Method for engineering proteases and protein kinases
09546359 ยท 2017-01-17
Assignee
Inventors
Cpc classification
C12N2810/40
CHEMISTRY; METALLURGY
C12N2800/60
CHEMISTRY; METALLURGY
C12N15/1058
CHEMISTRY; METALLURGY
C12N9/12
CHEMISTRY; METALLURGY
International classification
C12N9/12
CHEMISTRY; METALLURGY
C12N9/50
CHEMISTRY; METALLURGY
Abstract
Provided are methods for protein engineering, such as engineering proteases or kinases. The methods may utilize yeast display and/or ER sequestration of proteins or substrates. In some aspects, TEV proteases with altered substrate specificity, potency, and/or efficiency are provided.
Claims
1. A nucleic acid vector for engineering protease variants, wherein the nucleic acid vector encodes two separately expressed proteins, wherein the first protein is a first fusion protein comprising, in an N- to C-terminal direction: (i) a first endoplasmic reticulum (ER) targeting sequence; (ii) a surface expression sequence; (iii) a first peptide sequence that is a counterselection substrate sequence for the enzyme of the second protein; (iv) a first epitope tag sequence; (v) a second peptide sequence that is a selection substrate sequence for the enzyme of the second fusion protein; (vi) a second epitope tag sequence; and (vii) a first endoplasmic reticulum (ER) retention sequence; wherein the second protein is a protease or has protease activity.
2. The nucleic acid of claim 1, wherein the nucleic acid encoding the first fusion protein is operably linked to a first promoter; and wherein the nucleic acid encoding the second protein is operably linked to a second promoter.
3. The nucleic acid of claim 2, wherein the first promoter and the second promoter are expressable in yeast.
4. The nucleic acid of claim 2, wherein the first promoter is Gal1 or Gal10.
5. The nucleic acid of claim 2, wherein the second promoter is Gal1 or Gal10.
6. The nucleic acid of claim 2, wherein the nucleic acid comprises one or more enhancers.
7. The nucleic acid of claim 1, wherein at least a portion of the first peptide is randomized.
8. The nucleic acid of claim 1, wherein the first peptide is a sequence that has no sequence identity with the native substrate of the protease.
9. The nucleic acid of claim 1, wherein the first peptide is a mutated native substrate of the protease.
10. The nucleic acid of claim 1, wherein at least a portion of the second peptide is randomized.
11. The nucleic acid of claim 1, wherein the second peptide is the native substrate of the protease.
12. The nucleic acid of claim 1, wherein the second protein is further defined as a second fusion protein, wherein the second fusion protein comprises, in an N- to C-terminal direction: a second endoplasmic reticulum (ER) targeting sequence, a protease, and a second endoplasmic reticulum (ER) retention sequence.
13. The nucleic acid of claim 1, wherein the second protein is a protease, wherein the protease is not a fusion protein.
14. The nucleic acid of claim 1, wherein the protease is a human protease.
15. The nucleic acid of claim 14 wherein the protease is a TEV-protease, rTPA, a coagulation factor, factor 7, factor 9, human trypsin, a granzyme, a caspase, trypsin, human granzyme K, or a human caspase.
16. The nucleic acid of claim 1, wherein at least a portion of the protease is randomized.
17. The nucleic acid of claim 1, wherein the protease has 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 mutations, additions, or deletions as compared to the wild-type protease.
18. The nucleic acid of claim 1, wherein the first endoplasmic reticulum (ER) targeting sequence is MQLLRCFSIFSVIASVLA (SEQ ID NO:3).
19. The nucleic acid of claim 1, wherein the first endoplasmic reticulum (ER) retention sequence is FEHDEL (SEQ ID NO:4), KDEL (SEQ ID NO:5), HDEL (SEQ ID NO:6), or RDEL (SEQ ID NO:7).
20. The nucleic acid of claim 1, wherein the nucleic acid further encodes a third epitope tag sequence.
21. The nucleic acid of claim 20, wherein the third epitope tag sequence is a hemagglutinin epitope tag.
22. The nucleic acid of claim 20, wherein the third epitope tag is comprised in the first fusion construct.
23. The nucleic acid of claim 20, wherein the third epitope tag is located between (ii) and (iii).
24. A cell comprising the nucleic acid vector of claim 1.
25. The cell of claim 24, wherein the cell is a yeast cell.
26. A method for producing a protease, comprising: (i) expressing one or more nucleic acid of claim 1 in a plurality of cells; (ii) purifying or separating cells based on the presence or absence of an antibody that selectively binds the first epitope tag sequence or the second epitope tag sequence, and (iii) isolating or purifying the protease.
27. The method of claim 26, wherein the cell is a yeast cell.
28. The method of claim 26, wherein the nucleic acid further encodes a third epitope tag.
29. The method of claim 28, further comprising purifying cells that express the third epitope tag.
30. The method of claim 26, wherein the antibody is labeled with a fluorophore.
31. The method of claim 26, wherein the isolating or purifying the protease comprises FACS.
32. The method of claim 26, further comprising isolating the nucleic acid.
33. The method of claim 32, further comprising further randomizing a portion of the nucleic acid.
34. The method of claim 26, further comprising further characterizing the protease encoded by the nucleic acid.
35. The method of claim 34, further comprising repeating steps (i) and (ii).
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1) The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present invention. The invention may be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein.
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
(21)
(22)
DESCRIPTION OF ILLUSTRATIVE EMBODIMENTS
(23) The present invention provides, in various aspects, a yeast ER sequestration (YESS) approach for screening large libraries of protease or kinase variants for altered specificity and/or high overall catalytic activity. This general approach may be used to generate proteases, such as modified TEV proteases, or kinases, such as modified Ab1 tyrosine kinases, that exhibit modified specificity, potency, or efficiency. In various aspects, specific modified TEV proteases that exhibit altered specificity are provided.
(24) As shown in the below examples, the YESS approach may be utilized to allow for protease and substrate sequences to be co-expressed and targeted (Pelham et al., 1988; Semenza et al., 1990) to the yeast endoplasmic reticulum (ER) in order to facilitate protease-substrate interaction in a relatively confined environment. Following the encounter with a protease variant in the ER, the cleaved/uncleaved substrate can be transported to the yeast surface using, e.g., the Aga2p yeast display system (Boder and Wittrup, 1997). A set of internal immunotag sequences on the substrate can be used in conjunction with the corresponding fluorescently labeled antibodies to report the location and extent of cleavage during ratiometric fluorescence activated cell sorting (FACS) of the library. In order to screen against unwanted promiscuous protease variants, the substrate construct can be designed to contain a single selection substrate sequence along with one or more counter selection substrate sequences. An advantage of this strategy is that intracellular expression of both the protease and substrate are used such that a library of protease variants can be screened against a library of substrate sequences in a library-on-library experiment. The library on library approach should increase the odds that a highly active engineered protease-novel substrate pair can be identified through directed evolution. Using the YESS library-on-library approach, 52 different TEV-P variants that can recognize six different peptide substrates were isolated. Two variants, TEV-PE10 and TEV-PH21, which recognize E and H in P1, respectively, were further characterized. A 5000-fold change in substrate specificity was obtained with TEV-PE10, and an 1100-fold change was obtained for TEV-PH21 compared to wild-type TEV-P. These results demonstrate that the YESS system can be very effectively used for protease engineering in eukaryotic cells.
I. YESS SYSTEM FOR PROTEASE OR PROTEIN KINASE ENGINEERING
(25) An overview of the YESS protease engineering strategy used in the below examples is presented in
(26) In some aspects, a modified kinase may be generated by these methods. The kinase is preferably a protein kinase, such as, e.g., a tyrosine kinase, a serine/threonine-specific protein kinase, a protein-dual-specificity protein kinase, a protein histidine protein kinase, a protein-histidine pros-kinase, a protein-histidine tele-kinase, or a histidine kinase. As shown in the below examples, a mutant Ab1 tyrosine kinase with modified activity was generated. It is anticipated that virtually any kinase may be used with the methods disclosed herein. For example, if one has one or more enzymes that can distinguish between phosphorylated and unphosphorylated peptides or proteins, then one or more cells expressing a mutant kinase may be identified, e.g., via FACS. Specific kinases types that may be generated include, e.g the various members of the eukaryotic protein kinases superfamily including the AGC, CAMK (CaM Kinases), CMGC, CK1, STE, TKL, and thymidine kinases (TK kinases).
(27) In some embodiments, methods of the present invention may be used to generate an engineered sortase. The sortases are an enzyme class characterized by the ability to ligate two different peptide sequences together. In the sortase reaction mechanism, a first substrate peptide sequence is recognized and cleaved at a specific site to produce a free carboxylic acid group, then the amine terminus of a second specific peptide is attached to this carboxyl group to give the ligated construct. Adapted to the YESS approach, a first peptide substrate sequence containing the sortase cleavage site may be attached or fused to a sequence to allow for yeast cell. surface attachment (e.g., such as the AGA2 sequence in some preferred embodiments), and a second peptide substrate sequence that can serve as the peptide to (possibly) be ligated at its amine terminus is preferably fused to an antibody epitope. Both of these substrate sequences may be targeted to the ER for expression via an ER specific signal sequence similar to those used in the protease and kinase embodiments. Only if a sortase, also expressed in the same yeast cell and targeted to the ER, ligates the first peptide substrate sequence to the second peptide substrate sequence, will the epitope be attached to the cell surface via the AGA2 linkage. The presence of epitopes (from the second sequence) attached to the yeast surface will therefore be a direct measure of sortase activity, that can be identified though binding of a labeled antibody that recognizes the epitope (e.g., via FACS). Sequences in the engineered sortase may be randomized, e.g., at or near sites involved sequence recognition, cleavage, and/or ligation, etc. Thus, a sortase may be included as the enzyme in a nucleic acid vector of the present invention and used to engineer a modified sortase that displays, e.g., modified activity, potency, or specificity. In addition, one or both of the substrate sequences can be randomized to develop a comprehensive profile of the substrate specificity of a sortase of interest.
(28) In some embodiments, methods of the present invention may be used to generate an engineered glycosyltransferase. For example, methods used to engineer a glycosyltransferase may be very similar to a the methods used to generate an engineered kinase; however, instead of using an antibody to recognize the presence or absence of a phosphorylation event, an antibody that recognizes the presence or absence of a glycosylation event (e.g., transfer of a carbohydrate, glycoside, oligosaccharide, or a polysaccharide to an amino acid sequence) may be used to identify and or separate one or more glycosyltransferases that exhibit a desired activity. Sequences in an engineered glycosyltransferase may be randomized, e.g., at or near sites involved in sequence recognition or activity, etc. Thus, a glycosyltransferase may be substituted for a kinase in nucleic acid vectors of the present invention and used to engineer a modified glycosyltransferases that displays, e.g., modified activity, potency, or specificity.
