LAUNDRY WASTEWATER BIOLOGICAL TREATMENT PREPARATION, AND DEVICE AND METHOD FOR TREATING LAUNDRY WASTEWATER BY USING SAME

20170015577 ยท 2017-01-19

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention includes: a laundry wastewater tank that temporarily stores laundry wastewater from a plant facility; a biological treatment tank in which the laundry wastewater from the laundry wastewater tank is aerated and mixed with activated sludge; a treated water tank that stores the treated laundry wastewater that has been biologically treated; and a treatment preparation supplying device that supplies a laundry wastewater biological treatment preparation to the biological treatment tank. The laundry wastewater biological treatment preparation is introduced when a change in water quality that deteriorates the biological treatment in the biological treatment tank is detected. Thus, biological treatment can be performed stably.

Claims

1. A laundry wastewater biological treatment preparation, for being added to activated sludge for treating laundry wastewater that has been used to wash used clothing of plant workers or used cloth, the laundry wastewater biological treatment preparation being a freeze-dried sludge obtained by freeze-drying a laundry wastewater-acclimatized activated sludge that has been acclimatized using the laundry wastewater.

2. The laundry wastewater biological treatment preparation according to claim 1, wherein the freeze-dried sludge includes the genus Sphingomonas and related genera thereof, all of which have sphingolipids in the surface layer of the bacteria.

3. The laundry wastewater biological treatment preparation according to claim 1, wherein a protective agent is added to the freeze-dried sludge.

4. A device for treating laundry wastewater, comprising: a laundry wastewater tank that temporarily stores laundry wastewater from a plant facility; a biological treatment tank in which laundry wastewater from the laundry wastewater tank is aerated and mixed with activated sludge and is biologically treated; a treated water tank that stores treated laundry wastewater that has been biologically treated; and a supplying device that supplies the laundry wastewater biological treatment preparation according to claim 1 to the biological treatment tank.

5. The device for treating laundry wastewater according to claim 4, further comprising: a control device that introduces the laundry wastewater biological treatment preparation when a change in water quality that deteriorates the biological treatment in the biological treatment tank is detected.

6. The device for treating laundry wastewater according to claim 4, further comprising: a first COD measurement device that measures the COD in the laundry wastewater tank; and a control device that introduces the laundry wastewater biological treatment preparation into the biological treatment tank based on measurement results of the first COD measurement device.

7. The device for treating laundry wastewater according to claim 4, further comprising: a second COD measurement device that measures the COD in the treated laundry wastewater that has been biologically treated in the biological treatment tank; and a control device that introduces the laundry wastewater biological treatment preparation into the biological treatment tank based on measurement results of the second COD measurement device.

8. The device for treating laundry wastewater according to claim 4, further comprising: a bacterial flora analyzer that analyzes the genus Sphingomonas and related genera thereof in the biological treatment tank; and a control device that introduces the laundry wastewater biological treatment preparation based on analysis results of the bacterial flora analyzer.

9. The device for treating laundry wastewater according to claim 4, further comprising: means for extracting activated sludge from the biological treatment tank; and a freeze-drying device that freeze-dries the extracted activated sludge and thereby produces a laundry wastewater biological treatment preparation.

10. The device for treating laundry wastewater according to claim 9, wherein the laundry wastewater biological treatment preparation produced in the freeze-drying device is supplied to the supplying device.

11. A method for treating laundry wastewater, the method comprising introducing the laundry wastewater biological treatment preparation when a change in water quality that deteriorates the biological treatment in the biological treatment tank is detected, using the device for treating laundry wastewater according to claim 4.

12. The method for treating laundry wastewater according to claim 11, wherein the change in water quality that deteriorates the biological treatment in the biological treatment tank is determined by measuring the COD in the laundry wastewater tank.

13. The method for treating laundry wastewater according to claim 11, wherein the change in water quality that deteriorates the biological treatment in the biological treatment tank is determined by measuring the COD in the treated laundry wastewater that has been biologically treated in the biological treatment tank.

