TRADITIONAL CHINESE MEDICINE-BASED AGENT FOR CACHEXIA PREVENTION AND TREATMENT

20230120360 · 2023-04-20

Assignee

Inventors

Cpc classification

International classification

Abstract

This invention discloses a traditional Chinese medicine, Mu Dan Pi (Moutan radicis cort), that has the potential to be used for the prevention or treatment of cachexia and muscle loss in cancer patients. The composition is a novel therapeutic agent for cachexia.

Claims

1. A method of treating or preventing cancer-induced cachexia, comprising the administration of effective amounts of a composition to a subject with cancer-induced cachexia, wherein the composition comprises a Moutan radicis cort or a Moutan radicis cort extract.

2. The method of claim 1, wherein the Moutan radicis cort extract is prepared by soaking the Moutan radicis cort in 50% to 100% methanol or 50% to 100% ethanol.

3. The method of claim 2, wherein the Moutan radicis cort extract is prepared by soaking the Moutan radicis cort in 70% methanol or 70% ethanol.

4. A method of treating or preventing cancer-induced skeletal muscle weight losses, comprising the administration of effective amounts of a composition to a subject with cancer-induced muscle atrophy or muscle weight loss, wherein the composition comprises a Moutan radicis cort or a Moutan radicis cort extract.

5. The method of claim 4, wherein the Moutan radicis cort extract is prepared by soaking the Moutan radicis cort in 50% to 100% methanol or 50% to 100% ethanol.

6. The method of claim 5, wherein the Moutan radicis cort extract is prepared by soaking the Moutan radicis cort in 70% methanol or 70% ethanol.

7. The method of claim 4, wherein the composition upregulates the muscle homeostasis-associated gene, comprising Cc121a, Cc112, Lep, Kera, Tmem233, Chad, Ky, Clip, Mett121e, Mylk4, Kcng4, Plcd4, Vwa3b, Plin1, Casq1, Itgb6, Tnmd, Syp12, Mss51, Mett121c. 27 or combination thereof to reduce cancer-induced muscle atrophy.

8. The method of claim 4, wherein the composition downregulates the muscle homeostasis-associated gene, comprising Aldh8a1, Lcn2, Mt2, Dnase1, Mt1, Slc39a14, Nyx, Krt80, Serpina3m, Kcnk5, Cxcl13, Adamts2, Ampd3, Fah, Doc2b, Acox2, Myo1a, Itpkc, Acss1, Igfbp3. or combination thereof to reduce cancer-induced muscle atrophy.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0013] FIGS. 1A-1C illustrate the effects of DMSO and different TCMs on C26CM-induced C2C12 myotube atrophy. FIG. 1A illustrates the experimental procedure for C26CM-induced atrophy of C2C12 myotubes. FIG. 1B illustrates the effects of DMSO and H3-14 on C26CM-induced atrophy of C2C12 myotubes. FIG. 1C illustrates myotube diameter of C26CM-induced C2C12 treated with different TCMs.

[0014] FIG. 2 illustrates the lack of protective effect of 24 TCM extracts on C26CM-induced atrophy of C2C12 myotubes.

[0015] FIGS. 3A-3D illustrate the time-dependent effects of MDP versus DR on age-associated mobility and/or total body contraction in C. elegans. FIG. 3A illustrates the mobility of C. elegans treated with DR. FIG. 3B illustrates the mobility of C. elegans treated with MDP. FIG. 3C illustrates the mobility of C. elegans treated with 100 μg/ml MDP. FIG. 3D illustrates the relative total body contraction in C. elegans treated with 100 μg/ml MDP.

[0016] FIGS. 4A-4E illustrate the effects of MDP with three different doses (MDP-L, MDP-M, and MDP-H) versus vehicle via oral gavage on the body weight, tumor volume, protecting hindlimb muscles of C-26 tumor-bearing mice, and the alert and active phenotype of C-26 tumor-bearing mice. FIG. 4A illustrates the change of body weight of C-26 tumor-bearing mice treated with three different doses of MDP. FIG. 4B illustrates the change of body weight w/o tumor of C-26 tumor-bearing mice treated with three different doses of MDP.

[0017] FIG. 4C illustrates the tumor volume of C-26 tumor-bearing mice treated with three different doses of MDP. FIG. 4D illustrates mean of mass normalized to control on three different sections of skeletal muscles (Quad, GC, and TA) of hindlegs of C-26 tumor-bearing mice treated with three different doses of MDP. FIG. 4E illustrates the alert and active phenotype of C-26 tumor-bearing mice treated with three different doses of MDP.

[0018] FIGS. 5A-5C illustrate the effects of DR with 100 mg/kg versus vehicle via oral gavage on body weight (w/o tumor) and tumor volume. FIG. 5A illustrates the change in body weight w/o tumor of C-26 tumor-bearing mice treated with 100 mg/kg DR. FIG. 5B illustrates the photograph of C-26 tumor-bearing mice treated with three different treatments (w/o tumor, vehicle, and DR). FIG. 5C illustrates tumor volume of C-26 tumor-bearing mice treated with 100 mg/kg DR.

[0019] FIGS. 6A-6F illustrate a duplicate experiment showing the effects of MDP with 1000 mg/kg (MDP-H) versus vehicle via oral gavage on the body weight, tumor volume, its ability to diminish cachexia-associated decreases in skeletal muscle weights, rescuing the fiber size distribution from shifting to smaller cross-sectional areas, and restore the forelimb grip strength at day 17 of C-26 tumor-bearing mice. FIG. 6A illustrates the change in body weight of C-26 tumor-bearing mice treated with 1000 mg/kg MDP (MDP-H). FIG. 6B illustrates the change in body weight w/o tumor of C-26 tumor-bearing mice treated with 1000 mg/kg MDP (MDP-H). FIG. 6C illustrates tumor volume of C-26 tumor-bearing mice treated with 1000 mg/kg MDP (MDP-H). FIG. 6D illustrates mean of mass normalized to control on three different sections of skeletal muscles (Quad, GC, and TA) of hindlegs of C-26 tumor-bearing mice treated with 1000 mg/kg MDP (MDP-H). FIG. 6E illustrates muscle fiber size of C-26 tumor-bearing mice treated with 1000 mg/kg MDP (MDP-H). FIG. 6F illustrates the forelimb grip strength of C-26 tumor-bearing mice treated with 1000 mg/kg MDP (MDP-H).

[0020] FIGS. 7A-7C illustrate the effects of MDP on serum IL-6 in Veh-versus MDP-H-treated C26-tumor-bearing mice and its cell viability to C26 cells. FIG. 7A illustrates the mean serum IL-6 levels in the serum of C26 tumor-bearing mice treated with 1000 mg/kg MDP (MDP-H). FIG. 7B illustrates the secretion of serum IL-6 level by C26 cells treated with three treatments (DMSO, 25 μg/ml MDP, and 50 μg/ml MDP). FIG. 7C illustrates cell viability of C26 cells treated with three treatments (DMSO, 25 μg/ml MDP, and 50 μg/ml MDP).

[0021] FIGS. 8A-8B illustrate the bioinformatic analysis of shotgun sequencing. FIG. 8A illustrates two dimensional projection of RNA-seq data from the three study groups (T/Veh, TF/Veh, T/MDP). FIG. 8B illustrates a Venn diagram of total differentially expressed genes from the three study groups (T/Veh, TF/Veh, T/MDP).

[0022] FIGS. 9A-9B illustrate the effects of MDP on skeletal muscle-related genes and protein expressions. FIG. 8A illustrates the relative expression level of different skeletal muscle-related genes and proteins from MDP-H-treated mice. FIG. 9B illustrates western blot analysis of the protein expression levels of MuRF1 and Atrogin-1 in skeletal muscles from vehicle- and MDP-H-treated mice (T/Veh, TF/Veh, T/MDP).

DETAILED DESCRIPTION OF THE INVENTION

[0023] As used herein, “a,” “an,” “the,” “at least one,” and “one or more” are used interchangeably.

[0024] In one embodiment, the DR and MDP showed their abilities to suppress the inflammatory cytokine-induced atrophy effect of C2C12 myotubes.

[0025] In one embodiment, MDP ameliorates age-associated decreases in the mobility of C. elegans.

[0026] In one embodiment, the MDP prevents tumor-induced muscle wasting in C26 tumor-bearing mice.

[0027] In one embodiment, the MDP is effective in protecting hindlimb muscles, including quadriceps and tibialis anterior, against cancer-induced wasting.