(29) A major problem encountered in early protease engineering work was that often, attempts to alter protease specificity only resulted in the production of promiscuous enzymes. As shown in the below examples, the inventors were able to overcome this difficulty by incorporating one or more counter selection substrate sequences into the screening protocol (Varadarajan et al., 2008; Varadarajan et al., 2009a). In a simultaneous selection/counter selection screen, only those proteases are isolated that maximize cleavage of a desired new substrate sequence while minimizing promiscuous cleavage of the original wild-type or other unwanted substrate sequence. In various aspects, the protease itself may on occasion act as an effective counter selection substrate in the sense that any protease variant with specificity relaxed to the point that it efficiently cleaves itself will not exhibit a positive signal.
(30) A simultaneous selection/counter selection FACS assay may be achieved by placing elements in the following order: An N-terminal Aga2P anchoring sequence followed by the wild-type preferred counter selection substrate sequence (Peptide 1), the FLAG epitope tag sequence, the selection substrate sequence, a 6His sequence, and a C-terminal ER retention signal (See
(31) In some aspects, the YESS approach can display a very significant or unprecedented versatility and a tunable dynamic range. It is straightforward to vary the sequence of the protease, or the selection substrate cleavage sequence, or both simultaneously. Thus, the YESS system may be used to carry out a variety of experiments, including, e.g., the following three distinct types of experiments: 1) A protease library could be screened in an effort to identify activity with a single, desirable new target sequence. 2) A single protease could be screened against a library of substrate sequences to identify the overall substrate preferences of a protease. 3) In an attempt to maximize the chances of finding a protease variant with altered sequence specificity, a protease library could be screened against a library of potential target substrate sequences, a so-called library-on-library experiment. An advantage of the YESS approach is that the dynamic range of the assay can be adjusted by subtracting the ER retention sequences on either the protease or substrate sequences, or both. In this way, the stringency of the assay can be significantly increased by reducing the amount of time the protease and substrate can interact in the confines of the ER.
(32) In addition, the compartmental nature of eukaryotic cells makes possible the specific targeting of both protease and substrate to the same compartment, namely the ER. Having the protease interact with substrate in the relatively confined environment of the ER provides a considerable level of control that is not possible in the cytoplasmic milieu. In particular, by adding a C-terminal ER retention sequence, both the protease and substrate can be anchored on the ER membrane, increasing ER residence time, local protease/substrate concentrations, and therefore assay sensitivity. Increased assay sensitivity may be particularly helpful during initial library screens. When intermediate sensitivity is needed, for example during the middle rounds of library optimization/screening, the ER retention signal can be left off of either the protease or substrate. At the end of a screening experiment, when only the most active variants are being sought, the assay can be made even less sensitive by leaving off the ER retention sequences altogether. Consistent with the assay design criteria, wild-type TEV-P gave a maximum FACS signal with its preferred substrate when both the protease and substrate had the ER retention signals attached (
(33) The YESS approach incorporates two additional powerful features useful for library screening. Simultaneous selection and counter selection screens may be used to avoid isolating variants with relaxed specificity (Varadarajan et al., 2005; Varadarajan et al., 2008; Sellamuthu et al., 2008; O'Loughlin et al., 2006). Any number of counter selection substrate sequences (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) can be added to the YESS substrate construct to refine specificity. Additionally, because both the protease and substrate constructs are typically genetically encoded in the YESS approach, a library can be used for either one. Thus, a novel protease substrate specificity for a single desired substrate can be sought, e.g., by using a protease library with one substrate construct. The converse situation, in which a single protease is used in conjunction with a substrate library, can be used to identify the substrate specificity profile of a protease. In order to improve the chances of finding a new protease-substrate combination, a protease library can be screened against a substrate library. The inventors used this library-on-library approach to alter the P1 substrate specificity of the TEV-P. As shown in the below examples, all four contact residues in the putative 51 subsite of TEV-P were randomized as well as the P1 residue of the substrate in attempt to isolate TEV variants with novel P1 specificities. Combinatorial saturation of the residues that form the 51 subsite of TEV-P enables the isolation of enzyme variants capable of accepting six different amino acids other than Gln in P1. Notably, TEV-P mutants were identified that display selectivity for a new amino acid over the Gln that is overwhelmingly preferred by the wild-type enzyme at that position.
(34) As shown in Table 3, 52 different active variants with activity toward six different substrates were obtained from the initial library screening. Without wishing to be bound by any theory, several factors likely lead to this success. The wild-type preferred sequence, including Gln at P1, was used as the counter selection portion of the substrate construct in an effort to maximize overall specificity by minimizing wild-type activity. Notably, a stop codon inserted in the substrate sequence or an otherwise truncated construct, such as a frame-shift, would give a false positive FACS signal by mimicking a cleaved product. For this reason, all stop codon containing or frame-shifted substrate constructs were removed in a preliminary FACS screen (
(35) As shown in the below examples, the tunability of the YESS assay was used to advantage while screening the second generation error-prone PCR libraries constructed from the two most promising isolated clones, one specific for Glu and the other specific for His at P1. In particular, by removing the ER retention sequences from the C-terminus of the protease, only variants with relatively high levels of activity produced a significant FACS signal. Once again, wild-type preferred Gln at P1 was used as counter selection. As a result, two clones (TEV-PE10 and TEV-PH21) displaying substrate specificity reversals of 5,000-fold and 1,100-fold, respectively, along with relatively high overall catalytic activity were identified. In fact, the TEV-PE10 variant displayed a k.sub.cat/K.sub.M that was roughly 2-fold higher than that of even TEV-P reacting with its preferred substrate, verifying that new specificity did not come at the expense of overall catalytic activity. As further evidence of successful protease engineering, TEV-PE10 and TEV-PH21 were shown to be efficient in the processing of GST-MBP fusions containing their preferred recognition sequences, namely MBP-ENLYFES-GST (MBP-SEQ ID NO:1-GST) and MBP-ENLYFHS-GST (MBP-SEQ ID NO:2-GST), respectively (
(36) Most applications of proteases involve the cleavage of proteins, not peptides. Notably, the altered specificities measured for TEV-PE10 and TEV-PH21, using peptide substrates, translated into similar results when cleaving the corresponding GST-MPB fusion proteins (
(37) Without wishing to be bound by any theory, the origin of substrate specificity in the isolated variant TEV-PE10 was predicted (
(38) In summary, the below data demonstrates that the YESS system can be used to generate proteases with significantly altered substrate specificity while maintaining high overall catalytic activity. It is anticipated that assay dynamic range tunability and the incorporation of a counter selection substrate sequence may be very helpful for success. The YESS system may be used in other applications of protease engineering, including the development of potential therapeutic proteases. In addition, the methods disclosed herein may be used to detect other enzymatic reactions compatible with reaction in the ER, where the reaction product is displayed and detected on the yeast outer surface.
II. PROTEASES
(39) The present invention may be used in various aspects to engineer a protease. A variety of proteases may be generated via these methods, such as, e.g., a TEV protease, a tissue plasminogen activator, such as a recombinant tissue plasminogen activator (rTPA), a protease that targets or affects the function of a proteinase-activated receptor (PAR), or any protease capable of expression in yeast. In some embodiments, the engineered protease may be used in research to cleave a peptide linker, e.g., to separate protein entities in a fusion protein. In some embodiments, the engineered protease is a therapeutic protease. The therapeutic protease may be useful in treating diseases, including, but not limited to, cardiovascular disease, sepsis, a digestive disorder, inflammation, cystic fibrosis, a retinal disorder, psoriasis, cancer, a cell proliferative disease, diabetes, blood coagulation disorders (e.g., hemophelia, a deficiency in factor 7 and/or factor 9), an autoimmune disorder (e.g., psoriasis, lupus, etc.), an inflammatory lung disease (e.g., cystic fibrosis, emphysema, sarcoidosis, etc.), or asthma, as well as in disorders of the cardiovascular, musculoskeletal, gastrointestinal, respiratory, and/or central nervous system.
(40) The methods provided herein may be used as a fast and efficient high-throughput screening method to identify new proteases. The YESS system may be used to isolate desired variants from large protease libraries, and may be used in a wide range of potential applications for proteases. Several proteases, such as the important protease rTPA, are currently used clinically (Craik et al., 2011; Ramachandran et al., 2012), but the therapeutic application of proteases has thus far been limited to situations in which a naturally occurring protease cleavage specificity is of therapeutic benefit. The ability to precisely engineer a desired new sequence specificity into a human protease may facilitate the investigation of proteases as a general alternative to antibody therapeutics (Craik et al., 2011; Ramachandran et al., 2012). Compared to antibodies, which are relatively large molecules that bind/inactivate their therapeutic targets in stoichiometric fashion, a properly engineered therapeutic protease may require a much lower dose because it is significantly smaller and capable of catalytic inactivation of its target. Moreover, other proteases, such as TEV-P and subtilisin, have found significant academic as well as commercial application, and adding one or more new specificities would dramatically increase their potential uses.
(41) TEV Proteases
(42) In some embodiments, the protease is a TEV protease. TEV protease is a catalytic part of the Nuclear Inclusion protein a (NIa) from tobacco etch virus (TEV). TEV is a cysteine protease that specifically recognizes and cleaves a linear epitope with the general sequence E-X-X-Y-X-Q-(G/S) (where X is any amino acid, SEQ ID NO:20) (Dougherty et al., 1989; Dougherty and Parks, 1989; Dougherty et al., 1988; Kapust et al., 2002a). For a native TEV protease, the cleavage typically occurs between Q and G/S. The most common sequence is ENLYFQG (SEQ ID NO:21) or ENLYFQS (SEQ ID NO:18). As shown in the present invention, modified TEV proteases may be generated that exhibit altered specificity, efficiency, and/or potency. For reference, the wild-type TEV protease (TEV-P) preferably has the sequence (SEQ ID NO:52). In some preferred embodiments, the wild-type TEV-P contains the S219P mutation. Another wild-type TEV protease (TEV-E) that may contain one or more mutation as indicated herein preferably has the sequence (SEQ ID NO:53).
(43) TEV proteases may be resistant to many widely used serine and cysteine protease inhibitors, such as PMSF, AEBSF, TLCK, E-64, or Complete protease inhibitor cocktail (Roche). Robust enzyme activity may be observed in a wide range of different buffers (with NaCl varied from 0 to 0.4 M and in pH from 4 to 9, enzyme tolerates MES, acetate, phosphate, glycerol, and sorbitol).
(44) TEV proteases may be used for tag removal from thermolabile proteins. TEV proteases may be active in a broad temperature range, e.g., from about 4 C. to about 30 C. (although the native enzyme is about three times less active at 4 C. than at 30 C.) (Nallamsrtty et al., 2004). TEV proteases may be sensitive to some detergents (Mohanty et al., 2003).
(45) TEV proteases may be particularly useful for removing affinity tags from fusion proteins in conditions friendly for a target protein. TEV proteases may be genetically modified to reduce autolysis (self-cleavage) and increase catalytic activity, as compared to the wild-type enzyme.