14. The method for treating laundry wastewater according to claim 11, wherein the change in water quality that deteriorates the biological treatment in the biological treatment tank is determined by analyzing the genus Sphingomonas and related genera thereof in the biological treatment tank.

15. The laundry wastewater biological treatment preparation according to claim 2, wherein a protective agent is added to the freeze-dried sludge.

16. A device for treating laundry wastewater, comprising: a laundry wastewater tank that temporarily stores laundry wastewater from a plant facility; a biological treatment tank in which laundry wastewater from the laundry wastewater tank is aerated and mixed with activated sludge and is biologically treated; a treated water tank that stores treated laundry wastewater that has been biologically treated; and a supplying device that supplies the laundry wastewater biological treatment preparation according to claim 2 to the biological treatment tank.

17. A device for treating laundry wastewater, comprising: a laundry wastewater tank that temporarily stores laundry wastewater from a plant facility; a biological treatment tank in which laundry wastewater from the laundry wastewater tank is aerated and mixed with activated sludge and is biologically treated; a treated water tank that stores treated laundry wastewater that has been biologically treated; and a supplying device that supplies the laundry wastewater biological treatment preparation according to claim 3 to the biological treatment tank.

18. The device for treating laundry wastewater according to claim 5, further comprising: means for extracting activated sludge from the biological treatment tank; and a freeze-drying device that freeze-dries the extracted activated sludge and thereby produces a laundry wastewater biological treatment preparation.

19. The device for treating laundry wastewater according to claim 6, further comprising: means for extracting activated sludge from the biological treatment tank; and a freeze-drying device that freeze-dries the extracted activated sludge and thereby produces a laundry wastewater biological treatment preparation.

20. The device for treating laundry wastewater according to claim 7, further comprising: means for extracting activated sludge from the biological treatment tank; and a freeze-drying device that freeze-dries the extracted activated sludge and thereby produces a laundry wastewater biological treatment preparation.

Description

BRIEF DESCRIPTION OF DRAWINGS

[0027] FIG. 1 is an outline diagram of a device for treating laundry wastewater related to Example 1.

[0028] FIG. 2 is a photograph of freeze-dried sludge, to which no protective agent was added.

[0029] FIG. 3 is a photograph of freeze-dried sludge, to which a protective agent was added.

[0030] FIG. 4A is a photograph showing settleability of sludge before acclimatization.

[0031] FIG. 4B is a photograph showing settleability of sludge after completion of acclimatization.

[0032] FIG. 5 is a diagram illustrating an example of a testing device for a wastewater treatment test.

[0033] FIG. 6 is a diagram illustrating the relationship between the elapsed time (horizontal axis), the COD (left vertical axis; ppm), and the treatment ratio (right vertical axis; %) in an acclimatization treatment that uses a sewage seed sludge of related art.

[0034] FIG. 7 is a diagram illustrating the relationship between the elapsed time (horizontal axis), the COD (left vertical axis; ppm), and the treatment ratio (right vertical axis; %) in an acclimatization treatment to which the freeze-dried sludge of the present example was added.

[0035] FIG. 8 is a diagram illustrating the compositional ratio of principal microorganisms in a sewage sludge acclimatization treatment of related art.

[0036] FIG. 9 is a diagram illustrating the compositional ratio of principal microorganisms in a sewage sludge acclimatization treatment carried out using a freeze-dried activated sludge.

[0037] FIG. 10 is a diagram illustrating the results of a bacterial flora analysis for an activated sludge that has been used to treat laundry wastewater.

[0038] FIG. 11 is a diagram illustrating the results of a bacterial flora analysis for a commercially available microorganism preparation.

[0039] FIG. 12 is a diagram illustrating the results of a specificity identification test using a detection primer for detecting main activated sludge microorganisms using DNA for determination.

[0040] FIG. 13 is a diagram illustrating measurement of the principal microorganism ratio using real-time PCR.