[0028] In one embodiment, the MDP shows in vivo efficacy in protecting mice from C-26 tumor-induced body weight loss.

[0029] In another embodiment, the MDP diminishes cachexia-associated decreases in skeletal muscle weights.

[0030] In one embodiment, the MDP is able to rescue the fiber size distribution from shifting to smaller cross-sectional areas in cachectic muscles (P<0.05).

[0031] In one embodiment, the MDP reduces serum IL-6 levels.

[0032] In one embodiment, the MDP exerts the anti-cachectic effect by reversing tumor-induced reprogramming of muscle homeostasis-associated gene expression in skeletal muscle.

[0033] The present invention provides a method of treating or preventing cancer-induced cachexia, comprising the administration of effective amounts of a composition to a subject with cancer-induced cachexia, wherein the composition comprises a Moutan radicis cort or a Moutan radicis cort extract.

[0034] The present invention also provides a method of treating or preventing cancer-induced skeletal muscle weight losses, comprising the administration of effective amounts of a composition to a subject with cancer-induced muscle atrophy, wherein the composition comprises a Moutan radicis cort or a Moutan radicis cort extract.

[0035] In one embodiment, the Moutan radicis cort extract is prepared by soaking the Moutan radicis cort in 50% to 100% methanol or 50% to 100% ethanol.

[0036] In a preferred embodiment, the Moutan radicis cort extract is prepared by soaking the Moutan radicis cort in 70% methanol or 70% ethanol.

Example

[0037] The examples below are non-limited and are merely representative of various aspects and features of the present invention.

Example 1: C26CM-Induced Myotube Atrophy Model

[0038] The experimental design is depicted in FIG. 1A C2C12 myoblasts are exposed to 2% horse serum-containing differentiation medium (DM) for 4 days to facilitate their differentiation into myotubes, followed by treatment with C26CM for 4 days. At the end of this 8-day treatment, diameters of C26CM-treated C2C12 myotubes versus those of control cells (receiving DM only) are analyzed under light microscopy, of which the difference was quantified as a readout of C26CM-induced atrophy. In order to recapitulate the use of TCMs to delay the onset of muscle wasting, individual TCMs versus DMSO are added to culture media from the beginning throughout the course of experiment with daily replacement (H3-14 as another control), each of which was repeated four times. As shown, C26CM caused significant narrowing in C2C12 myotubes (FIG. 1B & FIG. 1C).

[0039] As shown in FIG. 1, the effects of different TCMs on C26CM-induced C2C12 myotube atrophy was shown. Schematic representation of the experimental design was shown in FIG. 1A. FIG. 1B was the image. FIG. 1C were the two quantitative analyses of image of FIG. 1B about the protective effect of Dioscoreae rhizome (DR), MDP, and three other representative TCMs on C26CM-induced atrophy of C2C12 myotubes of the representative experiments. Bar, means±S.D. (for data from two independent experiments Expt #1 and Expt #2).

[0040] Extracts of different TCMs, each at 25 and/or 50 μg/ml, were evaluated for their anti-atrophy activities, including Dioscoreae rhizome (DR), MDP, Sambuci chinensis radix et caulis (SCRC), Helminthostachydis radix et rhizome (HRR), Condonopsis radix (CR), Polygonati odorati rhizome, Glycyrrhizae radix et rhizome, Lilii bulbus, Citri sarcodactylis fructus, Euryales semen, Hordei fructus germinates, Siraitiae fructus, Pruni semen, Lycii fructus, Poria, Platycodonis radix, Bombycis chrysallidem, Alpiniae oxyphyllae Fructus, Nelumbinis semen, Polygonati rhizome, Sesami nigrum semen, Ziziphi spinosae semen, Coicis semen, Rubi fructus, Ginseng radix et rhizome, Amynthas et metaphire, Arctii radix, Portulacae herba, and Trionycis carapax. Among these TCM extracts, we found two widely used TCMs, DR and MDP, shared the ability of H3-14 to fully protect C2C12 myotubes from C26CM-induced atrophy (all Ps=0.0002 vis-à-vis C26CM control in the myotube atrophy platform, FIG. 1C), but others were either cytotoxic, or provided no protection, of which the representative data were shown in FIG. 1C.

[0041] Data of other TCMs were shown in FIG. 2. Bar, means±S.D. (N=4). #1 was Polygonati odorati rhizoma; #2 was Glycyrrhizae radix et rhizome; #3 was Lilii bulbus; #4 was Citri sarcodactylis fructus; #5 was Euryales semen; #6 was Hordei fructus germinates; #7 was Siraitiae fructus; #8 was Pruni semen; #9 was Lycii fructus; #10 was Poria; #11 was Platycodonis radix; #12 was Bombycis chrysallidem; #13 was Alpiniae oxyphyllae fructus; #14 was Nelumbinis semen; #15 was Polygonati rhizoma; #16 was Sesami nigrum semen; #17 was Ziziphi spinosae semen; #18 was Coicis semen; #19 was Rubi fructus; #20 was Ginseng radix et rhizoma; #21 was Amynthas et metaphire; #22 was Arctii radix; #23 was Portulacae herba; #24 was Trionycis carapax.

Example 2: C. elegans Mobility Testing of DR and MDP

[0042] In this phenotypic assay of nematode C, elegans, MDP and DR were dissolved in 1% DMSO-containing water at 10 mg/ml as stock solutions, and 100 μl of individual solutions versus vehicle control were evenly applied onto nematode growth medium (NGM) agar plates containing OP50 lawns (total volume of agar, 10 ml). After the solution was completely absorbed into agar, these OP50 plates were radiated under UV for 40 min, followed by seeding with about 50 synchronized eggs of CF512 worms. These plates were incubated at 25° C., and worm mobility was determined starting day 1 after adulthood every other day till day 7. Data, means±SEM. (n=170-420). *P<0.05; **P<0.01; ***P<0.0001 (t-test). The worms at different ages (day 1, 5, 9, 13 adults) were first incubated in drug-free solution and then in levamisole-containing solution for 10 minutes. The digital imaging system were used to quantify the length of the worm body using ImageJ. Data, means±SEM. (n>50). *P<0.05; **P<0.01; ***P<0.0001 (t-test).

[0043] As shown in FIG. 3A, there is no difference of time-dependent effects of Dioscorea radix (DR) as compared to control (vehicle) on age-associated mobility and/or total body contraction in C. elegans.

[0044] As shown in FIG. 3B, MDP could ameliorate age-associated decreases in C. elegans mobility relative to control.

[0045] As shown in FIG. 3C, the time-dependent effects of MDP showed parallel protective effects of mobility in a separate experiment with longer life-expectancy (body bending/second on day 1, 3, 5, 7 and 9).

[0046] As shown in FIG. 3D, MDP significantly delayed the age-associated loss of total body contraction (%) in muscle functions (relative total body contraction on day 1, 5, 9 and 13).

[0047] To sum up, MDP exhibited a unique ability to ameliorate age-associated decreases in worm mobility relative to control, but not for DR.

Example 3: MDP Efficacy in the C26 Model of Cancer Cachexia

[0048] The C-26 model is to confirm the in vivo anti-muscle wasting efficacy of MDP versus DR for their abilities to protect CD2F1 mice from C-26 tumor-induced body weight loss, which was reported to be associated with excessive IL-6 secretion by the tumor.

[0049] In the first set of experiments, the in vivo efficacy of MDP at three different doses (low dose: MDP-L, 100 mg/kg; medium dose: MDP-M, 500 mg/kg; high dose: MDP-H, 1,000 mg/kg) was evaluated via oral gavage once daily to CD2F1 mice starting at 7 days before C-26 tumor cells were implanted till mice were sacrificed at day 17. The body weight, tumor size, and food and water consumption of individual mice were measured every other day. At sacrifice, hindleg skeletal muscles were dissected and stored at −80° C. for further analysis after the weights were measured. The first set of experiment was shown in FIG. 4.