III. CONSTRUCTS COMPRISING OR ENCODING AN ENGINEERED PROTEASE
(46) Certain aspects of the present invention involve nucleic acids that encode a protease and/or an amino acid substrate. The protease and the substrate may be expressed as a fusion protein with one or more additional sequences, such as an ER targeting sequence, an ER retention sequence, a cell-surface sequence, and/or one or more immunotag sequences. In some embodiments, a single nucleic acid may be used to express both a protease and an amino acid substrate in a cell. It is generally anticipated that, although expressing both a protease and an amino acid substrate from a single vector or construct may effectively allow for interactions between the protease and amino acid substrate in a cell, in some embodiments the protease and amino acid substrate may be encoded by two different or separate nucleic acids or vectors, and the two nucleic acids may be expressed in a cell, such as a yeast cell.
(47) As shown in the below examples, the following construct may be generated. Under the control of the GAL10 promoter and after the Aga2 gene used for yeast surface display, a five-part cassette may be cloned consisting of (1) the native substrate of a protease (e.g., TEV-P, ENLYFQS, SEQ ID NO:18); (2) a first epitope tag sequence (e.g., a FLAG tag, DYKDDDDK, SEQ ID NO:22); (3) the designed peptide substrate library (e.g., ENLYFXS, X can be any residue, SEQ ID NO:23); (4) a second epitope tag (e.g., 6His tag, HHHHHH, SEQ ID NO:24); and (5) an ER retention signal peptide (e.g., FEHDEL, SEQ ID NO:4). Under the control of the GAL1 promoter, the protease library (such as the TEV-P library, see below) may be cloned along with a designed N-terminal ER targeting signal peptide (QLLRCFSIFSVIASVLA, SEQ ID NO:25) and with or without a C-terminal ER retention signal peptide.
(48) Endoplasmic Reticulum (ER) Targeting Sequences
(49) The construct may comprise 1, 2, or more sequences for targeting an amino acid sequence (e.g., comprising a protease or a substrate sequence) to the endoplasmic reticulum (ER). In some embodiments, the HDEL (SEQ ID NO:6) system may be used as described in Monnat et al. (2000), which is incorporated by reference herein in its entirety. In some embodiments, the ER targeting signal peptide (QLLRCFSIFSVIASVLA, SEQ ID NO:25) is used. The ER targeting signal peptide may be at or near the N-terminal portion such that an amino acid comprising a protease or substrate sequence can be targeted to the ER.
(50) Without wishing to be bound by any theory, the ER targeting sequence may bind a ribosome and allow for the amino acid to be transported into the ER. Generally, an ER targeting sequence may promote entry of an amino acid sequence, peptide, or protein, by promoting entry of the protein into the ER through the translocon, e.g., via a protein-conducting channel formed by a conserved, heterotrimeric membrane-protein complex referred to as the Sec61 or SecY complex. In some embodiments, a sequence disclosed as an ER targeting sequence of Rapoport (2007), Hedge and Keenan (2011), or Park and Rapoport (2012) may be used with the present invention. In some embodiments, an N-terminal targeting sequence for promoting entry into the endoplasmic reticulum may be identified via the Predotar (Prediction of Organelle Targeting sequences) method disclosed in Small et al. (2004).
(51) Endoplasmic Reticulum (ER) Retention Sequences
(52) Once in the ER, in certain embodiments, it may be preferable to include an ER retention sequence or peptide in order to allow or promote an amino acid (e.g., comprising a protease or a substrate sequence) to remain in the interior of the ER.
(53) In some embodiments, the ER retention signal peptide is FEHDEL (SEQ ID NO:4). The HDEL (SEQ ID NO:6) system may be used as described in Monnat et al. (2000). In some embodiments, a protein chimera may be generated that contains a C-terminal tetrapeptide sequences of (KDEL (SEQ ID NO:5), HDEL (SEQ ID NO:6), or RDEL (SEQ ID NO:7)) to promote retention in the ER. If only a partial retention in the ER is desired, a protein chimera may be generated that contains C-terminal sequence (KEEL, SEQ ID NO:26). In some embodiments where it is desirable a mammalian cell line for expression of constructs, it may be useful to use the mammalian (KDEL, SEQ ID NO:5) sequence in a fusion protein with a protease or a substrate. The particular ER retention sequence used may be chosen based on the amount of retention in the ER produced in a particular eukaryotic cell type. In some embodiments, an upstream sequence beyond the C-terminal tetrapeptide may be included that can influence or may be part of the structure of reticuloplasmin retention signals. In various aspects, a sequence may be included in a chimeric protease or in a chimeric substrate that promotes retention of the protein or peptide in the ER by affecting one or more of the following mechanisms: sorting of exported protein, retention of residents, and/or retrieval of escapees.
(54) HDEL (SEQ ID NO:6) sequences are further described in Denecke et al. (1992). In some embodiments, an ER targeting sequence or ER retention sequence of Copic et al. (2009) may be used. In some embodiments, an ER-targeting sequence, such as the cytoplasmic KKXX (SEQ ID NO:27) or RR of Teasdale and Jackson (1996), may be used. The ER-targeting sequence may be a Kar2p retention mutant, e.g., as described in Copic et al. (2009). In some embodiments, the C-terminal sequence VEKPFAIAKE (SEQ ID NO:28) described in Arber et al. (1992), may be used to promote localization to a subcompartment of the ER. Each of the foregoing references is incorporated by reference in its entirety.
(55) Epitope Tag Sequences
(56) A construct of the present invention may comprise one, two, or more epitope tag or immunotag sequences conjugated to or expressed as a fusion protein with the substrate target in or on the surface of a cell. It is anticipated that virtually any epitope tag may be used in various embodiments of the present invention. For example, epitope tags that may be included in a peptide or encoded by a nucleic acid of the present invention include, e.g., FLAG, 6His, hemagglutinin (HA), HIS, c-Myc, VSV-G, V5 HSV, and any peptide sequence for which a monoclonal antibody is available. Antibodies that selectively bind one, two, or more of the epitope tag sequences may be used to detect the presence or absence of the epitope tag(s). In some embodiments, the antibodies are labeled with a dye, such as a fluorophore, and used for cell sorting. As would be appreciated by one of skill in the art, a wide variety of antibodies that selectively recognize an epitope tag and are labeled with a fluorophore are commercially available. Antibodies that selectively bind different epitope tags may be labeled with different fluorophores; in this way, cells may be separated or purified based on the presence or absence of one, two, three, or more fluorescent signals, e.g., using ratiometric FACS.
(57) Many different epitope tags have been engineered into recombinant proteins. These include FLAG, HA, HIS, c-Myc, VSV-G, V5, and HSV. Select epitope tags that may be used with the present invention are listed below.
(58) TABLE-US-00001 TABLE1 SelectEpitopeTagSequences Tag Sequence SEQIDNO: HIS HHHHHH SEQIDNO:24 c-MYC EQKLISEEDL SEQIDNO:29 HA YPYDVPDYA SEQIDNO:30 VSV-G YTDIEMNRLGK SEQIDNO:31 HSV QPELAPEDPED SEQIDNO:32 V5 GKPIPNPLLGLDST SEQIDNO:33 FLAG DYKDDDDK SEQIDNO:34
(59) Cell Surface Display Sequence
(60) The construct may comprise a sequence for expression on the cell surface. For example, after Golgi-derived vesicle to plasma membrane fusion occurs where the vesicle contains a substrate (containing a ER targeting sequence and an ER retention sequence), a cell-surface display sequence may be used to retain an amino acid (e.g., comprising one or more cleaved or uncleaved substrate sequences) on the surface of a eukaryotic cell, such as, e.g., a yeast cell.
(61) In some embodiments, an Aga2p sequence can be used to display an amino acid sequence, such as a cleaved or uncleaved substrate amino acid sequence, on the surface of a eukaryotic cell, such as a yeast. For example, yeast cells can display a substrate from a randomized library extracellularly as a fusion to the Aga2p cell surface mating factor, which is covalently bound to the Aga1p mating factor via disulfide bonds (e.g., see
(62) In other embodiments, an amino acid sequence, such as a cleaved or uncleaved substrate, may be displayed on the cell surface of a cell, such as a yeast using a glycosylphosphatidylinositol (GPI) anchor attachment signal sequence.
(63) A mammalian mannosetypeMan5GlcNAc2 N-linked glycans may also be used to display a substrate. For example, a glycoengineered Pichia pastoris host strain that is genetically modified to secrete glycoproteins may be particularly useful for displaying a glycoprotein via this method as described, e.g., in Lin et al. (2011). This surface display method may use a linker (e.g., a pair of coiled-coil peptides) while using a GPI-anchored cell surface protein as an anchoring domain, such as, e.g., the Saccharomyces cerevisiae Sed1p GPI-anchored cell surface protein.
(64) A self-assembled amyloid-like oligomeric-cohesin scaffoldin may be used for protein display on a yeast, such as, e.g., Saccharomyces cerevisiae. For example, the cellulosomal scaffolding protein cohesin and its upstream hydrophilic domain (HD) may be genetically fused with the yeast Ure2p N-terminal fibrillogenic domain consisting of residues 1 to 80 (Ure2p1-80). The resulting Ure2p1-80-HD-cohesin fusion protein may be expressed in Escherichia coli to produce self-assembled supramolecular nanofibrils that can serve as a protein scaffold. The excess cohesin units on the nanofibrils provide ample sites for binding to dockerin fusion protein, such as a dockerin-substrate fusion protein. Self-assembled supramolecular cohesin nanofibrils created by fusion with the yeast Ure2p fibrillogenic domain can provide a protein scaffold that can be effectively used for yeast cell surface display. Related methods are described in additional detail in Han et al. (2012).
(65) In some embodiments, the construct may comprise an Aga2p sequence. The Aga2p yeast display system (Boder and Wittrup, 1997) has been previously characterized and may be used in various aspects of the present invention. Non-limiting examples of proteins that may be used as cell-surface proteins are described in Chen et al. (2011); Lee et al. (2011); Lin et al. (2012); Han et al. (2012); Gai et al. (2007); and article in press as: Gera et al. (2012), each of which are incorporated by reference in their entirety.
(66) Vectors
(67) The term vector is used to refer to a carrier nucleic acid molecule into which a nucleic acid sequence can be inserted for introduction into a cell where it can be replicated. A nucleic acid sequence can be exogenous, which means that it is foreign to the cell into which the vector is being introduced or that the sequence is homologous to a sequence in the cell but in a position within the host cell nucleic acid in which the sequence is ordinarily not found. Vectors include plasmids, cosmids, viruses (bacteriophage, animal viruses, and plant viruses), and artificial chromosomes (e.g., YACs). One of skill in the art would be well equipped to construct a vector through standard recombinant techniques. In certain preferred embodiments, the vector can express a nucleic acid sequence in a eukaryotic cell, such as, e.g., a yeast cell.