[0041] FIG. 14 is an outline diagram of a device for treating laundry wastewater related to Example 2.

[0042] FIG. 15 is an outline diagram of a device for treating laundry wastewater related to Example 3.

[0043] FIG. 16 is an outline diagram of a device for treating laundry wastewater related to Example 4.

[0044] FIG. 17 is an outline diagram of a device for treating laundry wastewater related to Example 5.

DESCRIPTION OF EMBODIMENTS

[0045] Hereinafter, suitable embodiments of the invention will be described in detail with reference to the attached drawings. The invention is not intended to be limited to these embodiments, and in a case in which there are a number of embodiments, the invention also includes a configuration of combining various embodiments.

Example 1

[0046] FIG. 1 is an outline diagram of a device for treating laundry wastewater related to Example 1.

[0047] As illustrated in FIG. 1, a device for treating laundry wastewater 10A related to the present example is a device including a laundry wastewater tank 12 that temporarily stores laundry wastewater 11 from, for example, a plant facility such as a nuclear power facility; a biological treatment tank 14 in which the laundry wastewater 11 from this laundry wastewater tank 12 is aerated and mixed with activated sludge and is biologically treated; a treated water tank 16 that stores treated laundry wastewater 15 that has been biologically treated; and a treatment preparation supplying device 22 that supplies a laundry wastewater biological treatment preparation 21 to the biological treatment tank 14.

[0048] In the present example, a first COD measurement device 19-1 that measures the COD in the laundry wastewater tank 12 in order to detect a change in water quality that deteriorates the biological treatment, and a control device 17 that introduces a laundry wastewater biological treatment preparation 21 into the biological treatment tank 14, based on the measurement results of the first COD measurement device 19-1, are provided.

[0049] Furthermore, at the initiation of the biological treatment tank 14, a laundry wastewater biological treatment preparation 21 is introduced so as to accelerate acclimatization of activated sludge in the biological treatment tank.

[0050] Here, the laundry wastewater biological treatment preparation 21 of the present example is a laundry wastewater biological treatment preparation that is added to the sludge of the biological treatment tank 14 for treating laundry wastewater 11 that has been used to wash used clothing of plant workers or used cloth. The laundry wastewater biological treatment preparation 21 is a freeze-dried sludge that is formed by freeze-drying a laundry wastewater-acclimatized activated sludge 13 that has been acclimatized using laundry wastewater 11.

[0051] It is particularly preferable that this freeze-dried sludge includes the genus Sphingomonas and related genera thereof, all of which have sphingolipids in the surface layer of the bacteria.

[0052] Examples of this genus Sphingomonas and related genera thereof include, but are not limited to, Sphingomonas, Novosphingobium, Sphingobium, and Sphingopyxis.

[0053] Furthermore, when the freeze-drying treatment is performed, a protective agent may be added so as to attempt protection of the freeze-dried sludge. Here, examples of the protective agent include, for example, glycerin, dimethyl sulfoxide, sodium glutamate, starch, and skimmed milk.

[0054] The freeze-drying treatment may be carried out by any known technique, and an example thereof will be described here.

[0055] First, a laundry wastewater-acclimatized activated sludge 13 is collected and centrifuged using a centrifuge device (for example, 3,000 rpm for 10 minutes).

[0056] Next, a precipitate is weighed and transferred to a container for freeze-drying.

[0057] Thereafter, the precipitate is subjected to a freeze-drying treatment overnight at 20 C.

[0058] In a case in which a protective agent is used, a predetermined amount (for example, 1% to 10%) of the protective agent is introduced into the activated sludge when the activated sludge is transferred to the container for freeze-drying.

[0059] Photographs of a freeze-dried product are shown in FIG. 2 and FIG. 3.

[0060] FIG. 2 is a photograph of a freeze-dried sludge to which a protective agent has not been added, and FIG. 3 is a photograph of a freeze-dried sludge to which a protective agent was added.

[0061] These freeze-dried sludges that had been subjected to a freeze-drying treatment were both easily dispersible in water.