[0050] FIG. 4 illustrates the effects of MDP at three doses (MDP-L, MDP-H, and MDP-H), vehicle and control (H3-14) via oral gavage on the body weight (FIG. 4A & FIG. 4B) and tumor volume (FIG. 4C) of C-26 tumor-bearing mice. NC, tumor-free mice. Tumor weights were estimated based on the assumption that 1,000 mm.sup.3 equals to 1 grain of body weight. S.D. bars are not shown to avoid over congestion of these graphs. For statistical analysis, generalized linear mixed-effects models with random intercept for individual subject and fixed effects for treatment and days of the treatment were used to test for differences among groups, using the Tukey-Kramer correction for multiple comparisons. (a) Significant difference from the control group at p<0.05. (b) Significant difference from the vehicle group at p<0.05. In FIG. 4D, the effects of MDP at three doses, vehicle and H3-14 via oral gavage on three different sections of skeletal muscles of hindlegs of C-26 tumor-bearing mice was shown. NC, tumor-free mice. (a) and (b) denote significant difference from NC group and vehicle group, respectively (Kruskal-Wallis test, with Dunn's multiple-comparison test using Bonferroni adjustment, p<0.05). FIG. 4E shown the photographs of one representative mouse from these five groups at the study endpoint depicting the therapeutic effect of MDP-H and MDP-M in tumor-bearing mice, as shown by alertness, normal posture, smooth haircoat, and better body conditions, despite large tumor burden.

[0051] As shown in FIG. 4A, MDP-H was effective in ameliorating body weight losses in C-26 tumor-bearing mice.

[0052] As shown in FIG. 4B, MDP-H was effective in ameliorating body weight losses (without tumor) in C-26 tumor-bearing mice.

[0053] As shown in FIG. 4C, MDP-H showed a very modest tumor-suppressive effect on tumor growth.

[0054] As shown in FIG. 4D, MDP-M was effective in protecting hindlimb muscles C-26 tumor-bearing mice.

[0055] As shown in FIG. 4E, C-26 tumor-bearing mice treated with MDP-M and MDP-H exhibited an alert and active phenotype.

[0056] In the second set of experiments, the in vivo efficacy of DR at 100 mg/kg versus vehicle via oral gavage was evaluated, which was shown in FIG. 5.

[0057] FIG. 5 illustrated the effects of DR at 100 mg/kg versus vehicle via oral gavage on body weight (w/o tumor) (FIG. 5A) and tumor volume (FIG. 5C) of C-26 tumor-bearing mice (*P<0.05; n=3-6). Control, tumor-free mice. (FIG. 5B) Photographs of representative mice from each group at the study endpoint depicting lack of therapeutic effect of DR. (a) and (b) denote significant difference from the control group and the vehicle group, respectively (Generalized linear mixed-effects models with Tukey-Kramer correction for multiple comparisons).

[0058] As shown in FIG. 5A, DR at 100 mg/kg exacerbated body weight loss.

[0059] As shown in FIG. 5B, DR at 100 mg/kg caused deterioration of physical appearances relative to vehicle control.

[0060] As shown in FIG. 5C, DR at 100 mg/kg had no effect on tumor growth.

[0061] FIG. 6 illustrated a duplicate experiment showing the effects of MDP at 1000 mg/kg (MDP-H) versus vehicle via oral gavage on the body weight (FIG. 6A & FIG. 6B), tumor volume (FIG. 6C) of C-26 tumor-bearing mice. NC, tumor-free mice. Tumor weights were estimated based on the assumption that 1,000 mm.sup.3 equals to 1 grain of body weight. S.D. bars are not shown to avoid over congestion of these graphs. For statistical analysis, generalized linear mixed-effects models with random intercept for individual subject and fixed effects for treatment and days of the treatment were used to test for differences among groups, using the Tukey-Kramer correction for multiple comparisons. Significant difference from the control group at p<0.05. (b) Significant difference from the vehicle group at p<0.05. FIG. 6D shown the effects of MDP-H versus vehicle on three different sections of skeletal muscles of hindlegs of −26 tumor-bearing mice. Control, tumor-free mice. (a) and (b) denote significant difference from control group and vehicle group, respectively (Kruskal-Wallis test, with Dunn's multiple-comparison test using Bonferroni adjustment, p<0.05). FIG. 6E shown the effects of MDP-H on muscle fiber size in C-26 tumor-bearing mice. The cross-sectional areas of muscle fibers in gastrocnemius muscles represented as a frequency histogram. Five sections from the gastrocnemius obtained from each of five mice per treatment group were analyzed as described in the Methods section. Using multiple comparisons for the log-rank test, comparison between muscles from tumorbearing/vehicle and tumor-bearing/MDP mice showed statistical significance (P<0.001). Data are presented as means. FIG. 6F shown the effects of MDP on grip strength.

[0062] As shown in FIG. 6A, MDP-H showed protecting mice from C-26 tumor-induced body weight loss on tumor burden at day 17.

[0063] As shown in FIG. 6B, MDP-H showed protecting mice from C-26 tumor-induced body weight loss (without tumor) on tumor burden at day 17.

[0064] As shown in FIG. 6C, MDP-H showed no significant suppressive effect on tumor burden at day 17.

[0065] As shown in FIG. 6D, MDP-H showed its ability to diminish cachexia-associated decreases in skeletal muscle weights.

[0066] As shown in FIG. 6E, MDP-H was able to rescue the fiber size distribution from shifting to smaller cross-sectional areas in cachectic muscles through immunostaining with anti-dystrophin of GC myofibers followed by quantification of myofiber diameter (P<0.0001).

[0067] As shown in FIG. 6F, MDP-H was able to restore the forelimb grip strength at day 17 (P<0.001).

[0068] FIG. 7 shown the effect of MDP on serum IL-6 in Veh-versus MDP-H-treated C26-tumor-bearing mice. Wilcoxon rank sum test was used for statistical analysis (n=5). FIG. 7B shown the effects of MDP at 25 and 50 μg/mL on IL-6 production in C26 cell culture medium and FIG. 7C shown the viability of C26 cells. Bar, means±S.D. (for data obtained from three independent experiments for (B) and (C), where ****, P<0.0001.

[0069] As shown in FIG. 7A, the mean serum IL-6 (a major driver in the C-26 tumor model of cachexia) levels in MDP-H-treated C-26 tumor-bearing mice was lower but no statistically significant different from that of vehicle control (P=0.06).

[0070] As shown in FIG. 7B, the diminished serum IL-6 level was associated with the unique ability of MDP at 25 and 50 μg/mL to suppress IL-6 secretion into culture medium by C26 cells (P<0.001).

[0071] As shown in FIG. 7C, MDP at 25 and 50 μg/mL was non-cytotoxic to C26 cells.

Example 4: Whole Transcriptome Shotgun Sequencing (RNA-Seq) Analysis

[0072] Whole transcriptome shotgun sequencing (RNA-seq) analysis was conducted by a commercial vendor (Welgene Biotech; Taiwan). Subsequently, these RNA-seq data were subjected to principal component analysis (PCA) to interrogate transcriptome variations among these groups. This clustering of expression profiles suggests that MDP was able to shift the gene expression profile of cachectic skeletal muscles (T/Veh) to a state similar to that of non-cachectic muscles (TF/Veh). Furthermore, pair comparisons of RNA-seq data was analyzed the differences in gene expression profiles among individual groups. Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway and Gene Ontology (GO) Knowledgebase described the related biological signaling pathways.

[0073] As shown in FIG. 8A, two-dimensional projection of RNA-seq data from the three study groups. The principal component analysis axes (Dim1, x-axis; Dim2, y-axis) emphasize the overall variation in RNA-seq data. As shown in FIG. 8B, each black dot represents a transformed gene expression value. Venn diagram of differentially expressed genes in each of the two pairwise comparisons of T/Veh versus TF/Veh and T/Veh versus T/MDP.

[0074] As shown in FIG. 8A, the principal component analysis (PCA) plot shows that the two-dimensional projection of the variation in the T/MDP group was much closer to that of the TF/Veh group than to that of the T/Veh group.

[0075] As shown in FIG. 8B, Venn diagram analysis reveals a total of 1849 differentially expressed genes shared by the two pairwise comparisons (center portion) that showed changed expression in the same direction.

[0076] The above bioinformatic analyses demonstrated the ability of MDP to reprogram the expression of genes associated with muscle homeostasis in cachectic skeletal muscles, which are reflected by the top twenty most up-versus down-regulated genes of the following Table 1 and Table 2.