(68) The term expression vector refers to any type of genetic construct comprising a nucleic acid coding for a RNA capable of being transcribed. In some cases, RNA molecules are then translated into a protein, polypeptide, or peptide. In other cases, these sequences are not translated, for example, in the production of antisense molecules or ribozymes. Expression vectors can contain a variety of control sequences, which refer to nucleic acid sequences necessary for the transcription and possibly translation of an operably linked coding sequence in a particular host cell. In addition to control sequences that govern transcription and translation, vectors and expression vectors may contain nucleic acid sequences that serve other functions as well, such as those described herein.
(69) An expression vector may comprise, for example, one or two or more promoters, enhancers, initiation signals, internal ribosome binding sites, multiple cloning site (MCS), RNA splicing sites, termination signals, polyadenylation signals, origins of replication (often termed ori), or selectable or screenable markers.
IV. EXPRESSION IN EUKARYOTIC CELLS
(70) In certain aspects of the present invention, a protease and protease substrate may be expressed in eukaryotic cells. Cells that may be used with the present invention include, e.g., yeast, mammalian cells, insect cells, stem cells, human cells, primate cells, induced pluripotent stem cells, cancerous cells, and embryonic cell lines (e.g., HEK 293 cells, etc.). In certain preferred examples, yeast cells are used. It is anticipated that, in various embodiments, virtually any cell that contains an endoplasmic reticulum (ER) may be used to selectively target a protease and a substrate to the ER of the cell.
(71) Using eukaryotic cells, such as yeast, can offer significant advantages over using bacteria. Building upon previous experience with E. coli-based protease engineering systems (Varadarajan et al., 2008) as well as yeast surface expression (Boder and Wittrup, 1997), the YESS approach uses eukaryotic cells and thus can offer several potential advantages for protease engineering. For example, the eukaryotic expression machinery in yeast can be more compatible with mammalian proteases, especially human proteases, as compared with bacteria, such as E. coli.
(72) In some embodiments, yeast cells are used for selection of a protease. Yeast cells may in some embodiments be advantageously used since, e.g., they are capable of dividing quickly and are relatively robust and allow for a reasonably simple culture. Yeast cell lines that may be used with the present invention include, e.g., GS115 cells, INVSc1 cells, KM71H cells, SMD1168 cells, SMD1168H cells, and X-33 cells. It is anticipated that virtually any strain of yeast may be used with the present invention. In some embodiments the yeast may be, e.g., Saccharomyces cerevisiae or Pichia pastoris. The yeast may be an Ascomycota, such as a Saccharomycotina (referred to as true yeasts), or a Taphrinomycotina, such as Schizosaccharomycetales (the fission yeasts).
(73) Various insect cell lines may be used with the present invention. For example, insect cells that may be used with the present invention include, e.g., Drosophila cells, Sf9 cells, and Sf21 cells.
(74) Mammalian cell lines that may be used with the present invention include, e.g., HEK 293 cells, CHO cells, 3T3 cells, BHK cells, CV1 cells, Jurkat cells, and HeLa cells. In some embodiments, a human cell line may be used.
V. CELL SORTING
(75) Cells may be sorted based on the presence of one or more sequences on the surface of the cell. For example, cells may be sorted using fluorescence-activated cell sorting (FACS) or magnetic-activated cell sorting (MACS).
(76) Subsequent to cell sorting, the specific protease produced by a yeast may be determined by genotyping nucleic acids from a colony of the yeast. A variety of known methods may be used for nucleotide sequencing. Virtually any sequencing method, such as, for example, traditional methods of sequencing or next-generation sequencing methods, may be used to determine one or more of the proteases expressed in a cell. In some embodiments, the nucleotide sequencing can be determined, e.g., by pyrosequencing or by chain termination sequencing.
(77) Magnetic-Activated Cell Sorting (MACS)
(78) Cells that selectively express a particular target sequence on the surface of the cells (e.g., due to expression of a protease that selectively cleaves a target substrate) may be isolated from other cells using a magnetic-activated cell sorter (MACS). MACS typically utilizes an antibody (e.g., an antibody that selectively binds an epitope tag sequence located within an expressed protein or peptide), in combination with magnetic beads to separate cells over a column. MACS may, in certain embodiments, be relatively gentle on cells and favorably affect cell viability and integrity of certain mammalian cell lines as compared to FACS.
(79) Various MACS products are commercially available, including MACS MicroBeads columns or AutoMACS (Miltenyi Biotec, CA, USA), and may be used according to the manufacturer's instructions. PBS/0.5% BSA (without EDTA) may used as the buffer for cell isolation. In some experiments, a Dead Cell Removal Kit (Miltenyi Biotec) may be used to remove dead cells prior to isolation of cells that express a cleaved target sequence. Repeated MACS columns may be used if necessary.
(80) Fluorescence-Activated Cell Sorting (FACS)
(81) Fluorescence-activated cell sorting (FACS) may also be used to separate cells that express a particular target sequence, e.g., that has been cleaved by a protease. FACS utilizes the degree of fluorescence exhibited by a cell to separate cells. In certain embodiments, one, two, or more anti-epitope tag antibodies comprising different fluorescent labels may be used to separate or purify a cell, such as a yeast cell, that expresses a cleaved or uncleaved substrate on the surface of the cell (indicating the presence of a protease with a particular specificity, activity, or potency).
(82) In some embodiments, FACS screening or other automated flow cytometric techniques may be used for the efficient isolation of a eukaryotic cell (e.g., a yeast cell) comprising a protease that exhibits a desired specificity, potency, or efficiency. Instruments for carrying out flow cytometry are known to those of skill in the art and are commercially available to the public. Examples of such instruments include FACStar Plus, FACScan, and FACSort instruments from Becton Dickinson (Foster City, Calif.), Epics C from Coulter Epics Division (Hialeah, Fla.), and MOFLO from Cytomation (Colorado Springs, Colo.).
(83) FACS may be used for sorting of cells. In various embodiments, the presence or absence of 1, 2, or more antibodies, which recognize 1, 2, or more epitope tags on the surface of a cell, reflects the activity of a protease. For example, the absence of a signal may indicate undesired activity of a protease, no activity of a protease, or desired activity of a protease. FACS may also be used to separate cells that have been transformed with a desired construct from cells that do not contain or have not been transformed with a desired construct.
(84) Flow cytometric techniques in general involve the separation of cells or other particles in a liquid sample. Typically, the purpose of flow cytometry is to analyze the separated particles for one or more characteristics, such as, e.g., presence of a labeled ligand or other molecule. FACS generally involves the direction of a fluid sample through an apparatus such that a liquid stream passes through a sensing region. The particles should pass one at a time by the sensor and are categorized base on size, refraction, light scattering, opacity, roughness, shape, fluorescence, etc.
(85) Rapid quantitative analysis of cells proves useful in biomedical research and medicine. Apparatuses permit quantitative multiparameter analysis of cellular properties at rates of several thousand cells per second. These instruments provide the ability to differentiate among cell types. Data are often displayed in one-dimensional (histogram) or two-dimensional (contour plot, scatter plot) frequency distributions of measured variables. The partitioning of multiparameter data files involves consecutive use of interactive one- or two-dimensional graphics programs.
(86) Quantitative analysis of multiparameter flow cytometric data for rapid cell detection consists of two stages: cell class characterization and sample processing. In general, the process of cell class characterization partitions the cell feature into cells of interest and not of interest. Then, in sample processing, each cell is classified in one of the two categories according to the region in which it falls.
(87) FACS is described further, e.g., in U.S. Pat. Nos. 3,826,364; 4,284,412; 4,989,977; 4,498,766; 5,478,722; 4,857,451; 4,774,189; 4,767,206; 4,714,682; 5,160,974; and 4,661,913, each of which are specifically incorporated herein by reference.
(88) In some embodiments, flow cytometry can be used repeatedly during multiple rounds of screening that are carried out sequentially. Cells may be isolated from an initial round of sorting and immediately reintroduced into the flow cytometer and screened again to improve the stringency of the screen. In some embodiments, non-viable cells can be advantageously recovered or separated using flow cytometry. Since flow cytometry generally involves a particle sorting technology, the ability of a cell to grow or propagate is not necessary in various embodiments of the present invention. Techniques for the recovery of nucleic acids from such non-viable cells are well known in the art and may include, for example, use of template-dependent amplification techniques, including PCR.
(89) Bioreactors and Robotic Automation
(90) One or more steps for the culture or separation of cells may be automated. Automating a process using robotic or other automation can allow for more efficient and economical methods for the production, culture, and differentiation of cells. For example, robotic automation may be utilized in conjunction with one or more of the culture of stem cells, passaging, addition of media, and separation of cell type, e.g., using MACS or FACS.
(91) A bioreactor may also be used in conjunction with the present invention to culture or maintain cells. Bioreactors provide the advantage of allowing for the scaling up of a process in order to produce an increased amount of cells. Various bioreactors may be used with the present invention, including batch bioreactors, fed batch bioreactors, continuous bioreactors (e.g., a continuous stirred-tank reactor model), and/or a chemostat.
VI. PHARMACEUTICAL PREPARATIONS
(92) In select embodiments, it is contemplated that a protease of the present invention may be comprised in a pharmaceutical composition and administered to a subject to treat a disease. The protease may, in some embodiments, be a modified or mutated rTPA protease.
(93) The phrases pharmaceutical, pharmaceutically acceptable, or pharmacologically acceptable refers to molecular entities and compositions that do not produce an adverse, allergic, or other untoward reaction when administered to an animal, such as, for example, a human, as appropriate. As used herein, pharmaceutically acceptable carrier includes any and all solvents, dispersion media, coatings, surfactants, antioxidants, preservatives (e.g., antibacterial agents, antifungal agents), isotonic agents, absorption delaying agents, salts, preservatives, drugs, drug stabilizers, gels, binders, excipients, disintegration agents, lubricants, sweetening agents, flavoring agents, dyes, such like materials and combinations thereof, as would be known to one of ordinary skill in the art (see, for example, Remington: The Science and Practice of Pharmacy, 21st edition, Pharmaceutical Press, 2011, incorporated herein by reference). Except insofar as any conventional carrier is incompatible with the active ingredient, its use in the compositions of the present invention is contemplated.
(94) A person having ordinary skill in the medical arts will appreciate that the actual dosage amount of a pharmaceutical composition comprising a protease administered to an animal or human patient can be determined by physical and physiological factors, such as body weight, severity of condition, the type of disease being treated, previous or concurrent therapeutic interventions, idiopathy of the patient, and on the route of administration. The practitioner responsible for administration will, in any event, determine the concentration of active ingredient(s) in a composition and appropriate dose(s) for the individual subject.
