AN ON-CHIP BIFURCATED CONTINUOUS FIELD-FLOW FRACTIONATION TECHNOLOGY FOR NUCLEIC ACID ISOLATION
20220325270 · 2022-10-13
Inventors
- Chenguang Zhang (South Bend, IN, US)
- Gongchen Sun (South Bend, IN, US)
- Satyajyoti Senapati (South Bend, IN, US)
- Hsueh-Chia Chang (South Bend, IN, US)
Cpc classification
C12M29/04
CHEMISTRY; METALLURGY
C12M35/02
CHEMISTRY; METALLURGY
C12N15/1003
CHEMISTRY; METALLURGY
C12N15/101
CHEMISTRY; METALLURGY
International classification
Abstract
Described herein is a bifurcated continuous field-flow fractionation (BCFFF) chip for high-yield and high-throughput nucleic acid extraction and purification. BCFFF uses a membrane ionic transistor to sustain low-ionic strength in a localized region at a junction, such that the resulting high field can selectively isolate high-charge density nucleic acids from the main flow channel and insert them into a standardized buffer in a side channel that bifurcates from the junction. The BCFFF platform can be used for isolation of both long dsDNAs and short miRNAs, without changing the device configuration or the operation protocol. BCFFF results in high-efficiency (>85%) concentration-independent DNA extraction and 40% net qRT-PCR miRNA yield from plasma, which is significantly higher than any other commercial liquid and solid extraction technologies.
Claims
1. An apparatus for isolating nucleic acids from a fluid sample comprising the nucleic acids, the apparatus comprising: an inlet, a first outlet, a second outlet and a microfluidic channel fluidly connecting the inlet, the first outlet and the second outlet, wherein the microfluidic channel includes a first channel portion extending from the inlet to a junction, a second channel portion extending from the junction to the first outlet, and a third channel portion extending from the junction to the second outlet; a cation exchange membrane (CEM) positioned across the second channel portion proximate to the junction; a plurality of electrodes adapted to generate an electric field at the junction.
2. The apparatus of claim 1, wherein the plurality of electrodes include a first terminal positioned within the third channel portion, a second terminal positioned within the second channel portion and a third terminal positioned on the CEM.
3. The apparatus of claim 1, wherein the microfluidic channel has a thickness between about 1 μm and about 100 μm.
4. A method for isolating nucleic acids from a fluid sample comprising the nucleic acids, the method comprising: providing the apparatus of claim 1; filling the microfluidic channel with a buffered solution comprising anions and cations; applying an electric field at the junction of about 0.1 to 10 V/mm thereby causing cations at the junction to migrate away from the junction through the CEM, and causing anions at the junction to migrate away from the junction towards the second outlet, and generating an ion depletion region at the junction; isolating nucleic acids from the fluid sample by: continuously loading the fluid sample into the microfluidic channel through the inlet and removing fluid from the first outlet such that fluids flow from the inlet to the first outlet at a flow rate that permits nucleic acids to electrophoretically migrate from the junction towards the second outlet due to the applied electric field, and to concentrate at the second outlet; and thereafter, collecting concentrated nucleic acids from the second outlet.
5. The method of claim 4, wherein the ion depletion region has an ionic strength less than about 1.0 mM.
6. The method of claim 4, wherein the dimension of the ion depletion region is inversely proportional to the applied electric field.
7. The method of claim 4, wherein the length of the ion depletion region is between about 0.1 mm and about 10 mm.
8. The method of claim 4, wherein the applied electric field and the flow rate are selected so as to permit at least 80% of the nucleic acids in the fluid sample to electrophoretically migrate from the junction towards the second outlet and concentrate at the second outlet.
9. The method of claim 4, wherein the flow rate is between about 0.1 μL/min and about 100 μL/min.
10. The method of claim 4, wherein the nucleic acids comprise one or more of ssDNA, dsDNA, rDNA, cDNA, ssRNA, dsRNA, rRNA, mRNA, tRNA, siRNA, or miRNA.