TABLE-US-00001 TABLE 1 Top 20 most upregulated genes in skeletal muscles of MDP- versus vehicle-treated C-26 tumor-bearing mice. Log2 ratio (MDP/ NCBI Gene Gene Veh) gene ID name description Gene functions 17.3 100504362 Ccl21a chemokine Ccl21 acts as a chemoattractant of (C-C motif) many types of immune cells via ligand 21A the cell surface receptor CCR7. (serine) CCR7 plays a role in regulating energy metabolism by suppressing brown adipose tissues, which is involved in the development of cancer cachexia 15.7 20293 Ccl12 chemokine Ccl12/MCP-5 specifically (C-C motif) attracts eosinophils, monocytes ligand 12; and lymphocytes by signaling aka, through the receptor CCR2, monocyte which plays a critical role in chemotactic muscle regeneration following protein 5 injury. (a.k.a., MCP-5) 15.7 16846 Lep leptin Deficiency in leptin has been associated with reduced skeletal muscle mass in genetically engineered mice, and treatment with exogenous leptin could reverse the muscle loss by inhibiting myofibrillar protein degradation as well as enhancing muscle cell proliferation 6.63 16545 Kera Keratocan One of the small leucine-rich repeat proteoglycans (SLRPs) identified as FoxO-regulated transcripts downregulated in cachectic muscle; located in the ECM where they regulate the structure and integrity of the ECM. 6.61 545798 Tmem233 Transmembrane Highly and specifically expressed protein 233 in skeletal muscles, of which the functions remain unclear. 6.05 12643 Chad Chondroadheri One of the small leucine-rich repeat proteoglycans (SLRPs) identified as FoxO-regulated transcripts downregulated in cachectic muscle; located in the ECM where they regulate the structure and integrity of the ECM. Chad is one of the most downregulated genes in the skeletal muscles of C26 tumor- bearing mice 5.50 16716 Ky Kyphoscoliosis This muscle-specific protein peptidase plays a vital role in muscle (Ky) growth; the absence of Ky protein leads to muscular dystrophy. 5.46 68709 Clip Cartilage The two isoforms of Cilp (Cilp-1 intermediate and Cilp-2), are components of layer extracellular matrix of cartilage, protein which play a role in cartilage (Clip) scaffolding. Downregulation of Cilp is involved in joint pathologies such as osteoarthritis. Cilp is one of the most downregulated genes in the skeletal muscles of C26 tumor- bearing mice. 5.16 403183 Mettl21e Methyltransferase This skeletal muscle-specific like 21E lysine methyltransferase acts an important modulator of autophagy-associated protein degradation in skeletal muscles, and ablation of Mettl21c in mice results in muscle weakness and disturbance of the protein degradation machinery. 5.15 238564 Mylk4 Myosin One of the members of the light chain Myosin light chain kinase kinase (MLCK) family which act as family, regulatory proteins in smooth member 4 muscle contraction. MYLK4 expression was reported to increase in skeletal muscles after high-intensity intermittent exercise training. 5.12 66733 Kcng4 Potassium Kcng4 is one of the most voltage- downregulated genes in the gated skeletal muscles of C26 tumor- channel, bearing mice. Voltagegated subfamily potassium (Kv) channels regulate G, member diverse physiological functions, 4 including neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. 4.90 18802 Plcd4 Phospholipase C, Plcd4 is one of the most delta 4 downregulated genes in the skeletal muscles of C26 tumor- bearing mice. Most abundant in skeletal muscles, and responsible for the production of important second messengers, including inositol trisphosphate and diacylglycerol. 4.80 Vwa3b von Intracellular proteins with VWA Willebrand domains are thought to function factor A in transcription, DNA repair, domain ribosomal and membrane containing transport, and the proteasome. 3B Mutations in this gene are associated with Spinocerebellar ataxia. 4.51 103968 Plin1 Perilipin 1 Perilipin 1 promotes triacylglycerol storage under basal conditions by reducing the access of cytosolic lipases to triacylglycerol substrates stored in lipid droplets. Expression of perilipins in human skeletal muscle in vitro and in vivo in relation to diet, exercise and energy balance. 4.49 12377 Casq1 Calsequestrin 1 A Ca2+-binding protein that acts as a Ca2+ buffer within the sarcoplasmic reticulum (SR), helping storing Ca2+ in the cisterna of the SR after muscle contractions. 4.48 16420 Itgb6 Integrin Itgb6 mRNA was found highly beta 6 enriched in skeletal muscles. Evidence suggests that Itgb6 protein is upregulated post- transcriptionally in response to muscle injury, which might be involved in the remodeling of extracellular matrix via TGF signaling. 4.43 64103 Tnmd Tenomodulin A marker of tendons and ligaments that integrate musculoskeletal components, and its loss-of-function in mice leads to a phenotype with distinct signs of premature aging at the tissue and stem/progenitor cell levels. 4.37 17306 Sypl2 Synaptophy- SYPL2 is thought to participate in sin-like 2 the excitation-contraction coupling process of skeletal muscle as SYPL2-null mice showed reduced muscle contractile force and altered triad junction structure and increased susceptibility to fatigue of the skeletal muscle. 4.32 74843 Mss51 MSS51 Mss51 was predominantly mitochondrial expressed in skeletal muscles and translationa1 in those muscles dominated by activator fast-Twitch fibers. In vitro, its expression was upregulated upon differentiation of C2C12 myoblasts into myotubes. 4.22 433294 Mettl21c Methyltransferase Ablation of Mettl21c in mice like 21C resulted in muscle weakness and disturbance of the protein degradation machinery.

TABLE-US-00002 TABLE 2 Top 20 most downregulated genes in skeletal muscles of MDP-versus vehicle-treated C-26 tumor-bearing mice. Log2 ratio (MDP/ NCBI Gene Gene Veh) gene ID name description Gene functions −7.43 237320 Aldh8a1 Aldehyde ALDH8A1 is involved in dehydrogenase retinaldehyde metabolism, 8 specifically the 9-cis retinal, and family, in oxidation of aliphatic member A1 aldehydes and glutaraldehyde. Although ALDHs are reported to regulate skeletal muscle homeostasis in healthy individuals and patients with Duchenne muscular dystrophy, the exact role of ALDH8A1 in cachectic muscles remains unclear. −5.85 16819 Lcn2 Lipocalin 2 One of the most upregulated genes in the skeletal muscles of C26 tumorbearing mice. Lipocalin was recently reported to be a pathologic mediator of cachexia through the melanocortin 4 receptor in the mediobasal hypothalamus. Its expression is closely associated with reduced food consumption and lean mass loss, and lipocalin 2 knockout mice are protected from cachexia. −5.07 17750 Mt2 Metallothionein One of the most upregulated genes in the skeletal muscles of C26 tumorbearing mice. Concomitant abrogation of metallothioneins 1 and 2 resulted in activation of the Akt pathway and increases in myotube size, and ultimately in muscle strength mass and strength. −5.04 13419 Dnase1 DNase I The functional role of DNase I in cachectic muscles remains uncharacterized −4.83 17748 Mt1 Metallothionein Concomitant abrogation of 1 metallothioneins 1 and 2 resulted in activation of the Akt pathway and increases in myotube size, and ultimately in muscle strength mass and strength. −4.51 213053 Slc39a14 Solute ZIP14 regulates zinc homeostasis carrier in skeletal muscle, and represents family 39 a critical mediator of cancer- (zinc induced cachexia by facilitating transporter), zinc accumulation, leading to member muscle atrophy and blocked 14 (a.k.a., muscle regeneration. ZIP14) −4.49 236690 Nyx Nyctalopin Nyctalopin is one of the SLRP members. Although it was reported to be essential for synaptic transmission in the cone dominated zebrafish retina, its role in cachectic muscles remains uncharacterized. −4.37 74127 Krt80 Keratin 80 KRT80 is a filament protein that make up one of the major structural fibers of epithelial cells. However, its role in cachectic muscles remains uncharacterized. −4.29 20717 Serpina3m Serine (or One of the most upregulated cysteine) genes in the skeletal muscles of peptidase C26 tumor bearing mice. inhibitor, Serpina3m is likely involved in clade A, neuromuscular junction member maintenance and/or stability, as 3M its expression is induced and localized at the motor endplate following denervation, and this effect is augmented in a rodent model of enhanced reinnervation. −4.22 16529 Kcnk5 Potassium Inhibition of TASK2 during channel, differentiation revealed a subfamily morphological impairment of K, member myoblast fusion accompanied by 5 (a.k.a., a downregulation of maturation TASK2) markers in C2C12 cells. −4.11 55985 Cxcl13 Chemokine A significant upregulation of (C-X-C CXCL13 was found in the CNS motif) of the amyotrophic lateral ligand 13 sclerosis mice, indicating a direct correlation between the activation of the chemokine and a faster disease progression. −4.00 216725 Adamts2 A ADAM-TS2 is also known as disintegrinlike procollagen I N-proteinase (PC I- and NP). ADAMTS2 is responsible metallopeptidase for processing several types of (reprolysin procollagen proteins. type) with Procollagens are the precursors of thrombospondin collagens, the proteins that add type 1 strength and support to many motif, 2 body tissues. (ADAM-TS2) −3.93 11717 Ampd3 Adenosine AMPD3 facilitates adenine monophosphate nucleotide degradation in skeletal deaminase muscles, which was found to 3 (AMPD3) accelerate protein degradation in C2C12 myotubesand to contribute to the pathophysiology of skeletal muscle atrophy. −3.87 14085 Fah Fumarylacetoacetate This gene encodes the last hydrolase enzyme in the tyrosine catabolism pathway, of which the role in cachectic muscles remain uncharacterized. −3.81 13447 Doc2b Double C2, One of the most upregulated beta genes in the skeletal muscles of C26 tumor bearing mice. Doc2b is a key positive regulator of Muncl8c-syntaxin 4-mediated insulin secretion as well as of insulin responsiveness in skeletal muscle, and thus a key effector for glucose homeostasis in vivo. −3.69 93732 Acox2 Acyl- ACOX2 encodes branched-chain Coenzyme acylCoA oxidase, a peroxisomal A oxidase enzyme believed to be involved 2, branched in the metabolism of branched- chain chain fatty acids and bile acid intermediates −3.66 432516 Myo1a Myosin IA Myosins are a superfamily of motor proteins best known for their roles in muscle contraction and in a wide range of other motility processes in eukaryotes. −3.65 233011 Itpkc Inositol ITPKC catalyzes the 1,4,5- phosphorylation of inositol 1,4,5- trisphosphate trisphosphate to 1,3,4,5- 3-kinase tetrakisphosphate, and has been C (ITPKC) proposed as a prognostic and predictive biomarker of neoadjuvant chemotherapy for triple negative breast cancer. −3.52 68738 Acss1 Acyl-CoA ACSS1 is a mitochondrial matrix synthetase enzyme that is strongly expressed short-chain in heart, skeletal muscle and family brown adipose tissue. member 1 (ACSS1) −3.41 16009 Igfbp3 Insulin-like IGFBP-3 potently leads to growth impaired myogenesis and factor enhanced muscle protein binding degradation, the major features of protein 3 muscle wasting, via IGF (IGFBP-3) signaling inhibition.