[0062] FIG. 4A and FIG. 4B are diagrams showing settleability of a freeze-dried sludge to which a protective agent has not been added.

[0063] FIG. 4A is a photograph showing the settleability of sludge before an acclimatization treatment, and FIG. 4B is a photograph showing the settleability of sludge after an acclimatization treatment.

[0064] Thereby, a freeze-dried sludge to which a protective agent had not been added, exhibited satisfactory settleability of the freeze-dried sludge after completion of acclimatization, compared to the settleability before the initiation of acclimatization.

[0065] As a result, since the sludge is not suspended, for example, in a case in which the activated sludge is introduced into a separation membrane, clogging of the separation membrane does not occur, which is preferable.

[0066] A wastewater treatment test was performed using this freeze-dried sludge.

[0067] FIG. 5 is a diagram illustrating an example of a testing device for a wastewater treatment test.

[0068] As illustrated in FIG. 5, a wastewater treatment testing device 50 includes an aeration unit 52 in which a predetermined amount of simulated laundry wastewater 11 is added from an addition unit 51, and oxygen (O.sub.2) is supplied to the bottom. The wastewater treatment testing device 50 also includes an aeration tank 54 having activated sludge 13, and a settling tank 56 that is in communication with this aeration tank 54 through a communicating pipe 55 on the upper side, in which the activated sludge 13 is settled. Treated laundry wastewater 15 is discharged through the top of the settling tank 56.

[0069] Here, simulated laundry wastewater 11 was operated at pH 6.5 to 8.0 and at 25 C.

[0070] Regarding the simulated laundry wastewater, a mixture of NH.sub.4Cl (N component), KH.sub.2PO.sub.4 (P component), and a detergent (including cationic and nonionic surfactants) was used.

[0071] FIG. 6 is a diagram illustrating the relationship between the elapsed time (horizontal axis), the COD (left vertical axis; ppm), and the treatment ratio (right vertical axis; %) in an acclimatization treatment using a sewage seed sludge of related art.

[0072] As in the case of related art, in a case in which sewage sludge is used and acclimatized, foaming occurs. Therefore, laundry wastewater with 180 ppm COD-Mn was used, and this was supplied intermittently. This operation was continued until foaming stopped.

[0073] In the present test, foaming continued for 12 days, and the initiation of acclimatization was on the 12.sup.th day.

[0074] Therefore, laundry wastewater with 180 ppm COD-Mn could be continuously supplied from the 12.sup.th day.

[0075] Also, since the COD concentration of the treated laundry wastewater 15 was below 20 ppm COD-Mn on the 17.sup.th day, the laundry wastewater was supplied after raising the concentration of the supplied laundry wastewater 11 to 240 ppm COD-Mn.

[0076] However, as a result of the increase in the COD concentration, the COD concentration of the treated laundry wastewater 15 did not go below 20 ppm COD-Mn until 23 days elapsed.

[0077] On the contrary, in a case in which the freeze-dried sludge of the present example is used and acclimatized, shortening of the acclimatization time could be attempted.

[0078] FIG. 7 is a diagram illustrating the relationship between the elapsed time (horizontal axis), the COD (left vertical axis; ppm), and the treatment ratio (right vertical axis; %), in an acclimatization treatment to which the freeze-dried sludge of the present example was added.

[0079] In a case in which freeze-dried sludge was used and acclimatized, in a case in which laundry wastewater with 180 ppm COD-Mn was used, the COD concentration of the treated laundry wastewater 15 could reach 20 ppm COD-Mn on the first day.

[0080] Therefore, the laundry wastewater 11 that was subsequently supplied was supplied after raising the concentration of the laundry wastewater 11 to 240 ppm COD-Mn. Even in this case, a COD concentration of 20 ppm COD-Mn of the treated laundry wastewater 15 could be continuously achieved, and therefore, the laundry wastewater 11 that was supplied on the 8.sup.th day was supplied after increasing the COD concentration of the laundry wastewater 11 to 300 ppm COD-Mn.