(95) A pharmaceutical composition of the present invention may comprise different types of carriers depending on whether it is to be administered in solid, liquid, or aerosol form, and whether it needs to be sterile for such routes of administration as injection. A pharmaceutical composition disclosed herein can be administered intravenously, intradermally, intraarterially, intraperitoneally, intralesionally, intracranially, intraarticularly, intraprostaticaly, intrapleurally, intratracheally, intranasally, intravitreally, intravaginally, intrarectally, topically, intratumorally, intramuscularly, intraperitoneally, subcutaneously, subconjunctivally, intravesicularlly, mucosally, intrapericardially, intraumbilically, intraocularly, orally, topically, locally, and by inhalation, injection, infusion, continuous infusion, lavage, and localized perfusion. A pharmaceutical composition may also be administered to a subject via a catheter, in cremes, in lipid compositions, by ballistic particulate delivery, or by other method or any combination of the forgoing as would be known to one of ordinary skill in the art (see, for example, Remington: The Science and Practice of Pharmacy, 21.sup.st Ed. Lippincott Williams and Wilkins, 2005, incorporated herein by reference).
(96) While any suitable carrier known to those of ordinary skill in the art may be employed in the pharmaceutical compositions of this invention, the type of carrier will vary depending on the mode of administration. For parenteral administration, such as subcutaneous injection, the carrier preferably comprises water, saline, alcohol, a fat, a wax, or a buffer. For oral administration, any of the above carriers or a solid carrier, such as mannitol, lactose, starch, magnesium stearate, sodium saccharine, talcum, cellulose, glucose, sucrose, and magnesium carbonate, may be employed. Biodegradable microspheres (e.g., polylactic galactide) may also be employed as carriers for the pharmaceutical compositions of this invention. Suitable biodegradable microspheres are disclosed, for example, in U.S. Pat. Nos. 4,897,268 and 5,075,109.
(97) In some embodiments, a pharmaceutical composition may comprise, e.g., a lipid microsphere, a lipid nanoparticle, an ethosome, a liposome, a niosome, a phospholipid, a sphingosome, a surfactant, a transferosome, an emulsion, or a combination thereof. The formation and use of liposomes and other lipid nano- and microcarrier formulations is generally known to those of ordinary skill in the art, and the use of liposomes, microparticles, nanocapsules, and the like have gained widespread use in delivery of therapeutics (e.g., U.S. Pat. No. 5,741,516, specifically incorporated herein in its entirety by reference). Numerous methods of liposome and liposome-like preparations as potential drug carriers, including encapsulation of peptides, have been reviewed (U.S. Pat. Nos. 5,567,434; 5,552,157; 5,565,213; 5,738,868; and 5,795,587, each of which is specifically incorporated in its entirety by reference).
(98) A protease may, in certain instances, be formulated into a composition in a neutral or salt form. Pharmaceutically acceptable salts include the acid addition salts (formed with the free amino groups of the protein), which are formed with inorganic acids, such as, for example, hydrochloric or phosphoric acids, or such organic acids as acetic, oxalic, tartaric, mandelic, and the like. Salts formed with the free carboxyl groups can also be derived from inorganic bases, such as, for example, sodium, potassium, ammonium, calcium, or ferric hydroxides, and such organic bases as isopropylamine, trimethylamine, histidine, procaine, and the like.
(99) In any case, the composition may comprise various antioxidants to retard oxidation of one or more component. Additionally, the prevention of the action of microorganisms can be brought about by preservatives, such as various antibacterial and antifungal agents, including but not limited to parabens (e.g., methylparabens, propylparabens), chlorobutanol, phenol, sorbic acid, thimerosal, or combinations thereof.
(100) Sterile injectable solutions may be prepared by incorporating the active proteases in the required amount in the appropriate solvent with various amounts of the other ingredients enumerated above, as required, utilizing filtered sterilization. Generally, dispersions may be prepared by incorporating the various sterilized active ingredients into a sterile vehicle that contains the basic dispersion medium and/or the other ingredients. In the case of sterile powders for the preparation of sterile injectable solutions, suspensions, or emulsion, the preferred methods of preparation are vacuum-drying or freeze-drying techniques, which yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered liquid medium thereof. The liquid medium should be suitably buffered if necessary and the liquid diluent first rendered isotonic prior to injection with sufficient saline or glucose. The preparation of highly concentrated compositions for direct injection is also contemplated, where the use of DMSO as solvent is envisioned to result in extremely rapid penetration, delivering high concentrations of the active agents to a small area.
(101) The composition must be stable under the conditions of manufacture and storage, and preserved against the contaminating action of microorganisms, such as bacteria and fungi. It will be appreciated that endotoxin contamination should be kept minimally at a safe level, for example, less than 0.5 ng/mg protein.
(102) In particular embodiments, prolonged absorption of an injectable composition can be brought about by the use in the compositions of agents delaying absorption, such as, for example, aluminum monostearate, gelatin, or combinations thereof.
VII. MODIFIED PROTEASES
(103) Some embodiments concern modified proteins and polypeptides, particularly a modified protein or polypeptide that exhibits at least one functional activity that is comparable to the unmodified version, yet the modified protein or polypeptide possesses an additional advantage over the unmodified version, such as altering protease specificity, potency, or efficiency, decreasing degradation in the body, reduced antigenicity, easier or cheaper to produce, eliciting fewer side effects, and/or having better or longer efficacy or bioavailability. Thus, when the present application refers to the function or activity of modified protein or a modified polypeptide one of ordinary skill in the art would understand that this includes, for example, a protein or polypeptide that 1) performs at least one of the same activities or has at least one of the same specificities as the unmodified protein or polypeptide, but that may have a different level of another activity or specificity; and 2) possesses an additional advantage over the unmodified protein or polypeptide. Determination of activity may be achieved using assays familiar to those of skill in the art, particularly with respect to the protein's activity, and may include for comparison purposes, for example, the use of native and/or recombinant versions of either the modified or unmodified protein or polypeptide. It is specifically contemplated that embodiments concerning a modified protein may be implemented with respect to a modified polypeptide, and vice versa. In addition to the modified proteins and polypeptides discussed herein, embodiments may involve domains, polypeptides, and proteins described in WO 2008/137475, which is hereby specifically incorporated by reference.
(104) Aspects of the present invention relate to one or more of the below modified proteases, e.g., a TEV protease as shown Table 2, Table 3, Table 4, and/or Table 5. These modified proteases are further discussed in the examples below. In some embodiments, a modified TEV protease may comprise one or more of the mutations listed below.
(105) TABLE-US-00002 TABLE 2 Engineered TEV-P variants obtained after sorting the S1 pocket library Variant Number (P1) T146 D148 H167 S170 Other mutations TEV-PE1 E T K H S TEV-PH1 H A A H S V228A TEV-PL1 L C A V T T173N TEV-PN1 N A S H T TEV-PP1 P T D Y L G213C TEV-PT1 T V R Q A T113A, T173A
(106) TABLE-US-00003 TABLE 3 Evolved TEV-P variants obtained after the cell sorting of the S1 pocket library and the error-prone PCR libraries Variant Number (P1) T146 D148 H167 S170 Other mutations TEV-PE1 E T K H S TEV-PE2 E T P H R TEV-PE3 E T R H S TEV-PE4 E T R H A T22A, L56W, F172L, T173A, Q197R TEV-PE5 E T R H A V125A, T173A, N174H TEV-PE6 E T R H A K65R, T173A, N177K, F186L, M218I TEV-PE7 E T R H A P92L, R108H, M121L, S122P, T173A, N177K TEV-PE8 E T R H S N171S TEV-PE9 E T R H S N177K TEV-PE10 E T R H S S120R, T173A, N177K, M218I TEV-PE11 E A P H A T173A, N177K TEV-PE12 E A P H A T173A, N177K, V199D TEV-PE13 E A P H A T173A, N177K, Q196R TEV-PE14 E A P H A K65E, T173A, N177K, F179L TEV-PE15 E A P H A N12D, I163V, T173A, N177K, M218I TEV-PE16 E A P H A M124I, T173A, N177K, K184R, P221S TEV-PE17 E A P H A C110R, R159G, T173A, N177K, N192D, E223G TEV-PH1 H A A H S V228A TEV-PH2 H A A H T TEV-PH3 H A A H T R203Q TEV-PH4 H A S H T TEV-PH5 H A P H A TEV-PH6 H A P H A E106G, T173A TEV-PH7 H A P H A T173A, M218I TEV-PH8 H A P H S TEV-PH9 H A P H S K89R, T173A TEV-PH10 H A P H S Q96R TEV-PH11 H A P H T TEV-PH12 H C P H T TEV-PH13 H C Q H S N171D TEV-PH14 H V A H S TEV-PH15 H V P H A N171S TEV-PH16 H V P H S T128S, D136G TEV-PH17 H V P H S D136G TEV-PH18 H V P H T K147T TEV-PH19 H V R H S TEV-PH20 H A P H A T173A TEV-PH21 H A P H A T17A, S153C, S168T, T173A TEV-PH22 H A P H A Y11F, C110R, I144T, T173A, F186L, M218I TEV-PL1 L C A V T T173N TEV-PL2 L C A V T T173N, N192S TEV-PL3 L C P V T T17A, T173N, K184R TEV-PL4 L C R V T T70M, T173N TEV-PL5 L Q R V T Q58K, K99E, T173N TEV-PN1 N A S H T TEV-PN2 N V E H T Q104R, T173A TEV-PN3 N V P H S D136G TEV-PN4 N V P H S P39H, D136G TEV-PN5 N V P H A N171S TEV-PN6 N V R H S TEV-PP1 P T D Y L G213C TEV-PT1 T V R Q A T113A, T173A Variants TEV-PE4 to TEV-PE17, and TEV-PH20 to TEV-PH21 were obtained from the error-prone PCR libraries.
(107) TABLE-US-00004 TABLE 4 Engineered TEV-P variants obtained after sorting the error-prone libraries Variant Number (P1) T146 D148 H167 S170 Other mutations TEV-PE10 E T R H S S120R, T173A, N177K, M218I TEV-PH21 H A P H A T17A, S153C, S168T, T173A
(108) TABLE-US-00005 TABLE 5 Engineered TEV protease variants obtained after the cell sorting of the error-prone PCR libraries Variant Number (P1) T146 D148 H167 S170 Other mutations TEV-PE4 E T R H A T22A, L56W, F172L, T173A, Q197R TEV-PE5 E T R H A V125A, T173A, N174H TEV-PE6 E T R H A K65R, T173A, N177K, F186L, M218I TEV-PE7 E T R H A P92L, R108H, M121L, S122P, T173A, N177K TEV-PE8 E T R H S N171S TEV-PE9 E T R H S N177K TEV-PE10 E T R H S S120R, T173A, N177K, M218I TEV-PE11 E A P H A T173A, N177K TEV-PE12 E A P H A T173A, N177K, V199D TEV-PE13 E A P H A T173A, N177K, Q196R TEV-PE14 E A P H A K65E, T173A, N177K, F179L TEV-PE15 E A P H A N12D, I163V, T173A, N177K, M218I TEV-PE16 E A P H A M124I, T173A, N177K, K184R, P221S TEV-PE17 E A P H A C110R, R159G, T173A, N177K, N192D, E223G TEV-PH20 H A P H A T173A TEV-PH21 H A P H A T17A, S153C, S168T, T173A TEV-PH22 H A P H A Y11F, C110R, I144T, T173A, F186L, M218I
(109) Modified proteins may possess deletions and/or substitutions of amino acids; thus, a protein with a deletion, a protein with a substitution, and a protein with a deletion and a substitution are modified proteins. In some embodiments these modified proteins may further include insertions or added amino acids, such as with fusion proteins or proteins with linkers, for example. A modified deleted protein lacks one or more residues of the native protein, but possesses the specificity and/or activity of the native protein. A modified deleted protein may also have reduced immunogenicity or antigenicity. An example of a modified deleted protein is one that has an amino acid residue deleted from at least one antigenic region, that is, a region of the protein determined to be antigenic in a particular organism, such as the type of organism that may be administered the modified protein.