[0077] As shown in FIG. 9, the effects of MDP on skeletal muscle-related genes and protein expressions. As shown in FIG. 9A, 5 upregulated (left) and 5 downregulated (right) genes in skeletal muscles from vehicle-treated versus MDP-H-treated mice (n=3 for each group) were shown by qPCR analysis. The fold increase and % expression on upregulated and downregulated genes were shown as relative expression levels of selected skeletal muscle-related genes of MDP-H-treated mice to the vehicle counterparts, respectively. Bar, means+S.D (n=3). As shown in FIG. 9B, western blot analysis of the protein expression levels of MuRF1 and Atrogin-1 in skeletal muscles from vehicle- and MDP-H-treated C26 tumor-bearing mice (T/Veh and T/MDP-H, respectively) vis-à-vis vehicle-treated tumor-free mice (TF/Veh) were shown, respectively. The forward primer and reverse primer of the quantitative RT-PCR was shown in the following Table 3.

TABLE-US-00003 TABLE 3 Primer sequences used for quantitative RT-PCR analysis Gene Forward/ name Reverse Sequence (5’-3’) 18s Forward AGAAACGGCTACCACATCCA rRNA (SEQ ID NO: 1) Reverse CCCTCCAATGGATCCTCGTT (SEQ ID NO: 2) Kera Forward CAGCCACAGGACTCAACGG (SEQ ID NO: 3) Reverse AGTAGGGAAACTGGGAGGACA (SEQ ID NO: 4) LEP Forward AAGGGGCTTGGGTTTTTCCA (SEQ ID NO: 5) Reverse CAGACAGAGCTGAGCACGAA (SEQ ID NO: 6) Ky Forward ACAGTCAATGGGAAAGCCACA (SEQ ID NO: 7) Reverse CTCCAGCTTCATCCCGTTCT (SEQ ID NO: 8) Chad Forward CAACTCGTTTCGGACCATGC (SEQ ID NO: 9) Reverse GATGTCGTTGTGGGACAGGT (SEQ ID NO: 10) Mettl21e Forward GCCATCGGCCCTTGTTCTAT (SEQ ID NO: 11) Reverse TAGCAATCACACGAGCACCA (SEQ ID NO: 12) Trim63 Forward AGGGACTAGCATAGGGCTCC (SEQ ID NO: 13) Reverse TGACAATCGCCAGTCACACA (SEQ ID NO: 14) Fbxo32 Forward CGGGGTTTGTTTTCAGCAGG (SEQ ID NO: 15) Reverse ACACAGACATTGCCTCCCAG (SEQ ID NO: 16) Lcn2 Forward TGAGTGTCATGTGTCTGGGC (SEQ ID NO: 17) Reverse GAACTGATCGCTCCGGAAGT (SEQ ID NO: 18) Mt1 Forward CTGTCCTCTAAGCGTCACCA (SEQ ID NO: 19) Reverse AGCAGCTCTTCTTGCAGGAG (SEQ ID NO: 20) Ampd3 Forward ACAACTGACCTGTCCTCCCT (SEQ ID NO: 21) Reverse CAAAGCTCAGCCCGTTAGGA (SEQ ID NO: 22)

[0078] As shown in FIG. 9A, the changes in the expression levels of upregulated and downregulated genes from qPCR analysis paralleled that of RNA-seq analysis.

[0079] As shown in FIG. 9B, MDP-H was effective in suppressing the protein expression of Atrogin-1 and MuRF1 in C26 tumor-bearing mice to the basal levels noted in the control group upon Western blotting analysis.

[0080] While the invention has been described and exemplified in sufficient details for those skilled in this art to make and use it, various alternatives, modifications, and improvements should be apparent without departing from the spirit and scope of this invention.

[0081] One skilled in the art readily appreciates that the present invention is well adapted to carry out the objects and obtain the ends and advantages mentioned, as well as those inherent therein. The processes and methods for producing them are representative of preferred embodiments, are exemplary, and are not intended as limitations on the scope of the invention. Modifications therein and other uses will occur to those skilled in the art. These modifications are encompassed within the spirit of the invention and are defined by the scope of the claims.