[0081] When it is said that this COD concentration is 300 ppm COD-Mn, this is a load concentration for actual machine application. The COD concentration of the treated laundry wastewater 15 could reach 20 ppm COD-Mn on the 14.sup.th day.

[0082] As a result, in a case in which freeze-dried sludge is supplied to the activated sludge tank, COD decomposition performance can be immediately expected.

[0083] Therefore, it was found that performing an acclimatization treatment for a long time period as in the case of performing an acclimatization treatment using seed sludge as in conventional cases, is unnecessary.

[0084] Furthermore, conventionally, in a case in which the COD concentration of laundry wastewater is, for example, above 300 ppm COD-Mn, it has been necessary to subject the laundry wastewater to a dilution treatment using a diluent before the laundry wastewater is introduced into a biological treatment tank. However, now, a buffer tank in which treatment water for such a dilution treatment is stored, or a dilution treatment is carried out, may be reduced, or even installation of a buffer tank becomes unnecessary.

[0085] Next, the composition ratios of principal microorganisms in the case of a conventional seed sludge treatment and in the case of using the freeze-dried sludge of the present example, in a case in which simulated laundry wastewater was used, were checked.

[0086] FIG. 8 is a diagram illustrating the compositional ratio of principal microorganisms in a sewage sludge acclimatization treatment of related art. Here, in FIG. 8, the bar graph represents the composition ratio (%) of principal microorganisms.

[0087] Here, the microorganisms to which attention was paid were the genus Sphingomonas and related genera thereof (Novosphingobium, Sphingobium, Sphingopyxis, and the like), and these will be described as principal microorganisms hereinafter.

[0088] In a preliminary acclimatization in which foaming occurred, the composition ratio of the principal microorganisms was several percent (%).

[0089] Thereafter, in a case in which main acclimatization was carried out, the composition ratio of the principal microorganisms increased to 5%, and in a case in which the COD concentration was increased to 240 ppm COD-Mn, the composition ratio of the principal microorganisms was only about 12%.

[0090] Furthermore, the conformity ratio (symbol in the diagram) of the treated wastewater was also decreased, after the COD concentration was raised to 240 ppm COD-Mn in the main acclimatization.

[0091] FIG. 9 is a diagram illustrating the compositional ratio of principal microorganisms in a sewage sludge acclimatization treatment using freeze-dried activated sludge. Here, in FIG. 9, the bar graph represents the composition ratio of the principal microorganisms. As illustrated in FIG. 9, the composition ratio of the principal microorganisms increased synchronically with the treatment capacity.

[0092] Then, it was confirmed that the wastewater treatment capacity conformed to the input COD concentration from the 14.sup.th day.

[0093] FIG. 10 is a diagram illustrating the results of a bacterial flora analysis for an activated sludge that has been used to treat laundry wastewater. FIG. 11 is a diagram illustrating the results of a bacterial flora analysis for a commercially available microorganism preparation.

[0094] As illustrated in FIG. 10, it was confirmed that three kinds of microorganisms of the genus Sphingomonas occupied about a half of the composition ratio.

[0095] Here, in FIG. 10, microorganism a represents Sphingomonas, microorganism b represents Sphingobium, and microorganism c represents Sphingopyxis.

[0096] In FIG. 11, in the commercially available microorganism preparation, microorganisms of the genus Pseudomonas, designated as microorganism d, occupied 90% of the composition ratio.

[0097] FIG. 12 is a diagram illustrating the results of a specificity identification test using a detection primer for the detection of the principal microorganisms of activated sludge for laundry wastewater using a DNA for determination.

[0098] Table 1 shows the detection primers for the genus Sphingomonas and related genera thereof (Novosphingobium, Sphingobium, and Sphingopyxis).

[0099] Table 2 shows forward primers and reverse primers of the detection primers (SPG5 to SPG9).