(110) Substitutional or replacement variants typically contain the exchange of one amino acid for another at one or more sites within the protein and may be designed to modulate one or more properties of the polypeptide, particularly its effector functions and/or bioavailability. Substitutions may or may not be conservative, that is, one amino acid is replaced with one of similar shape and charge. Conservative substitutions are well known in the art and include, for example, the changes of: alanine to serine; arginine to lysine; asparagine to glutamine or histidine; aspartate to glutamate; cysteine to serine; glutamine to asparagine; glutamate to aspartate; glycine to proline; histidine to asparagine or glutamine; isoleucine to leucine or valine; leucine to valine or isoleucine; lysine to arginine; methionine to leucine or isoleucine; phenylalanine to tyrosine, leucine or methionine; serine to threonine; threonine to serine; tryptophan to tyrosine; tyrosine to tryptophan or phenylalanine; and valine to isoleucine or leucine.
(111) In addition to a deletion or substitution, a modified protein may possess an insertion of residues, which typically involves the addition of at least one residue in the polypeptide. This may include the insertion of a targeting peptide or polypeptide or simply a single residue. Terminal additions, called fusion proteins, are discussed below.
(112) The term biologically functional equivalent is well understood in the art and is further defined in detail herein. Accordingly, sequences that have between about 70% and about 80%, or between about 81% and about 90%, or even between about 91% and about 99% of amino acids that are identical or functionally equivalent to the amino acids of a native polypeptide are included, provided the biological activity of the protein is maintained. A modified protein may be biologically functionally equivalent to its native counterpart.
(113) It also will be understood that amino acid and nucleic acid sequences may include additional residues, such as additional N- or C-terminal amino acids or 5 or 3 sequences, and yet still be essentially as set forth in one of the sequences disclosed herein, so long as the sequence meets the criteria set forth above, including the maintenance of biological protein activity where protein expression is concerned. The addition of terminal sequences particularly applies to nucleic acid sequences that may, for example, include various non-coding sequences flanking either of the 5 or 3 portions of the coding region or may include various internal sequences, i.e., introns, which are known to occur within genes.
(114) The following is a discussion based upon changing of the amino acids of a protein to create an equivalent, or even an improved, second-generation molecule. For example, certain amino acids may be substituted for other amino acids in a protein structure with or without appreciable loss of interactive binding or enzymatic capacity with structures, such as, for example, binding sites to substrate molecules. Since it is the interactive capacity and nature of a protein that defines that protein's biological functional activity, certain amino acid substitutions can be made in a protein sequence and in its underlying DNA coding sequence, and nevertheless produce a protein with like properties. It is thus contemplated by the inventors that various changes may be made in the DNA sequences of genes without appreciable loss of their biological utility or activity, as discussed below. A proteinaceous molecule has homology or is considered homologous to a second proteinaceous molecule if one of the following homology criteria is met: 1) at least 30% of the proteinaceous molecule has sequence identity at the same positions with the second proteinaceous molecule; 2) there is some sequence identity at the same positions with the second proteinaceous molecule and at the nonidentical residues, at least 30% of them are conservative differences, as described herein, with respect to the second proteinaceous molecule; or 3) at least 30% of the proteinaceous molecule has sequence identity with the second proteinaceous molecule, but with possible gaps of nonidentical residues between identical residues. As used herein, the term homologous may equally apply to a region of a proteinaceous molecule, instead of the entire molecule. If the term homology or homologous is qualified by a number, for example, 50% homology or 50% homologous, then the homology criteria, with respect to 1), 2), and 3), is adjusted from at least 30% to at least 50%. Thus it is contemplated that there may be homology of at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or more between two proteinaceous molecules or portions of proteinaceous molecules.
(115) Alternatively, a modified polypeptide may be characterized as having a certain percentage of identity to an unmodified polypeptide or to any polypeptide sequence disclosed herein, including an engineered or modified protease, such as a TEV protease. The percentage identity may be at most or at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% (or any range derivable therein) between two proteinaceous molecules or portions of proteinaceous molecules. For example, a modified protease may have from 85% to 99.5% homology as compared to the wild-type protease. Generally, a modified polypeptide or modified protease will have at least one mutation, substitution mutation, addition, or deletion, as compared to the wild-type polypeptide or protease such that the amino acid sequences of the modified polypeptide or protease are not identical to the wild-type polypeptide or protease. It is contemplated that the percentage of identity discussed above may relate to a particular region of a polypeptide compared to an unmodified region of a polypeptide. In some embodiments, a modified protease or a modified protein kinase may comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 or more mutations, substitution mutations, additions, or deletions as compared to the native or wild-type protease or kinase, respectively, but otherwise share complete amino acid sequence identity with the protease or kinase.
(116) In making such changes, the hydropathic index of amino acids may be considered. The importance of the hydropathic amino acid index in conferring interactive biologic function on a protein is generally understood in the art (Kyte and Doolittle, 1982). It is accepted that the relative hydropathic character of the amino acid contributes to the secondary structure of the resultant protein, which in turn defines the interaction of the protein with other molecules, for example, enzymes, substrates, receptors, DNA, antibodies, antigens, and the like.
(117) It also is understood in the art that the substitution of like amino acids can be made effectively on the basis of hydrophilicity. U.S. Pat. No. 4,554,101, incorporated herein by reference, states that the greatest local average hydrophilicity of a protein, as governed by the hydrophilicity of its adjacent amino acids, correlates with a biological property of the protein. As detailed in U.S. Pat. No. 4,554,101, the following hydrophilicity values have been assigned to amino acid residues: arginine (+3.0); lysine (+3.0); aspartate (+3.01); glutamate (+3.01); serine (+0.3); asparagine (+0.2); glutamine (+0.2); glycine (0); threonine (0.4); proline (0.51); alanine (0.5); histidine (0.5); cysteine (1.0); methionine (1.3); valine (1.5); leucine (1.8); isoleucine (1.8); tyrosine (2.3); phenylalanine (2.5); tryptophan (3.4).
(118) It is understood that an amino acid can be substituted for another having a similar hydrophilicity value and still produce a biologically equivalent and immunologically equivalent protein. In such changes, the substitution of amino acids whose hydrophilicity values are within 2 is preferred, those that are within 1 are particularly preferred, and those within 0.5 are even more particularly preferred.
(119) As outlined above, amino acid substitutions generally are based on the relative similarity of the amino acid side-chain substituents, for example, their hydrophobicity, hydrophilicity, charge, size, and the like. Exemplary substitutions that take into consideration the various foregoing characteristics are well known to those of skill in the art and include: arginine and lysine; glutamate and aspartate; serine and threonine; glutamine and asparagine; and valine, leucine, and isoleucine.
(120) Fusion and Conjugated Proteins
(121) A specialized kind of insertional variant is the fusion protein. This molecule generally has all or a substantial portion of the native molecule, linked at the N- or C-terminus, to all or a portion of a second polypeptide.
(122) Embodiments also concern conjugated polypeptides, such as translated proteins, polypeptides, and peptides that are linked to at least one agent to form a modified protein or polypeptide. In order to increase the efficacy of molecules as diagnostic or therapeutic agents, it is conventional to link or covalently bind or complex at least one desired molecule or moiety. Such a molecule or moiety may be, but is not limited to, at least one effector or reporter molecule. Effector molecules comprise molecules having a desired activity, e.g., cytotoxic activity. Non-limiting examples of effector molecules that have been attached to antibodies include toxins, anti-tumor agents, therapeutic enzymes, radio-labeled nucleotides, antiviral agents, chelating agents, cytokines, growth factors, and oligo- or poly-nucleotides. By contrast, a reporter molecule is defined as any moiety that may be detected using an assay. Non-limiting examples of reporter molecules that have been conjugated to antibodies include enzymes, radiolabels, haptens, fluorescent labels, phosphorescent molecules, chemiluminescent molecules, chromophores, luminescent molecules, photoaffinity molecules, colored particles, or ligands, such as biotin.
(123) Certain examples of antibody conjugates are those conjugates in which the antibody is linked to a detectable label. Detectable labels are compounds and/or elements that can be detected due to their specific functional properties, and/or chemical characteristics, the use of which allows the antibody to which they are attached to be detected, and/or further quantified if desired. Another such example is the formation of a conjugate comprising an antibody linked to a cytotoxic or anti-cellular agent, and may be termed immunotoxins.
(124) Amino acids, such as selectively-cleavable linkers, synthetic linkers, or other amino acid sequences, may be used to separate proteinaceous moieties.
VIII. EXAMPLES
(125) The following examples are included to demonstrate preferred embodiments of the invention. It should be appreciated by those of skill in the art that the techniques disclosed in the examples which follow represent techniques discovered by the inventor to function well in the practice of the invention, and thus can be considered to constitute preferred modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention.
Example 1
Materials and Methods
(126) Construction and Transformation of Yeast Vectors for Library Sorting.
(127) The pESD plasmid was constructed based on the pCTCon2 (generously contributed by Dr. Dane K. Wittrup at MIT) and the pESC-TRP vectors (Agilent Technologies, Santa Clara Calif.; generously contributed by Dr. Edward W. Marcotte at UT Austin) (
(128) Construction of TEV-P P1 Pocket Library and Error-Prone Library.
(129) A saturation mutagenesis library of TEV-P, termed the S1 pocket library, was constructed using a previously described method (Varadarajan et al., 2009b). Four residues in the 51 substrate-binding pocketT146, D148, H167, and S170were chosen for mutagenesis based on the known structure of TEV-P (Phan et al., 2002). Briefly, for the construction of the S1 pocket library of TEV-P, PAGE-purified primers (Primers 1-Primer 8, Table 6), which contained a randomized NNS codon (N=A, T, G, or C; S=G or C) in place of the wild-type codon at these four positions, were used to amplify the TEV-P gene by splicing overlap extension PCR (Kim et al., 2000). The PCR product was digested with KpnI and PstI, gel purified, and ligated into similarly digested vector pTrc99A-MBP. The ligation product was used to electroporate electrocompetent E. coli MC1061 [F.sup. (ara-leu)7697 [araD139].sub.B/r (codB-lacI)3 galK16 galE15 .sup. e14.sup. mcrA0 relA1 rpsL150(strR) spoT1 mcrB1 hsdR2(r.sup.m.sup.+)] cells, and the library was plated on selective media. Plasmid DNA was isolated from the pooled clones using a QIAprep Spin Miniprep kit (QIAGEN, Valencia, Calif., USA).