11. The method of claim 4, wherein the fluid sample further comprises one or more cationic molecules, and wherein the applied electric field and the flow rate cause the cationic molecules to electropheretically and hydrodynamically migrate from the junction towards the CEM.
12. The method of claim 11, wherein the cationic molecules comprise ions or proteins.
13. The method of claim 4, wherein the fluid sample further comprises anionic biomolecules other than nucleic acids, and wherein the flow rate causes the anionic biomolecules to hydrodynamically migrate from the junction towards the CEM.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0010]
[0011]
[0012]
[0013]
[0014]
[0015]
[0016]
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
DETAILED DESCRIPTION
[0033] Described herein is a bifurcated continuous field-flow fractionation (BCFFF) chip for high-yield and high-throughput nucleic acid extraction and purification. BCFFF uses a membrane ionic transistor to sustain low-ionic strength in a localized region at a junction, such that the resulting high field can selectively isolate high-charge density nucleic acids from the main flow channel and insert them into a standardized buffer in a side channel that bifurcates from the junction. The BCFFF platform can be used for isolation of both long dsDNAs and short miRNAs, without changing the device configuration or the operation protocol. BCFFF results in high-efficiency (>85%) concentration-independent DNA extraction and 40% net qRT-PCR miRNA yield from plasma, which is significantly higher than any other commercial liquid and solid extraction technologies.
[0034] One embodiment described herein is an apparatus for isolating nucleic acids from a fluid sample comprising the nucleic acids, the apparatus comprising: an inlet, a first outlet, a second outlet and a microfluidic channel fluidly connecting the inlet, the first outlet and the second outlet, wherein the microfluidic channel includes a first channel portion extending from the inlet to a junction, a second channel portion extending from the junction to the first outlet, and a third channel portion extending from the junction to the second outlet; a cation exchange membrane (CEM) positioned across the second channel portion proximate to the junction; a plurality of electrodes adapted to generate an electric field at the junction. In one aspect, the plurality of electrodes include a first terminal positioned within the third channel portion, a second terminal positioned within the second channel portion and a third terminal positioned on the CEM. In another aspect, the microfluidic channel has a thickness between about 1 μm and about 100 μm.
[0035] Another embodiment described herein is a method for isolating nucleic acids from a fluid sample comprising the nucleic acids, the method comprising: providing the apparatus described herein; filling the microfluidic channel with a buffered solution comprising anions and cations; applying an electric field at the junction of about 0.1 to 10 V/mm thereby causing cations at the junction to migrate away from the junction through the CEM, and causing anions at the junction to migrate away from the junction towards the second outlet, and generating an ion depletion region at the junction; isolating nucleic acids from the fluid sample by: continuously loading the fluid sample into the microfluidic channel through the inlet and removing fluid from the first outlet such that fluids flow from the inlet to the first outlet at a flow rate that permits nucleic acids to electrophoretically migrate from the junction towards the second outlet due to the applied electric field, and to concentrate at the second outlet; and thereafter, collecting concentrated nucleic acids from the second outlet. In one aspect, the ion depletion region has an ionic strength less than about 1.0 mM. In another aspect, the dimension of the ion depletion region is inversely proportional to the applied electric field. In another aspect, the length of the ion depletion region is between about 0.1 mm and about 10 mm. In another aspect, the applied electric field and the flow rate are selected so as to permit at least 80% of the nucleic acids in the fluid sample to electrophoretically migrate from the junction towards the second outlet and concentrate at the second outlet. In another aspect, the flow rate is between about 0.1 μL/min and about 100 μL/min. In another aspect, the nucleic acids comprise one or more of ssDNA, dsDNA, rDNA, cDNA, ssRNA, dsRNA, rRNA, mRNA, tRNA, siRNA, or miRNA. In another aspect, the fluid sample further comprises one or more cationic molecules, and wherein the applied electric field and the flow rate cause the cationic molecules to electropheretically and hydrodynamically migrate from the junction towards the CEM. In another aspect, the cationic molecules comprise ions or proteins. In another aspect, the fluid sample further comprises anionic biomolecules other than nucleic acids, and wherein the flow rate causes the anionic biomolecules to hydrodynamically migrate from the junction towards the CEM.