[0100] Table 3 shows a gene sequence that was obtained by obtaining consensus sequences (results of automatic production of consensus sequences using BIOEDIT), which were obtained from 16S rDNA gene alignment analysis of the microorganisms of the genus Sphingomonas and related genera, subsequently comparing these consensus sequences with the alignment results, and deleting the portions that needed to be deleted for having very low commonality.

[0101] A PCR primer for detection using these gene sequences (SPG7: underlined) are shown below.

TABLE-US-00001 TABLE 1 Primer Determination criteria corresponding Evaluation of PCR product Reaction with name PCR product length Escherichia coli Univ. B present SPG1 C B B 107 absent SPG5 B B B 205 absent SPG6 B B B 207 absent SPG7 A B B 292 absent SPG8 B B B 211 absent SPG9 C B B 87 absent

TABLE-US-00002 TABLE2 Primer Sequence corresponding No. Primer name 1 F1 GTGCGTAACGCGTGGGA SPG5 2 R1 GTGTCTCAGTCCCAGTGTGG 3 F2 GGTGCGTAACGCGTGGG SPG6 4 R2 CGTGTCTCAGTCCCAGTGTG 5 F3 GGGTGCGTAACGCGTGG SPG7 6 R3 TTCATCACTCACGCGGCATT 7 F4 GCGCACGGGTGCGTAA SPG8 8 R4 GTCTCAGTCCCAGTGTGGC 9 F5 TGGCTCAGAACGAACGCTG SPG9 10 R5 CGCGTTACGCACCCGT (Base sequence 5.fwdarw. 3)

TABLE-US-00003 TABLE3 AGAGTTTGATCHTTGGCGTCAGAACGAACGCTGGCGGCATGCCTAAYACA TGCAAGTCGAACCADNHCTTCGGDBBTAGTGGCGCAC custom-character AATCTRCCCTTKGSTDCGGAATAACHNNBDG AAAYBDVWGCTAATACCGNATDATGWCGTHVGHCCAAAGATTTATCGSC MAVGGATGAGCCCGCGTARGATTAGVTAGTTGGTGRGGTAAAVGCBHAC CAAGSCKACGATCYTTAGCTGGTCTGAGAGGATGATCACCCACACTGGG ACTGAGACACGGCCCAGACTCCTACGGGAGGCAGCAGTDGGGAATATTG GACAATGGGCGVAAGCCTGATCCAGCcustom-character GCCYTNGGTHGTAAAGCTCTTTTACCNGDGATGATAATGACATACBGGA GAATAAGCYCCGCTAACTYCGTGGCAGCVGCCGCGGTAATT

[0102] Lanes 1 to 7 show the cases in which laundry wastewater sludge was used, and Lanes 8 to 14 show the cases in which Escherichia coli was used. Lane 15 has water only.

[0103] A universal primer was used in Lane 1; SPG1 primer was used in Lane 2; SPG5 primer was in Lane 3; SPG6 primer was used in Lane 4; SPG7 primer was used in Lane 5; SPG8 primer was used in Lane 6; and SPG9 primer was used in Lane 7. Furthermore, a universal primer was used in Lane 8; SPG1 primer was used in Lane 9; SPG5 primer was used in Lane 10; SPG6 primer was used in Lane 11; SPG7 primer was used in Lane 12; SPG8 primer was used in Lane 13; SPG9 primer was used in Lane 14; and a universal primer was used in Lane 15.

[0104] FIG. 13 is a diagram showing the measurement results of the principal microorganism composition using real-time PCR.

[0105] A DNA amplification test was carried out in a real-time PCR device, using a universal primer that can amplify DNA in all kinds of microorganisms, and a specific primer that can amplify DNA in specific microorganisms (genus Sphingomonas, genus Novosphingobium, genus Sphingobium, and genus Sphingopyxis) only (SPG7 of Lane 5).

[0106] As shown in FIG. 13, the initial amounts of DNA are estimated (Fragment I and Fragment II) from an amplification curve for the PCR primer for analyzing specific microorganisms (solid line) and an amplification curve for the PCR primer for analyzing general microorganisms (dot-dash line), and the compositional ratio of principal microorganisms is calculated.