(130) The TEV-P S1 pocket library DNA was then PCR-amplified using Primer 9 and Primer 10 (Table 6). A sequence encoding the ER retention peptide (FEHDEL (SEQ ID NO: 4)) was fused in frame to the 3 by overlap extension PCR. The library DNA was fused to a sequence encoding the Aga2 signal peptide QLLRCFSIFSVIASVLA (SEQ ID NO:25). The DNA product was inserted downstream of the GAL1 promoter in pESD vector by homologous recombination, in the Saccharomyces cerevisiae EBY100 strain (URA+, leu, trp) (Benatuil et al., 2010).
(131) TABLE-US-00006 TABLE6 Primers Primers Sequences Primer1 5-GGAAGCATTGGATTCAANNSAAGNNSGGGCAGTGTGGCAGTCC-3 (SEQIDNO:35) Primer2 5-ATTAGTATCAACTAGAGATGGGTTCATTGTTGGTATA-3 (SEQIDNO:36) Primer3 5-ATCTCTAGTTGATACTAATGGACTGCCACACTGCCC-3 (SEQIDNO:37) Primer4 5-TTTGTGTTGGTGAAATTSNNTGCTGASNNTATACCAACAATGAACCC-3 (SEQIDNO:38) Primer5 5-TTGAATCCAATGCTTCCAGAA-3 (SEQIDNO:39) Primer6 5-AATTTCACCAACACAAACAA-3 (SEQIDNO:40) Primer7 5-TACCATCTGCAGAGCGACGGCGACGACGATTCATGAG-3 (SEQIDNO:41) Primer8 5-ATGGTTGGTACCGAAAATCTTTATTTTAGCGGTCATCATCATC-3 (SEQIDNO:42) Primer9 5-CGTCAAGGAGAAAAAACCCCGGATCCGTAATACGACTCACTATAGGGCCCGGGCGTCGA CATGCAACTTTTGAGATGCTTCAGTATTTTCAGCGTCATCGCCAGTGTGCTGGCCAGCTTG TTTAAGGGGCCGCGTG-3 (SEQIDNO:43) Primer10 5-GTACAGTGGGAACAAAGTCGATTTTGTTACATCTACACTGTTGTTATCAGATCTCGAGCG GTACCTTACTCATTACAATTCGTCGTGTTCGAAACTACCCAAGTCCTCTTCAGAAATAAGC TTTTGTTCGGATCCATTCATGAGTTGAGTCGCTTCC-3 (SEQIDNO:44) Primer11 5-ATGGCTGGCCCAGCCGGCCAGCTTGTTTAAGGGGCCGCG-3 (SEQIDNO:45) Primer12 5-GTCCATGGCCCCCGAGGCCTTAATTCATGAGTTGAGTCGCTTCCTTAAC-3 (SEQID NO:46) Primer13 5-GTACAGTGGGAACAAAGTCGATTTTGTTACATCTACACTGTTGTTATCAGATCTCGAGCG GTACCTTACTCATTAATTCATGAGTTGAGTCGCTTCC-3 (SEQIDNO:47) Primer14 5-GAGCTCACAATTCGTCGTGTTCGAAACTACCATGATGATGATGATGATGACTGCCAGASN NGAAATACAAATTTTCACTGCCTTTATCGTCGTCATCTTTATAATC-3 (SEQIDNO:48) Primer15 5-CGAATTCAACCCTCACTAAAGGGCGGCCGCACTAGTATCGATG-3 (SEQIDNO:49)
(132) Error-Prone PCR Library Construction.
(133) Random mutagenesis was performed by error-prone PCR amplification (Drummond et al., 2005) using the selected TEV-P variants as templates and Primers 11 and 12 (Table 6). The error-prone PCR libraries were then constructed in the pMOPAC12 vector (Jung et al., 2010) for library confirmation and storage. The error-prone PCR libraries were amplified for yeast transformation using Primer 9 and Primer 13 (Table 6). The ER retention peptide was removed during the PCR amplification process. The amplified library was then integrated into the pESD vector during yeast transformation by homologous recombination.
(134) Substrate Library Construction.
(135) For the construction of the TEV-P substrate library, PAGE-purified primers (Primer 14 and Primer 15, Table 6), which contained a randomized NNS codon correspondent to the residue Q in the wild-type TEV-P substrate (ENLYFQS, SEQ ID NO:18), were used to amplify the whole substrate fusion gene. The whole substrate fusion gene is comprised of Aga2, selection and counter selection substrate sequences, multiple intervening epitope tag sequences, and a C-terminal ER retention sequence. The PCR products were then inserted downstream of the GAL10 promoter in the pESD vector by homologous recombination, in the Saccharomyces cerevisiae EBY100 strain (URA+, leu, trp) (Benatuil et al., 2010). The substrate library was labeled with anti-6His-FITC antibody and pre-sorted to remove any undesired mutations, including possible stop codons or shifted reading frames.
(136) Library Sorting with Flow Cytometry.
(137) The constructed libraries were integrated into corresponding pESD vectors during the transformation into yeast cells EBY100 by electroporation (Benatuil et al., 2010). The cells were grown and induced as previously described with slight modification (Chao et al., 2006). The yeast cells were grown to an OD.sub.600 of 2.0-3.0 in 1 L YNB-CAA+glucose medium, followed by induction through switching the medium to YNB-CAA+galactose medium with a final OD.sub.600 of 0.5. The cells were then grown at 30 C. overnight with shaking. The induced cells (2-510.sup.8 cells, which is around 10-fold larger than the library sizes) were washed and then labeled with anti-FLAG-PE antibody (ProZyme, Hayward, Calif., USA) followed by anti-6His-FITC antibody (Genscript, Piscataway, N.J., USA). During the antibody labeling steps, the cells were resuspended into 1PBS solution containing 0.5% BSA with a final cell density of 10.sup.5 cells/L. The amounts of antibody used for labeling were 0.02 g/L and 0.01 g/L for anti-FLAG-PE antibody and anti-6His-FITC antibody, respectively. The antibody-labeled cells were washed and resuspended in 1PBS buffer and analyzed by BD Biosciences FACS Aria II flow cytometer (BD Biosciences San Jose, Calif., USA). Library sorting was performed using gates set on FSC/SSC and 575/30 nm as well as 510/20 nm emission filters. A total of about 210.sup.8 cells were screened. To avoid bacterial contamination, penicillin and streptomycin were added into the growth and inducing media, with the final concentration of 100 units and 100 g/mL, respectively. After 4-5 rounds of cell sorting and resorting, the cells were plated on selective medium plates, and individual colonies were re-analyzed and confirmed by flow cytometry. The DNA was extracted from the confirmed yeast single colonies, then transformed into E. coli and sequenced to obtain the mutated gene sequence information.
(138) In similar steps, human AblTK expressing cells were labeled using Alexa Fluor 647 anti-Phosphotyrosine antibody (BioLegend, San Diego, Calif., USA) and anti-6His-FITC antibody (Genscript, Piscataway, N.J., USA) with final concentrations of 0.03 g/L and 0.01 g/L, respectively. The gates were set on 660/20 nm emission filter for Alexa Fluor 647 as well as 510/20 nm emission filter for FITC in the BD Biosciences FACS Aria II flow cytometer (BD Biosciences San Jose, Calif., USA).
(139) Purification of TEV Proteases and their Protein Substrates.
(140) The wild-type TEV-P and its variants were expressed and purified as previously described (Tropea et al., 2009). To monitor the cleavage of fusion proteins by TEV-P or its variants, protein substrates were constructed by anchoring the different peptide sequences between the maltose binding protein (MBP) and the glutathione-S-transferase (GST) proteins. The protein substrate Q (ProS.sub.Q), protein substrate E (ProS.sub.E), and protein substrate H (ProS.sub.H), contained ENLYFQS (SEQ ID NO:18), ENLYFES (SEQ ID NO:1), and ENLYFHS (SEQ ID NO:2) peptide sequences, respectively, between the MBP and GST proteins. The respective fusions were designated MBP-ENLYFQS-GST (MBP-SEQ ID NO:18-GST), MBP-ENLYFES-GST (MBP-SEQ ID NO:1-GST), and MBP-ENLYFHS-GST (MBP-SEQ ID NO:2-GST). For kinetic analysis, the different substrate peptides, including TENLYFQSGTRRW (PepS.sub.Q, SEQ ID NO:8), TENLYFESGTRRW (PepS.sub.E, SEQ ID NO:10), and TENLYFHSGTRRW (PepS.sub.H, SEQ ID NO:9), were synthesized by and purchased from Genscript (Genscript, Piscataway, N.J., USA).
(141) Kinetic Measurement of Wild-Type TEV-P and its Variants.
(142) All purified enzymes were >95% pure as determined by SDS-PAGE with Coomassie staining (Tropea et al., 2009). Kinetic assays were carried out in 50 mM Tris-HCl buffer, pH 8.0, containing 1 mM EDTA and 2 M freshly prepared DTT. Five micromolar to 6 mM substrates were incubated with 0.025-5 M purified enzymes at 30 C. for 10 to 30 minutes. The reactions were quenched with freshly prepared 0.5% trifluoroacetic acid (TFA) followed by freezing at 80 C. All the enzymatic reactions were analyzed by HPLC on a Phenomenex C.sub.18 reverse-phase column (Phenomenex, Torrance, Calif., USA) using an acetonitrile gradient from 15% to 90%, and a flow rate of 1 mL/min. The cleavage products were collected and confirmed by LC-MS (ESI) on a Magic 2002 instrument (Micron Bioresources, Auburn, Calif.). The product amount was calculated upon the integration area at 280 nm and fitted to nonlinear regression of the Michaelis-Menten equation using KaleidaGraph software (Synergy Software, Reading, Pa., USA).
Example 2
Protease Engineering Using Yeast ER Sequestering (YESS)
(143) YESS Method Validation
(144) The expression of both the protease and substrate as separate fusions allows for at least three different types of experiments using the YESS format. A single new substrate can be used as the selection substrate along with one or more counter selection substrates in the presence of a protease library in order to isolate a protease variant with a desired new sequence specificity. Alternatively, a single protease of interest can be used with a library of substrate sequences in order to profile protease cleavage positional specificity. Finally, a library-on-library approach can be used in which a library of proteases is expressed in conjunction with a library of substrates, potentially increasing the odds of identifying highly active/specific new engineered protease-substrate pairs.