[0036] It will be apparent to one of ordinary skill in the relevant art that suitable modifications and adaptations to the compositions, formulations, methods, processes, and applications described herein can be made without departing from the scope of any embodiments or aspects thereof. The compositions and methods provided are exemplary and are not intended to limit the scope of any of the specified embodiments. All of the various embodiments, aspects, and options disclosed herein can be combined in any and all variations or iterations. The scope of the compositions, formulations, methods, and processes described herein include all actual or potential combinations of embodiments, aspects, options, examples, and preferences herein described. The exemplary compositions and formulations described herein may omit any component, substitute any component disclosed herein, or include any component disclosed elsewhere herein. Should the meaning of any terms in any of the patents or publications incorporated by reference conflict with the meaning of the terms used in this disclosure, the meanings of the terms or phrases in this disclosure are controlling. Furthermore, the foregoing discussion discloses and describes merely exemplary embodiments. All patents and publications cited herein are incorporated by reference herein for the specific teachings thereof.
EXAMPLES
Example 1
[0037] Fabrication of the Microfluidic Chips. The membrane transistor fabrication method is adopted from previous research of ionic transistor (Sun et al., Lab on a chip 2016, 16, 1171-7; Sun et al., Phys. Rev. Applied 2017, 7, 064024). As shown in
[0038] Experiment Setup. During the experiment, all the openings of the chip are sealed except the inlet and outlet of the loading channel. Platinum wires are fixed in the G, D, S reservoirs on the microfluidic chip. External voltages are applied through these wires by Keithley 2636A Dual-Channel System SourceMeter Instrument controlled and monitored by custom MATLAB code. The samples are loaded on to the chip through the inlet of the loading channel by a Braintree syringe pump. After pretreatment, the outlet of the loading channel is sealed, 4 μL of purified sample is quickly collected from the extraction outlet with a pipette.
[0039] Fluorescent Visualization and Measurement. The real-time fluorescence images of pretreatment of ssDNA are taken by using an inverted epifluorescence microscope (Olympus 1X71) equipped with a mercury lamp and a high-speed camera (QImaging Retiga-EX). The visualization of on-chip pretreatment of dsDNA from plasma is performed on a customized dark-room platform equipped with a Dark Reader Transilluminator (Clare Chemical) to excite the fluorescent dye from the bottom of the microfluidic chip. The fluorescent signal is filtered and recorded at the top of the microfluidic chip by a Logitech C920 Webcam. SYBR® Green I Nucleic Acid Stain is purchased from Lonza (Cat #50513). Pierce™ Recombinant GFP Protein is purchased from Thermo Scientific™ (Cat #88899). The fluorescence measurement of pretreated samples is performed on Tecan Infinite M200 Plate Reader.
[0040] Plasma Samples. De-identified fresh human plasma samples were purchased from Zen-Bio Inc. The 10 mL samples were collected in tubes with EDTA anticoagulant. All samples were obtained following FDA-mandated testing for pathogens.
Quantification of Calcium Concentration. The concentration of calcium in each sample is measured by Inductively Coupled Plasma Optically Emitting Spectra (ICP-OES, Perkin Elmer Optima 8000).
[0041] E. coli DNA Amplification and Gel Electrophoresis. E. coli with pUC18 plasmid is purchased from Modern Biology Inc. The primers from IDT DNA are shown in Table 1. Pellet of E. coli is obtained by centrifugation at 5000×g for 10 min and resuspended in 1×PBS. The solution is put into 95° C. water bath for 10 min to thermally lyse the bacteria. PCR of E. coli DNA is carried out on a Bio-Rad MJ Mini. Each 20 μL reaction contained 2 μL of the sample, 10 μL SsoAdvanced Universal SYBR Green Supermix (Bio-Rad), 500 nM of forward primer, 500 nM of reverse primer, and 4 μL water. The following TaqMan thermocycling conditions were used: 10 min at 95° C., followed by 28 cycles of 95° C. for 60 s, 50° C. for 60 s, and 75° C. for 180 s. Electrophoresis of the amplicon is run at 80 V for 1 hour in 1.2% agarose gel. The gel was stained with SYBR® Green I Nucleic Acid Stain (Lonza) and visualized under a dark reader transilluminator (Clare Chemical).