[0107] The calculation is based on the following:


Existence ratio (%)=DNA of specific microorganisms (Fragment I)/(DNA of all microorganisms (Fragment II)+1.4)100=46.6%

[0108] Therefore, a bacterial flora analysis of the biological treatment tank 14 can be rapidly carried out using this real-time PCR device.

[0109] From the above results, in the present example, the treatment process in the biological treatment tank is not carried out such that activated sludge is acclimatized for a long time period using conventional seed sludge, but acclimatization can be carried out rapidly using freeze-dried sludge.

[0110] Regarding the case of applying this laundry wastewater biological treatment preparation 21 of freeze-dried sludge, the laundry wastewater biological treatment preparation 21 can be used at the time of starting up the biological treatment tank 14 prior to a wastewater treatment, instead of supplying conventional seed sludge.

[0111] Furthermore, during the operation, the treatment can be carried out while checking the COD concentration of the laundry wastewater 11.

[0112] In a case in which a plant has been stopped for a long time period, since the bacterial flora in the biological treatment tank 14 undergoes a change, at the time of start-up after this stoppage, the laundry wastewater biological treatment preparation 21 of the present example may be added to the biological treatment tank 14.

[0113] At this time, the laundry wastewater biological treatment preparation 21 may be supplied while inspecting the status of bacterial flora, by checking the bacterial flora in the biological treatment tank 14 using a bacterial flora device such as a real-time PCR device. The bacterial flora device has been explained using a real-time PCR device; however, the invention is not intended to be limited to this, and any known device that can analyze the status of bacterial flora can all be applied.

[0114] Furthermore, even in a case in which aeration has been brought to a stop due to power failure or the like, the situation can be rapidly coped with by adding the laundry wastewater biological treatment preparation 21 to the biological treatment tank 14.

[0115] As such, according to the present example, for example, in a case in which laundry wastewater that has been used for washing, for example, working clothes or used cloth in a nuclear facility or a general plant facility, is subjected to decomposition, a biological treatment can be stably carried out by introducing a laundry wastewater biological treatment preparation, when a change in water quality that deteriorates the biological treatment in a biological treatment tank of activated sludge is detected.

Example 2

[0116] FIG. 14 is an outline diagram of a laundry wastewater treatment device related to Example 2.

[0117] As illustrated in FIG. 14, in the laundry wastewater treatment device 10B related to the present example, a second COD measurement device 19-2 that measures the COD in the treated laundry wastewater 15 that has been biologically treated in the biological treatment tank 14 is further provided to the laundry wastewater treatment device 10A of Example 1, and the laundry wastewater biological treatment preparation 21 is introduced to the biological treatment tank 14 by a control device 17 based on the measurement results of the second COD measurement device 19-2.

[0118] As a result, conventionally, in a case in which the COD in the treated laundry wastewater 15 is higher than the standard value for discharged water 18 (for example, 20 ppm COD-Mn), there has been a need to separately dilute the laundry wastewater 11 that is supplied to the biological treatment tank 14. However, in the present example, since the situation can be coped with by supplying the laundry wastewater biological treatment preparation 21 to the biological treatment tank 14, such a dilution treatment as in conventional cases may be reduced, or may become unnecessary, and thus, reduction of the cost of initially facilities installation of plant and running equipment can be promoted.

Example 3

[0119] FIG. 15 is an outline diagram of a laundry wastewater treatment device related to Example 3.

[0120] As illustrated in FIG. 15, in the laundry wastewater treatment device 10C related to the present example, a bacterial flora analyzer (for example, real-time PCR analyzer) 25 that analyzes the genus Sphingomonas and related genera thereof in the biological treatment tank 14 is further provided to the laundry wastewater treatment device 10B of Example 2. The laundry wastewater biological treatment preparation 21 is introduced into the biological treatment tank 14 by the control device 17 based on the analysis results of this bacterial flora analyzer (real-time PCR analyzer) 25, and the compositional ratio of principal microorganisms of the biological treatment tank 14 can be increased.