TABLE-US-00004 SEQUENCE LISTING <ST26Sequencelisting dtdVersion = ″V1_3″ fileName = ″A TRADITIONAL CHINESE MEDICINE-BASED AGENT FOR CACHEXIA PREVENTION AND TREATMENT.xml″ softwareName = ″WIPO Sequence″ softwareVersion = ″2.1.2″ productionDate = ″2022-10-13″> <ApplicationIdentification> <IPOfficeCode>US</IPOfficeCode> <ApplicationNumberText/> <FilingDate/> </ApplicationIdentification> <ApplicantFileReference>3991-CMU-US</ApplicantFileReference> <EarliestPriorityApplicationIdentification> <IPOfficeCode>US</IPOfficeCode> <ApplicationNumberText>63/255,963</ApplicationNumberText> <FilingDate>2021-10-15</FilingDate> </EarliestPriorityApplicationldentification> <ApplicantName languageCode = ″en″>CHINA MEDICAL UNIVERSITY</ApplicantName> <InventorName languageCode = ″en″>Hsiang-Wen Lin</InventorName> <InventorNameLatin>Hsiang-Wen Lin</InventorNameLatin> <InventionTitle languageCode = ″en″>A TRADITIONAL CHINESE MEDICINE-BASED AGENT FOR CACHEXIA PREVENTION AND TREATMENK/InventionTitle> <SequenceTotalQuantity>22</SequenceTotalQuantity> <SequenceData sequenceIDNumber = ″1″> <INSDSeq> <INSDSeq_length>20</INSDSeq_length> <INSDSeq_moltype>DNA</INSDSeq_moltype> <INSDSeq_division>PAT</INSDSeq_division> <INSDSeq_feature-table> <INSDFeature> <INSDFeature_key>source</INSDFeature_key> <INSDFeature_location>1..20</INSDFeature_location> <INSDFeature_quals> <INSDQualifier> <INSDQualifier_name>mol_type</INSDQualifier_name> <INSDQualifier_value>other DNA</INSDQualifier_value> </INSDQualifier> <INSDQualifier id = ″q3″> <INSDQualifier_name>note</INSDQualifier name> <INSDQualifier_value>forward primer</INSDQualifier_value> </INSDQualifier> <INSDQualifier id = ″q1″> <INSDQualifier_name>organism</INSDQualifier_name> <INSDQualifier_value>synthetic construct</INSDQualifier_value> </INSDQualifier> </INSDFeature_quals> </INSDFeature> </INSDSeq_feature-table> <INSDSeq_sequence>agaaacggctaccacatcca</INSDSeq_sequence> </INSDSeq> </SequenceData> <SequenceData sequenceIDNumber = ″2″> <INSDSeq> <INSDSeq_length>20</INSDSeq_length> <INSDSeq_moltype>DNA</INSDSeq_moltype> <INSDSeq_division>PAT</INSDSeq_division> <INSDSeq_feature-table> <INSDFeature> <INSDFeature_key>source</INSDFeature_key> <INSDFeature_location>1..20</INSDFeature_location> <INSDFeature_quals> <INSDQualifier> <INSDQualifier_name>mol_type</INSDQualifier_name> <INSDQualifier_value>other DNA</INSDQualifier_value> </INSDQualifier> <INSDQualifier id = ″q4″> <INSDQualifier_name>note</INSDQualifier_name> <INSDQualifier_value>reverse primer</INSDQualifier_value> </INSDQualifier> <INSDQualifier id = ″q2″> <INSDQualifier_name>organism</INSDQualifier_name> <INSDQualifier_value>synthetic construct</INSDQualifier_value> </INSDQualifier> </INSDFeature_quals> </INSDFeature> </INSDSeq_feature-table> <INSDSeq_sequence>ccctccaatggatcctcgtt</INSDSeq_sequence> </INSDSeq> </SequenceData> <SequenceData sequenceIDNumber = ″3″> <INSDSeq> <INSDSeq_length>19</INSDSeq_length> <INSDSeq_moltype>DNA</INSDSeq_moltype> <INSDSeq_division>PAT</INSDSeq_division> <INSDSeq_feature-table> <INSDFeature> <INSDFeature_key>source</INSDFeature_key> <INSDFeature_location>1..19</INSDFeature_location> <INSDFeature_quals> <INSDQualifier> <INSDQualifier_name>mol_type</INSDQualifier_name> <INSDQualifier_value>other DNA</INSDQualifier_value> </INSDQualifier> <INSDQualifier id = ″q6″> <INSDQualifier_name>note</INSDQualifier_name> <INSDQualifier_value>forward primer</INSDQualifier_value> </INSDQualifier> <INSDQualifier id = ″q5″> <INSDQualifier_name>organism</INSDQualifier_name> <INSDQualifier_value>synthetic construct</INSDQualifier_value> </INSDQualifier> </INSDFeature_quals> </INSDFeature> </INSDSeq_feature-table> <INSDSeq_sequence>cagccacaggactcaacgg</INSDSeq_sequence> </INSDSeq> </SequenceData> <SequenceData sequenceIDNumber = ″4″> <INSDSeq> <INSDSeq_length>21</INSDSeq_length> <INSDSeq_moltype>DNA</INSDSeq_moltype> <INSDSeq_division>PAT</INSDSeq_division> <INSDSeq_feature-table> <INSDFeature> <INSDFeature_key>source</INSDFeature_key> <INSDFeature_location>1..21</INSDFeature_location> <INSDFeature_quals> <INSDQualifier> <INSDQualifier_name>mol_type</INSDQualifier_name> <INSDQualifier_value>other DNA</INSDQualifier_value> </INSDQualifier> <INSDQualifier id = ″q8″> <INSDQualifier_name>note</INSDQualifier_name> <INSDQualifier_value>reverse primer</INSDQualifier_value> </INSDQualifier> <INSDQualifier id = ″q7″> <INSDQualifier_name>organism</INSDQualifier_name> <INSDQualifier_value>synthetic construct</INSDQualifier_value> </INSDQualifier> </INSDFeature_quals> </INSDFeature> </INSDSeq_feature-table> <INSDSeq_sequence>agtagggaaactgggaggaca</INSDSeq_sequence> </INSDSeq> </SequenceData> <SequenceData sequenceIDNumber = ″5″> <INSDSeq> <INSDSeq_length>20</INSDSeq_length> <INSDSeq_moltype>DNA</INSDSeq_moltype> <INSDSeq_division>PAT</INSDSeq_division> <INSDSeq_feature-table> <INSDFeature> <INSDFeature_key>source</INSDFeature_key> <INSDFeature_location>1..20</INSDFeature_location> <INSDFeature_quals> <INSDQualifier> <INSDQualifier_name>mol_type</INSDQualifier_name> <INSDQualifier_value>other DNA</INSDQualifier_value> </INSDQualifier> <INSDQualifier id = ″q10″> <INSDQualifier_name>note</INSDQualifier_name> <INSDQualifier_value>forward primer</INSDQualifier_value> </INSDQualifier> <INSDQualifier id = ″q9″> <INSDQualifier_name>organism</INSDQualifier_name> <INSDQualifier_value>synthetic construct</INSDQualifier_value> </INSDQualifier> </INSDFeature_quals> </INSDFeature> </INSDSeq_feature-table> <INSDSeq_sequence>aaggggcttgggtttttcca</INSDSeq_sequence> </INSDSeq> </SequenceData> <SequenceData sequenceIDNumber = ″6″> <INSDSeq> <INSDSeq_length>20</INSDSeq_length> <INSDSeq_moltype>DNA</INSDSeq_moltype> <INSDSeq_division>PAT</INSDSeq_division> <INSDSeq_feature-table> <INSDFeature> <INSDFeature_key>source</INSDFeature_key> <INSDFeature_location>1..20</INSDFeature_location> <INSDFeature_quals> <INSDQualifier> <INSDQualifier_name>mol type</INSDQualifier_name> <INSDQualifier_value>other DNA</INSDQualifier_value> </INSDQualifier> <INSDQualifier id = ″q15″> <INSDQualifier_name>note</INSDQualifier_name> <INSDQualifier_value>reverse primer</INSDQualifier_value> </INSDQualifier> <INSDQualifier id = ″q14″> <INSDQualifier_name>organism</INSDQualifier_name> <INSDQualifier_value>synthetic construct</INSDQualifier_value> </INSDQualifier> </INSDFeature_quals> </INSDFeature> </INSDSeq_feature-table> <INSDSeq_sequence>cagacagagctgagcacgaa</INSDSeq_sequence> </INSDSeq> </SequenceData> <SequenceData_sequenceIDNumber = ″7″> <INSDSeq> <INSDSeq_length>21</INSDSeq_length> <INSDSeq_moltype>DNA</INSDSeq_moltype> <INSDSeq_division>PAT</INSDSeq_division> <INSDSeq_feature-table> <INSDFeature> <INSDFeature_key>source</INSDFeature_key> <INSDFeature_location>1..21</INSDFeature_location> <INSDFeature_quals> <INSDQualifier> <INSDQualifier_name>mol_type</INSDQualifier_name> <INSDQualifier_value>other DNA</INSDQualifier_value> </INSDQualifier> <INSDQualifier id = ″q17″> <INSDQualifier_name>note</INSDQualifier_name> <INSDQualifier_value>forward