[0042] DNA Quantification. As shown in Table 1, the oligos and DNA templates sequences are adapted from literature report (Haugland et al., Water research 2012, 46, 5989-6001) and purchased from IDT DNA. The dsDNA is obtained by purification of PCR products from the DNA template with QuickClean PCR Purification Kit (GenScript). To quantify the yield of DNA, triplicates of qPCR reactions were carried out on a StepOnePlus™ Real-Time PCR System (Applied Biosystems). The reaction contained 2 μL of the sample, 10 μL TaqMan™ Universal Master Mix II, no UNG (Qiagen), 500 nM of forward primer, 500 nM of reverse primer, 500 nM of TaqMan probe, and 2 μL RNase-free water in a final volume of 20 μL. The following TaqMan thermocycling conditions were used: 10 min at 95° C., followed by 45 cycles of 95° C. for 30 s and 60° C. for 60 s. The C.sub.q values were acquired and analyzed using StepOne™ Software v2.3.
TABLE-US-00001 TABLE 1 Oligonucleotide and gene sequences used in this study Sequence Name Sequence SEQ IQ NO Fluorescence-labeled 5′-TAGCCCTAAAGCTATTTCGGAGAGAACCA-3′ SEQ ID NO: 1 ssDNA Sequence Enterococcus 5′-GAGAAATTCCAAACGAACTTG-3′ SEQ ID NO: 2 Forward Primer Enterococcus 5′-CAGTGCTCTACCTCCATCATT-3′ SEQ ID NO: 3 Reverse Primer Enterococcus [6-FAM]-5′-TGGTTCTCTCCGAAATAGCTTTAGGGCTATAMRA- SEQ ID NO: 4 TaqMan ® Probe 3′ DNA Template for 5′- SEQ ID NO: 5 dsDNA Fragment TCATGCAAGTCGAGCGATGGAGAAATTCCAAACGAACTTGGGGGTT CTGAGAGGAAGGTGGTAGAGCACTGTTTCGGCATCTGAGGAGCACG AGACGGCAGGCTCGAGAATGATGGAGGTAGAGCACTGAAAAGGAAG ATTAATACCGCATAGAGAATGTTATCACGGGAGACAAGTAGCGTGA AGGATGACGG-3′* rDNA Forward Primer 5′-ACGAATTCGTGCCAGCAGCCGCGGTAA-3′ SEQ ID NO: 6 rDNA Reverse Primer 5′-TGGAATICGGTTACCTTGTTACGACTT-3′ SEQ ID NO: 7 Ampicillin-resistance 5′-GCTCACCCAGAAACGCTGGTGAAAGTA-3′ SEQ ID NO: 8 gene Forward Primer Ampicillin-resistance 5′-CGCAACGTTGTTGCCATTGCTACAGGC-3′ SEQ ID NO: 9 gene Reverse Primer *Bold: forward primer sequence, underlined: complementary sequence of reverse primer.
[0043] MiRNA Quantification. For the quantification of miRNA, qRT-PCR was performed on each extracted sample. Reverse transcription was carried out using a miScript II RT Kit (Qiagen). A 20 μL reverse transcription reaction was prepared with 2 μL of eluted miRNA, 4 μL 5× miScript HiSpec Buffer (Qiagen), 2 μL 10× miScript Nucleics Mix (Qiagen), 10 μL RNase-free water, and 2 μL miScript Reverse Transcriptase Mix (Qiagen). The reaction was incubated at 37° C. for 60 min, followed by 95° C. for 5 min. The reverse transcription reaction was then diluted with 200 μL RNase-free water. Triplicates of qPCR reactions were carried out using the miScript SYBR Green PCR Kit (Qiagen). The reaction contained 2 μL diluted cDNA, 12.5 μL 2× QuantiTect® SYBR Green PCR Master Mix (Qiagen), 2.5 μL 10× miScript Universal Primer (Qiagen), 10× miScript Primer Assay (Qiagen) for the target miRNA, and 5.5 μL RNase-free water in a final volume of 25 μL. The reaction mixtures were incubated for 15 min at 95° C., followed by 45 cycles of 94° C. for 15 s, 55° C. for 30 s, and 70° C. for 30 s.