[0121] As a result, the problem of operating the device by the course of nature as in conventional cases is solved, and stable operation of a biological treatment plant is enabled.

Example 4

[0122] FIG. 16 is an outline diagram of a laundry wastewater treatment device related to Example 4.

[0123] As illustrated in FIG. 16, in the laundry wastewater treatment device 10D related to the present example, an extraction line 31, which is an extraction means for extracting activated sludge 13 from the biological treatment tank 14, and a freeze-drying device 32 that freeze-dries this extracted activated sludge 13 and produces a laundry wastewater biological treatment preparation 21, are included in the laundry wastewater treatment device 10B of Example 2.

[0124] Thereby, the laundry wastewater biological treatment preparation 21 can be produced within a biological treatment plant facility, and if needed, the laundry wastewater biological treatment preparation 21 can be quickly supplied from a treatment preparation supplying device 22.

[0125] As a result, it is not necessary to stock a large amount of the laundry wastewater biological treatment preparation 21, and constantly stable operation of biological treatment plants is enabled.

Example 5

[0126] FIG. 17 is an outline diagram of a laundry wastewater treatment device related to Example 5.

[0127] As illustrated in FIG. 17, in the laundry wastewater treatment device 10E related to the present example, a freeze-drying device 32 that produces the laundry wastewater biological treatment preparation 21 by freeze-drying the extracted activated sludge 13 of the laundry wastewater treatment device 10D of Example 4, is provided, and this produced laundry wastewater biological treatment preparation 21 is used in a in-house plant and is also supplied to the outside 40 for sales and distribution.

[0128] The laundry wastewater biological treatment preparation 21 obtainable by this freeze-drying device 32 can be directly applied to similar laundry wastewater treatment biological treatment devices. Therefore, the preparation can be supplied to, for example, wastewater treatment plants in the outside, where a biological treatment is performed on laundry wastewater in which similar detergents (including cationic and nonionic surfactants) were used.

[0129] For example, in a case in which there is a demand for an urgent increase in the biological treatment performance (for example, stoppage of aeration in a biological treatment tank caused by power failure or the like), a technique of transporting activated sludge in the form of sludge by means of a vacuum truck or the like has been conventionally adopted. However, this transportation in the form of sludge has problems that 1) the personnel expenses and the cost for vehicle rental and the like increase; 2) during the summer season or the like, a chilling means and the like are needed at the time of conveyance, and in the case of long-distance transportation, there is also a need for an aeration treatment to be appropriately carried out, so that there is a high risk of deteriorating the sludge quality.

[0130] In this regard, since the laundry wastewater biological treatment preparation 21 obtainable by the freeze-drying device 32 has a reduced volume, and storage and transportation of the preparation are easily achieved, sludge can be supplied to other wastewater treatment plants where biological treatments are performed on wastewater in which similar detergents (including cationic and nonionic surfactants) have been used, at low cost with low risk.

REFERENCE SIGNS LIST

[0131] 10A to 10E LAUNDRY WASTEWATER TREATMENT DEVICE [0132] 11 LAUNDRY WASTEWATER [0133] 12 LAUNDRY WASTEWATER TANK [0134] 13 ACTIVATED SLUDGE [0135] 14 BIOLOGICAL TREATMENT TANK [0136] 15 TREATED LAUNDRY WASTEWATER [0137] 16 TREATED WATER TANK [0138] 18 DISCHARGED WATER [0139] 19-1 FIRST COD MEASUREMENT DEVICE [0140] 19-2 SECOND COD MEASUREMENT DEVICE [0141] 21 LAUNDRY WASTEWATER BIOLOGICAL TREATMENT PREPARATION [0142] 22 TREATMENT PREPARATION SUPPLYING DEVICE [0143] 31 EXTRACTION LINE [0144] 32 FREEZE-DRYING DEVICE