primer</INSDQualifier_value> </INSDQualifier> <INSDQualifier id = ″q16″> <INSDQualifier_name>organism</INSDQualifier_name> <INSDQualifier_value>synthetic construct</INSDQualifier_value> </INSDQualifier> </INSDFeature_quals> </INSDFeature> </INSDSeq_feature-table> <INSDSeq_sequence>acagtcaatgggaaagccaca</INSDSeq_sequence> </INSDSeq> </SequenceData> <SequenceData_sequenceIDNumber = ″8″> <INSDSeq> <INSDSeq_length>20</INSDSeq_length> <INSDSeq_moltype>DNA</INSDSeq_moltype> <INSDSeq_division>PAT</INSDSeq_division> <INSDSeq_feature-table> <INSDFeature> <INSDFeature_key>source</INSDFeature_key> <INSDFeature_location>1..20</INSDFeature_location> <INSDFeature_quals> <INSDQualifier> <INSDQualifier_name>mol_type</INSDQualifier_name> <INSDQualifier_value>other DNA</INSDQualifier_value> </INSDQualifier> <INSDQualifier id = ″q19″> <INSDQualifier_name>note</INSDQualifier_name> <INSDQualifier_value>reverse primer</INSDQualifier_value> </INSDQualifier> <INSDQualifier id = ″q18″> <INSDQualifier_name>organism</INSDQualifier_name> <INSDQualifier_value>synthetic construct</INSDQualifier_value> </INSDQualifier> </INSDFeature_quals> </INSDFeature> </INSDSeq_feature-table> <INSDSeq_sequence>ctccagcttcatcccgttct</INSDSeq_sequence> </INSDSeq> </SequenceData> <SequenceData sequenceIDNumber = ″9″> <INSDSeq> <INSDSeq_length>20</INSDSeq_length> <INSDSeq_moltype>DNA</INSDSeq_moltype> <INSDSeq_division>PAT</INSDSeq_division> <INSDSeq_feature-table> <INSDFeature> <INSDFeature_key>source</INSDFeature_key> <INSDFeature_location>1..20</INSDFeature_location> <INSDFeature_quals> <INSDQualifier> <INSDQualifier_name>mol_type</INSDQualifier_name> <INSDQualifier_value>other DNA</INSDQualifier_value> </INSDQualifier> <INSDQualifier id = ″q21″> <INSDQualifier_name>note</INSDQualifier_name> <INSDQualifier_value>forward primer</INSDQualifier_value> </INSDQualifier> <INSDQualifier id = ″q20″> <INSDQualifier_name>organism</INSDQualifier_name> <INSDQualifier_value>synthetic construct</INSDQualifier_value> </INSDQualifier> </INSDFeature_quals> </INSDFeature> </INSDSeq_feature-table> <INSDSeq_sequence>caactcgtttcggaccatgc</INSDSeq_sequence> </INSDSeq> </SequenceData> <SequenceData sequenceIDNumber = ″10″> <INSDSeq> <INSDSeq_length>20</INSDSeq_length> <INSDSeq_moltype>DNA</INSDSeq_moltype> <INSDSeq_division>PAT</INSDSeq_division> <INSDSeq_feature-table> <INSDFeature> <INSDFeature_key>source</INSDFeature_key> <INSDFeature_location>1..20</INSDFeature_location> <INSDFeature_quals> <INSDQualifier> <INSDQualifier_name>mol_type</INSDQualifier_name> <INSDQualifier_value>other DNA</INSDQualifier_value> </INSDQualifier> <INSDQualifier id = ″q23″> <INSDQualifier_name>note</INSDQualifier_name> <INSDQualifier_value>reverse primer</INSDQualifier_value> </INSDQualifier> <INSDQualifier id = ″q22″> <INSDQualifier_name>organism</INSDQualifier_name> <INSDQualifier_value>synthetic construct</INSDQualifier_value> </INSDQualifier> </INSDFeature_quals> </INSDFeature> </INSDSeq_feature-table> <INSDSeq_sequence>gatgtcgttgtgggacaggt</INSDSeq_sequence> </INSDSeq> </SequenceData> <SequenceData sequenceIDNumber = ″11″> <INSDSeq> <INSDSeq_length>20</INSDSeq_length> <INSDSeq_moltype>DNA</INSDSeq_moltype> <INSDSeq_division>PAT</INSDSeq_division> <INSDSeq_feature-table> <INSDFeature> <INSDFeature_key>source</INSDFeature_key> <INSDFeature_location>1..20</INSDFeature_location> <INSDFeature_quals> <INSDQualifier> <INSDQualifier_name>mol_type</INSDQualifier_name> <INSDQualifier_value>other DNA</INSDQualifier_value> </INSDQualifier> <INSDQualifier id = ″q25″> <INSDQualifier_name>note</INSDQualifier_name> <INSDQualifier_value>forward primer</INSDQualifier_value> </INSDQualifier> <INSDQualifier id = ″q24″> <INSDQualifier_name>organism</INSDQualifier_name> <INSDQualifier_value>synthetic construct</INSDQualifier_value> </INSDQualifier> </INSDFeature_quals> </INSDFeature> </INSDSeq_feature-table> <INSDSeq_sequence>gccatcggcccttgttctat</INSDSeq_sequence> </INSDSeq> </SequenceData> <SequenceData sequenceIDNumber = ″12″> <INSDSeq> <INSDSeq_length>20</INSDSeq_length> <INSDSeq_moltype>DNA</INSDSeq_moltype> <INSDSeq_division>PAT</INSDSeq_division> <INSDSeq_feature-table> <INSDFeature> <INSDFeature_key>source</INSDFeature_key> <INSDFeature_location>1..20</INSDFeature_location> <INSDFeature_quals> <INSDQualifier> <INSDQualifier_name>mol_type</INSDQualifier_name> <INSDQualifier_value>other DNA</INSDQualifier_value> </INSDQualifier> <INSDQualifier id = ″q27″> <INSDQualifier_name>note</INSDQualifier_name> <INSDQualifier_value>reverse primer</INSDQualifier_value> </INSDQualifier> <INSDQualifier id = ″q26″> <INSDQualifier_name>organism</INSDQualifier_name> <INSDQualifier_value>synthetic construct</INSDQualifier_value> </INSDQualifier> </INSDFeature_quals> </INSDFeature> </INSDSeq_feature-table> <INSDSeq_sequence>tagcaatcacacgagcacca</INSDSeq_sequence> </INSDSeq> </SequenceData> <SequenceData sequenceIDNumber = ″13″> <INSDSeq> <INSDSeq_length>20</INSDSeq_length> <INSDSeq_moltype>DNA</INSDSeq_moltype> <INSDSeq_division>PAT</INSDSeq_division> <INSDSeq_feature-table> <INSDFeature> <INSDFeature_key>source</INSDFeature_key> <INSDFeature_location>1..20</INSDFeature_location> <INSDFeature_quals> <INSDQualifier> <INSDQualifier_name>mol_type</INSDQualifier_name> <INSDQualifier_value>other DNA</INSDQualifier_value> </INSDQualifier> <INSDQualifier id = ″q29″> <INSDQualifier_name>note</INSDQualifier_name> <INSDQualifier_value>forward primer</INSDQualifier_value> </INSDQualifier> <INSDQualifier id = ″q28″> <INSDQualifier_name>organism</INSDQualifier_name> <INSDQualifier_value>synthetic construct</INSDQualifier_value> </INSDQualifier> </INSDFeature_quals> </INSDFeature> </INSDSeq_feature-table> <INSDSeq_sequence>agggactagcatagggctcc</INSDSeq_sequence> </INSDSeq> </SequenceData> <SequenceData sequenceIDNumber = ″14″> <INSDSeq> <INSDSeq_length>20</INSDSeq_length> <INSDSeq_moltype>DNA</INSDSeq_moltype> <INSDSeq_division>PAT</INSDSeq_division> <INSDSeq_feature-table> <INSDFeature> <INSDFeature_key>source</INSDFeature_key> <INSDFeature_location>1..20</INSDFeature_location> <INSDFeature_quals> <INSDQualifier> <INSDQualifier_name>mol_type</INSDQualifier_name> <INSDQualifier_value>other DNA</INSDQualifier_value> </INSDQualifier> <INSDQualifier id = ″q31″> <INSDQualifier_name>note</INSDQualifier_name> <INSDQualifier_value>reverse primer</INSDQualifier_value> </INSDQualifier> <INSDQualifier id = ″q30″> <INSDQualifier_name>organism</INSDQualifier_name> <INSDQualifier_value>synthetic construct</INSDQualifier_value> </INSDQualifier> </INSDFeature_quals> </INSDFeature> </INSDSeq_feature-table> <INSDSeq_sequence>tgacaatcgccagtcacaca</INSDSeq_sequence> </INSDSeq> </SequenceData> <SequenceData sequenceIDNumber = ″15″> <INSDSeq> <INSDSeq_length>20</INSDSeq_length> <INSDSeq_moltype>DNA</INSDSeq_moltype> <INSDSeq_division>PAT</INSDSeq_division> <INSDSeq_feature-table> <INSDFeature> <INSDFeature_key>source</INSDFeature_key> <INSDFeature_location>1..20</INSDFeature_location> <INSDFeature_quals> <INSDQualifier> <INSDQualifier_name>mol_type</INSDQualifier_name> <INSDQualifier_value>other