[0044] Stability of the Depletion Front. To investigate the influence of flow on the depletion generated by the CEM, ionic current going through the cross channel is recorded. Without flow, the current initially drops down following a diffusive √t law and then approaches a zero-current steady state.
[0045] Proof-of-Concept of Calcium Removal by Purification of E. coli DNA from High Calcium Concentration Buffer. To prove the ability of extracting nucleic acid from inhibitors, a proof-of-concept experiment is done with thermally lysed E. coli spiked into 0.1×PBS buffer with 20 mM of added-in calcium chloride (Sigma-Aldrich). The E. coli (Modern Biology Inc. IND-21) is cultured in LB Broth Media (Teknova) for 2 days. The media is centrifuged at 5000×g for 15 minutes. The supernatant is removed, and the pellet is resuspended in 0.1×PBS buffer with 20 mM of added-in calcium chloride and thermally lysed in 95° C. water bath for 20 minutes. The lysed E. coli is pretreated with our device using the same DNA protocol described in the main article. PCR amplification of both pretreated and untreated sample is carried out using the primer sets and thermal cycling condition in the IND-21 kit targeting an ampicillin-resistance gene on plasmid pUC18. 1% agarose gel is prepared by mixing 0.5 g agarose I (Bioscience) and 1.2 μL SYBR® Green I Nucleic Acid Stain (Lonza) in 50 mL 1×TAE buffer (VWR). After casting the gel, 10 μL of amplicons of the sample is mixed with 2 μL of 10× loading buffer and loaded onto the gel. Electrophoresis was run at 120 V for 1 hour. The gel was visualized by Dark Reader Transilluminator (Clare Chemical). As shown in
Example 2
Principle of the On-Chip Nucleic Acid Extraction
[0046] The current adsorption-based solid-extraction technologies are plagued by low yield for short miRNAs (Jimenez et al., Anal Bioanal Chem 2018, 410, 1053-1060; Vigneron et al., Molecular Oncology 2016, 10, 981-992). For adsorption of polyelectrolyte, the critical substrate surface charge density for adsorption scales as 1/N (de Carvalho et al., Soft Matter 2015, 11, 4430-4443), where N is the length of the polyelectrolyte. Therefore, the yield of the column goes down at least proportionally with the length, with the all-important short miRNAs having the lowest yield. Different nucleic acid sequences also have different binding affinities to the substrate even if they have the same length (Kim et al., Mol. Cell 2012, 46, 893-895; Monleau et al., BMC Genomics 2014, 15, 395), which leads to variation in extraction efficiency and inaccuracy of the quantification. To the contrary, due to their high charge density, free-flow electrophoretic mobility of nucleic acids is higher than any other large biomolecule and beyond a critical length (>200 bp), a saturation mobility of 2×10.sup.−4 cm.sup.2 V.sup.−1 s.sup.−1 to 4×10.sup.−4 cm.sup.2 V.sup.−1 s.sup.−1 independent of concentration, size, and electric field strength is reached (Stellwagen et al., Biopolymers 1997, 42, 687-703; Grossman and Soane, Journal of Chromatography A 1991, 559, 257-266; Slater et al., Current Opinion in Biotechnology 2003, 14, 58-64). Interestingly, shorter miRNAs that are no more than a few persistence lengths long exhibit more hydrodynamic screening than electrostatic screening (Grass and Holm, J. Phys.: Condens. Matter 2008, 20, 494217), producing higher mobility than even longer nucleic acids and hence exhibit the highest electrophoretic mobility among all biomolecules. The high electrophoretic mobility of nucleic acid molecules, particularly short miRNAs, will be exploited in our BCFFF design, as a field-flow extraction design with an electric field is expected to have a better yield than solid-phase extraction or other field-flow designs with other fields, particularly for short miRNAs.
