 2 minutes, and a final extension step of 7 minutes.
[0249] The four plasmids were further checked by restriction digests using NotI and EcoRV (fermentas). Expected sizes from digestion: 2343 bp and 5383 bp, undigested plasmid: 7726 bp
[0250] The invention has been described herein, with reference to certain preferred embodiments, in order to enable the reader to practice the invention without undue experimentation. However, a person having ordinary skill in the art will readily recognise that many of the components and parameters may be varied or modified to a certain extent or substituted for known equivalents without departing from the scope of the invention. It should be appreciated that such modifications and equivalents are herein incorporated as if individually set forth. Titles, headings, or the like are provided to enhance the reader's comprehension of this document, and should not be read as limiting the scope of the present invention.
[0251] The entire disclosures of all applications, patents and publications, cited above and below, if any, are hereby incorporated by reference. However, the reference to any applications, patents and publications in this specification is not, and should not be taken as, an acknowledgment or any form of suggestion that they constitute valid prior art or form part of the common general knowledge in any country in the world.
[0252] Throughout this specification and any claims which follow, unless the context requires otherwise, the words comprise, comprising and the like, are to be construed in an inclusive sense as opposed to an exclusive sense, that is to say, in the sense of including, but not limited to.