(145) A number of experiments were carried out to validate the YESS system. Throughout, the TEV-P was used as a model protease due to its broad application in research and industry as well as its relatively high level of substrate specificity. The substrate construct consisted of Aga2 fused at its C-terminus to the HA epitope tag (for internal expression level calibration), a flexible linker (GGGS)4, a counter selection peptide sequence (the canonical hepatitis C virus NS4A/NS4B protease (HCV-P) substrate DEMEECASHL, SEQ ID NO:17), the FLAG epitope tag, the wild-type TEV-P preferred substrate peptide ENLYFQS (SEQ ID NO:18), the 6His epitope tag, and finally the ER retention signal at the C-terminus. Following induction of expression of the protease and substrate fusion constructs in media with galactose as the carbon source, the cells were incubated with the PE-labeled, anti-FLAG antibody as well as the FITC-labeled, anti-6His antibody. When the TEV-P was not expressed, the cells were labeled with both antibodies and hence occupy the diagonal in the two dimensional FACS plot (
(146) Six vectors based on the pESD plasmid were constructed to evaluate various details of ER retention effects in the YESS system (
(147) A cell-enrichment study was carried out in order to evaluate the efficiency of the YESS screen (
(148) The ER retention sequence plays an important role in modulating the sensitivity and dynamic range of the YESS system. In time-course experiments, the ER retention sequence, FEHDEL (SEQ ID NO:4), dramatically retains the protein substrate in the yeast ER (
(149) Directed Evolution of TEV-P with Altered Substrate Specificity
(150) After successful system validation, the inventor's sought to alter the TEV-P substrate specificity at P1 using the YESS system. In an effort to find a new enzyme-substrate combination in an efficient manner, the inventor's adopted the library-on-library approach. First, a substrate library randomized at the P1 position (ENLYFXS, X can be any residue, SEQ ID NO:23) was created using specifically randomized oligonucleotides inserted into the peptide 2 position of the construct without a TEV-P (pESD-A,
(151) To obtain the faster and more specific engineered TEV-P variants, second-generation libraries were constructed without ER retention signals using the most promising variants (analogous to the pESD-C construct). The idea is to decrease concentration as well as the amount of time the protease variant incubates with substrate in the ER, increasing stringency of the screen. In particular, the variants with the highest relative PE to FITC signals from the initial sorting experiment (Table 3), TEV-PE3 (P1=E) (
(152) Characterization of Engineered TEV-P Variants
(153) After analyzing the sorted single colonies using FACS (
(154) TABLE-US-00007 TABLE7 Michelis-Mentenkineticsofthewild-typeTEV-Pandselectedvariantswithpeptide substrates k.sub.cat/K.sub.M Enzyme Mutations Substrate K.sub.M(mM) k.sub.cat(s.sup.-1) (mM.sup.1s.sup.1) TEV-P none TENLYFQSGTRRW 0.11 0.02 0.13 0.01 1.20 0.09 (SEQIDNO:8) TEV-P TENLYFESGTRRW 1.93 0.25 6.09 0.3 3.14 0.45 (SEQIDNO:10) 10.sup.3 10.sup.3 TEV-P TENLYFHSGTRRW 0.64 0.10 4.93 0.20 7.55 0.68 (SEQIDNO:9) 10.sup.3 10.sup.3 TEV-PE10 S120R, TENLYFQSGTRRW 0.12 0.03 1.94 0.1 0.16 0.02 D148R, (SEQIDNO:8) 10.sup.2 TEV-PE10 T173A, TENLYFESGTRRW 1.28 0.18 2.55 0.08 2.06 0.46 N177K, (SEQIDNO:10) 10.sup.2 10.sup.2 M2181 TEV- T17A,T146A, TENLYFQSGTRRW 0.82 0.10 1.71 0.06 2.07 0.13 PH21 D148P, (SEQIDNO:8) 10.sup.2 10.sup.2 TEV- S1530, TENLYFHSGTRRW 0.25 0.02 3.75 0.08 0.15 0.02 PH21 S168T, (SEQIDNO:9) 10.sup.2 S170A, T173A
(155) To assess the activities of the TEV-P, TEV-PE10, and TEV-PH21 variants with protein (as opposed to peptide) substrates, three different MBP-GST fusion protein substrates were created containing the sequences ENLYFQS (MBP-ENLYFQS-GST) (MBP-SEQ ID NO:18-GST), ENLYFQS (MBP-ENLYFES-GST) (MBP-SEQ ID NO:1-GST), and ENLYFHS (MBP-ENLYFHS-GST) (MBP-SEQ ID NO:2-GST), respectively, within a linker inserted between the MBP and GST units (
(156) Using Other Proteases and Kinases with the YESS System
(157) To assess the generality of the YESS system for other proteases, analogous constructs were created in which the hepatitis C protease (HCV-P) and the human granzyme K protease (GrK) were used in conjunction with their preferred substrate sequences, respectively. As seen in
(158) All of the methods disclosed and claimed herein can be made and executed without undue experimentation in light of the present disclosure. While the compositions and methods of this invention have been described in terms of preferred embodiments, it will be apparent to those of skill in the art that variations may be applied to the methods and in the steps or in the sequence of steps of the method described herein without departing from the concept, spirit and scope of the invention. More specifically, it will be apparent that certain agents which are both chemically and physiologically related may be substituted for the agents described herein while the same or similar results would be achieved. All such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the spirit, scope and concept of the invention as defined by the appended claims.
REFERENCES
(159) The following references, to the extent that they provide exemplary procedural or other details supplementary to those set forth herein, are specifically incorporated herein by reference. U.S. Pat. No. 3,826,364 U.S. Pat. No. 4,284,412 U.S. Pat. No. 4,498,766 U.S. Pat. No. 4,554,101 U.S. Pat. No. 4,661,913 U.S. Pat. No. 4,714,682 U.S. Pat. No. 4,767,206 U.S. Pat. No. 4,774,189 U.S. Pat. No. 4,857,451 U.S. Pat. No. 4,897,268 U.S. Pat. No. 4,989,977 U.S. Pat. No. 5,075,109 U.S. Pat. No. 5,160,974 U.S. Pat. No. 5,478,722 U.S. Pat. No. 5,552,157 U.S. Pat. No. 5,565,213 U.S. Pat. No. 5,567,434 U.S. Pat. No. 5,738,868 U.S. Pat. No. 5,795,587 Aharoni et al., Chem. Biol., 12(12):1281-1289, 2005. Arber et al., J. Cell Biol., 116:113-125, 1992. Benatuil et al., Protein Eng. Des. Sel., 23(4):155-159, 2010. Boder and Wittrup, Nat. Biotechnol., 15(6):553-557, 1997. Chanalia et al., Rev. Med. Microbiol., 22(4):6, 2011. Chao et al., Nat. Protoc., 1(2):755-768, 2006. Chen et al., Proc. Natl. Acad. Sci. USA, 108(28):11399-11404, 2011. Cohen and Lijnen, Blood, 78(12):3114-3124, 1991. Copic et al., Genetics, 182:757-769, 2009. Craik et al., Biochem. J., 435(1):1-16, 2011. Denecke et al., EMBO J., 11(6):2345-2355, 1992. Dougherty and Parks, Virology, 172145, 1989. Dougherty et al., Embo J., 7(5):1281-1287, 1988. Dougherty et al., Virology, 172:302, 1989. Drag and Salvesen, Nat. Rev. Drug Discov., 9:690-701, 2010. Drummond et al., J. Mol. Biol., 350(4):806-816, 2005. Gai et al., Curr. Opin. Struct. Biol., 17:467-473, 2007. Gera et al., Methods, 2012 (Epub ahead of print)) Gould and Tawfik, Biochemistry, 44(14):5444-5452, 2005. Gray et al., Cell, 142(4):637-646, 2010. Gupta et al., Appl. Microbiol. Biotechnol., 59(1):15-32, 2002. Han et al., Appl. Environ. Microbiol., 78(9):3249, 2012/ Hedstrom et al., Science, 255(5049):1249-1253, 1992. Hedstrom, Chem. Rev., 102(12):4501-4524, 2002. Hegde and Keenan, Nat Rev Mol Cell Biol., 12(12):787-98, 2011. Huang et al., Genetics, 182(1):173-89, 2009. Jung et al., Proc. Natl. Acad. Sci. U.S.A., 107:604-609, 2010. Kapust et al., Biochem. Biophys. Res. Commun., 294:949-955, 2002a. Kim et al., Anal. Biochem., 284(1):42-48, 2000. Kim et al., Appl Microbiol Biotechnol., 88(4):893-903, 2010. Kyte and Doolittle, J. Mol. Biol., 157(1):105-132, 1982. Lee et al., Bioresource Tech., 102:9179-9184, 2011. Lim et al., J. Biol. Chem., 282(13):9722-9732, 2007. Lin et al., J. Immunol. Methods, 375:159-165, 2012 Marnett and Craik, Trends Biotechnol., 23(2):59-64, 2005. Mohanty et al., Protein Expr. Purif., 27:109-114, 2003. Monnat et al., Molec. Biol. Cell, 11:3469-3484, 2000. Nallamsrtty et al., Protein Expr. Purif., 38(1):108-15, 2004. O'Loughlin et al., Mol. Biol. Evol., 23(4):764-772, 2006. Overall and Blobel, Nat. Rev. Mol. Cell Biol., 8(3):245-257, 2007. Park and Rapoport, Annu Rev Biophys., 41:21-40, 2012. PCT Appln. WO 2008/137475. Pelham et al., Embo J., 7(6):1757-1762, 1988. Phan et al., J. Biol. Chem., 277(52):50564-50572, 2002. Ramachandran et al., Nat. Rev. Drug Discov., 11(1):69-86, 2012. Rapoport, Nature, 450(7170):663-9, 2007. Remington: The Science and Practice of Pharmacy, 21.sup.st Ed. Lippincott Williams and Wilkins, 2005. Remington: The Science and Practice of Pharmacy, 21.sup.st Ed., Pharmaceutical Press, 2011. Schechter and Berger, A Biochem. Biophys. Res. Commun., 27(2):157-162, 1967. Schilling and Overall, Nat. Biotechnol., 26(6):685-694, 2008. Sellamuthu et al., Biochem. Biophys. Res. Commun., 371(1):122-126, 2008. Sellamuthu et al., PLoS One, 6(7):e22554, 2011. Semenza et al., Cell, 61(7):1349-1357, 1990. Small et al., Proteomics, 4(6):1581-90, 2004. Teasdale and Jackson, Cell Dev. Biol. 12, 27-54, 1996. Tropea et al., Methods Mol. Biol., 498:297-307, 2009. Varadarajan et al., Angew. Chem. Int. Ed. Engl., 47(41):7861-7863, 2008. Varadarajan et al., J. Am. Chem. Soc., 131(50):18186-18190, 2009a. Varadarajan et al., Nat. Chem. Biol., 4(5):290-294, 2008. Varadarajan et al., Nat. Protoc., 4(6):893-901, 2009b. Varadarajan et al., Proc. Natl. Acad. Sci. USA, 102(19):6855-6860, 2005. Villa et al., J. Biol. Chem., 278(43):42545-42550, 2003. Waugh, Protein Expr. Purif., 80:283-293, 2011. Wehr et al., Nat. Methods, 3:985-993, 2006.