[0047] Even though miRNAs should have the largest free-space electrophoretic mobility of all biomolecules, their mobility should still be significantly lower than that of ions, particularly the ubiquitous divalent cations like Ca.sup.2+ that are also PCR inhibitors. Hence, the field-flow fractionation design must also reject counter-ions to nucleic acids, particularly multivalent cations. This issue motivates the bifurcated-channel design in BCFFF, as shown in
[0048] Even with the high mobility of 4×10.sup.−4 cm.sup.2 V.sup.−1 s.sup.−1 for miRNA, a high electric field (˜100 V/cm) is still required for their extraction into the bifurcated channel, during passage through the typical millimeter-length of the junction, at the standard high-throughput linear velocity of mm/s. Such a high field in a typical physiological fluid with ion strength of ≥100 mM would produce a large ionic current and a high Ohmic heating rate of tens of mW/mm.sup.2, causing bubble formation and pH changes due to electrochemical reactions at elevated temperatures and voltages. Our solution is to locally deplete the ionic strength to below mM, which is the principle behind many recent electrokinetic chip designs which use ion-selective membrane for on-chip ion concentration depletion (Quist et al., Anal. Chem. 2011, 83, 7910-7915; Quist et al., Anal. Chem. 2012, 84, 9065-9071; Marczak et al., Biosensors and Bioelectronics 2016, 86, 840-848). The electric field in the ion-depleted region is inversely proportional to the dimension of the depleted region. Hence, ideally, the depletion region should be localized just at the junction of the bifurcated-main channel to sustain a high field at the working position. Any fluctuation in the length of the depletion zone would corrupt and render inconsistent the yield of the extraction pretreatment process. However, the extent and intensity of depletion are difficult to control and an excessively large depletion zone can reduce the field intensity at the desired location. Our recent work uses a 3-terminal ionic transistor design to stabilize the depletion front at a designated location (Sun and Chang, Lab on a chip 2016, 16, 1171-7; Sun et al., Phys. Rev. Applied 2017, 7, 064024). This design is ideal for continuous isolation of target from the sample flow to standard buffer in the cross channel, where the high field of the ion depletion region is only needed at the junction between of the main channel with the eluting bifurcated channel. As shown in
Example 3
Estimation of Nucleic Acid Extraction by Fluorescence
[0049] The extraction efficiency of this method is first quantified by comparing the total fluorescence of fluorescence-labelled ssDNA before and after the on-chip isolation. Such efficiency is dictated by the electric field and the hydrodynamic drag locally at the junction, which are independently controlled by external voltages and the flow rate applied to the systems. Inside the depletion region which is stabilized at the junction by fixing V.sub.d/V.sub.g at 80 (
Example 4
Removal of Major PCR Inhibitors
[0050] One of the major inhibitors of PCR amplification is calcium ion, particularly in urine and plasma samples. Calcium ions can compete with magnesium ions, which is a cofactor of the polymerase reaction (Schrader et al., J Appl Microbiol 2012, 113, 1014-1026), during the latter's binding with the DNA polymerase. To evaluate the calcium removal efficiency of our device, we perform pretreatment experiments on 1 μM ssDNA spiked in 10 μL 0.5×PBS samples with −2 mM of calcium ions. These concentration levels are comparable to that in plasma and can cause inaccurate quantification or total inhibition of PCR amplification (Schrader et al., J Appl Microbiol 2012, 113, 1014-1026). After pretreated with the optimized protocol (V.sub.d=1 V, V.sub.g=80 V, flow rate=0.75 μL/min).