DNA</INSDQualifier_value> </INSDQualifier> <INSDQualifier id = ″q33″> <INSDQualifier_name>note</INSDQualifier_name> <INSDQualifier_value>forward primer</INSDQualifier_value> </INSDQualifier> <INSDQualifier id = ″q32″> <INSDQualifier_name>organism</INSDQualifier_name> <INSDQualifier_value>synthetic construct</INSDQualifier_value> </INSDQualifier> </INSDFeature_quals> </INSDFeature> </INSDSeq_feature-table> <INSDSeq_sequence>cggggtttgttttcagcagg</INSDSeq_sequence> </lNSDSeq> </SequenceData> <SequenceData sequenceIDNumber = ″16″> <INSDSeq> <INSDSeq_length>20</INSDSeq_length> <INSDSeq_moltype>DNA</INSDSeq_moltype> <INSDSeq_division>PAT</INSDSeq_division> <INSDSeq_feature-table> <INSDFeature> <INSDFeature_key>source</INSDFeature_key> <INSDFeature_location>1..20</INSDFeature_location> <INSDFeature_quals> <INSDQualifier> <INSDQualifier_name>mol_type</INSDQualifier_name> <INSDQualifier_value>other DNA</INSDQualifier_value> </INSDQualifier> <INSDQualifier id = ″q35″> <INSDQualifier_name>note</INSDQualifier_name> <INSDQualifier_value>reverse primer</INSDQualifier_value> </INSDQualifier> <INSDQualifier id = ″q34″> <INSDQualifier_name>organism</INSDQualifier_name> <INSDQualifier_value>synthetic construct</INSDQualifier_value> </INSDQualifier> </INSDFeature_quals> </INSDFeature> </INSDSeq_feature-table> <INSDSeq_sequence>acacagacattgcctcccag</INSDSeq_sequence> </INSDSeq> </SequenceData> <SequenceData sequenceIDNumber = ″17″> <INSDSeq> <INSDSeq_length>20</INSDSeq_length> <INSDSeq_moltype>DNA</INSDSeq_moltype> <INSDSeq_division>PAT</INSDSeq_division> <INSDSeq_feature-table> <INSDFeature> <INSDFeature_key>source</INSDFeature_key> <INSDFeature_location>1..20</INSDFeature_location> <INSDFeature_quals> <INSDQualifier> <INSDQualifier_name>mol_type</INSDQualifier_name> <INSDQualifier_value>other DNA</INSDQualifier_value> </INSDQualifier> <INSDQualifier id = ″q37″> <INSDQualifier_name>note</INSDQualifier_name> <INSDQualifier_value>forward primer</INSDQualifier_value> </INSDQualifier> <INSDQualifier id = ″q36″> <INSDQualifier_name>organism</INSDQualifier_name> <INSDQualifier_value>synthetic construct</INSDQualifier_value> </INSDQualifier> </INSDFeature_quals> </INSDFeature> </INSDSeq_feature-table> <INSDSeq_sequence>tgagtgtcatgtgtctgggc</INSDSeq_sequence> </INSDSeq> </SequenceData> <SequenceData sequenceIDNumber = ″18″> <INSDSeq> <INSDSeq_length>20</INSDSeq_length> <INSDSeq_moltype>DNA</INSDSeq_moltype> <INSDSeq_division>PAT</INSDSeq_division> <INSDSeq_feature-table> <INSDFeature> <INSDFeature_key>source</INSDFeature_key> <INSDFeature_location>1..20</INSDFeature_location> <INSDFeature_quals> <INSDQualifier> <INSDQualifier_name>mol_type</INSDQualifier_name> <INSDQualifier_value>other DNA</INSDQualifier_value> </INSDQualifier> <INSDQualifier id = ″q39″> <INSDQualifier_name>note</INSDQualifier_name> <INSDQualifier_value>reverse primer</INSDQualifier_value> </INSDQualifier> <INSDQualifier id = ″q38″> <INSDQualifier_name>organism</INSDQualifier_name> <INSDQualifier_value>synthetic construct</INSDQualifier_value> </INSDQualifier> </INSDFeature_quals> </INSDFeature> </INSDSeq_feature-table> <INSDSeq_sequence>gaactgatcgctccggaagt</INSDSeq_sequence> </INSDSeq> </SequenceData> <SequenceData sequenceIDNumber = ″19″> <INSDSeq> <INSDSeq_length>20</INSDSeq_length> <INSDSeq_moltype>DNA</INSDSeq_moltype> <INSDSeq_division>PAT</INSDSeq_division> <INSDSeq_feature-table> <INSDFeature> <INSDFeature_key>source</INSDFeature_key> <INSDFeature_location>1..20</INSDFeature_location> <INSDFeature_quals> <INSDQualifier> <INSDQualifier_name>mol_type</INSDQualifier_name> <INSDQualifier_value>other DNA</INSDQualifier_value> </INSDQualifier> <INSDQualifier id = ″q41″> <INSDQualifier_name>note</INSDQualifier_name> <INSDQualifier_value>forward primer</INSDQualifier_value> </INSDQualifier> <INSDQualifier id = ″q40″> <INSDQualifier_name>organism</INSDQualifier_name> <INSDQualifier_value>synthetic construct</INSDQualifier_value> </INSDQualifier> </INSDFeature_quals> </INSDFeature> </INSDSeq_feature-table> <INSDSeq_sequence>ctgtcctctaagcgtcacca</INSDSeq_sequence> </INSDSeq> </SequenceData> <SequenceData sequenceIDNumber = ″20″> <INSDSeq> <INSDSeq_length>20</INSDSeq_length> <INSDSeq_moltype>DNA</INSDSeq_moltype> <INSDSeq_division>PAT</INSDSeq_division> <INSDSeq_feature-table> <INSDFeature> <INSDFeature_key>source</INSDFeature_key> <INSDFeature_location>1..20</INSDFeature_location> <INSDFeature_quals> <INSDQualifier> <INSDQualifier_name>mol_type</INSDQualifier_name> <INSDQualifier_value>other DNA</INSDQualifier_value> </INSDQualifier> <INSDQualifier id = ″q43″> <INSDQualifier_name>note</INSDQualifier_name> <INSDQualifier_value>reverse primer</INSDQualifier_value> </INSDQualifier> <INSDQualifier id = ″q42″> <INSDQualifier_name>organism</INSDQualifier_name> <INSDQualifier_value>synthetic construct</INSDQualifier_value> </INSDQualifier> </INSDFeature_quals> </INSDFeature> </INSDSeq_feature-table> <INSDSeq_sequence>agcagctcttcttgcaggag</INSDSeq_sequence> </INSDSeq> </SequenceData> <SequenceData sequenceIDNumber = ″21″> <INSDSeq> <INSDSeq_length>20</INSDSeq_length> <INSDSeq_moltype>DNA</INSDSeq_moltype> <INSDSeq_division>PAT</INSDSeq_division> <INSDSeq_feature-table> <INSDFeature> <INSDFeature_key>source</INSDFeature_key> <INSDFeature_location>1..20</INSDFeature_location> <INSDFeature_quals> <INSDQualifier> <INSDQualifier_name>mol_type</INSDQualifier_name> <INSDQualifier_value>other DNA</INSDQualifier_value> </INSDQualifier> <INSDQualifier id = ″q45″> <INSDQualifier_name>note</INSDQualifier_name> <INSDQualifier_value>forward primer</INSDQualifier_value> </INSDQualifier> <INSDQualifier id = ″q44″> <INSDQualifier_name>organism</INSDQualifier_name> <INSDQualifier_value>synthetic construct</INSDQualifier_value> </INSDQualifier> </INSDFeature_quals> </INSDFeature> </INSDSeq_feature-table> <INSDSeq_sequence>acaactgacctgtcctccct</INSDSeq_sequence> </INSDSeq> </SequenceData> <SequenceData sequenceIDNumber = ″22″> <INSDSeq> <INSDSeq_length>20</INSDSeq_length> <INSDSeq_moltype>DNA</INSDSeq_moltype> <INSDSeq_division>PAT</INSDSeq_division> <INSDSeq_feature-table> <INSDFeature> <INSDFeature_key>source</INSDFeature_key> <INSDFeature_location>l..20</INSDFeature_location> <INSDFeature_quals> <INSDQualifier> <INSDQualifier_name>mol_type</INSDQualifier_name> <INSDQualifier_value>other DNA</INSDQualifier_value> </INSDQualifier> <INSDQualifier id = ″q47″> <INSDQualifier_name>note</INSDQualifier_name> <INSDQualifier_value>reverse primer</INSDQualifier_value> </INSDQualifier> <INSDQualifier id = ″q46″> <INSDQualifier_name>organism</INSDQualifier_name> <INSDQualifier_value>synthetic construct</INSDQualifier_value> </INSDQualifier> </INSDFeature_quals> </INSDFeature> </INSDSeq_feature-table> <INSDSeq_sequence>caaagctcagcccgttagga</INSDSeq_sequence> </INSDSeq> </SequenceData> </ST26SequenceListing>