[0051] Another category of inhibitor is protein. Unlike nucleic acids, which are strongly negatively charged, most proteins are weakly charged, and their polarity can be either positive or negative depending on their isoelectric point. The positively charged proteins can be easily removed by our system just as other cationic molecules. For negatively charged proteins, their mobilities are usually much smaller than that of nucleic acids (Stellwagen et al., Biopolymers 1997, 42, 687-703; Chun and Lee, Colloids and Surfaces A: Physicochemical and Engineering Aspects 2008, 318, 191-198); thus, they tend to be dragged away by the flow instead of being collected into the eluting channel by the electric field. Here we use GFP molecules to validate the removal of protein using our device. The removal efficiency is demonstrated by loading 0.5×PBS spiked with GFP onto the pretreatment chip and running optimized protocol (V.sub.d=1 V, V.sub.g=80 V, Flow rate=0.75 μL/min) for nucleic acid extraction. The recombinant GFP is negatively charged in the physiological environment and the depletion region. However, because of its low electrophoretic mobility, it can be successfully separated from the isolated nucleic acids under the hydrodynamic drag force. As shown in
Example 5
[0052] Amplification of DNA Extracted from Spiked Plasma Sample
[0053] The ability of our device to extract and purify long DNA is verified with E. coli pUC18 plasmid spiked into human plasma samples. 10 μL of lysed E. coli in 1×PBS is spiked into 190 μL of human plasma. Human plasma contains 60-80 mg/mL of total protein and is the most heterogeneous sample for molecular detection and quantification (Walker et al., Clinical Methods: The History, Physical, and Laboratory Examinations, Butterworths, Boston, 3rd edn., 1990). After applying the voltage (V.sub.d=1 V, V.sub.g=80 V) and stabilizing the current, 30 μL of the prepared sample is loaded onto to the device at a flow rate of 0.75 μL/min followed by 5 μL of 0.1×PBS. 4 μL of fluid is eluted from the chip for PCR amplification.
Example 6
[0054] Quantification of Extracted DNA from Plasma
[0055] To quantify the yield of extracted nucleic acids and inhibitor removal efficiency of our BCFFF device, we perform pre-treatment of human plasma spiked with enterococcus DNA fragments. The 111-bp enterococcus DNA is exogenous for human and suitable as a spiked-in control to evaluate purification efficiency. To achieve a higher yield with acceptable throughput, the spiked plasma is diluted by DI water of the same volume. 1 μM of dsDNA sample is labelled with SYBR dye to visualize the process (
[0056] We evaluated the purification from inhibitors of the eluted sample by examining the PCR efficiency of the spiked enterococcus DNA. In PCR experiments, impurity in the sample could lead to low PCR efficiency and nonlinearity during serial dilution of the sample. A series of dilution is carried out on the eluted sample. The qPCR result of these diluted samples is compared with both the result from a series of dilution of inhibitor-free control in DI water (
[0057] A series of spiked plasma sample is pretreated on the chip following the same protocol described above (
[0058] This suggests we have removed all the inhibitors in both the undiluted and diluted plasma samples. The BCFFF pre-treatment module hence can effectively remove all the plasma inhibitors, independent of the target copy number. As far as we know, it is the first pre-treatment unit whose extraction yield is concentration-independent.
Example 7
[0059] On-Chip miRNA Extraction
[0060] Not only can our BCFFF device purify large DNA fragments, but it also shows excellent performance for isolation of small miRNAs. The extraction efficiency of miRNA by our chip is compared with the commercial kit. Samples are prepared by spiking 3.5 μL of 1.6×10.sup.8 copies/μL of the synthetic 22-base cel-mir-39 into 200 μL plasma. MiRNA is isolated from 20 μL sample with the same protocol optimized for DNA extraction. For comparison, Commercial kit (Qiagen miReasy Serum/Plasma Kit) is used on 100 μL samples with the protocol described in the manual. Reverse transcription is carried out on the eluted sample, and qPCR analysis is used to quantify the number of miRNAs and to calculate extraction efficiency. As shown in